KR20110077644A - Composition for improving obesity using wheat bran - Google Patents

Abstract

PURPOSE: A composition containing wheat bran extract is provided to suppress adipocyte differentiation and adipose accumulation. CONSTITUTION: A composition for treating obesity contains wheat bran extract as an active ingredient. The composition is a food composition or a pharmaceutical composition. A composition for diet contains wheat bran extract as an active ingredient. The wheat bran extract is: (I) an extract prepared by isolating wheat bran in water, low alcohol of 1-4 carbon atoms, or mixture solvent thereof; (II) an extract prepared by fractioning the extract of (I) using two or more kinds of solvents among water, low alcohol of 1-4 carbon atoms, or mixture solvent thereof; or (III) an extract prepared by extracting wheat bran with water, ethanol, or mixture solvent thereof.

Description

Composition for improving obesity using wheat bran extract {Composition for Improving Obesity Using Wheat Bran}

The present invention relates to an obesity improving composition using wheat bran extract.

Recently, the obese population is rapidly increasing due to the improvement of living standards according to economic development, lack of exercise due to busy living environment, and excessive intake of nutrition. The proportion of obese populations in Korea is growing rapidly from 11.7% in 1995 to 29.4% in 2001 and 18.0% in 1995 to 32.6% in 2001 (Ministry of Health and Welfare, 2007).

Obesity is an abnormal increase in fat tissue due to excessive accumulation of energy in the body due to an imbalance between energy intake and consumption (Clinical Endocrinology 28: 675-689, 1998; Clinical Obesity (eds. Kopelman PG, Stock MJ). 248-89 (Blackwell Science, Oxford 1998) Clinically, men are considered obese when their body fat is 25% or more than 30% of their body weight, and clinically they are BMI (Body Mass Index) Is more than 30.0 is defined as obesity.

The causes of obesity include environmental and genetic factors such as high fat and high calorie diet, lack of exercise due to busy social environment, and endocrine disorders. Among them, about 50 to 70% of obesity is caused by environmental factors. It is known that the rest is due to genetic factors.

Energy in the body is stored in the form of triglycerides in fat cells, and when the body's energy source is depleted, the stored fat is broken down into free fatty acids and glycerol to be used as an energy source, but excessive intake of energy leads to differentiation of fat cells. Promotes and increases the amount of fat stored in the body is a direct cause of obesity.

Adipocytes are produced by differentiating from adipocytes, which include peroxisome proliferator-activated receptor γ (PPARγ), C / EBP family (CCAAT / enhancer binding proteins; C / EBRα, C / EBRβ, and C / EBRδ). ) ADD1 / SREBP1c (adipocyte determination differentiation factor 1) / ( a transcription factor known as sterol regulatory element binding protein 1c) that are known to play a pivotal role (Genes De 2000, 14 (11) 1293-1307). These transcription factors induce expression at different points in the differentiation process of adipocytes, and interact with each other to regulate the expression of several adipocyte-specific genes and gradually induce activation of adipogenesis and differentiation of adipocytes ( Physiol Rev 1998, 78 (3): 783-809; Annu Rev Biochem 2008, 77: 289-312; Genes Dev 1996, 10: 1096-1107).

Therefore, inhibiting the differentiation of adipocytes into adipocytes and / or inhibiting adipocyte accumulation in adipocytes, or inhibiting the expression of PPARγ, C / EBRα, and / or ADD1 / SREBP1c are antiobesity agents. Can be utilized. Republic of Korea Patent No.920648 discloses ginkgolide A or bilobalide as an active ingredient, Republic of Korea discloses ginsenoside-Rf or compound K (Compound K) as an active ingredient Patent No. 847252 and Korean Patent No. 576157, which discloses Oltipraz as an active ingredient, belong to this example.

The present invention has also been completed based on the fact that wheat bran extract has an activity of inhibiting differentiation and adipocyte accumulation into adipocytes and also has an expression inhibitory activity of PPARγ, C / EBRα, and ADD1 / SREBP1c.

An object of the present invention is to provide an obesity improver composition using wheat bran extract having the activity of inhibiting the differentiation and adipogenesis of adipocytes and inhibiting the expression of PPARγ, C / EBRα and ADD1 / SREBP1c.

Other objects or specific aspects of the present invention will be presented below.

The inventors of the present invention confirmed that the wheat bran extract obtained in the following examples inhibits the differentiation of adipocytes promoted by insulin into adipocytes and inhibits the accumulation of adipocytes. The activity of inhibiting the expression of PPARγ, C / EBRα and ADD1 / SREBP1c, which are centrally involved in differentiation, was identified.

The present invention is provided based on the experimental results, the obesity improver composition of the present invention is characterized in that it comprises wheat bran extract as an active ingredient.

In the present specification, the "wheat bran" means a by-product obtained in the process of milling wheat. These by-products usually consist of the rind and the embryo, except for the endosperm, which becomes flour.

In addition, in the present specification, regardless of the extraction method, the "extract" is obtained by immersing the wheat bran to be extracted by immersing it in water including distilled water, lower alcohols having 1 to 4 carbon atoms such as methanol, ethanol, butanol, or a mixed solvent thereof. Crude extracts and their crude extracts are understood as meaning including extracts fractionated with the solvents listed above. Regardless of the extraction method, as long as the extraction object is extracted through the step of immersing in the extraction solvent, the extraction method may be any method such as cooling, refluxing, heating, ultrasonic radiation, and the like. In the case of the fractionated extract, the crude extract is suspended in a specific solvent and mixed and fixed with a solvent of different polarity. The crude extract is adsorbed onto a column filled with hydrophobic resin, and the fraction obtained by using the solvent as a mobile phase is obtained. It is meant to include. Hydrophobic resins that can be used can be appropriately selected from among commercially available products such as Amberlite XAD-2 ™, Diaion HP-20 ™ used in the examples below. The meaning of the extract includes a concentrated liquid extract or solid extract from which the extraction solvent is removed.

In addition, in the present specification, the term "obesity" refers to a state in which fat tissue is abnormally increased, whether it is caused by genetic factors or obesity due to environmental factors, and obesity according to the classification of body mass index (BMI is 30.0 Above) and overweight (if your BMI is 25-30).

In addition, in the present specification, the "active ingredient" alone refers to a component that can exhibit the desired activity or itself can exhibit the activity with a carrier that is not active.

In addition, in the present specification, "improving obesity" is meant to include the reduction of body fat and / or weight loss, including the prevention of obesity, the treatment of obesity.

The obesity improver composition of the present invention may include the wheat bran extract as an active ingredient in any amount (effective amount) according to the use, formulation, blending purpose, etc., as long as it can exhibit the activity to improve obesity, the typical effective amount is the total weight of the composition It will be determined in the range of 0.001% to 99.990% by weight based on. Here, the "effective amount" refers to the amount of the active ingredient that can induce the effect of improving obesity. Such effective amounts can be determined experimentally within the range of ordinary skill in the art.

Subjects to which the compositions of the invention can be applied (prescribed) are mammals and humans, in particular humans.

In another aspect, the present invention relates to a diet composition comprising wheat bran extract as an active ingredient.

As used herein, "diet" is defined as a condition in which a weight condition is not obese or overweight, but for which a reduction in weight / body fat is desirable or necessary for cosmetic or health purposes. Usually, the composition for a diet of the present invention will be manufactured and used for use for normal beauty or health purposes.

In the composition for a diet of the present invention, with respect to the meaning of the wheat bran extract, the effective amount thereof, and the like as its active ingredient, the above-mentioned bar is effective as it relates to the obesity improving composition of the present invention.

In another aspect, the present invention relates to an insulin resistance improving composition comprising wheat bran extract as an active ingredient.

Obesity is one of several causes of insulin resistance. Although insulin resistance does not develop at high obesity, insulin resistance and obesity have a close correlation.

Adipocytes secrete the bioactive adipocytokine, which plays an important role in maintaining metabolic homeostasis. However, when adipocytokine is produced, the adipocytokine is produced and secreted. It is understood that insulin resistance is caused by the excess or underestimation resulting in a breakdown of the balance.

Among the adipocytokines, there are those that promote insulin sensitivity and cause insulin resistance. The former are adiponectin, leptin, and AMPK (AMP-dependent protein kinase), and the latter is TNF. -α, lL-6, a resistin, etc. are mentioned.

Fatty acid synthase (Fas) and adiocytes (adipocyte fatty acid-binding protein 2), which are expressed in adipocytes, are also known to cause insulin resistance.

Fas is initially expressed in the differentiation of adipocytes (J. Biol. Chem., 255, 4745-4750 (1980)) and palmitate from acetyl-CoA and malonyl-CoA It is an enzyme that produces (palmitate), and Fas stores excess energy in the form of triglycerides to cause obesity, while the triglycerides produced by it, palmitate, are reported to destroy the pancreatic β cells causing insulin resistance. (Proc. Natl. Acad. Sci. 95, 2498-2502 (1998)), aP2 is a potent in the development of insulin-resistant therapies due to the low incidence of insulin resistance in mice lacking the gene and the aP2 inhibitors that decrease insulin resistance. It is proposed as a target protein (Nature 447, 959-965 (21 July 2007)).

The present inventors consider that the bran extract, an active ingredient of the obesity improver composition of the present invention, can be utilized as an insulin resistance improving agent, resulting in insulin resistance in adipocytes treated with wheat bran extract, Resistine, and Fas and aP2. It was confirmed that their expression is significantly suppressed. These experimental results show that wheat bran extract can be useful as an anti-obesity enhancer as well as an obesity improver.

In the present specification, the term "insulin resistance" refers to a state in which an individual such as a cell, an organ, or a human body needs more than a usual amount of insulin for normal metabolic activity, that is, an insufficiency state of insulin in which insulin's action force is reduced. , Insulin-independent diabetes or type 2 diabetes. Diabetes is an insulin-dependent diabetes mellitus (type 1 diabetes) that requires insulin for its treatment as a result of the destruction of β-cells in the pancreas, and insulin-independent diabetes mellitus, which does not require insulin for its treatment. Type 2 diabetes), insulin resistance, insulin independent diabetes and type 2 diabetes are taken in the same sense in the art.

In the insulin resistance improver composition of the present invention, the meaning of wheat bran extract as an effective ingredient, its effective amount, and the like, as described above with respect to the obesity improver composition of the present invention, is effective as it is.

The composition of this invention can be grasped | ascertained as a food composition in another specific aspect.

The food composition of the present invention may be prepared as a dietary supplement, a special nutritional supplement, a functional beverage, and the like.

The food composition of the present invention may include sweeteners, flavoring agents, bioactive ingredients, minerals, etc. in addition to the active ingredients.

Sweeteners may be used in amounts that give the food a suitable sweet taste, and may be natural or synthetic. Preferably, natural sweeteners are used. Examples of natural sweeteners include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose and maltose.

Flavoring agents can be used to enhance the taste or aroma, both natural and synthetic. Preferably, a natural one is used. When using natural ones, the purpose of nutritional fortification can be performed in addition to the flavor. The natural flavor may be obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, and the like, or may be obtained from green tea leaves, round leaves, jujube leaves, cinnamon, chrysanthemum leaves, jasmine and the like. Also, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, banks and the like can be used. The natural flavoring agent may be a liquid concentrate or a solid form of extract. In some cases, synthetic flavoring agents may be used, and synthetic flavoring agents may include esters, alcohols, aldehydes, terpenes, and the like.

As the physiologically active substance, catechins such as catechin, epicatechin, gallocatechin, epigallocatechin, vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine, riboflavin, and the like can be used.

As minerals, calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium, zinc and the like can be used.

In addition, the food composition of the present invention may contain a preservative, an emulsifier, an acidulant, a thickener, and the like, in addition to the sweetener.

Such preservatives, emulsifiers and the like are preferably added and used in very small amounts as long as the use to which they are added can be achieved. By trace amount is meant numerically expressed in the range of 0.0005% to about 0.5% by weight based on the total weight of the food composition.

Examples of preservatives that can be used include sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate, EDTA (ethylenediaminetetraacetic acid), and the like.

Emulsifiers that can be used include acacia gum, carboxymethylcellulose, xanthan gum, pectin and the like.

Examples of acidulants that may be used include lead acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, phosphoric acid, and the like. Such acidulant may be added so that the food composition is at an appropriate acidity for the purpose of inhibiting the growth of microorganisms in addition to the purpose of enhancing taste.

Thickeners that can be used include suspending implements, sedimenters, gel formers, swelling agents and the like.

In addition, the food composition of the present invention is already known to have an activity for improving obesity or improving liver function in order to improve flavor and palatability, to enhance or enhance its functionality, or to add other functionalities (such as fatty liver improving activity and hangover relieving activity). It may include powders or extracts derived from natural products of, ointment powder or extracts, bean sprouts powder or extracts, shellfish powder or extracts, oyster powder or extracts, parsley powder or extracts, radish juice or extracts, cucumber juice or extracts, leek Juice or extract, spinach juice or extract, lotus root juice or extract, sesame juice or extract, pine needle juice or extract, ginseng juice or extract, birch powder or extract, licorice powder or extract, brownish powder or extract, brown root powder or extract, Sine powder or extract, gourd powder or extract, ginger powder Silver extract, jujube powder or extract, phosphorus powder or extract, spermatozoon powder or extract, hydrophobic powder or extract, white extract powder or extract, spirit powder or extract, dermis (peel of tangerine) powder or extract, wolfberry powder or extract, Green tea powder or extract, Schisandra chinensis powder or extract, Hawthorn extract, Chichi extract, Root extract, Cinnamon extract, Decusinol and the like can be exemplified. The meaning of the extract in the above is as described above with respect to wheat bran extract. Such extracts may be obtained by mixing the extraction objects.

The composition of the present invention can be used as a pharmaceutical composition in a specific embodiment.

The pharmaceutical composition of the present invention includes oral formulations (tablets, suspensions, granules, emulsions, capsules, syrups, etc.), parenteral formulations (sterile), in addition to bran extract, which is an active substance, in addition to pharmaceutically acceptable carriers, excipients, and the like. Aqueous or oily suspensions for injection), topical formulations (solutions, creams, ointments, gels, lotions, patches) and the like.

As used herein, "pharmaceutically acceptable" means that the subject of application (prescription) does not have more toxicity (adequately low toxicity) to which the subject of application (prescription) is adaptable without inhibiting the activity of the active ingredient.

Examples of pharmaceutically acceptable carriers include lactose, glucose, sucrose, starch (such as corn starch, potato starch, etc.), cellulose, derivatives thereof (such as sodium carboxymethyl cellulose, ethylcellulose, etc.) malt, gelatin, talc, solids Lubricants (e.g. stearic acid, magnesium stearate, etc.), calcium sulfate, vegetable oils (e.g. peanut oil, cottonseed oil, sesame oil, olive oil, etc.), polyols (e.g. propylene glycol, glycerin, etc.), alginic acid, emulsifiers (e.g. TWEENS), wetting agents (e.g. Sodium lauryl sulfate), colorants, flavoring agents, tableting agents, stabilizers, antioxidants, preservatives, water, saline, phosphate buffer solutions and the like. The carrier may be selected from one or more of suitable pharmaceutical formulations according to the formulation of the pharmaceutical composition of the present invention.

Excipients may be selected and used according to the formulation of the pharmaceutical composition of the present invention, for example, when the pharmaceutical composition of the present invention is prepared with an aqueous suspending agent, suitable excipients are sodium carboxymethyl cellulose, methyl cellulose, hydropropylmethylcellulose And suspending agents and dispersing agents such as sodium alginate and polyvinylpyrrolidone. Suitable excipients when prepared from injection solutions include Ringer's solution, isotonic sodium chloride, and the like.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and in some cases, can be administered topically.

The daily dose of the pharmaceutical composition of the present invention is usually 0.001 to 150 mg / kg body weight, and may be administered once or several times. However, since the dosage of the pharmaceutical composition of the present invention is determined in view of various related factors such as the route of administration, the age, sex, weight of the patient, the severity of the patient and the like, the dosage may limit the scope of the present invention in any aspect. It should not be understood as.

As described above, the present invention can provide an obesity improving composition. In addition, the present invention can provide an insulin resistance improving agent composition. Obesity improver composition and insulin improver composition of the present invention can be commercialized as a functional food, drugs and the like.

Hereinafter, the present invention will be described with reference to Examples and Experimental Examples. However, the scope of the present invention is not limited to these examples and experimental examples.

< Example > Push  Preparation of Extract

200 g of Red-dog was placed in 2 L of water and extracted with hot water for 6 hours. The hot water extract was filtered and the filtrate was placed in a column filled with Diaion HP-20 resin, and 100% ethanol and water were used as the mobile phase, and the sample passed through 100% ethanol was called Red-dog A. Red-dog B was used for the experiment.

< Experimental Example > Obesity improvement activity experiment and insulin resistance improvement activity experiment

< Experimental Example  1> Obesity Improvement Active Experiment

Experimental Example 1-1 Evaluation of Differentiation Inhibitory Activity of Preadipocytes into Adipocytes

3T3-L1, a mouse precursor cell, was added with 10% BCS DMEM medium and cultured at 37 ° C. and 5% CO ₂ .

After dispensing 3T3-L1 progenitor cells with a cell number of ⁵ × 10 ⁴ / well in a 24 well plate, 100% confluency was maintained for 2 more days. Preadipocytes induced adipocyte differentiation for 2 days with 10% FBS DMEM medium containing MDI (0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 uM dexamethasone, 1 ug / ml insulin). After hours, the cells were incubated for 2 days with 10% FBS DMEM containing 1 ug / ml insulin. It was then replaced with 10% FBS DMEM culture for 4 days every 2 days. During induction of adipocyte differentiation, Red-dog A and B were treated in each culture at concentrations of 25, 50, and 100 ug / ml, and the degree of adipocyte differentiation was observed on day 8, when the differentiation was completed. The degree of adipocyte differentiation was determined primarily by microscopy through Oil Red O staining, and the degree of adipocyte staining was measured by the amount of differentiated fat of cells at 510 nm absorbance.

Example The results of quantitative analysis of Oil Red O staining and fat amount of each sample are shown in <Figure 1>. Referring to <Figure 1>, all of the samples of the Examples showed concentration-dependent proliferation inhibitory activity of adipocytes into adipocytes. It can be seen that it has.

<Experimental Example 1-2> inhibition promotes transcription activity of PPAR γ evaluation

Renilla is a recombinant vector and control reporter obtained by inserting the PPARγ response element (PPRE) gene and the PPARγ gene into the pGL3-basic luciferase expression vector (Promega). pRL-SV-40 Pramide (Promega) containing luciferase cDNA was co-transfected into HEK 293T cells. After expressing the genes for one day, the cells were treated with 50, 100 ug / ml of the sample alone or with Pugγ-inducing substance 4ug / ml troglitazone for 24 hours, and then luciferase expression of the PPARγ transcriptional activity by the sample. Observed through the intensity.

EXAMPLES The effect on the PPARγ transcriptional activity of each sample is shown quantitatively in FIG. 2, but it can be seen that all the samples of the Example inhibit PPARγ transcriptional promoting activity in a concentration-dependent manner.

Experimental Example 1-3 Evaluation of Expression Inhibitory Activity of Transcription Factors Involved in Adipocyte Differentiation

Experimental Example 1-3-1 Evaluation of Expression Inhibitory Activity at the Gene Level

In the stage of differentiation into adipocytes, expression of PPARγ, C / EBRα and ADD1 / SREBP1c is increased.

In the same manner as in <Experimental Example 1-1>, after treating Red-dog A and B at a concentration of 50 and 100 ug / ml, the expression of PPARγ, C / EBRα and ADD1 / SREBP1c by differentiating adipocytes for 8 days. Was confirmed by Real-time PCR. After washing the differentiated 3T3-L1 cells with PBS twice for 8 days, cell pellets were collected and RNA was isolated by RNA prep kit (Qiagen). After synthesis of cDNA using 1 ug of the extracted RNA, real-time PCR was performed using SYBR green (Takara) and the primers shown in [Table 1], and the control gene was GAPDH. PCR composition was 5ul by diluting cDNA synthesized with 1ug of RNA to 1/50 with distilled water, and 0.5ul for 10 pmole primer, 10ul for 2X SYBR green, and 4ul for distilled water to adjust the total volum to 20ul. In the real-time PCR cycle, the initial degeneration was 95 ℃ 30 seconds, the degeneration was 95 ℃ 5 seconds, the annealing was 60 ℃ 15 seconds, the extension reaction was 72 ℃ 10 seconds, and the melting curve started at 55 ℃ and 95 ℃. At the end of the test, the desired fluorescence value was detected by increasing 80 ° C by 0.5 ° C (quantitative fluorescence signal was used by Bio-Rad MyiQ program).

TABLE 1

primer

Gene name Forward primer Reverse primer GAPDH GAGTCAACGGATTTGGTCGT (SEQ ID NO: 1) GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 2) PPARγ CGCTGATGCACTGCCTATGA (SEQ ID NO: 3) AGAGGTCCACAGAGCTGATTCC (SEQ ID NO: 4) C / EBPa AGGTGCTGGAGTTGACCAGT (SEQ ID NO: 5) CAGCCTAGAGATCCAGCGAC (SEQ ID NO: 6) ADD1 / SREBP1c CAAACTGCCCATCCACCGAC (SEQ ID NO: 7) TGCCTCCTCCACTGCCACAA (SEQ ID NO: 8)

The results are shown in FIGS. 3A to 3C. 3A to 3C show that each sample of the example inhibits the expression of PPARγ, C / EBRα and ADD1 / SREBP1c in a concentration-dependent manner.

Experimental Example 1-3-2 Evaluation of Expression Inhibitory Activity at the Protein Level

After treatment with 3T3-L1 cells at two-day intervals as in the adipocyte differentiation method, cells were washed twice with PBS and RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM sodium chloride, 1% NP-40, Cells were lysed using 0.5% sodium dexycholate, 0.1% sodium dodecyl sulfate, protease inhibitor). Protein was extracted and quantified by centrifugation at 13000 rpm for 30 minutes and electrophoresed using 8% SDS-PAGE gel. Electrophoretic proteins were transferred to the membrane and blocked with TBST containing 5% skim milk. After reacting with primary antibodies (PPARγ, C / EBPα) (SantaCruz) and secondary antibodies (SantaCruz), the expression levels of PPARγ and C / EBPα proteins were compared with the expression levels of β-actin through ECL (Thermo scientific). Evaluated.

The results are shown in FIG. 4. Similar to the results of FIG. 3, it can be seen that each sample of the example inhibits the expression of PPARγ and C / EBRα in a concentration-dependent manner.

< Experimental Example  2> Insulin Resistance Improvement Activity Experiment

In order to evaluate the potential of the extract of the Example as an insulin resistance improving agent in <Experimental Example 1> using the primers of the following [Table 2] by the same method in the expression level of the resistin, aP2 and Fas in the differentiated fat cells for 8 days Quantitative evaluation.

TABLE 2

primer

Gene name Forward primer Reverse primer GAPDH GAGTCAACGGATTTGGTCGT (SEQ ID NO: 9) GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 10) aP2 CATGGCCAAGCCCAACAT (SEQ ID NO: 11) CGCCCAGTTTGAAGGAAATC (SEQ ID NO: 12) Resistin TCAACTCCCTGTTTCCAAATGC (SEQ ID NO: 13) TCTTCACGAATGTCCCACGA (SEQ ID NO: 14) Fas CTGAGATCCCAGCACTTCTTGA (SEQ ID NO: 15) GCCTCCGAAGCCAAATGAG (SEQ ID NO: 16)

The results are shown in FIGS. 5A to 5C, but it can be seen that the samples of the examples inhibit the expression of resistin, aP2 and Fas in a concentration-dependent manner.

1 is a result showing that wheat bran extract has a fat accumulation inhibitory activity of fat cells in a concentration-dependent manner.

Figure 2 shows that wheat bran extract inhibits PPARγ transcriptional activity in a concentration-dependent manner.

Figure 3 shows that wheat bran extract inhibits the expression of PPARγ, C / EBRα and ADD1 / SREBP1c at the gene level in a concentration-dependent manner.

4 shows that wheat bran extract inhibits the expression of PPARγ and C / EBRα at a protein level in a concentration-dependent manner.

5 is a result showing that wheat bran extract inhibits the expression of resistin, aP2 and Fas in a concentration-dependent manner.

Claims (12)

Obesity improver composition comprising wheat bran extract as an active ingredient. The method of claim 1, The wheat bran extract is an obesity improving composition, characterized in that one of the following (I) to (III) (I) an extract obtained by extracting wheat bran by immersion in water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof; (II) an extract obtained by fractionating the extract of (I) using two or more solvents among water, a lower alcohol having 1 to 4 carbon atoms, and a mixed solvent thereof; and (III) An extract obtained by extracting wheat bran by immersion in water, ethanol or a mixed solvent thereof. The method according to claim 1 or 2, The composition is an obesity improver composition, characterized in that the food composition. The method according to claim 1 or 2, The composition is an obesity improver composition, characterized in that the pharmaceutical composition. Diet composition comprising wheat bran extract as an active ingredient. The method of claim 5, The wheat bran extract is a dietary composition, characterized in that one of the following (I) to (III) (I) an extract obtained by extracting wheat bran by immersion in water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof; (II) an extract obtained by fractionating the extract of (I) using two or more solvents among water, a lower alcohol having 1 to 4 carbon atoms, and a mixed solvent thereof; and (III) An extract obtained by extracting wheat bran by immersion in water, ethanol or a mixed solvent thereof. The method according to claim 5 or 6, The composition is a composition for a diet, characterized in that the food composition. The method according to claim 5 or 6, The composition is a composition for a diet, characterized in that the pharmaceutical composition. Insulin resistance improving composition comprising wheat bran extract as an active ingredient. 10. The method of claim 9, The wheat bran extract is an insulin resistance improving agent composition, characterized in that one of the following (I) to (III) (I) an extract obtained by extracting wheat bran by immersion in water, a lower alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof; (II) an extract obtained by fractionating the extract of (I) using two or more solvents among water, a lower alcohol having 1 to 4 carbon atoms, and a mixed solvent thereof; and (III) An extract obtained by extracting wheat bran by immersion in water, ethanol or a mixed solvent thereof. 11. The method according to claim 9 or 10, The composition is an insulin resistance improver composition, characterized in that the food composition. 11. The method according to claim 9 or 10, The composition is an insulin resistance improver composition, characterized in that the pharmaceutical composition.

Images