KR101387663B1 - Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene - Google Patents

Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene Download PDF

Info

Publication number
KR101387663B1
KR101387663B1 KR1020120044695A KR20120044695A KR101387663B1 KR 101387663 B1 KR101387663 B1 KR 101387663B1 KR 1020120044695 A KR1020120044695 A KR 1020120044695A KR 20120044695 A KR20120044695 A KR 20120044695A KR 101387663 B1 KR101387663 B1 KR 101387663B1
Authority
KR
South Korea
Prior art keywords
bladder cancer
methylation
nucleic acid
pcr
dna
Prior art date
Application number
KR1020120044695A
Other languages
Korean (ko)
Other versions
KR20130121467A (en
Inventor
안성환
오태정
나용길
Original Assignee
(주)지노믹트리
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)지노믹트리 filed Critical (주)지노믹트리
Priority to KR1020120044695A priority Critical patent/KR101387663B1/en
Publication of KR20130121467A publication Critical patent/KR20130121467A/en
Application granted granted Critical
Publication of KR101387663B1 publication Critical patent/KR101387663B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/34—Genitourinary disorders

Abstract

본 발명은 방광암 특이적인 마커 유전자를 이용한 방광암 또는 방광암 진행단계의 검출방법과 상기 방광암 특이적 마커 유전자를 이용한 방광암 진단용 키트 및 핵산 칩에 관한 것으로, 보다 구체적으로는, 방광암 형질전환 세포에서 프로모터 부위가 특이적으로 메틸화되는 방광암 특이적 마커 유전자의 프로모터 메틸화를 확인할 수 있는 방광암 진단용 키트 및 핵산 칩에 관한 것이다.
본 발명의 진단용 키트 및 진단용 핵산 칩을 이용하면, 방광암을 초기 형질전환 단계에서 진단할 수 있어, 조기 진단이 가능하고, 통상적인 방법보다 정확하고 빠르게 방광암을 진단할 수 있다.The present invention relates to a method for detecting bladder cancer or bladder cancer progression step using a bladder cancer specific marker gene, and a kit and nucleic acid chip for diagnosing bladder cancer using the bladder cancer specific marker gene. More specifically, the promoter region in the bladder cancer transformed cell The present invention relates to a bladder cancer diagnostic kit and nucleic acid chip capable of confirming promoter methylation of a specifically methylated bladder cancer specific marker gene.
By using the diagnostic kit and the diagnostic nucleic acid chip of the present invention, bladder cancer can be diagnosed at an early transformation stage, so that early diagnosis is possible, and bladder cancer can be diagnosed more accurately and quickly than conventional methods.

Description

방광암 특이적 메틸화 마커 유전자를 이용한 방광암 검출방법{Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene}Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene}

본 발명은 방광암 특이적인 마커 유전자를 이용한 방광암 또는 방광암 진행단계의 검출방법과 상기 방광암 특이적 마커 유전자를 이용한 방광암 진단용 키트 및 핵산 칩에 관한 것으로, 보다 구체적으로는, 방광암 형질전환 세포에서 프로모터 부위가 특이적으로 메틸화되는 방광암 특이적 마커 유전자의 프로모터 메틸화를 확인할 수 있는 방광암 진단용 키트 및 핵산 칩에 관한 것이다.
The present invention relates to a method for detecting bladder cancer or bladder cancer progression step using a bladder cancer specific marker gene, and a kit and nucleic acid chip for diagnosing bladder cancer using the bladder cancer specific marker gene. More specifically, the promoter region in the bladder cancer transformed cell The present invention relates to a bladder cancer diagnostic kit and nucleic acid chip capable of confirming promoter methylation of a specifically methylated bladder cancer specific marker gene.

방광암은 비뇨기계 암 중 가장 흔한 암으로서, 발생 원인이 비교적 많이 밝혀졌다. 주로 흡연이나 여러 가지 화학 물질(가죽 등의 염색 도료, 대기 오염 물질, 인공 감미료, 질산염)이 체내에 흡수되었다가 소변으로 배설되어 나오면서 방광 벽을 자극하여 암을 유발시키는 것으로 알려져 있다.Bladder cancer is the most common cancer of the genitourinary tract. It is known that smoking and various chemical substances (dyeing paints such as leather, air pollutants, artificial sweeteners, nitrate) are absorbed into the body and excreted in the urine to stimulate the bladder wall to induce cancer.

전통적인 방광암 검사로는 소변에서 비정상 세포를 찾아내는 방법을 사용하고 있으나, 이는 정확도가 낮다. 또한, 카테터(도관)를 방광에 밀어 넣어 의심되는 조직을 떼어내 검사하는 방광경 검사는 침습적 방법으로써 비교적 정확도가 높은 편이다. Conventional bladder cancer screening uses a method to detect abnormal cells in the urine, but this is less accurate. In addition, the cystoscope (catheter) is inserted into the bladder and the suspected tissue is removed for examination. The cystoscopy is relatively invasive and relatively accurate.

일반적으로 방광암을 조기에 진단하면 환자의 생존율이 높아지지만, 조기에 방광암을 진단하는 것은 쉽지 않은 실정이다. 현재 사용되고 있는 방광암 진단법은 신체의 일부를 절개하는 방법을 이용하고 있으나, 이는 방광암을 조기에 진단하는데 어려움이 있다.In general, early diagnosis of bladder cancer increases the survival rate of the patient, but it is not easy to diagnose bladder cancer early. The current method of detecting bladder cancer uses a method of incising a part of the body, but it is difficult to diagnose bladder cancer early.

방광암은 방광근층 침범 여부에 따라 표재성 또는 침윤성 암으로 분류하며, 평균적으로 진단 당시 30% 가량의 환자가 침윤성 방광암에 해당된다. 따라서, 환자의 생존 기간을 늘이려면 병변 범위가 작을 때 조기 진단하는 것이 가장 좋은 방법이므로, 기존의 각종 방광암 진단 방법보다 효율적인 진단 방법, 즉 조기 진단이 가능하고, 대용량으로 검체를 처리할 수 있으며, 민감도 및 특이도가 높은 방광암 특이적 바이오 마커의 개발이 절실히 요구되고 있는 실정이다. Bladder cancer is classified as superficial or invasive cancer according to the involvement of the bladder muscle, and on average, about 30% of the patients are invasive bladder cancer. Therefore, to increase the patient's survival time, early diagnosis is the best method when the lesion range is small. Therefore, it is possible to diagnose more efficiently than conventional methods of diagnosing bladder cancer, such as early diagnosis, , The development of bladder cancer specific biomarkers with high sensitivity and specificity is urgently required.

이에, 최근에는 DNA 메틸화 측정을 통하여 암을 진단하는 방법들이 제시되고 있는데, DNA 메틸화는 주로 특정 유전자의 프로모터 부위의 CpG 섬(CpG island)의 시토신(cytosine)에서 일어나고, 그로 인하여 전사 인자의 결합이 방해를 받게 되어 특정 유전자의 발현이 차단되는 것으로서, 종양 억제 유전자의 프로모터 CpG 섬의 메틸화를 검색하는 것이 암 연구에 큰 도움이 되며, 이를 메틸화 특이 PCR(methylation specific PCR, 이하, "MSP"라고 함)이나 자동 염기 분석 등의 방법으로 검사하여 암의 진단과 스크리닝 등에 이용하려는 시도가 활발하게 이루어지고 있다.Recently, methods for diagnosing cancer through DNA methylation measurement have been proposed. DNA methylation mainly occurs in the cytosine of the CpG island of the promoter region of a specific gene, In addition, methylation of the CpG islands of the promoter of the tumor suppressor gene is highly useful for cancer research. This is called methylation specific PCR (hereinafter referred to as "MSP"). ) Or automatic base analysis, and thus, attempts have been actively made for diagnosis and screening of cancer.

프로모터 CpG 섬의 메틸화가 발암을 직접 유발하는지, 또는 발암의 2차적인 변화를 일으키는지에 대해 논란이 있으나, 여러 암에서 종양 억제 유전자(tumor suppressor gene), DNA 수선 유전자(DNA repair gene), 세포 주기 조절 유전자 등이 과메틸화(hyper-methylation)되어 있어 이들 유전자의 발현이 차단되어 있다는 것이 확인되었으며, 특히 암 발생의 초기 단계에서 특정 유전자의 프로모터 부위에 과메틸화가 일어난다는 것이 알려져 있다. There is controversy as to whether methylation of the promoter CpG island directly induces carcinogenesis or causes secondary changes in carcinogenesis. However, in many cancers, tumor suppressor gene, DNA repair gene, Regulatory genes are hypermethylated and thus the expression of these genes is blocked. It is known that hypermethylation occurs in the promoter region of a specific gene at an early stage of cancer development.

따라서, 종양 관련 유전자의 프로모터 메틸화가 암의 중요한 지표이며, 이를 암의 진단 및 조기 진단, 발암 위험의 예측, 암의 예후 예측, 치료 후 추적 조사, 항암 요법에 대한 반응 예측 등 다방면으로 이용할 수 있다. 실제 혈액이나 객담, 침, 대변, 소변 등에서 종양 관련 유전자의 프로모터 메틸화를 조사하여 각종 암 진료에 사용하려는 시도가 최근 활발하게 이루어지고 있다 (Esteller, M. et al ., Cancer Res ., 59:67, 1999; Sanchez-Cespedez, M. et al ., Cancer Res., 60:892, 2000; Ahlquist, D.A. et al ., Gastroenterol ., 119:1219, 2000). Thus, the promoter methylation of tumor-associated genes is an important indicator of cancer, and it can be used in many aspects such as diagnosis and early diagnosis of cancer, prediction of carcinogenesis risk, prediction of cancer prognosis, follow-up after treatment and prediction of response to chemotherapy . In recent years, attempts have been made to investigate the promoter methylation of tumor-related genes in blood, sputum, saliva, feces, and urine and use them in various cancer treatments (Esteller, M. et. al ., Cancer Res . 59:67, 1999; Sanchez-Cespedez, M. et al ., Cancer Res ., 60: 892, 2000; Ahlquist, DA et al . , Gastroenterol . , 119: 1219, 2000).

이에, 본 발명자들은 방광암을 효과적으로 진단할 수 있는 진단용 키트를 개발하고자 예의 노력한 결과, 방광암 세포에서 특이적으로 메틸화되는 메틸화 관련 유전자의 프로모터를 바이오 마커로 이용하여 메틸화 정도를 측정함으로써, 방광암을 진단할 수 있다는 것을 확인하고 본 발명을 완성하게 되었다.
Accordingly, the present inventors have made intensive efforts to develop a diagnostic kit for effectively diagnosing bladder cancer. As a result, the inventors of the present invention used a promoter of a methylation-related gene, which is methylated specifically in bladder cancer cells, as a biomarker to diagnose methylation of bladder cancer. It was confirmed that the present invention can be completed.

본 발명의 목적은 방광암 마커 유전자의 메틸화된 프로모터부위를 함유하는 방광암 진단용 키트를 제공하는데 있다.An object of the present invention to provide a kit for diagnosing bladder cancer containing the methylated promoter region of the bladder cancer marker gene.

본 발명의 다른 목적은 상기 방광암 특이적 마커 유전자의 CpG 섬을 포함하는 단편과 하이브리다이제이션할 수 있는 프로브를 포함하는 방광암 진단용 핵산 칩을 제공하는데 있다.
Another object of the present invention is to provide a nucleic acid chip for diagnosing bladder cancer comprising a probe capable of hybridizing with a fragment comprising a CpG island of the bladder cancer specific marker gene.

상기 목적을 달성하기 위하여, 본 발명은 (a) 임상샘플에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 방광암 바이오마커인 CBLN1 유전자의 프로모터 부위의 메틸화를 검출하는 단계를 포함하는 방광암 또는 방광암 진행단계의 검출방법을 제공한다. In order to achieve the above object, the present invention comprises the steps of (a) separating the DNA from the clinical sample; And (b) detecting methylation of a promoter region of the CBLN1 gene, which is a bladder cancer biomarker, in the separated DNA.

본 발명은 또한, Cerebellin precursor protein 1 (CBLN1) 방광암 마커 유전자의 메틸화된 프로모터부위를 함유하는 방광암 진단용 키트를 제공한다.The present invention also provides a kit for diagnosing bladder cancer containing the methylated promoter region of the Cerebellin precursor protein 1 (CBLN1) bladder cancer marker gene.

본 발명은 또한, Cerebellin precursor protein 1 (CBLN1) 방광암 마커 유전자의 프로모터부위 CpG섬을 포함하는 단편과 하이브리다이제이션할 수 있는 프로브를 포함하는 방광암 진단용 핵산 칩을 제공한다.
The present invention also provides a nucleic acid chip for diagnosing bladder cancer comprising a fragment capable of hybridizing with a fragment comprising a promoter region of the Cerebellin precursor protein 1 (CBLN1) bladder cancer marker gene and a CpG island.

본 발명은 방광암 특이적 마커 유전자의 CpG 섬의 메틸화를 검출하여 방광암 또는 방광암 진행단계를 검출할 수 있는 효과가 있다.The present invention has the effect of detecting the stage of bladder cancer or bladder cancer by detecting the methylation of the CpG island of the bladder cancer specific marker gene.

본 발명의 진단용 키트 및 진단용 핵산 칩을 이용하면, 방광암을 초기 형질전환 단계에서 진단할 수 있어 조기 진단이 가능하고, 통상적인 방법보다 정확하고 빠르게 방광암을 진단할 수 있다.
By using the diagnostic kit and diagnostic nucleic acid chip of the present invention, bladder cancer can be diagnosed at an early transformation stage, and thus early diagnosis is possible, and bladder cancer can be diagnosed more accurately and quickly than conventional methods.

도 1은 정상인과 방광암 환자의 소변세포로부터 CpG 마이크로어레이 분석을 통하여 방광암 진단을 위한 메틸화 바이오 마커를 발굴하는 과정을 나타낸 모식도이다.
도 2는 방광암 세포주에서 4개의 메틸화 바이오 마커의 파이로시퀀싱을 통한 정량적인 메틸화 정도를 나타낸 것이다.
도 3은 CBLN1 바이오 마커 유전자의 방광조직 임상 시료에서의 메틸화 지수를 측정한 것이다.
도 4는 정상인 및 방광암 환자 소변세포에서의 메틸화 정도를 나타낸 것이다. 1 is a schematic diagram showing a process of discovering a methylated biomarker for diagnosing bladder cancer from the urine cells of normal people and bladder cancer patients by CpG microarray analysis.
Figure 2 shows the quantitative degree of methylation through pyro sequencing of four methylated biomarkers in bladder cancer cell lines.
Figure 3 measures the methylation index of the bladder tissue clinical sample of the CBLN1 biomarker gene.
Figure 4 shows the degree of methylation in urine cells of normal and bladder cancer patients.

일 관점에서, 본 발명은 (a) 임상샘플에서 DNA를 분리하는 단계; 및 (b) 상기 분리된 DNA에서 방광암 바이오마커인 CBLN1 유전자의 프로모터 부위의 메틸화를 검출하는 단계를 포함하는 방광암 또는 방광암 진행단계의 검출방법에 관한 것이다. In one aspect, the invention comprises the steps of (a) isolating DNA from clinical samples; And (b) detecting methylation of the promoter region of the CBLN1 gene, which is a bladder cancer biomarker in the separated DNA.

본 발명에 있어서, 상기 프로모터부위는 적어도 하나의 메틸화된 CpG 디뉴클레오티드를 함유하는 것을 특징으로 할 수 있고, 상기 프로모터부위는 서열번호 1로 표시되는 것을 특징으로 할 수 있다. In the present invention, the promoter region may be characterized by containing at least one methylated CpG dinucleotide, the promoter region may be characterized by SEQ ID NO: 1.

본 발명에 따른 메틸화 마커 유전자를 스크리닝하는 방법은 다음 단계를 포함한다: (a) 형질전환 세포 및 비형질전환 세포로부터 게놈 DNA를 분리하는 단계; (b) 상기 분리된 게놈 DNA로부터 메틸화된 DNA에 결합하는 단백질과 반응시켜 메틸화된 DNA를 분리하는 단계; 및 (c) 상기 메틸화된 DNA를 증폭시킨 후, CpG 마이크로어레이에 하이브리다이제이션한 다음, 정상 세포와 암 세포 간 메틸화 정도의 차이가 가장 큰 유전자를 메틸화 마커 유전자로 선정하는 단계.The method for screening methylated marker genes according to the present invention comprises the following steps: (a) separating genomic DNA from transformed and non-transformed cells; (b) separating the methylated DNA from the separated genomic DNA by reacting with a protein that binds to the methylated DNA; And (c) amplifying the methylated DNA, hybridizing to a CpG microarray, and selecting a methylation marker gene having the largest difference in the degree of methylation between normal cells and cancer cells.

상기 메틸화 바이오 마커 유전자의 선별방법으로 방광암뿐만 아니라, 방광암으로 진행 중인 여러 이형증 단계에서 다양하게 메틸화되는 유전자를 찾아낼 수 있으며, 선별된 유전자는 방광암 스크리닝, 위험성 평가, 예측, 병명 확인, 병의 단계 진단 및 치료 타겟의 선정에도 사용될 수 있다. As a screening method of the methylated biomarker gene, not only bladder cancer but also various methylated genes can be found in various stages of dysplasia progressing to bladder cancer, and the selected genes are screened for bladder cancer, risk assessment, prediction, disease identification, and stage of disease. It can also be used to select diagnostic and therapeutic targets.

방광암 및 여러 단계의 이상에서 메틸화되는 유전자를 확인하는 것은 정확하고 효과적으로 방광암을 조기 진단할 수 있게 하며, 다중 유전자를 사용한 메틸화 목록 확립 및 치료를 위한 새로운 타겟을 확인할 수 있다. 추가로, 본 발명에 따른 메틸화 데이타는 다른 비-메틸화 연관 바이오 마커 검출 방법과 연계하면 더욱 정확한 방광암 진단 시스템을 확립할 수 있을 것이다.Identifying genes that are methylated in bladder cancer and multiple stages of abnormality will allow accurate and effective early diagnosis of bladder cancer and identify new targets for establishing and treating methylation lists using multiple genes. In addition, the methylated data according to the present invention may establish a more accurate bladder cancer diagnostic system in conjunction with other non-methylated biomarker detection methods.

본 발명의 상기 방법으로, 검체로부터 얻어진 하나 이상의 핵산 바이오 마커의 메틸화 단계를 결정하는 것을 포함하는 여러 단계 또는 기(期)의 방광암 진행을 진단할 수 있다. 방광암의 각 단계의 검체에서 분리된 핵산의 메틸화 단계를 방광 조직의 세포 증식성 이상을 갖지 않는 검체로부터 얻어진 하나 이상의 핵산의 메틸화 단계와 비교하여, 검체의 방광암의 특정 단계를 확인할 수 있으며, 상기 메틸화 단계는 하이퍼메틸화일 수 있다.With the above method of the present invention, it is possible to diagnose various stages or stage of bladder cancer progress, including determining the methylation step of one or more nucleic acid biomarkers obtained from a specimen. The methylation step of the nucleic acid isolated from the sample of each stage of bladder cancer can be compared with the methylation step of the at least one nucleic acid obtained from the sample having no cell proliferative abnormality of bladder tissue to identify a specific stage of bladder cancer of the sample, The step may be hypermethylated.

본 발명의 일례로, 핵산은 유전자의 조절 부위에서 메틸화될 수 있다. 다른 예로, 메틸화는 유전자의 조절 부위의 외곽에서부터 시작되어 내부로 진행되기 때문에, 조절 부위의 외곽에서 메틸화를 검출하는 것으로 세포 형질전환에 관여하는 유전자를 조기 진단할 수 있다.In one example of the invention, the nucleic acid may be methylated at the regulatory site of a gene. As another example, since methylation starts from the outside of the regulatory region of the gene and proceeds to the inside, detection of methylation at the outside of the regulatory region enables early diagnosis of genes involved in cellular transformation.

본 발명의 키트의 일예로는 샘플을 담는 구획된 캐리어 수단, 비메틸화 시토신을 민감하게 절단하는 제제를 함유하는 첫번째 용기, CpG 함유 핵산을 증폭하기 위한 프라이머를 함유하는 두번째 용기 및 절단된 또는 절단되지 않은 핵산의 존재를 검출하는 수단이 함유된 세번째 용기를 포함하는 하나 이상의 용기를 포함한다. 본 발명에 따라 사용되는 프라이머는 서열번호 2~3에 기재된 서열, 기능적 조합 및 그 단편을 포함할 수 있다. 기능적 조합 또는 단편은 게놈상에서 메틸화가 일어났는지의 여부를 검출하는 프라이머로 사용된다. An example of a kit of the invention includes a first container containing a partitioned carrier means for containing a sample, a preparation that sensitively cleaves unmethylated cytosine, a second container containing a primer for amplifying a CpG containing nucleic acid, And a third container containing a means for detecting the presence of the non-nucleic acid. Primers used according to the present invention may include the sequences set forth in SEQ ID NOS: 2-3, functional combinations and fragments thereof. A functional combination or fragment is used as a primer to detect whether methylation has occurred on the genome.

다른 예로, 본 발명에서는 Cerebellin precursor protein 1 (CBLN1) 유전자의 핵산의 메틸화 상태를 키트 또는 핵산 칩을 이용하여 검출하는 것에 의하여, 검체에 존재하는 방광 조직의 세포 성장성 이상(이형증)을 진단할 수 있다. As another example, in the present invention, by detecting the methylation state of the nucleic acid of the Cerebellin precursor protein 1 (CBLN1) gene using a kit or a nucleic acid chip, cell growth abnormality (dysplasia) of the bladder tissue present in the specimen can be diagnosed. .

본 발명은 다른 관점에서, 방광암 마커 유전자의 메틸화된 프로모터부위를 함유하는 방광암 진단용 키트에 관한 것이다. In another aspect, the present invention relates to a bladder cancer diagnostic kit containing a methylated promoter region of a bladder cancer marker gene.

본 발명의 진단용 키트 또는 핵산 칩을 이용하면 검체의 방광 조직의 세포 성장성 이상 성향(이형증 진행도)을 결정할 수 있다. 상기 방법은 검체로부터 분리한 하나 이상의 핵산의 메틸화 상태를 결정하는 것을 포함하고, 상기 하나 이상의 핵산의 메틸화 단계는 방광 조직의 세포 성장성 이상 성향(이형증)이 없는 검체로부터 분리한 핵산의 메틸화 단계와 비교하는 것을 특징으로 할 수 있다. Using the diagnostic kit or nucleic acid chip of the present invention, it is possible to determine the abnormal growth tendency (dysplasia progression degree) of the bladder tissue of a specimen. The method comprises determining the methylation status of one or more nucleic acids isolated from a sample, wherein the methylation step of the one or more nucleic acids is compared with a methylation step of nucleic acid isolated from a sample lacking cell growth abnormalities (dysplasia) of bladder tissue .

본 발명의 또 다른 실시예에서는 상기 메틸화 유전자 마커를 이용하여 방광암을 형성할 가능성이 있는 세포의 조기 진단이 가능하다. 암세포에서 메틸화된다고 확인된 유전자가 임상적으로 또는 형태학적으로 정상으로 보이는 세포에서 메틸화되면, 상기 정상으로 보이는 세포는 암화가 진행되고 있는 것이다. 그러므로, 정상으로 보이는 세포에서의 방광암 특이적 유전자가 메틸화를 확인함으로, 방광암을 조기 진단할 수 있다.In yet another embodiment of the present invention, early diagnosis of cells that are likely to form bladder cancer using the methylated gene markers is possible. If a gene that has been confirmed to be methylated in cancer cells is methylated in a cell that appears to be clinically or morphologically normal, the normal appearing cell is undergoing carcinogenesis. Therefore, by confirming the methylation of bladder cancer-specific genes in normal-appearing cells, bladder cancer can be diagnosed early.

또다른 관점에서, 본 발명은 방광암 마커 유전자의 프로모터부위CpG섬을 포함하는 단편과 하이브리다이제이션할 수 있는 프로브를 포함하는 방광암 진단용 핵산 칩에 관한 것이다.In another aspect, the present invention relates to a nucleic acid chip for diagnosing bladder cancer comprising a fragment capable of hybridizing with a fragment comprising a promoter region CpG island of the bladder cancer marker gene.

본 발명의 메틸화 마커 유전자를 이용하면, 검체에서 방광 조직의 세포 성장성 이상(이형증진행)을 검출할 수 있다. 상기 방법은 검체로부터 분리한 하나 이상의 핵산을 포함하는 시료를 하나 이상의 메틸화 상태를 결정할 수 있는 제제와 접촉시키는 것을 포함한다. 상기 방법은 하나 이상의 핵산에서 하나 이상의 부위의 메틸화 상태를 확인하는 것을 포함하고, 상기 핵산의 메틸화 상태는 방광 조직의 세포 성장성 이상(이형증 진행)을 가지지 않는 검체의 핵산에서의 동일한 부위의 메틸화 상태와 차이가 있는 것을 특징으로 할 수 있다.By using the methylation marker gene of the present invention, it is possible to detect a cell growth abnormality (progression of dysplasia) of a bladder tissue in a specimen. The method comprises contacting a sample comprising one or more nucleic acids isolated from a sample with an agent capable of determining one or more methylation states. The method comprises identifying the methylation state of one or more sites in one or more nucleic acids, wherein the methylation state of the nucleic acid is selected from the group consisting of the methylation status of the same site in the nucleic acid of the sample not having cell growth resistance (dysplasia progression) It is possible to make a difference.

본 발명에서 상기 프로브는 CBLN1 유전자 프로모터의 CpG와는 상보적이면서 동시에 상기 CBLN1 유전자의 프로모터 부위의 CpG를 포함하는 단편과 하이브리다이제이션할 수 있는 염기서열을 포함하는 것을 특징으로 할 수 있다. In the present invention, the probe may be characterized by comprising a base sequence capable of hybridizing with a fragment containing CpG of the promoter region of the CBLN1 gene, which is complementary to the CpG of the CBLN1 gene promoter.

본 발명의 또 다른 실시예에서는 상기 키트 또는 핵산 칩을 이용하여 마커 유전자의 메틸화를 검사하는 것에 의하여 형질전환된 방광암 세포를 확인할 수 있다.In another embodiment of the present invention, the kit or the nucleic acid chip can be used to identify the methylation of the marker gene to identify transformed bladder cancer cells.

본 발명의 또 다른 실시예에서는 상기 키트 또는 핵산 칩을 이용하여 마커 유전자의 메틸화를 검사하는 것에 의하여 방광암을 진단할 수 있다.In another embodiment of the present invention, bladder cancer can be diagnosed by examining the methylation of the marker gene using the kit or nucleic acid chip.

본 발명의 또 다른 실시예에서는 정상 표현형을 나타내는 샘플을 이용하여 상기 키트 또는 핵산 칩을 이용하여 마커 유전자의 메틸화를 검사하는 것에 의하여 방광암으로 진행될 수 있는 가능성을 진단할 수 있다. 상기 샘플은 고체 또는 액체 조직, 세포, 소변, 혈청 또는 플라즈마를 사용할 수 있다.In another embodiment of the present invention, the possibility of progressing to bladder cancer can be diagnosed by examining the methylation of the marker gene using the kit or the nucleic acid chip using a sample showing a normal phenotype. The sample may be a solid or liquid tissue, cell, urine, serum or plasma.

본 발명에 있어서, 상기 메틸화 측정방법은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR , 정량 PCR, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 상기 임상 샘플은 암 의심 환자 또는 진단 대상 유래의 조직, 세포, 혈액 또는 소변인 것을 특징으로 할 수 있다.In the present invention, the methylation measurement method may be selected from the group consisting of PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, quantitative PCR, pyrosequencing, And bisulfite sequencing. The clinical sample may be a tissue suspected of being a cancer patient or a tissue, cell, blood, or urine derived from a subject to be diagnosed.

본 발명에 있어서, 상기 유전자의 프로모터 메틸화 여부를 검출하는 방법은 다음 단계를 포함한다: (a) 임상샘플로부터 샘플 DNA를 분리하는 단계; (b) 상기 분리된 DNA를 Cerebellin precursor protein 1 (CBLN1) 유전자 프로모터의 CpG 섬을 포함하는 단편을 증폭할 수 있는 프라이머를 사용하여 증폭하는 단계; 및 (c) 상기 (b) 단계에서 증폭된 결과물의 생성 유무를 근거로 프로모터의 메틸화 여부를 결정하는 단계. In the present invention, a method for detecting whether a promoter methylation of the gene is detected comprises the steps of: (a) separating sample DNA from a clinical sample; (b) amplifying the isolated DNA using primers capable of amplifying fragments containing CpG islands of the Cerebellin precursor protein 1 (CBLN1) gene promoter; And (c) determining whether the promoter is methylated based on whether the amplified product is produced in step (b).

본 발명의 또 다른 실시예에서는 방광암에서 특이적으로 메틸화되는 유전자의 메틸화 빈도를 검토하고, 방광암 진행 가능성을 가지는 조직의 메틸화 빈도를 정하는 것에 의하여 조직의 방광암으로의 발전 가능성을 평가할 수 있다.In another embodiment of the present invention, the frequency of methylation of a gene that is specifically methylated in bladder cancer can be examined and the likelihood of tissue development into bladder cancer can be assessed by determining the frequency of methylation of tissue with potential for bladder cancer progression.

본 발명에서 사용된 "세포 형질전환"은 정상에서 비정상으로, 비-종양성에서 종양성으로, 미분화에서 분화로, 줄기세포에서 비-줄기세포로와 같이 세포의 특징이 한 형태에서 다른 형태로 바뀌는 것을 의미한다. 추가적으로, 상기 형질전환은 세포의 형태, 표현형, 생화학적 성질 등에 의하여 인식될 수 있다. As used herein, the term "cell transformation" refers to a process in which the characteristics of a cell differs from one form to another, such as from normal to abnormal, from non-positive to heterozygous, from undifferentiated to differentiated, It means to change. In addition, the transformation can be recognized by cell morphology, phenotype, biochemical properties, and the like.

본 발명에서 암의 "조기 확인"은 전이되기 전에 암의 가능성을 발견하는 것으로, 바람직하게는 검체 조직 또는 세포에서 형태학적 변화가 관찰되기 전에 발견하는 것이다. 추가적으로, 세포 형질전환의 "조기 확인"은 세포가 형질전환되는 형태가 되기 전에 초기 단계에서 형질전환이 일어날 가능성 높은 것을 말한다.In the present invention, "early identification" of cancer is to discover the possibility of cancer before metastasis, preferably before the morphological changes are observed in the specimen tissue or cells. In addition, "early identification" of cell transformation refers to the likelihood of transformation at an early stage before the cell is transformed into a form.

본 발명에서 "하이퍼메틸화"는 CpG 섬의 메틸화를 의미한다.In the present invention, "hypermethylation" means methylation of CpG islands.

본 발명에서, "샘플" 또는 "검체 샘플"은 수행되는 분석의 종류에 따라, 개개인, 체액, 세포주, 조직 배양 등에서 얻어지는 모든 생물학적 샘플을 포함하는 폭넓은 범위의 샘플을 의미한다. 포유동물로부터 체액 및 조직 생검을 획득하는 방법은 통상적으로 널리 알려져 있다. 바람직한 소스는 방광의 생검(biopsy)이다.
In the present invention, "sample" or "sample sample" means a wide range of samples, including all biological samples obtained from individuals, body fluids, cell lines, tissue culture and the like, depending on the kind of analysis performed. Methods for obtaining body fluids and tissue biopsies from mammals are commonly known. A preferred source is biopsy of the bladder.

메틸화 조절 바이오 Methylation regulation bio 마커의Marker 스크리닝 Screening

본 발명에서는 세포 또는 조직이 형질전환되거나 세포의 형태가 다른 형태로 변화될 때에 메틸화되는 바이오 마커 유전자를 스크리닝하였다. 여기서, "형질전환" 세포는 정상형태가 비정상형태로, 비-종양성이 종양성으로, 미분화형태가 분화형태로 바뀌는 등의 세포 또는 조직의 형태가 다른 형태로 변화되는 것을 의미한다.In the present invention, a biomarker gene that is methylated when a cell or tissue is transformed or a cell shape is changed to another form was screened. Here, the term "transformed" cell means that the cell or tissue is changed into a different form such as a normal form, an abnormal form, a non-positive form, a non-differentiated form, or a differentiated form.

본 발명의 일 실시예에서는 정상인 및 방광암 환자의 소변으로부터 소변세포를 분리한 후, 상기 소변세포로부터 게놈 DNA를 분리하였다. 게놈 DNA로부터 메틸화된 DNA만을 획득하기 위하여, 상기 게놈 DNA를 메틸화된 DNA에 결합하는 MBD2bt와 반응시킨 후, MBD2bt 단백질에 결합하는 메틸화된 DNA를 분리하였다. 상기 분리된 MBD2bt 단백질에 결합하는 메틸화된 DNA를 증폭한 후, 정상인 유래 DNA는 Cy3으로, 방광암 환자 유래 DNA는 Cy5로 표지한 다음, human CpG 마이크로어레이에 하이브리다이제이션시켜 정상인과 방광암 환자간 메틸화 정도의 차이가 가장 큰 4개의 유전자를 바이오 마커로 선택하였다.In one embodiment of the present invention, after separating urine cells from urine of normal and bladder cancer patients, genomic DNA was isolated from the urine cells. To obtain only methylated DNA from genomic DNA, the genomic DNA was reacted with MBD2bt that binds to the methylated DNA, and then the methylated DNA bound to the MBD2bt protein was isolated. After amplifying the methylated DNA binding to the isolated MBD2bt protein, normal DNA derived from Cy3, bladder cancer patient derived DNA was labeled with Cy5, and hybridized to a human CpG microarray, and thus methylation degree between normal and bladder cancer patients. The four genes with the largest difference of were selected as biomarkers.

본 발명에서는 상기 4개의 바이오 마커가 메틸화되었는지 추가로 확인하기 위하여, 파이로시퀀싱을 수행하였다. In the present invention, pyro sequencing was performed to further confirm whether the four biomarkers were methylated.

즉, 방광암 세포주 RT-4, J82, HT1196 및 HT1376로부터 전체 게놈 DNA를 분리하여 바이설파이트를 처리한 후, 바이설파이트로 전환된 게놈 DNA를 증폭하였다. 이후, 상기 증폭된 PCR 산물을 파이로시퀀싱을 수행하여 메틸화 정도를 측정하였다. 그 결과, 상기 10개의 바이오 마커 유전자가 모두 메틸화되어 있다는 것을 확인할 수 있었다.
That is, the whole genomic DNA was isolated from the bladder cancer cell lines RT-4, J82, HT1196 and HT1376 to treat bisulfite, and then the genomic DNA converted to bisulfite was amplified. Then, the amplified PCR product was subjected to pyrosequencing to measure the degree of methylation. As a result, it was confirmed that all 10 biomarker genes were methylated.

방광암에 대한 바이오 Bio for Bladder Cancer 마커Marker

본 발명에서는 방광암 진단을 위한 바이오 마커를 제공한다.
The present invention provides a biomarker for diagnosis of bladder cancer.

방광암에 대한 바이오 Bio for Bladder Cancer 마커Marker -정상세포와의 비교를 위한 암세포의 용도Use of cancer cells for comparison with normal cells

본 실시예에서, "정상" 세포는 비정상적 세포 형태 또는 세포학적 성질의 변화를 나타내지 않은 세포를 의미한다. "종양"세포는 암 세포를 의미하고, "비종양" 세포는 병증 조직의 일부이지만, 종양 부위는 아니라고 판단되는 세포를 의미한다.In this embodiment, "normal" cells refer to cells that do not exhibit abnormal cell morphology or changes in cytostatic properties. "Tumor" refers to a cancer cell, and "non-tumor" refers to a cell that is part of a diseased tissue but not a tumor.

본 발명은 일 관점에서, 방광암과 Cerebellin precursor protein 1 (CBLN1) 유전자의 프로모터부위 하이퍼메틸화 사이의 관련성의 발견에 기반을 둔 것이다.In one aspect, the present invention is based on the discovery of a relationship between bladder cancer and promoter site hypermethylation of the Cerebellin precursor protein 1 (CBLN1) gene.

본 발명의 진단용 키트 및 핵산 칩의 다른 용도로, 검체에서 분리된 하나 이상의 핵산의 메틸화 단계를 결정하여 검체의 방광 조직의 세포 성장성 이상을 조기 진단할 수 있다. 상기 하나 이상의 핵산의 메틸화 단계는 방광 조직의 세포 성장성 이상을 가지고 있지 않은 검체로부터 분리된 하나 이상의 핵산의 메틸화 상태와 비교하는 것을 특징으로 할 수 있다. 핵산은 CpG 섬과 같은 CpG-함유 핵산인 것이 바람직하다.For other uses of the diagnostic kit and nucleic acid chip of the present invention, the methylation step of one or more nucleic acids isolated from a sample can be determined to early diagnose abnormal cell growth of the bladder tissue of the specimen. Wherein the methylation step of the one or more nucleic acids is characterized by comparing the methylation status of one or more nucleic acids isolated from a sample that does not have a cell growth abnormality of the bladder tissue. The nucleic acid is preferably a CpG-containing nucleic acid such as a CpG island.

본 발명의 진단용 키트 및 핵산 칩의 다른 용도로, 검체로부터 분리된 Cerebellin precursor protein 1 (CBLN1) 유전자의 메틸화를 결정하는 것을 포함하는 검체의 방광 조직의 세포 성장성 이상 소양을 진단할 수 있다. In another use of the diagnostic kit and nucleic acid chip of the present invention, it is possible to diagnose abnormalities in cell growth of the bladder tissue of a sample comprising determining methylation of a Cerebellin precursor protein 1 (CBLN1) gene isolated from the sample.

상기 "소양"은 상기 세포 성장성 이상에 걸리기 쉬운 성질을 의미한다. 소양을 가진 검체는 아직은 세포 성장성 이상을 가지고 있지 않지만, 세포 성장성 이상이 존재하거나 존재할 경향이 증가된 검체를 말한다.The term "soybean" means a property that is liable to suffer from the cell growth abnormality. A specimen with a lysate is a specimen that does not have any cell growth abnormality yet, but has an increased tendency to exist or to have a cell growth abnormality.

본 발명은 다른 관점에서, 검체의 핵산을 포함하는 시료를 시료의 메틸화 상태를 결정할 수 있는 제제와 접촉시키고, 핵산의 메틸화를 확인하는 것을 포함하는 검체의 방광 조직의 세포 성장성 이상을 진단하는 방법을 제공한다. In another aspect, the present invention provides a method for diagnosing abnormality in cell growth of a bladder tissue of a specimen, comprising contacting a sample containing nucleic acid of a sample with a preparation capable of determining the methylation state of the sample and confirming methylation of the nucleic acid to provide.

본 발명의 방법은 검체로부터 분리된 하나 이상의 핵산의 하나 이상의 부위의 메틸화를 결정하는 단계를 포함한다. 여기서, "핵산" 또는 "핵산 서열"이란 올리고뉴클레오티드, 뉴클레오티드, 폴리뉴클레오티드를 의미하거나 이들의 단편, 단일가닥 또는 이중가닥의 게놈 기원 또는 합성 기원의 DNA 또는 RNA, 센스 또는 안티센스 가닥의 게놈 기원 또는 합성 기원의 DNA 또는 RNA, PNA(peptide nucleic acid) 또는 자연 기원 또는 합성 기원의 DNA 양 또는 RNA 양 물질을 말한다. 핵산이 RNA이면, 데옥시뉴클레오티드 A, G, C 및 T를 대신하여, 각각 리보뉴클레오티드 A, G, C 및 U로 대체된다는 것은 당해 분야 통상의 지식을 가진 자에 있어서 자명하다. The method of the invention comprises determining the methylation of at least one site of one or more nucleic acids isolated from a sample. Herein, the term "nucleic acid" or "nucleic acid sequence" means an oligonucleotide, a nucleotide, a polynucleotide or a DNA or RNA of a genomic or synthetic origin of a fragment, a single strand or a double strand thereof, a genomic origin or a synthetic DNA or RNA of origin, PNA (peptide nucleic acid), or a DNA quantity or RNA substance of natural or synthetic origin. It will be apparent to those skilled in the art that if the nucleic acid is RNA, it is replaced by ribonucleotides A, G, C and U, respectively, instead of deoxynucleotides A, G, C and T.

서로 다르게 메틸화된 CpG 섬의 존재를 검출할 수 있는 핵산이라면 어떤 것이든 사용할 수 있다. 상기 CpG 섬은 핵산 서열에서 CpG가 풍부한 부위이다.
Any nucleic acid that can detect the presence of differently methylated CpG islands can be used. The CpG island is a CpG-rich region in the nucleic acid sequence.

메틸화(Methylation ( methylationmethylation ))

본 발명에서의 정제되거나 정제되지 않은 형태의 어떠한 핵산도 사용될 수 있으며, 타겟 부위(예를 들면, CpG-함유 핵산)를 함유하는 핵산 서열을 함유하고 있거나 함유할 것으로 의심되는 어떠한 핵산도 사용될 수 있다. 차별적으로 메틸화될 수 있는 핵산 부위가 CpG 섬이고, 이는 다른 디뉴클레오티드 CpG 핵산 부위와 비교하여 높은 CpG 밀도를 가지는 핵산 서열이다. 이중(doublet) CpG는 G*C 염기쌍의 비율로 예측하였을 때, 척추동물 DNA에서 단 20% 정도의 확률로 나타난다. 특정 부위에서, 이중 CpG의 밀도는 게놈의 다른 부위와 비교하여 10배나 더 높다. CpG 섬은 평균 G*C 비율이 약 60%로, 보통의 DNA의 G*C 비율은 평균 40%를 나타낸다. CpG 섬은 전형적으로 약 1~2kb 길이를 가지고, 인간 게놈에는 약 45,000개의 CpG 섬이 존재한다. Any nucleic acid in purified or untreated form in the present invention may be used, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (for example, a CpG-containing nucleic acid) may be used . A nucleic acid site that can be differentially methylated is a CpG island, which is a nucleic acid sequence having a high CpG density compared to other dinucleotide CpG nucleic acid sites. Doublet CpG is only 20% probable in vertebrate DNA when predicted by the ratio of G * C base pairs. At certain sites, the density of double CpG is ten times higher than at other sites in the genome. CpG islands have an average G * C ratio of about 60%, with the average DNA G * C ratio of 40%. CpG islands are typically about 1 to 2 kb in length and there are about 45,000 CpG islands in the human genome.

여러 유전자에서, CpG 섬은 프로모터의 업스트림(upstream)에서 시작하여, 다운스트림의 전사 부위까지 확장된다. 프로모터에서 CpG 섬의 메틸화는 보통 유전자의 발현을 억제시킨다. CpG 섬은 또한 유전자 코딩 부위의 3' 부위뿐만 아니라, 유전자 코딩 부위의 5' 부위를 둘러싸고 있을 수 있다. 그러므로, CpG 섬은 프로모터 부위를 포함하는 조절 부위의 코딩 서열 업스트림, 코딩 부위(예를 들어, 엑손영역), 코딩 부위의 다운스트림, 예를 들면, 인헨서 부위 및 인트론을 포함하는 여러 부위에서 발견된다.In many genes, CpG islands start upstream of the promoter and extend to the transcriptional site downstream. Methylation of CpG islands in promoters usually inhibits expression of genes. The CpG island may also surround the 5 'region of the gene coding region, as well as the 3' region of the gene coding region. Thus, CpG islands are found in several sites, including coding sequence upstream of the regulatory region comprising the promoter region, coding region (e.g., exon region), downstream of the coding region, such as the enhancer region and intron do.

통상적으로, CpG-함유 핵산은 DNA이다. 그러나, 본 발명의 방법은 예를 들면, DNA 또는 DNA와 mRNA를 포함하는 RNA를 함유하는 시료를 적용할 수 있으며, 여기서 DNA 또는 RNA는 단일가닥 또는 이중가닥일 수 있으며, 또는 DNA-RNA 하이브리드를 함유한 시료인 것을 특징으로 할 수 있다.Typically, the CpG-containing nucleic acid is DNA. However, the method of the present invention may apply for example a sample containing DNA or RNA containing DNA and mRNA, wherein the DNA or RNA may be single stranded or double stranded, or DNA-RNA hybrids. It may be characterized by the contained sample.

핵산 혼합물 또한 사용할 수 있다. 검출될 특이적인 핵산 서열은 큰 분자의 분획일 수 있고, 처음부터 특이 서열이 전체 핵산 서열을 구성하는 분리된 분자 형태로 존재할 수 있다. 상기 핵산 서열은 순수한 형태로 존재하는 핵산일 필요는 없으며, 핵산은 전체 인간 DNA가 포함되어 있는 것과 같이 복잡한 혼합물 내의 적은 분획일 수도 있다. 시료에 포함된 핵산의 메틸화 정도를 측정하는 데 사용되거나, 메틸화된 CpG 섬을 검출하는 데 사용되는 시료에 포함된 핵산은 Sambrook 등(Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY., 1989)에 기재된 여러 가지 방법으로 추출될 수 있다.Nucleic acid mixtures may also be used. The specific nucleic acid sequence to be detected may be a fraction of a large molecule and the unique sequence from the beginning may exist in the form of a separate molecule constituting the entire nucleic acid sequence. The nucleic acid sequence need not be a nucleic acid present in a pure form, and the nucleic acid may be a small fraction in a complex mixture such as a whole human DNA. Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 1989) used to measure the degree of methylation of the nucleic acid contained in the sample, or the nucleic acid contained in the sample used to detect the methylated CpG island, Can be extracted by various methods.

핵산은 정보를 코드하거나 핵산의 전사를 조절하는 DNA 부위인 조절 부위를 포함할 수 있다. 조절 부위는 적어도 하나의 프로모터를 포함한다. "프로모터"는 전사를 지시하는데 필요한 최소한의 서열이고, 프로모터-의존성 유전자에서 세포 타입 특이적, 조직 특이적 또는 외부 시그널이나 제제에 의한 유도성을 조절할 수 있다. 프로모터는 유전자의 5' 또는 3' 부위에 위치한다. 프로모터 부위의 전체 또는 부분의 핵산 수는 CpG 섬 부위의 메틸화를 측정하는데 적용될 수 있다. 타겟 유전자 프로모터의 메틸화는 외곽에서부터 내부로 진행한다. 그러므로, 세포 전환의 초기 단계는 프로모터 부위의 외곽에서의 메틸화를 분석함으로써 검출할 수 있다.The nucleic acid may comprise a regulatory site, which is a DNA site that encodes information or regulates transcription of the nucleic acid. The regulatory site comprises at least one promoter. A "promoter" is the minimum sequence necessary to direct transcription and can regulate inducibility by cell type specific, tissue specific or external signal or agent in a promoter-dependent gene. The promoter is located at the 5 'or 3' site of the gene. Nucleic acid numbers of all or part of a promoter site can be applied to measure methylation of CpG island sites. Methylation of the target gene promoter proceeds from outside to inside. Therefore, the early stages of cell turnover can be detected by analyzing methylation outside of the promoter region.

검체로부터 분리된 핵산은 검체의 생물학적 시료에 의하여 얻어진다. 방광암이나 방광암의 진행 단계를 진단하고 싶다면, 스크랩이나 생검으로 방광 조직에서 핵산을 분리하여야 한다. 이러한 시료는 당해 분야에서 알려진 여러 의학적 과정에 의하여 얻어질 수 있다.The nucleic acid isolated from the sample is obtained by biological sample of the sample. If you want to diagnose the progression of bladder cancer or bladder cancer, you should isolate the nucleic acid from the bladder tissue by scrap or biopsy. Such samples can be obtained by various medical procedures known in the art.

본 발명의 한 양태에서, 검체로부터 얻어진 샘플의 핵산의 메틸화 정도는 방광 조직의 세포 성장성 이상이 없는 검체의 동일한 핵산 부분과 비교하여 측정한다. 하이퍼메틸화는 하나 이상의 핵산에서 메틸화된 대립유전자가 존재하는 것을 말한다. 방광 조직의 세포 성장성 이상이 없는 검체는 동일한 핵산을 검사했을 때, 메틸화 대립유전자가 나타나지 않는다.
In one embodiment of the present invention, the degree of methylation of the nucleic acid of the sample obtained from the sample is measured relative to the same nucleic acid portion of the sample without the cell growth abnormality of the bladder tissue. Hypermethylation refers to the presence of a methylated allele in one or more nucleic acids. Specimens without cell growth abnormalities in bladder tissues do not show methylated alleles when tested for the same nucleic acid.

샘플(Sample( samplesample ))

본 발명은 방광암의 조기 확인에 대하여 기술하고 있으며, 방광암 특이적 유전자 메틸화를 이용하고 있다. 방광암 특이적 유전자의 메틸화는 종양 부위의 부근 조직에서도 일어났다. 그러므로, 방광암의 조기 확인 방법은 액체 또는 고체 조직을 포함하는 모든 샘플로 방광암-특이적 유전자의 메틸화의 유무를 확인할 수 있다. 상기 샘플은 조직, 세포, 소변, 혈청 또는 플라즈마를 포함하나, 이에 한정되지는 않는다.
The present invention describes early detection of bladder cancer and uses bladder cancer-specific gene methylation. The methylation of the bladder cancer specific gene also occurred in the nearby tissues of the tumor site. Therefore, early detection of bladder cancer can confirm the presence or absence of methylation of the bladder cancer-specific gene in all samples containing liquid or solid tissue. The sample includes, but is not limited to, tissue, cells, urine, serum or plasma.

개별 유전자 및 패널Individual genes and panels

본 발명은 진단 또는 예측 마커로서 각 유전자를 개별적으로 사용하거나, 몇몇 마커 유전자를 조합하여 패널 디스플레이 형태로 하여 사용할 수 있고, 몇몇의 마커 유전자는 전체적인 패턴 또는 메틸화된 유전자의 목록을 통하여 신뢰성 및 효율성을 향상시키는 것을 확인할 수 있다. 본 발명에서 확인된 유전자는 개별적으로, 또는 본 실시예에서 언급된 유전자가 조합된 유전자 세트로 사용될 수 있다. 또는, 유전자들은 함께 메틸화된 유전자의 수 및 그 중요도에 따라 순위를 매길 수 있고, 가중치를 둘 수 있으며, 암으로 발전할 가능성의 수준을 선정할 수 있다. 이러한 알고리즘은 본 발명에 속한다.
The present invention can be used as a diagnostic or predictive marker, either individually or in combination with some marker genes in the form of a panel display, and some marker genes can be used as a diagnostic or predictive marker, . The genes identified in the present invention can be used individually or as a set of genes in which the genes mentioned in the present embodiment are combined. Alternatively, the genes can be ranked, weighted, and the level of likelihood of developing cancer by the number and the significance of the methylated genes together. Such an algorithm belongs to the present invention.

메틸화 검출 방법Methylation detection method

메틸화 특이 Methylation specific PCRPCR ( ( methylationmethylation specificspecific PCRPCR ))

지노믹 DNA에 바이설파이트를 처리하면 5'-CpG'-3 부위의 시토신이 메틸화된 경우에는 그대로 시토신으로 남아 있고, 비메틸화된 경우에는 우라실로 변하게 된다. 따라서, 바이설파이트 처리 후 변환된 염기서열을 대상으로 5'-CpG-3' 염기서열이 존재하는 부위에 해당하는 PCR 프라이머를 제작하였다. 이때 메틸화된 경우에 해당되는 PCR 프라이머와 비메틸화된 경우에 해당하는 두 종류의 프라이머를 제작하였다. 지노믹 DNA를 바이설파이트로 변환시킨 다음, 상기 두 종류의 프라이머를 이용하여 PCR을 하면 메틸화된 경우에는 메틸화된 염기서열에 해당되는 프라이머를 사용한 것에서 PCR 산물이 만들어지게 되고, 반대로 비메틸화인 경우에는 비메틸화에 해당되는 프라이머를 이용한 것에서 PCR 산물이 만들어진다. 메틸화 여부는 아가로즈겔 전기영동방법으로 정성적으로 확인할 수 있다.
When biosulfite is treated with genomic DNA, the cytosine in the 5'-CpG'-3 region is left as it is when it is methylated, and when it is unmethylated, it changes into uracil. Therefore, PCR primers corresponding to the sites where the 5'-CpG-3 'nucleotide sequence exists were prepared for the converted nucleotide sequence after bisulfite treatment. At this time, PCR primers corresponding to methylation and two types of primers corresponding to unmethylated primers were prepared. When genomic DNA is converted into bisulfite and then PCR is carried out using the above two types of primers, PCR products are produced by using primers corresponding to the methylated nucleotide sequence when methylated, and in the case of unmethylated PCR products are produced using primers corresponding to unmethylated sequences. The methylation can be qualitatively confirmed by agarose gel electrophoresis.

실시간 메틸화 특이 Real time methylation specific PCRPCR ( ( realreal timetime methylationmethylation specificspecific PCRPCR ))

실시간 메틸화 특이 PCR은 메틸화 특이 PCR 방법을 실시간 측정방법으로 전환한 것으로, 지노믹 DNA에 바이설파이트를 처리한 후, 메틸화된 경우에 해당하는 PCR 프라이머를 디자인하고, 이들 프라이머를 이용하여 실시간 PCR을 수행하는 것이다. 이때, 증폭된 염기서열과 상보적인 TanMan 프로브를 이용하여 검출하는 방법과 Sybergreen을 이용하여 검출하는 두 가지 방법이 있다. 따라서, 실시간 메틸화 특이 PCR은 메틸화된 DNA만을 선택적으로 정량 분석할 수 있다. 이때, in vitro methylated DNA 샘플을 이용하여 표준곡선을 작성하고, 표준화를 위하여 염기서열내에 5'-CpG-3' 서열이 없는 유전자를 음성대조군으로 함께 증폭하여 메틸화 정도를 정량 분석하였다.
Real-time methylation specific PCR is the conversion of methylation-specific PCR method to real-time measurement method. The PCR primer corresponding to the methylation of biosulfite treated with genomic DNA was designed and real-time PCR was performed using these primers . At this time, there are two methods of detection using a TanMan probe complementary to the amplified nucleotide sequence and detection using Sybergreen. Therefore, real-time methylation-specific PCR can quantitatively analyze only methylated DNA. Where in Standard curves were prepared using in vitro methylated DNA samples, and genes without the 5'-CpG-3 'sequence in the nucleotide sequence were amplified with negative controls to quantify the degree of methylation.

파이로시퀀싱Pyrosequencing

파이로시퀀싱 방법은 바이설파이트 시퀀싱 방법을 정량적인 실시간 시퀀싱으로 변환한 방법이다. 바이설파이트 시퀀싱과 마찬가지로 지노믹 DNA를 바이설파이트를 처리하여 전환시킨 다음, 5'-CpG-3' 염기서열이 없는 부위에 해당하는 PCR 프라이머를 제작하였다. 지노믹 DNA를 바이설파이트로 처리한 후, 상기 PCR 프라이머로 증폭한 다음, 시퀀싱 프라이머를 이용하여 실시간 염기서열 분석을 수행하였다. 5'-CpG-3' 부위에서 시토신과 티민의 양을 정량적으로 분석하여 메틸화 정도를 메틸화 지수로 나타내었다.
The pyrosequencing method is a method of converting the bisulfite sequencing method into quantitative real-time sequencing. Similar to bisulfite sequencing, genomic DNA was transformed by treatment with bisulfite, and PCR primers corresponding to sites lacking the 5'-CpG-3 'nucleotide sequence were prepared. The genomic DNA was treated with bisulfite, amplified with the PCR primer, and subjected to real-time sequencing using a sequencing primer. The amounts of cytosine and thymine were quantitatively analyzed in the 5'-CpG-3 'region and the degree of methylation was expressed as a methylation index.

메틸화 Methylation DNADNA 특이적 결합 단백질을 이용한  Using specific binding proteins PCRPCR 또는 정량  Or quantitative PCRPCR 및  And DNADNA 칩 chip

메틸화 DNA 특이적 결합 단백질을 이용한 PCR 또는 DNA 칩 방법은 메틸화 DNA에만 특이적으로 결합하는 단백질을 DNA와 섞어주게 되면, 메틸화 DNA에만 특이적으로 단백질이 결합하기 때문에 메틸화 DNA만을 선택적으로 분리할 수 있다. 지노믹 DNA를 메틸화 DNA 특이적 결합 단백질과 섞어준 후, 메틸화된 DNA만을 선택적으로 분리하였다. 이들 분리된 DNA를 프로모터 부위에 해당하는 PCR 프라이머를 이용하여 증폭한 후, 아가로즈 전기영동으로 메틸화 여부를 측정하였다. In PCR or DNA chip method using methylated DNA-specific binding protein, when a protein specifically binding to methylated DNA is mixed with DNA, only the methylated DNA can be selectively isolated because the protein specifically binds to the methylated DNA . Genomic DNA was mixed with methylated DNA-specific binding protein and only methylated DNA was selectively isolated. These isolated DNAs were amplified using a PCR primer corresponding to the promoter region and then methylated by agarose electrophoresis.

또한, 정량 PCR 방법으로도 메틸화 여부를 측정할 수 있으며, 메틸화 DNA 특이적 결합 단백질로 분리한 메틸화 DNA는 형광 염료로 표지하여 상보적인 프로브가 집적된 DNA칩에 하이브리디제이션시킴으로써 메틸화 여부를 측정할 수 있다. 여기서 메틸화 DNA 특이적 결합 단백질은 McrBt에 제한되지 않는다.
In addition, methylation can be measured using a quantitative PCR method. The methylated DNA separated by a methylated DNA-specific binding protein is labeled with a fluorescent dye and hybridized to a complementary probe-integrated DNA chip to measure methylation . Here, the methylated DNA-specific binding protein is not limited to McrBt.

차별적 메틸화의 검출-메틸화 민감성 제한 Detection of differential methylation - restriction of methylation sensitivity 엔도뉴클레아제Endonuclease

차별적 메틸화의 검출은 메틸화되지 않은 CpG 부위만을 절단하는 메틸화 민감성 제한 엔도뉴클레아제와 핵산 샘플을 접촉시켜 비메틸화된 핵산을 절단하는 것으로 수행할 수 있다.Detection of differential methylation can be accomplished by contacting the nucleic acid sample with a methylation sensitive restriction endonuclease that cleaves only the unmethylated CpG site and cleaving the unmethylated nucleic acid.

별도의 반응으로, 상기 샘플을 메틸화 및 비메틸화 CpG 부위를 모두 절단하는 메틸화 민감성 제한 엔도뉴클레아제의 이소키소머(isochizomer)와 접촉시켜, 메틸화된 핵산을 절단하였다. In a separate reaction, the sample was contacted with an isochisomer of a methylation-sensitive restriction endonuclease that cleaves both methylated and unmethylated CpG sites to cleave the methylated nucleic acid.

특이적 프라이머를 핵산 샘플에 첨가하고, 통상의 방법으로 핵산을 증폭시켰다. 메틸화 민감성 제한 엔도뉴클레아제를 처리한 샘플에서 증폭 산물이 존재하고, 메틸화 및 비메틸화 CpG 부위를 모두 절단하는 메틸화 민감성 제한 엔도뉴클레아제의 이소키소머를 처리한 샘플에서 증폭 산물이 존재하지 않으면, 분석된 핵산 부위에 메틸화가 일어난 것이다. 그러나, 메틸화 민감성 제한 엔도뉴클레아제를 처리한 샘플에서 증폭 산물이 존재하지 않고, 메틸화 및 비메틸화 CpG 부위를 모두 절단하는 메틸화 민감성 제한 엔도뉴클레아제의 이소키소머를 처리한 샘플에서도 증폭 산물이 존재하지 않는다는 것은 분석된 핵산 부위에 메틸화가 일어나지 않은 것이다.A specific primer was added to the nucleic acid sample and the nucleic acid was amplified by a conventional method. If the amplification product is present in the sample treated with the methylation-sensitive restriction endonuclease and the amplification product is not present in the sample treated with the methylation-sensitive restriction endonuclease isokisome that cleaves both methylated and unmethylated CpG sites , And methylation occurred at the analyzed nucleic acid site. However, even in samples that were treated with methylation-sensitive restriction endonuclease isokisomes that did not have an amplification product in the sample treated with the methylation-sensitive restriction endonuclease and cleaved both methylated and unmethylated CpG sites, Not present means that no methylation has occurred in the nucleic acid region analyzed.

여기서, "메틸화 민감성 제한 엔도뉴클레아제"는 인식 부위에 CG를 포함하고, C가 메틸화되지 않았을 때와 비교하여 C가 메틸화되었을 때 활성을 가지는 제한효소이다 (예를 들면, SmaI). 메틸레이션 민감성 제한 엔도뉴클레아제의 비제한적 예로써, MspI, HpaII, BssHII, BstUI 및 NotI이 포함된다. 상기 효소들은 단독으로 또는 조합하여 사용될 수 있다. 다른 메틸레이션 민감성 제한 엔도뉴클레오티드로는 예를 들어, SacII 및 EagI를 들 수 있으나 이에 한정되는 것은 아니다. Here, "methylation-sensitive restriction endonuclease" is a restriction enzyme that contains CG at the recognition site and has activity when C is methylated as compared to when C is not methylated (for example, Sma I). Non-limiting examples of methylation sensitive restriction endonuclease include Msp I, Hpa II, Bss HII, Bst UI and Not I. These enzymes can be used alone or in combination. Other methylation sensitive restriction endonucleotides include, but are not limited to Sac II and Eag I, for example.

메틸화 민감성 제한 엔도뉴클레아제의 이소키소머는 메틸레이션 민감성 제한 엔도뉴클레아제와 동일한 인식 부위를 갖는 제한 엔도뉴클레아제이지만, 메틸화된 CGs와 비메틸화된 CGs를 모두 절단하며, 예를 들면, MspI를 들 수 있다.Isokimers of methylation sensitive restriction endonuclease are limited endonucleases with the same recognition sites as methylation sensitive restriction endonucleases but cleave both methylated CGs and unmethylated CGs, for example, Msp I < / RTI >

본 발명의 프라이머는 증폭될 로커스의 각 가닥과 "대체적으로" 상보성을 가지도록 제작되고, 상기에서 설명한 바와 같이, 적당한 G 또는 C 뉴클레오티드를 포함한다. 이것은 중합반응을 수행하는 조건에서 프라이머가 대응하는 핵산 가닥과 하이브리다이제이션 되기에 충분한 상보성을 가지는 것을 의미한다. 본 발명의 프라이머는 증폭 과정에 사용되며, 상기 증폭 과정은 예를 들면, PCR과 같은, 타겟 로커스가 많은 반응 단계를 거치면서 기하급수적인 숫자로 증가하는 효소 연속 반응이다. 전형적으로, 한 프라이머(안티센스 프라이머)는 로커스의 네가티브(-) 가닥에 대하여 상동성을 가지고, 나머지 하나의 프라이머(센스 프라이머)는 포지티브(+) 가닥에 대하여 상동성을 가진다. 변성된 핵산에 프라이머가 어닐링되면, DNA 폴리머라아제 I(Klenow) 및 뉴클레오티드와 같은 효소 및 반응물들에 의하여 사슬이 신장되고, 그 결과, 타겟 로커스 서열을 함유하는 + 와 - 가닥이 새롭게 합성된다. 상기 새로이 합성된 타겟 로커스가 주형으로도 사용되어 변성, 프라이머 어닐링 및 사슬 신장의 사이클이 반복되면 타겟 로커스 서열의 기하급수적인 합성이 진행된다. 상기 연속 반응의 산물은 반응에 사용된 특이 프라이머의 말단과 대응하는 말단을 가지는 독립적인 이중가닥 핵산이다.The primers of the present invention are engineered to be "substantially" complementary to each strand of the locus to be amplified and comprise the appropriate G or C nucleotides, as described above. This means that the primer has sufficient complementarity to hybridize with the corresponding nucleic acid strand under the conditions of performing the polymerization reaction. The primers of the present invention are used in an amplification process, wherein the amplification process is an enzymatic sequencing reaction in which the target locus increases in exponential numbers through many reaction steps, such as, for example, PCR. Typically, one primer (antisense primer) has homology to the negative (-) strand of the locus and the other one (sense primer) has homology to the positive (+) strand. Once the primer is annealed to the denatured nucleic acid, the chain is extended by enzymes and reagents such as DNA polymerase I (Klenow) and nucleotides, resulting in a new synthesis of the + and - strands containing the target locus sequence. When the newly synthesized target locus is also used as a template and the cycles of denaturation, primer annealing, and chain extension are repeated, exponential synthesis of the target locus sequence proceeds. The product of the continuous reaction is an independent double-stranded nucleic acid having a terminal end corresponding to the specific primer used in the reaction.

상기 증폭 반응은 당해 분야에서 보편적으로 사용되고 있는 PCR인 것이 바람직하다. 그러나, 리얼타임 PCR 또는 등온 효소를 사용한 선형증폭과 같은 대체적인 방법도 사용할 수 있으며, 멀티플렉스 증폭 반응 역시 사용할 수 있다.
The amplification reaction is preferably a PCR commonly used in the art. However, alternative methods such as real-time PCR or linear amplification using isothermal enzymes can be used, and multiplex amplification reactions can also be used.

차별적 메틸화의 검출-Detection of differential methylation - 바이설파이트Bisulfite 시퀀싱 방법 How to Sequence

메틸화 CpG를 함유한 핵산을 검출하는 다른 방법은 핵산을 함유한 시료를 비메틸화 시토신을 변형시키는 제제와 접촉시키는 단계 및 CpG-특이적 올리고뉴클레오티드 프라이머를 사용하여 시료의 CpG-함유 핵산을 증폭시키는 단계를 포함한다. 여기서, 상기 올리고뉴클레오티드 프라이머는 변형된 메틸화 및 비메틸화 핵산을 구별하여 메틸화 핵산을 검출하는 것을 특징으로 할 수 있다. 상기 증폭 단계는 선택적이고, 바람직하지만 필수적인 것은 아니다. 상기 방법은 변형된(예를 들면, 화학적으로 변형된) 메틸화 및 비메틸화 DNA를 구별하는 PCR 반응에 의존하는 것이다. 상기와 같은 방법은 미국특허 5,786,146에 개시되어 있으며, 상기 특허에는 메틸화 핵산의 검출을 위한 바이설파이트(bisulfite) 시퀀싱과 연관하여 기재되어 있다.
Another method of detecting a nucleic acid containing methylated CpG involves contacting a sample containing nucleic acid with an agent to modify unmethylated cytosine and amplifying the CpG-containing nucleic acid of the sample using a CpG-specific oligonucleotide primer . Here, the oligonucleotide primer may be characterized in that methylated nucleic acid is detected by distinguishing modified methylated and unmethylated nucleic acids. The amplification step is optional and desirable but not necessary. The method relies on PCR reactions to distinguish between modified (e. G., Chemically modified) methylated and unmethylated DNA. Such a method is disclosed in U.S. Patent 5,786,146, which is described in connection with bisulfite sequencing for the detection of methylated nucleic acids.

기질temperament

타겟 핵산 부위가 증폭되면 핵산 서열의 존재를 검출하기 위하여, 상기 핵산 증폭 산물은 고체 지지체(기질)에 고정된 알려진 유전자 프로브와 하이브리다이제이션될 수 있다.When the target nucleic acid region is amplified, the nucleic acid amplification product can be hybridized with a known gene probe immobilized on a solid support (substrate) in order to detect the presence of the nucleic acid sequence.

여기서, "기질"은 물질, 구조, 표면 또는 재료, 비생물학적이고, 합성되고, 무생물, 평면, 구형 또는 특이적 결합, 평편한 표면의 물질을 포함하는 혼합물 수단으로, 하이브리다이제이션 또는 효소 인식 부위 또는 대다수의 다른 인식 부위 또는 표면, 구조 또는 재료로 구성된 수많은 다른 분자 종을 넘어서는 수많은 다른 인식 부위를 포함할 수 있다. 상기 기질은 예를 들면, 반도체, (유기)합성 메탈, 합성 반도체, 인슐레이터 및 도판트; 금속, 합금, 원소, 화합물 및 미네랄; 합성되고, 분해되며, 에칭되고, 리소그라프되며, 프린트되고 마이크로패브리케이트된 슬라이드, 장치, 구조 및 표면; 산업적, 폴리머, 플라스틱, 멤브레인, 실리콘, 실리케이트, 유리, 금속 및 세라믹; 나무, 종이, 카드보드, 면, 울, 천, 직조 및 비직조 섬유, 재료 및 패브릭일 수 있으나, 이에 한정되는 것은 아니다.As used herein, the term "substrate" refers to a hybridization or enzymatic recognition site, such as a substance, structure, surface or material, abiotic, synthetic, inanimate, flat, spherical or specific binding, Or a large number of other recognition sites or a number of other recognition sites beyond a number of other molecular species composed of surfaces, structures or materials. Such substrates include, for example, semiconductors, (organic) synthetic metals, synthetic semiconductors, insulators and dopants; Metals, alloys, elements, compounds and minerals; Synthesized, degraded, etched, lithographic, printed and microfabricated slides, devices, structures and surfaces; Industrial, polymers, plastics, membranes, silicones, silicates, glass, metals and ceramics; But are not limited to, wood, paper, cardboard, cotton, wool, cloth, woven and nonwoven fibers, materials and fabrics.

몇몇 형태의 멤브레인은 당해 분야에서 핵산 서열에 대하여 부착력을 가진다고 알려져 있다. 이러한 멤브레인의 특이적이고 비제한적인 예로 니트로셀룰로오스 또는 폴리비닐클로라이드, 디아조티즈드(diazotized) 페이퍼 및 GENESCREENTM, ZETAPROBETM(Biorad) 및 NYTRANTM 등의 상업적으로 사용되는 멤브레인과 같이 유전자 발현 검출용 멤브레인을 들 수 있다. 비드, 글래스, 웨이퍼 및 금속 기질도 포함된다. 이러한 목적물에 핵산을 부착시키는 방법은 당해 분야에서 잘 알려져 있다. 이와 다르게, 액체 상에서도 스크리닝을 수행할 수 있다.
Some types of membranes are known in the art to have an affinity for nucleic acid sequences. Specific, non-limiting examples of such membranes include nitrocellulose or polyvinyl chloride, diazotized paper, and membranes for gene expression detection such as commercially available membranes such as GENESCREEN ™ , ZETAPROBE ™ (Biorad) and NYTRAN ™ . Beads, glasses, wafers and metal substrates. Methods for attaching nucleic acids to such objects are well known in the art. Alternatively, screening can be performed in a liquid phase.

하이브리다이제이션Hybridization 조건 Condition

핵산 하이브리다이제이션 반응에서, 엄격한 특정 수준을 달성하기 위하여 사용되는 조건은 하이브리다이즈되는 핵산의 성질에 따라 다양하다. 예를 들면, 하이브리다이제이션되는 핵산 부위의 길이, 상동성 정도, 뉴클레오티드 서열 조성(예를 들면, GC/AT 조성비) 및 핵산 타입(예를 들면, RNA, DNA)등이 하이브리다이제이션 조건을 선택하는데 고려된다. 추가적인 고려 조건은 핵산이 예를 들면, 필터 등에 고정화되어 있는지의 여부이다.In nucleic acid hybridization reactions, the conditions used to achieve a certain level of stringency will vary depending on the nature of the nucleic acid being hybridized. For example, hybridization conditions such as the length of the nucleic acid site to be hybridized, the degree of homology, the nucleotide sequence (for example, GC / AT composition ratio) and the nucleic acid type (for example, RNA or DNA) . An additional consideration is whether the nucleic acid is immobilized, for example, on a filter or the like.

매우 엄격하게 진행되는 조건의 예를 들면 다음과 같다: 실온의 2X SSC/0.1% SDS(하이브리다이제이션 조건); 실온의 0.2X SSC/0.1% SDS(엄격성이 낮은 조건); 42℃에서의 0.2X SSC/0.1% SDS(보통의 엄격성을 가지는 조건); 68℃에서 0.1X SSC(높은 엄격성을 가지는 조건). 세척 과정은 이들 중 한가지 조건을 사용하여 수행할 수 있고, 예를 들면 높은 엄격성을 가지는 조건, 또는 상기 조건을 각각 사용할 수 있으며, 상기 기재된 순서대로 각각 10~15분씩, 상기 기재된 조건을 전부 또는 일부 반복하여 수행할 수 있다. 그러나 상기에 기술한 바와 같이, 최적 조건은 포함된 특별한 하이브리다이제이션 반응에 따라 다양하며, 실험을 통하여 결정할 수 있다. 일반적으로, 중요한 프로브의 하이브리다이제이션에는 높은 엄격성을 가지는 조건이 사용된다.
Examples of very stringent conditions include: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42 < 0 > C (conditions with normal stringency); 0.1X SSC at 68 ° C (conditions with high stringency). The cleaning process can be carried out using one of these conditions, for example a condition with high stringency, or the above conditions can be used respectively, and the conditions described above may be applied in whole or in part, Some can be done iteratively. However, as described above, optimal conditions vary depending on the particular hybridization reaction involved and can be determined through experimentation. Generally, conditions with high stringency are used for hybridization of critical probes.

표지(sign( LabelLabel ))

중요한 프로브는 검출할 수 있도록 표지되며, 예를 들면 방사선 동위원소, 형광 화합물, 바이오 발광 화합물, 화학 발광 화합물, 금속 킬레이트 또는 효소로 표지될 수 있다. 상기와 같은 프로브를 적당하게 표지하는 것은 당해 분야에서 널리 알려진 기술이며, 통상적인 방법을 통하여 수행할 수 있다.
Important probes are detectably labeled and may be labeled, for example, as radioactive isotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. It is well known in the art to appropriately label such a probe, and can be carried out by a conventional method.

키트(Kit ( KitKit ))

본 발명에 의하면, 검체의 세포 성장성 이상을 검출하는 데 유용한 키트를 제공하고 있다. 본 발명의 키트는 샘플을 담는 구획된 캐리어 수단, 비메틸화 시토신을 민감하게 절단하는 제제를 함유하는 첫번째 용기, CpG 함유 핵산을 증폭하기 위한 프라이머를 함유하는 두번째 용기 및 절단된 또는 절단되지 않은 핵산의 존재를 검출하는 수단이 함유된 세번째 용기를 포함하는 하나 이상의 용기를 포함한다. 본 발명에 따라 사용되는 프라이머는 서열번호 2~3에 기재된 서열, 기능적 조합 및 그 단편을 포함한다. 기능적 조합 또는 단편은 게놈상에서 메틸화가 일어났는지의 여부를 검출하는 프라이머로 사용된다.According to the present invention, there is provided a kit useful for detecting abnormality in cell growth of a specimen. The kit of the present invention comprises a first container containing a partitioned carrier means for containing a sample, an agent for sensitively cleaving unmethylated cytosine, a second container containing a primer for amplifying the CpG containing nucleic acid, and a second container containing a cleaved or uncut nucleic acid And at least one container comprising a third container containing means for detecting the presence. Primers used in accordance with the present invention include the sequences set forth in SEQ ID NOS: 2-3, functional combinations and fragments thereof. A functional combination or fragment is used as a primer to detect whether methylation has occurred on the genome.

캐리어 수단은 병, 튜브와 같은 하나 이상의 용기를 함유하기에 적합하고, 각 용기는 본 발명의 방법에 사용되는 독립적 구성요소들을 함유한다. 본 발명의 명세서에서, 당해 분야의 통상의 지식을 가진 자는 용기 중의 필요한 제제를 손쉽게 분배할 수 있다. 예를 들면, 메틸화 민감성 제한 엔도뉴클레아제를 함유하는 용기를 하나의 용기로 구성할 수 있다. 하나 이상의 용기는 중요 핵산 로커스와 상동성을 가지는 프라이머를 포함할 수 있다. 또한, 하나 이상의 용기는 메틸화 민감성 제한효소의 이소키소머를 포함할 수 있다.
The carrier means is suitable for containing one or more containers such as bottles, tubes, and each container contains the independent components used in the method of the present invention. In the context of the present invention, those skilled in the art will readily be able to dispense the necessary formulation in a container. For example, a container containing a methylation sensitive restriction endonuclease can be constructed in a single container. One or more containers may contain primers that are homologous to the critical nucleic acid locus. In addition, the one or more containers may comprise an isokisome of a methylation sensitive restriction enzyme.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

실시예Example 1: 방광암 특이적 메틸화 유전자 발굴 1: Finding bladder cancer specific methylation gene

방광암에서 특이적으로 메틸화된 바이오 마커를 선별하기 위하여, 방광암 환자 10명 및 정상인 10명의 소변 약 20㎖를 각각 4,200ㅧg에서 10분간 원심분리(한일과학)하여 소변세포를 분리하였다. 상층액을 버리고, PBS 5㎖를 이용하여 세포 침전물을 2회 세척한 후, 상기 세포 침전물로부터 QIAamp DNA Mini kit(QIAGEN, USA)를 사용하여 게놈 DNA를 분리하였다. 상기 분리된 게놈 DNA 500ng을 초음파 분쇄(Vibra Cell, SONICS)하여, 약 200~300bp의 게놈 DNA 절편을 제작하였다. In order to select specifically methylated biomarkers from bladder cancer, urine cells were separated by centrifugation (Hanil Science) for 10 minutes at 4,200 μg of urine from 10 patients of bladder cancer and 10 normal persons, respectively. The supernatant was discarded and the cell precipitate was washed twice with 5 ml of PBS, and genomic DNA was isolated from the cell precipitate using the QIAamp DNA Mini kit (QIAGEN, USA). 500 ng of the isolated genomic DNA was ultrasonically crushed (Vibra Cell, SONICS) to produce genomic DNA fragments of about 200-300 bp.

게놈 DNA로부터 메틸화된 DNA만을 획득하기 위하여, 메틸화 DNA에 결합한다고 알려진 메틸바인딩 도메인 (Methyl binding domain; MBD) (Fraga et al., 2003, Nucleic Acid Res., 31: 1765-1774)을 사용하였다. 즉, 6X His가 tagging된 MBD2bt 2㎍을 대장균 JM110(한국생명공학연구원 생명자원센터, No. 2638) 게놈 DNA 500ng과 pre-incubation시킨 다음, Ni-NTA 마그네틱 비드 (Qiagen, USA)에 결합시켰다. 여기에 상기 초음파 분쇄된 정상인 및 방광암 환자 소변세포에서 분리한 게놈 DNA 500ng을 결합 반응 용액(10mM Tris-HCl(pH 7.5), 50mM NaCl, 1mM EDTA, 1mM DTT, 3mM MgCl2, 0.1% Triton-X100, 5% 글리세롤, 25㎎/㎖ BSA)하에서 4℃, 20 분간 반응시킨 후, 700mM NaCl이 포함된 결합 반응 용액 500㎕를 이용하여 3회 세척한 다음, MBD2bt에 결합된 메틸화된 DNA를 QiaQuick PCR purification kit(QIAGEN, USA)을 사용하여 분리하였다. In order to obtain only methylated DNA from genomic DNA, a methyl binding domain (MBD) known to bind to methylated DNA (Fraga et al., 2003, Nucleic Acid Res., 31: 1765-1774) was used. Namely, 2 μg of MBD2bt tagged with 6X His was preincubated with 500 ng of genomic DNA of Escherichia coli JM110 (Life Science Center, Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Korea) and then bound to Ni-NTA magnetic beads (Qiagen, USA). Here, 500 ng of genomic DNA isolated from the ultrasonically pulverized normal and bladder cancer patient urine cells were combined with a reaction solution (10 mM Tris-HCl, pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 3 mM MgCl 2 , 0.1% Triton-X100 , 5% glycerol, 25 mg / ml BSA), and reacted at 4 ° C. for 20 minutes, and then washed three times using 500 μl of a binding reaction solution containing 700 mM NaCl, followed by QiaQuick PCR for methylated DNA bound to MBD2bt. Separation was performed using a purification kit (QIAGEN, USA).

이후, 상기 MBD2bt에 결합된 메틸화된 DNA를 게놈 증폭 키트(Sigma, USA, Cat. No. WGA2)를 이용하여 증폭한 후, 상기 증폭된 게놈 DNA 4㎍을 BioPrime Total Genomic Labeling system I(Invitrogen Corp., USA)을 이용하여 정상인 유래 DNA는 Cy3, 방광암 환자 유래 DNA는 Cy5로 표지하였다. 상기 정상인 및 방광암 환자의 DNA를 혼합한 후, 244K human CpG 마이크로어레이(Agilent, USA)에 하이브리다이제이션시켰다 (도 1). 상기 하이브리다이제이션 후, 일련의 세척 과정을 거친 다음. Agilent scanner를 이용하여 스캐닝하였다. 마이크로어레이 이미지로부터 시그날 값의 계산은 Feature Extraction 프로그램 v. 9.5.3.1(Agilent)을 이용하여 정상인과 방광암 환자 시료 간 시그날의 상대적인 강도 차이를 계산하였다. Thereafter, the methylated DNA bound to the MBD2bt was amplified using a genome amplification kit (Sigma, USA, Cat. No. WGA2), and then 4 μg of the amplified genomic DNA was prepared using BioPrime Total Genomic Labeling system I (Invitrogen Corp. , USA) was labeled as Cy3 for normal human-derived DNA and Cy5 for bladder cancer patient-derived DNA. The DNA of the normal and bladder cancer patients were mixed and hybridized to a 244K human CpG microarray (Agilent, USA) (FIG. 1). After the hybridization, after a series of washing steps. And scanned using an Agilent scanner. The calculation of signal values from the microarray image is performed using the Feature Extraction program v. 9.5.3.1 (Agilent) was used to calculate the relative intensity difference between normal and bladder cancer patient samples.

정상에서 메틸화되지 않은 스팟을 선택하기 위하여, 전체 Cy3 시그날 값의 평균값을 구한 후, 이 평균값의 10% 이하인 시그날 값을 갖는 스팟을 정상인의 시료에서 메틸화되지 않은 것으로 간주하였다. 그 결과, Cy3 시그날 값이 65 이하인 41,674개의 스팟을 구하였다. To select spots that were not methylated at normal, the mean value of the total Cy3 signal values was obtained, and the spots with signal values less than or equal to 10% of this mean value were considered as unmethylated in the sample of normal people. As a result, 41,674 spots having a Cy3 signal value of 65 or less were obtained.

이로부터 정상과 방광암 환자 사이에 메틸화 정도의 상대적인 차이가 2배 이상 과메틸화된 4개의 유전자(CBLN1, PCDHA4, PTGER4, CART1)를 선택하고, MethPrimer (~urolab/ methprimer/index1.html)을 이용하여 상기 4개 유전자의 프로모터 부위에 CpG islands가 존재하는 것으로 확인하였으며, 이들을 방광암 진단을 위한 메틸화 바이오 마커 후보로 확보하였다.
From this, four genes ( CBLN1 , PCDHA4 , PTGER4 , CART1 ) hypermethylated more than two times the relative difference in the degree of methylation between normal and bladder cancer patients were selected, and using MethPrimer (~ urolab / methprimer / index1.html) It was confirmed that CpG islands exist at the promoter regions of the four genes, and these were secured as methylated biomarker candidates for diagnosing bladder cancer.

실시예Example 2: 방광암 세포주에서의 바이오  2: Bio in Bladder Cancer Cell Lines 마커Marker 유전자의 메틸화 측정 Measure methylation of genes

상기 4개 유전자의 메틸화 상태를 추가적으로 확인하기 위하여, 각각의 프로모터에 대해 바이설파이트 시퀀싱을 수행하였다.To further confirm the methylation status of the four genes, bisulfite sequencing was performed for each promoter.

바이설파이트(bisulfite)를 이용하여 메틸화되지 않은 시토신을 우라실로 변형하기 위하여, 방광암 세포주 RT-4(한국세포주은행 (KCLB 30002), J82(KCLB 30001), HT1197(KCLB 21473) 및 HT1376 (KCLB 21472)로부터 전체 게놈 DNA를 분리하여, 그 중 게놈 DNA 200ng에 EZ DNA methylation-Gold kit(Zymo Research, USA)를 이용하여 바이설파이트를 처리하였다. DNA를 바이설파이트로 처리하면, 비메틸화된 시토신은 우라실로 변형되고, 메틸화된 시토신은 변화없이 남게 된다. 상기 바이설파이트가 처리된 DNA를 멸균 증류수 20㎕로 용출시켜 파이로시퀀싱(pyrosequencing)을 수행하였다.Bladder cancer cell lines RT-4 (Korea Cell Line Bank (KCLB 30002), J82 (KCLB 30001), HT1197 (KCLB 21473) and HT1376 (KCLB 21472) to modify unmethylated cytosine to uracil using bisulfite The whole genomic DNA was isolated and bisulfite was treated with 200 ng of genomic DNA using the EZ DNA methylation-Gold kit (Zymo Research, USA.) When the DNA was treated with bisulfite, unmethylated cytosine Is transformed into uracil and methylated cytosine remains unchanged The pyrosequencing was performed by eluting the bisulfite treated DNA with 20 μl of sterile distilled water.

상기 4개의 유전자에 대한 파이로시퀀싱을 수행하기 위한 PCR 및 시퀀싱 프라이머는 PSQ assay design 프로그램(Biotage, USA)을 이용하여 설계하였다. 각 유전자의 메틸화 측정을 위한 PCR 및 시퀀싱 프라이머는 하기 표 1 및 표 2와 같다. PCR and sequencing primers for performing pyro sequencing for the four genes were designed using the PSQ assay design program (Biotage, USA). PCR and sequencing primers for methylation measurement of each gene are shown in Tables 1 and 2 below.

Figure 112012033984138-pat00001
Figure 112012033984138-pat00001

메틸화 마커 유전자의 시퀀싱 프라이머 서열Sequencing Primer Sequences of Methylation Marker Genes 유전자gene 서열(5'-->3')Sequence (5 '-> 3') 서열번호SEQ ID NO: CBLN1CBLN1 TACCCCTTAAAACCCATACCCCTTAAAACCCA 1010 PCDHA4PCDHA4 GGGGAAGAGGTTAGGAATTGGGGAAGAGGTTAGGAATT 1111 PTGER4PTGER4 TGTTAGTAAGAGTGTGTTGTGTTAGTAAGAGTGTGTTG 1212 CART1CART1 ATTTAGTATAGGGTTGTTTTATTTAGTATAGGGTTGTTTT 1313

상기의 바이설파이트로 전환된 게놈 DNA 20ng을 PCR로 증폭하였다. PCR 반응 용액(바이설파이트로 전환된 게놈 DNA 20ng, 10X PCR buffer(Enzynomics, Korea) 5㎕, Taq polymerase(Enzynomics, Korea) 5units, 2.5mM dNTP(Solgent, Korea) 4㎕, PCR 프라이머 2㎕(10 pmole/㎕))을 95℃에서 5분 동안 처리한 후, 95℃에서 40초, 60℃에서 45초, 72℃에서 40초로 총 45회 실시한 다음, 72℃에서 5분 동안 반응시켰다. 상기 PCR 산물의 증폭 여부는 2.0% 아가로오스젤을 사용한 전기영동으로 확인하였다. 20 ng of genomic DNA converted into bisulfite was amplified by PCR. 5 μl of Taq polymerase (Enzynomics, Korea), 4 μl of 2.5 mM dNTP (Solgent, Korea), 2 μl of PCR primer (5 μl of PCR buffer (Enzynomics, 10 pmole / 占 퐇)) was treated at 95 占 폚 for 5 minutes, followed by 45 times at 95 占 폚 for 40 seconds, 60 占 폚 for 45 seconds, and 72 占 폚 for 40 seconds, and then reacted at 72 占 폚 for 5 minutes. Amplification of the PCR product was confirmed by electrophoresis using 2.0% agarose gel.

상기 증폭된 PCR 산물에 PyroGold 시약(Biotage, USA)을 처리한 후, PSQ96MA 시스템(Biotage, USA)을 이용하여 파이로시퀀싱을 수행하였다. 상기 파이로시퀀싱 후, 메틸화 지수(methylation index)를 계산함으로써 메틸화 정도를 측정하였다. 메틸화 지수는 각 CpG 부위에서 시토신이 결합하는 평균율을 구하여 계산하였다. The amplified PCR products were treated with PyroGold reagent (Biotage, USA) and pyrosequencing was performed using a PSQ96MA system (Biotage, USA). After the pirosequencing, the degree of methylation was measured by calculating the methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site.

도 2는 4개의 바이오 마커의 방광암 세포주에서의 메틸화 정도를 파이로시퀀싱 방법을 이용하여 정량적으로 나타낸 것이다. 그 결과, 상기 4개의 바이오 마커 유전자 모두가 최소 1개 이상의 세포주에서 높은 수준으로 메틸화되어 있는 것을 확인하였다. 각 세포주에서 메틸화 정도가 높고 빈도가 높은 CBLN1 유전자를 최종 방광암 바이오마커로 선별하였으며, CBLN1의 프로모터 서열을 서열번호 1에 나타내었다.
Figure 2 quantitatively shows the degree of methylation of four biomarkers in bladder cancer cell lines using the pyro sequencing method. As a result, it was confirmed that all four biomarker genes were methylated at high levels in at least one cell line. CBLN1 genes with high degree of methylation and high frequency in each cell line were selected as the final bladder cancer biomarkers, and the promoter sequence of CBLN1 is shown in SEQ ID NO: 1.

실시예Example 3: 방광암 조직에서의  3: in bladder cancer tissue CBLN1CBLN1 바이오마커의Biomarker 과메틸화Hypermethylation 측정 Measure

실시예 1~2에서 나타난 바와 같이, 방광암 조직에서 과메틸화 되어 있으며, 간암 세포주에서 과메틸화 되어 있는 바이오마커를 이용하여 방광암 진단용 바이오마커로 사용할 수 있는지 검증하기 위하여, 14명의 방광암 조직 임상 검체를 이용하여 선발된 바이오마커에 대하여 메틸화 어세이를 수행하였다. 메틸화 어세이는 파이로시퀀싱 방법을 사용하여 실시예 2에 기재된 방법으로 수행하였다. 그 결과, 방광암 환자의 방광암 조직 연접 부위의 정상소견 조직에 비해 방광암 환자의 암조직에서 메틸화 수준이 높은 경우가 14예 중 11예로서, 78.6%의 높은 빈도를 나타내었다 (도 3).
As shown in Examples 1 and 2, clinical samples of 14 bladder cancer tissues were used to verify whether they can be used as biomarkers for bladder cancer diagnosis by using a biomarker hypermethylated in bladder cancer tissue and hypermethylated in liver cancer cell line. The methylation assay was performed on the selected biomarkers. The methylation assay was performed by the method described in Example 2 using the pyro sequencing method. As a result, 11 out of 14 cases showed higher methylation levels in the cancer tissues of the bladder cancer patients than in the normal findings of the bladder cancer tissue junctions of the bladder cancer patients, 78.6% (FIG. 3).

실시예Example 4: 방광암 환자의 소변 세포에서의 바이오  4: Bio in urine cells of bladder cancer patients 마커Marker 유전자의 메틸화 측정 Measure methylation of genes

상기 CBLN1 유전자를 방광암 진단용 바이오 마커로 사용할 수 있는지 검증하기 위하여, 정상인 10명 및 방광암 환자 10명의 소변 약 20㎖를 4,200ㅧg에서 10분간 원심분리(한일과학)하여 세포를 분리하였다. 상층액을 버리고, PBS 5㎖를 이용하여 세포 침전물을 2회 세척하였다. 상기 세척된 세포로부터 QIAamp DNA Mini kit(QIAGEN, USA)를 사용하여 게놈 DNA를 분리한 후, 상기 분리된 게놈 DNA 200ng에 EZ DNA methylation-Gold kit(Zymo Research, USA)를 이용하여 바이설파이트를 처리한 다음, 멸균 증류수 20㎕로 용출하여 파이로시퀀싱에 사용하였다.In order to verify whether the CBLN1 gene can be used as a biomarker for bladder cancer diagnosis, about 20 ml of urine of 10 normal and 10 bladder cancer patients was centrifuged at 4,200 μg for 10 minutes to separate cells. The supernatant was discarded and the cell precipitate was washed twice with 5 ml of PBS. Genomic DNA was isolated from the washed cells using QIAamp DNA Mini kit (QIAGEN, USA), and then bisulfite was purified using EZ DNA methylation-Gold kit (Zymo Research, USA) on 200ng of the isolated genomic DNA. After treatment, the solution was eluted with 20 µl of sterile distilled water and used for pyro sequencing.

상기 바이설파이트로 전환된 게놈 DNA 20ng을 PCR로 증폭하였다. PCR 반응 용액(바이설파이트로 전환된 게놈 DNA 20ng, 10X PCR buffer 5㎕(Enzynomics, Korea), Taq polymerase 5 units(Enzynomics, Korea), 2.5mM dNTP 4㎕(Solgent, Korea), PCR 프라이머 2㎕(10pmole/㎕))을 95℃에서 5분 동안 처리한 후, 95℃에서 40초, 60℃에서 45초, 72℃에서 40초로 총 45회 실시한 다음, 72℃에서 5분 동안 반응시켰다. 상기 PCR 산물의 증폭 여부는 2.0% 아가로오스젤을 사용한 전기영동으로 확인하였다. 20 ng of genomic DNA converted into bisulfite was amplified by PCR. PCR reaction solution (20 ng genomic DNA converted to bisulfite, 5 μl of 10X PCR buffer (Enzynomics, Korea), Taq polymerase 5 units (Enzynomics, Korea), 4 μl of 2.5 mM dNTP (Solgent, Korea), 2 μl of PCR primer (10 pmole/μl)) was treated for 5 minutes at 95 ° C., and then 45 times at 95 ° C., 45 seconds at 60 ° C., and 40 seconds at 72 ° C., followed by reaction at 72 ° C. for 5 minutes. Amplification of the PCR product was confirmed by electrophoresis using 2.0% agarose gel.

상기 증폭된 PCR 산물에 PyroGold 시약(Biotage, USA)을 처리한 후, PSQ96MA 시스템(Biotage, USA)을 이용하여 파이로시퀀싱을 수행하였다. 파이로시퀀싱 후, 메틸화 정도는 메틸화 지수(methylation index)를 계산함으로써 측정하였다. 메틸화 지수는 각 CpG 부위에서 시토신이 결합하는 평균율을 구하여 계산하였다. 또한, 정상인과 방광암 환자의 소변세포 DNA에서의 메틸화 지수를 측정한 후, 방광암 환자 진단을 위한 메틸화 지수 cut-off를 ROC(receiver operating characteristic) 커브 분석을 통하여 결정하였다. The amplified PCR products were treated with PyroGold reagent (Biotage, USA) and pyrosequencing was performed using a PSQ96MA system (Biotage, USA). After pyro sequencing, the degree of methylation was determined by calculating the methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site. In addition, after measuring the methylation index in the urine cell DNA of normal people and bladder cancer patients, the methylation index cut-off for diagnosing bladder cancer patients was determined through a receiver operating characteristic (ROC) curve analysis.

도 4은 상기 CBLN1 바이오 마커 유전자의 소변세포에서의 메틸화를 측정한 결과이다. 정상에 비하여 방광암 환자의 시료에서 메틸화 정도 높게 증가하는 것을 볼 수 있다. Figure 4 is the result of measuring the methylation of urine cells of the CBLN1 biomarker gene. Compared to the normal, the degree of methylation can be seen to increase in the sample of the bladder cancer patient.

CBLN1 바이오 마커의 메틸화 분석은 각 바이오 마커의 임상 시료에서의 메틸화 지수를 구하고, 이로부터 ROC(receiver operating characteristic) 커브 분석을 통해 얻은 방광암을 진단하기 위한 메틸화 지수가 상기 cut-off 보다 높은 경우를 메틸화 양성으로 판정하였고, 이하인 경우에는 음성으로 판정하였다. 도 4에 나타낸 바와 같이, ROC 커브 분석 결과 얻은 cut-off를 기준으로 하였을 경우, 정상인의 소변세포에서는 CBLN1 바이오 마커가 메틸화 음성을 나타내었으나, 방광암 환자에서는 80%의 메틸화 양성 빈도를 나타내었다.
Methylation analysis of CBLN1 biomarker calculates methylation index in clinical samples of each biomarker, and methylation index where methylation index for diagnosis of bladder cancer obtained through receiver operating characteristic (ROC) curve analysis is higher than the cut-off. It was determined as positive, and as below in case of negative. As shown in FIG. 4, based on the cut-off obtained from the ROC curve analysis, the CBLN1 biomarker showed methylation negative in normal urine cells, but showed 80% methylation frequency in bladder cancer patients.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (13)

다음 단계를 포함하는 방광암 또는 방광암 진행단계의 검출방법:
(a) 임상샘플에서 DNA를 분리하는 단계; 및
(b) 상기 분리된 DNA에서 방광암 바이오마커인 CBLN1 유전자의 프로모터 부위의 메틸화를 검출하는 단계.
Method of detecting bladder cancer or bladder cancer progression step comprising the following steps:
(a) separating DNA from a clinical sample; And
(b) detecting methylation of a promoter region of the CBLN1 gene, which is a bladder cancer biomarker in the separated DNA.
제1항에 있어서, 방광암 바이오마커인 CBLN1 유전자의 메틸화 검출은 서열번호 1의 염기서열을 가지는 DNA 부위에서 수행되는 것을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
The method of claim 1, wherein methylation detection of the CBLN1 gene, which is a bladder cancer biomarker, is performed at a DNA region having a nucleotide sequence of SEQ ID NO: 1.
제1항에 있어서, 상기 메틸화 검출은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR, 정량 PCR, DNA 칩, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 방법에 의해 수행되는 것을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
The method according to claim 1, wherein the detection of methylation is performed using PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, quantitative PCR, And sequencing by bisulfite sequencing. The method of detecting bladder cancer or bladder cancer progression according to claim 1,
제1항에 있어서, 상기 임상 샘플은 암 의심 환자 또는 진단 대상 유래의 조직, 세포, 혈액, 혈장 및 소변으로 구성된 군에서 선택되는 것임을 특징으로 하는 방광암 또는 방광암 진행단계의 검출방법.
The method according to claim 1, wherein the clinical sample is selected from the group consisting of a suspected cancer patient or tissue, cell, blood, plasma, and urine derived from a subject to be diagnosed.
방광암 바이오마커인 CBLN1 유전자의 프로모터 부위의 메틸화 부위를 함유하는 방광암 진단용 키트.
Bladder cancer diagnostic kit containing the methylation site of the promoter region of the CBLN1 gene, which is a bladder cancer biomarker.
제5항에 있어서, 상기 프로모터 부위는 적어도 하나의 메틸화된 CpG 디뉴클레오티드를 함유하는 것을 특징으로 하는 방광암 진단용 키트.
6. The kit for diagnosing bladder cancer according to claim 5, wherein the promoter region contains at least one methylated CpG dinucleotide.
제5항에 있어서, 방광암 바이오마커인 CBLN1 유전자의 프로모터의 메틸화 부위는 서열번호 1의 염기서열을 가지는 것을 특징으로 하는 방광암 진단용 키트.
The kit for diagnosing bladder cancer according to claim 5, wherein the methylation site of the promoter of the CBLN1 gene, which is a bladder cancer biomarker, has a nucleotide sequence of SEQ ID NO: 1.
제5항에 있어서, 상기 프로모터의 메틸화 부위는 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR), 메틸화 DNA 특이적 결합 단백질을 이용한 PCR , 정량 PCR, 파이로시퀀싱 및 바이설파이트 시퀀싱으로 구성된 군에서 선택되는 방법으로 메틸화가 측정되는 것을 특징으로 하는 방광암 진단용 키트.
The method of claim 5, wherein the methylation site of the promoter is PCR, methylation specific PCR, real time methylation specific PCR, PCR using methylated DNA specific binding protein, quantitative PCR, pyro Kit for diagnosing bladder cancer, characterized in that methylation is measured by a method selected from the group consisting of sequencing and bisulfite sequencing.
방광암 바이오마커인 CBLN1 유전자 프로모터의 메틸화 부위를 포함하는 단편과 하이브리다이제이션 할 수 있는 프로브를 포함하는 방광암 진단용 핵산칩.
Bladder cancer nucleic acid chip comprising a fragment comprising a methylation site of the CBLN1 gene promoter, which is a bladder cancer biomarker, and a probe capable of hybridization.
제9항에 있어서, 방광암 바이오마커인 CBLN1 유전자 프로모터의 메틸화 부위는 서열번호 1의 염기서열을 가지는 것을 특징으로 하는 방광암 진단용 핵산칩.
10. The nucleic acid chip for bladder cancer diagnosis according to claim 9, wherein the methylation site of the CBLN1 gene promoter, which is a bladder cancer biomarker, has a nucleotide sequence of SEQ ID NO: 1.
제9항에 있어서, 프로브는 CBLN1 유전자 프로모터의 CpG와는 상보적이면서 동시에 상기 CBLN1 유전자의 프로모터 부위의 CpG를 포함하는 단편과 하이브리다이제이션할 수 있는 염기서열을 포함하는 것을 특징으로 하는 방광암 진단용 핵산칩.
10. The bladder cancer diagnostic nucleic acid chip according to claim 9, wherein the probe comprises a base sequence capable of hybridizing with a fragment including CpG of the promoter region of the CBLN1 gene and complementary to CpG of the CBLN1 gene promoter. .
제9항에 있어서, 상기 핵산 칩에 적용되는 DNA 샘플은 PCR, 메틸화 특이 PCR(methylation specific PCR), 실시간 메틸화 특이 PCR(real time methylation specific PCR) 및 메틸화 DNA 특이적 결합 단백질을 이용한 PCR로 구성된 군에서 선택되는 방법으로 제작되는 것을 특징으로 하는 방광암 진단용 핵산칩.
The group of claim 9, wherein the DNA sample applied to the nucleic acid chip is composed of PCR, methylation specific PCR, real time methylation specific PCR, and PCR using methylated DNA specific binding proteins. Bladder cancer diagnostic nucleic acid chip, characterized in that it is produced by a method selected from.
제12항에 있어서, 상기 DNA 샘플은 암 의심 환자 또는 진단 대상 유래의 조직, 세포, 혈액 및 소변으로 구성된 군에서 선택되는 임상샘플 유래인 것을 특징으로 하는 방광암 진단용 핵산칩.The nucleic acid chip of claim 12, wherein the DNA sample is derived from a clinical sample selected from the group consisting of tissue, cells, blood, and urine suspected of cancer or a diagnosis target.
KR1020120044695A 2012-04-27 2012-04-27 Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene KR101387663B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120044695A KR101387663B1 (en) 2012-04-27 2012-04-27 Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120044695A KR101387663B1 (en) 2012-04-27 2012-04-27 Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene

Publications (2)

Publication Number Publication Date
KR20130121467A KR20130121467A (en) 2013-11-06
KR101387663B1 true KR101387663B1 (en) 2014-04-22

Family

ID=49851700

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120044695A KR101387663B1 (en) 2012-04-27 2012-04-27 Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene

Country Status (1)

Country Link
KR (1) KR101387663B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101750146B1 (en) * 2014-12-30 2017-06-23 충북대학교 산학협력단 Use of RSPH9 for Prognostic Marker Diagnosis of Bladder Cancer
KR101759382B1 (en) 2015-02-25 2017-07-19 충북대학교 산학협력단 Method for Diagnosis of Bladder Cancer using PRAC methylation and A Use thereof
CN113755584A (en) * 2020-06-05 2021-12-07 广州市基准医疗有限责任公司 DNA methylation biomarker combination and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060031809A (en) * 2003-06-09 2006-04-13 더 리젠츠 오브 더 유니버시티 오브 미시간 Compositions and methods for treating and diagnosing cancer
KR20110036553A (en) * 2011-03-07 2011-04-07 (주)지노믹트리 Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene
US20120101023A1 (en) * 2009-04-20 2012-04-26 Erasmus University Medical Center Rotterdam Method of diagnosing bladder cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060031809A (en) * 2003-06-09 2006-04-13 더 리젠츠 오브 더 유니버시티 오브 미시간 Compositions and methods for treating and diagnosing cancer
US20120101023A1 (en) * 2009-04-20 2012-04-26 Erasmus University Medical Center Rotterdam Method of diagnosing bladder cancer
KR20110036553A (en) * 2011-03-07 2011-04-07 (주)지노믹트리 Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene

Also Published As

Publication number Publication date
KR20130121467A (en) 2013-11-06

Similar Documents

Publication Publication Date Title
JP5820363B2 (en) Bladder cancer diagnostic kit and chip using methylation marker gene specific to bladder cancer
KR101569498B1 (en) Method for Detecting Gastric Polyp and Gastric Cancer Using Gastric Polyp and Gastric Cancer Specific Methylation Marker Gene
KR101284014B1 (en) Methylation Biomarker of Gastric Cancer Specific for Gastric Cancer Diagnosis
KR102223014B1 (en) Method for detecting precancerous lesions
KR101255769B1 (en) Method for Detecting Methylation of Colorectal Cancer Specific Methylation Marker Gene for Colorectal Cancer Diagnosis
KR101573467B1 (en) Method for Detecting Bladder Cancer Using Bladder Cancer Specific Epigenetic Marker Gene
US9670551B2 (en) Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene
KR101313756B1 (en) Method for Detecting Liver Cancer Using Liver Cancer Specific Hypermethylated CpG Sequence
US9670552B2 (en) Diagnosis kit and chip for bladder cancer using bladder cancer specific methylation marker gene
KR101374822B1 (en) Methylation Marker For Cervical Cancer Diagnosis
KR101387663B1 (en) Method for Detecting Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene
KR101255768B1 (en) Biomarker for Diagnosing Cervical Cancer Containing CpG island of Cervical Cancer Specific Methylation Gene
KR101145406B1 (en) Method for Detecting Methylation of Colorectal Cancer Specific Methylation Marker Gene for Colorectal Cancer Diagnosis
KR101200552B1 (en) Diagnosis Kit and Chip for Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene
KR101200537B1 (en) Diagnosis Kit and Chip for Bladder Cancer Using Bladder Cancer Specific Methylation Marker Gene
KR101142130B1 (en) Method for Detecting Breast Cancer Using Breast Cancer Specific Methylation Marker Genes
KR101136505B1 (en) Method for Detecting Methylation of Colorectal Cancer Specific Methylation Marker Gene for Colorectal Cancer Diagnosis
KR101009062B1 (en) Method for detecting methylation of gastric cancer specific methylation marker gene for gastric cancer diagnosis
KR101191947B1 (en) Method for Detecting Breast Cancer Using Breast Cancer Specific Methylation Marker Genes
KR101019727B1 (en) Method for Detecting Methylation of Gastric Cancer Specific Methylation Marker Gene for Gastric Cancer Diagnosis

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170214

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180220

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20190116

Year of fee payment: 6