KR20110053103A - Reporter system comprising dual promoter and methods for analyzing the differentiation of embryonic stem cells into cardiac lineage - Google Patents

Abstract

PURPOSE: A reporter system for detecting single or double promoter transcription activity is provided to detect differentiation from stem cells to cardiac lineage. CONSTITUTION: A composition for detecting promoter activity to detect differentiation from embryonic stem cells to cardiomyocytes contains an agent for measuring Nkx2.5 promoter at differentiation initial stage and MLC2v promoter at differentiation later stage. The embryonic stem cell is derived from human. The agent for measuring promoter activity contains: Nkx2.5 promoter; a reporter gene which is operatively linked to Nkx2.5 promoter; MLC2v promoter; and a reporter gene which is operatively linked to MLC2v promoter.

Description

Reporter system comprising dual promoter and method for detecting myocardial system differentiation of embryonic stem cells using the same {reporter system comprising dual promoter and methods for analyzing the differentiation of embryonic stem cells into cardiac lineage}

The present invention relates to a method for detecting differentiation from multipotent stem cells to cardiac lineage cells using a reporter system for detecting single or dual promoter transcriptional activity using an Nkx2.5 promoter and an MLC2V promoter. A composition for detecting promoter activity, a kit for detecting promoter activity comprising the composition, a differentiation regulator for regulating the promoter activity, and a method for searching for the differentiation control candidate substance.

Heart disease is one of the most serious diseases in the world, both east and west. About one in every five people in the United States reported heart disease (National Health and Nutrition Examination Survey III, 1988-94, Center of Disease Control and the American Heart Association). It is ranked second in the cause. Although the heart is the most central organ in the supply and circulation of blood to sustain an individual's life, the cardiomyocytes required for its recovery or regeneration lose their dividing function after birth. Therefore, cardiomyocyte abnormalities, such as myocardial infarction, will result in fatal outcomes or death.

Recently, the potential utilization of differentiation-derived cardiomyocytes from human embryonic stem cells and human embryonic stem cells has emerged to prevent and treat heart-related diseases. Human embryonic stem cell-derived cardiomyocytes are an important resource for the development of cell therapies and new drugs for the treatment of heart disease. Various researches are being conducted to obtain cardiomyocytes with excellent qualitative and quantitative performance using the characteristics of human embryonic stem cells. There is a situation.

Specifically, a variety of methods have been developed to induce cardiomyocytes from multipotent stem cells. For example, mouse embryonic stem cells (mESCs) are inhibited from differentiation of leukemia inhibitory factor (LIF). Suspension culture under factor-deficient culture conditions, followed by culturing in a structure similar to that of an early embryo called an embryoid body (EB), followed by continuous culture of EB in a suspended or adherent state. Cells are known to be generated (Methods in Molecular Medicine, 140, 1543-1894).

In addition, it has been reported that induction of differentiation into cardiomyocytes is possible by controlling the culture conditions of human embryonic stem cells (hESCs) (Kehat et al., J. Clin. Invest. 108: 407, 2001; Klug et al., J. Clin. Invest. 98: 216, 1996; Chunhui et al., 91: 508, 2002; Jang J et al., Stem Cells. 11: 2782-90. 2008; Rust W et al. , Regen Med. 4 (2): 225-37, 2009.). According to these studies, not only differentiation-induced cardiomyocytes from HESCs have self-supporting pulsatile functions, but also myosin heavy chain / light chain, a-actinin, troponin I, atrial diuretic peptide (artial) Myocardial-specific proteins and gene expression such as natriuretic peptide ( ANP ), GATA-4, Nkx2.5, MEF-2c, etc. are induced and maintain the traits of immature cardiomyocytes of the immature stage by microanatomical observation and electrophysiological interpretation. Was confirmed.

On the other hand, various methods of inducing differentiation into cardiomyocytes have been proposed as described above. However, in order to apply cardiomyocytes derived from pluripotent stem cells to cell transplantation treatment or new drug development, there are still problems to be solved. In particular, current differentiation induction technology is that differentiation is induced in the form of a mixture of other types of cells such as hematopoietic, vascular, nervous, and intestinal cells in addition to cardiomyocytes. The percentage of cardiomyocytes in these differentiated cells is not very high and accounts for only 5-20% of the total (Passier et al. STEM CELLS, 23: 772-780, 2005). Therefore, there is an urgent need for the development of technology capable of securing high-purity cardiomyocytes by increasing differentiation induction efficiency, and for this purpose, it is very important to discover new differentiation factors or substances with excellent performance.

The results of the previous studies show that in most cases, when differentiation molecular targets and differentiation-inducing substances having positive activity in human embryonic stem cells are used in human embryonic stem cells, they have negative or active activity. In addition, the degree of activity is very low, the value of use in technology development for utilizing human embryonic stem cells is low. Therefore, there is a growing demand for the development of technology capable of qualitatively and quantitatively analyzing the state and extent of neural differentiation induction of human embryonic stem cells.

Therefore, the present inventors have grasped the types and aspects of specific proteins expressed according to differentiation without artificial manipulation when multipotent cells, specifically human embryonic stem cells, naturally differentiate into cardiomyocytes, Efforts have been made to determine the differentiation and timing of differentiation. As a result of differentiation from human embryonic stem cells to cardiomyocytes, transcription of downstream genes including the Nkx2.5 promoter is activated at the early stage of differentiation. It was confirmed that transcription of the downstream reporter gene including the MLC2v promoter is activated. Therefore, when using them as markers using the activity of the two promoters, it is confirmed that the differentiation into cardiomyocytes in the form of excellent performance in terms of sensitivity and specificity, as well as detect specific expression times. This invention was completed.

An object of the present invention is to provide a composition for detecting promoter activity for detecting whether differentiation from embryonic stem cells to cardiomyocytes using a reporter system for detecting single or double promoter transcriptional activity using Nkx2.5 promoter and MLC2V promoter. It is.

Another object of the present invention is to provide an embryonic stem cell comprising the composition.

Still another object of the present invention is to provide a method for detecting the differentiation of embryonic stem cells from myocardial cells by checking the activity levels of the Nkx2.5 promoter and the MLC2v promoter.

It is yet another object of the present invention to provide a method of controlling differentiation from embryonic stem cells to cardiomyocytes by increasing or decreasing the activity of the Nkx2.5 promoter and the MLC2v promoter.

Another object of the present invention is to process a candidate substance expected to regulate differentiation into myocardial cells in embryonic stem cells; And measuring the transcriptional activity of the Nkx2.5 promoter and MLC2v promoter downstream genes or the expression level of the protein encoded by the genes in the embryonic stem cells, candidate cells for controlling differentiation from embryonic stem cells to cardiomyocytes. And a method of searching for molecular targets.

As one embodiment for achieving the above object, the present invention comprises a composition for measuring the activity of the Nkx2.5 promoter and MLC2v promoter, composition for detecting promoter activity for detecting whether differentiation from embryonic stem cells to cardiomyocytes It is about.

The cells differentiated into myocardial system cells of the present invention may be multipotent or pluripotent cells, and are preferably pluripotent stem cells. More preferably, pluripotent cells may be embryonic stem cells (ESCs), which include both wild-type embryonic stem cells or genetically modified embryonic stem cells. In addition, the multipotent or pluripotent cells of the present invention may be derived from humans, primates, rodents, birds, etc., specifically, humans, monkeys, pigs, horses, cattle (cows), sheep (sheeps), dogs (cats), mice (mice), rabbits (rabbits) and the like can be derived from all animals, preferably human origin.

Nucleic acid sequences that can be used to detect differentiation into cardiomyocytes of the present invention are nucleic acids that significantly increase activity in cells differentiated from embryonic stem cells to cardiomyocytes, and are particularly specific according to specific differentiation times. Nucleic acids whose activity is significantly increased. Preferably it is Nkx2.5 promoter and MLC2v promoter, said promoter sequence can be easily obtained through NCBI or through a gene bank known in the art. Specifically, the human Nkx2.5 promoter is a promoter region of Nkx2.5, a gene named NK2 transcription factor related, locus 5 (Drosophila), and the genes are CSX, CSX1, CHNG5, NKX2E, NKX2.5, and NKX4. Also called -1 or NKX2-5 . The Nkx2.5 gene and its promoter are located on chromosome 5q34 and the gene sequence is defined as NC_000005.8.

The MLC2v promoter is the promoter region of a gene, also called CMH10, DKFZp779C0562, MYL2 or MLC2, and MLC2 stands for myosin, light chain 2, regulatory, cardiac, slow, and cardiac myosin beta heavy chain It is known to encode a regulatory light chain that binds to. MLC2v and its promoter are located at 12q24.11 on the chromosome and the gene sequence is defined as NC_000012.10.

The promoter used in the present invention includes a functional equivalent of the nucleic acid molecule constituting the promoter, and some sequences of nucleotides are deleted, substituted, inserted, or these by artificial modification. Variants may be modified by combination of or functional fragments of said polynucleotides that perform the same function.

In addition, the promoter downstream gene of the present invention is a gene operably linked to each of the Nkx2.5 promoter and the MLC2v promoter, as long as the gene capable of measuring the activity of the promoter can be used without limitation, and as long as the activity is maintained. Sequences include all modified, deleted substitutions, and inserted genes. Preferably the gene is a reporter gene.

In addition, the protein encoded by the promoter of the present invention is a polypeptide encoded by the gene located downstream of the promoter of the present invention, which can be used to determine whether differentiation from embryonic stem cells to cardiomyocytes. Amino acid residues of one native amino acid sequence may be substituted, deleted, and / or added with other residues in various modified forms. Preferably the protein is a reporter protein.

Nkx2.5 and MLC2v are known as myocardial-specific marker genes and have been reported to be used in some myocardial differentiation studies using each of them. However, there is no known method of detecting differentiation or detecting specific timing of differentiation by simultaneously using the activity of the promoter regions of these two genes. Unlike the method for monitoring cardiomyocyte differentiation using only a single promoter of any one of the above genes, the present invention provides a differentiation detection method (myocardial myocardium from embryonic stem cells) which can be achieved by using two promoters of the present invention simultaneously. Information on the degree of differentiation of the differentiation into cells and whether the differentiated cells are early or late).

In the present invention, as a result of the efforts to provide a single assay system for human embryonic stem cell myocardial differentiation significantly improved in use and effects compared with the prior art, multipotent stem cells, specifically, early and late myocardial differentiation of human embryonic stem cells We have successfully developed a dual promoter reporter system that can explore the stages, and each of the early differentiation marker gene Nkx2.5 promoter and the late differentiation marker gene MLC2v promoter increases the activity of embryonic stem cells to differentiate into cardiomyocytes. In particular, it was confirmed that the activity of the two promoters increased in a specific step in the differentiation into myocardial cells. By measuring the expression of genes operably linked to the two promoters and downstream thereof of the present invention, the inventors have found that they can be used as early markers and late markers in differentiation into cardiomyocytes. Confirmed. In particular, this effect, which can be judged with high sensitivity, accuracy, and specificity in determining the differentiation into myocardial cells, is more effective when each of the two markers is used together. Specifically, in the process of differentiation from stem cells to cardiomyocytes, the current degree of differentiation can be determined according to the activity of each of the promoters, and the degree of differentiation can be used to discriminate cardiomyocytes according to differentiation time. Can be. The Nkx2.5 promoter may be used as an early marker since its activity is initially increased in myocardial cell differentiation. Therefore, when differentiation proceeds from embryonic stem cells using appropriate culture conditions and culture methods, it is possible to determine whether the differentiation into myocardial progenitor cells has progressed by checking whether the Nkx2.5 promoter activity is increased in the cells. In addition, when the activity of the Nkx2.5 promoter was increased but the activity of the MLC2v promoter was not increased, it was directly confirmed that the cells differentiated to the early stages of cardiomyocytes (myocardial progenitor cells), but not to the late stages. have. After confirming the increased activity of the MLC2v promoter it can be determined that the differentiation of the cells to the cardiomyocytes. Preferably, the present invention can be used as a measure for determining successful differentiation of cardiomyocytes from pluripotent cells by confirming the activity of the Nkx2.5 promoter as an early marker and the MLC2v promoter as a late marker. As it progresses, the differentiation stage can be specifically determined, and thus can be used as an effective marker for identifying, separating and using cells according to differentiation time and state.

"Agent measuring the Nkx2.5 promoter and a activity of MLC2v promoter" may be used without preparation is capable of measuring the activity of Nkx2.5 promoter and promoter MLC2v limited, preferably the agents of the invention a promoter of the invention Is a reporter gene operably linked with. The Nkx2.5 promoter and a reporter gene located downstream thereof, and the MLC2v promoter and a reporter gene located downstream thereof may be prepared in the form of a structure capable of delivering a genome to a cell and may be transformed into an embryonic stem cell. And preferably the structure is a vector. The vector of the present invention can be produced in a suitable form according to the needs of those skilled in the art, and the two promoters and the downstream genes can be prepared in one vector or in one vector.

As used herein, the term "vector" refers to a gene construct, which is an expression vector capable of expressing a protein of interest in a suitable host cell, and which contains essential regulatory elements operably linked to express the gene insert.

"Operably linked" of the present invention means that when the gene is linked downstream of the promoter sequence of the present invention, the gene is linked in a form capable of expression, and any sequence is added to achieve the above object. It may be included as. Examples of any of the above sequences include an operator sequence, a sequence for in frame, and a cis element, such as an enhancer, and a splicing signal, in addition to the gene of the present invention. (splicing signal), poly A addition signal (poly A addition signal), a selection marker (selection marker), a ribosome binding sequence (ribosome binding sequence, SD sequence) and the like may be further included. As examples of selection markers, chloramphenicol resistance genes, ampicillin resistance genes, dihydrofolate reductase, neomycin resistance genes, and the like may be used, but additional components for operably linked by the above examples are limited. It is not.

Preferably, the vector of the present invention comprises a reporter gene downstream of each of the Nkx2.5 promoter and the MLC2v promoter, and more preferably, the vector is a vector composed of Nkx2.5 promoter-EGFP. Nkx2.5- EGFP) and may be represented by a cleavage map (pLenti6- MLC2v- DsRed) on the right side of FIG. 2A as a vector composed of MLC2v promoter-DsRed.

In addition, the reporter gene can be used without limitation as long as the gene is expressed according to the promoter activity of the upstream (upstream) to confirm its expression in the cell, and preferably, the reporter gene is any reporter gene capable of color development. It includes. Examples of reporter genes include green fluorescent protein (GFP), modified green fluorescent protein, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), and enhanced red fluorescent protein. (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), and enhanced indigo fluorescent protein ( ECFP) and Renila luciferase, red fluorescent protein (DsRed) and the like, but are not limited to the above examples.

In the present invention, specifically, the reporter gene that can detect the expression of the two promoters and each of the promoters (downstream) of the present invention by cloning, and transfected the embryonic stem cells as a result, In the early stage and late stage of cardiomyocyte differentiation, it was confirmed that each of the two reporter genes showed fluorescence. In addition, it was confirmed that the overexpression activity of the promoter was increased in proportion to the amount of Nkx2.5 and MLC2v expression in the cell, and it was confirmed that the expression of Nkx2.5 and MLC2v in the cell was increased, and the expression level was known as cardiomyocytes. Considering the level of increased expression of proteins expressed in cells ( Nkx2.5, MLC2A, α-MHC, β-MHC, Isl1, Tbx20, ANP, GATA4 and MEF2C ), the activity measurement of the two promoters of the present invention Not only can be used as an effective marker for detecting differentiation from embryonic stem cells to cardiomyocytes, it can be seen that it can be used as a marker for determining the specific differentiation time.

In addition, the effect of using the two promoters and genes operatively linked to the downstream of each of the promoters, higher sensitivity in determining the differentiation into cardiomyocytes than when using only one promoter and the downstream genes, It can have accuracy and specificity, and given the specific increase in activity of each promoter during the early and late stages of differentiation, it can be used as an effective marker for studying or industrially using information based on specific differentiation times. have. In other words, by using the Nkx2.5 promoter and MLC2v promoter as a combination marker (or double marker) at the same time, it was confirmed that high specificity and accuracy can be obtained, detection of differentiation time, and detection efficiency can be improved.

As another aspect, the present invention relates to an embryonic stem cell comprising the composition. In more detail, the embryonic stem cells of the present invention can be prepared by transforming a vector comprising a Nkx2.5 promoter and an MLC2v promoter, and a reporter gene operably linked downstream of each promoter.

The method of introducing a vector of the present invention into an embryonic stem cell can be used without limitation methods known in the art, for example, methods using calcium chloride (CaCl ₂ ) and heat shock, electroporation ( electroporation, particle gun bombardment, silicon carbide whiskers, sonication, precipitation using PEG (polyethylenglycol), natural introduction methods, etc. The method of introducing the vector of the present invention is not limited.

As another aspect, the present invention relates to a method for detecting the differentiation from embryonic stem cells to cardiomyocytes by confirming the activity levels of Nkx2.5 promoter and MLC2v promoter.

Confirmation of the activity level of the promoter of the present invention can be used without limitation known methods for measuring the expression level of a particular gene, preferably immunostaining or flow cytometry analysis of the expression level of the downstream gene by the promoter activity of the marker gene The level of expression of genes can be measured using methods, or reverse transcriptase polymerase chain reaction (RT-PCR) or real time polymerase chain reaction (Real time PCR). In addition, confirming the expression level of the protein encoded by the downstream genes of the promoter of the present invention, if the downstream gene is a reporter gene with color development, the expression of the gene, such as the measurement of fluorescence intensity and the amount of color development is measured This can be confirmed by.

Preferably, the method comprises the steps of: (a) inducing differentiation from embryonic stem cells to cardiomyocytes using differentiation-inducing substances; (b) obtaining a nucleic acid sample or protein sample of embryonic stem cells and stem cells which are expected to have differentiation induced; (c) measuring the mRNA transcription amount of the Nkx2.5 promoter and MLC2v promoter downstream gene or the expression amount of the protein encoded by the gene in the nucleic acid sample or protein sample; And (d) determining that embryonic stem cells have been differentiated into cardiomyocytes when the amount of transcription of the gene or the expression level of the protein of step (c) is increased. Whether to induce differentiation into cells, stages of differentiation, and degree of differentiation can be determined.

Specifically, the step of inducing differentiation into cardiomyocytes in step (a) may be used without limitation the method of differentiation into cardiomyocytes used in the art, by adding a suitable differentiation inducing substance according to the choice of those skilled in the art and culture conditions By setting. Preferably the method is cultured so that embryonic stem cells to form EB using a cardiomyocyte differentiation medium (CDM), and then transferred to CM medium again to induce differentiation into cardiomyocytes, but Differentiation induction method is not limited by the method. As such, when EB is initially induced using CDM medium, differentiation into cardiomyocytes is induced at an early stage , resulting in fluorescence (color development) due to Nkx2.5 promoter activity, which is an early marker (about 2 to 2). Day 5), and then cultured using CDM medium, as a result of continuous differentiation into cardiomyocytes, fluorescence due to MLC2v promoter activity, which is a late marker 3 to 4 weeks after culture, is shown.

In the step (c), the mRNA transcription amount measurement of the gene may be performed by measuring the transcription level of the downstream gene of the promoter of the present invention, polymerase chain reaction (PCR), real time polymerase chain reaction (Real time PCR) And electrophoresis. Preferably, the downstream genes of the present invention can be found to significantly increase the level of transcription specifically in cells differentiated into cardiomyocytes. In a specific embodiment of the present invention, the expression level of the marker gene of the present invention may be identified. In order to perform RT-PCR, the cardiomyocyte-specific marker genes ( Nkx2.5, MLC2A, α-MHC, β-MHC, Isl1, Tbx20, ANP, GATA4 and MEF2C ) of the present invention were differentiated into cardiomyocytes. Only specific increase in cells was confirmed.

In addition, the method for detecting at the protein level the differentiation of embryonic stem cells from the embryonic stem cells of the present invention can be confirmed by the expression of genes operatively linked downstream of the promoter of the present invention. In particular, when the downstream gene is a gene involved in color development and fluorescence as a reporter gene, methods such as fluorescence microscopy and flow cytometric analysis can be used.

In addition, when the degree of color development is increased by the reporter gene, in order to confirm whether the corresponding cells have successfully differentiated into cardiomyocytes, it is possible to further confirm whether the expression of proteins with increased expression by differentiating the original cells into cardiomyocytes. have. In a preferred embodiment of the present invention, as a result of immunochemical analysis on cells determined to differentiate into cardiomyocytes by the development of reporter genes, cardiomyocyte markers are expressed in almost all cells determined to be cardiomyocytes from the reporter genes. It was confirmed that cTnT and a-actinin are expressed (Example 7). This means that it is possible to select with high specificity and accuracy according to the time of differentiation, compared to the conventional method of confirming whether the expression of any one gene and whether the degree of differentiation, and the reporter system of the present invention If used, this means that a separate protein expression identification process is unnecessary.

As another aspect, the present invention relates to a method for regulating differentiation from embryonic stem cells to cardiomyocytes by increasing or decreasing the expression of genes downstream of the Nkx2.5 promoter and the MLC2v promoter.

In the present invention, a method for increasing gene expression for inducing differentiation into cardiomyocytes effectively may use various methods known in the art for increasing gene expression in cells, and preferably, constructs a vector comprising the genes. These cells can be transduced to increase the expression rate of these genes.

In addition, the method for lowering the gene expression rate in order to prevent differentiation into cardiomyocytes in the present invention may use a method known in the art that can delete genes in cells or lose gene function through gene mutation, Preferably, small hairpin RNA (shRNA) or siRNA for the genes can be designed, and they can be transduced into cells to reduce the expression of these genes.

In the case of using such a control method, not only the promoter by introducing the reporter system, but also the activity of the promoter originally contained in the stem cells can be regulated, thereby ultimately facilitating the promotion or suppression of the differentiation of embryonic stem cells. do.

In the present invention, a regulator for inducing differentiation may include a molecule capable of increasing the expression rate of the gene, preferably a vector capable of overexpressing the gene, and a regulator for inhibiting differentiation may include an expression rate of the gene. Molecules that can be lowered, preferably siRNA or shRNA for the gene, and the like. In addition, the promoter of the present invention appears to be very closely related to differentiation regulators for differentiation into cardiomyocytes, and thus, by using these inhibitors or promoters, the differentiation can be efficiently and simply increased. Therefore, the differentiation regulator to the cardiomyocytes of the present invention can be used for the treatment of myocardial regeneration or heart diseases such as myocardial infarction, ischemic heart disease, congestive heart failure, hypertrophic cardiomyopathy, expanded cardiomyopathy, myocarditis or chronic heart failure. The diseases in which the cardiomyocytes or differentiation regulators into cardiomyocytes of the present invention can be used are not limited.

In another aspect, the present invention provides a method of treating embryonic stem cells with candidate substances expected to regulate differentiation into cardiomyocytes; And measuring the transcriptional activity of the Nkx2.5 promoter and MLC2v promoter downstream genes or the expression level of the protein encoded by the genes in the embryonic stem cells, the candidate substances for controlling differentiation from embryonic stem cells to cardiomyocytes. It relates to a method of screening.

As used herein, the term "candidate substance" refers to any substance that is expected to indirectly or directly inhibit or induce a change in the amount of gene expression significantly occurring in cells upon induction of differentiation into cardiomyocytes. Differentiation modulators selected by the candidate screening may further increase the activity of the Nkx2.5 promoter whose activity is increased early in differentiation and the MLC2v promoter whose activity is increased later in differentiation, thereby inducing differentiation or decreasing its activity. It can be adjusted to suppress differentiation.

Therefore, the activity of the promoter of the present invention on cardiomyocytes in the presence and absence of differentiation control candidates is controlled by differentiation from embryonic stem cells to cardiomyocytes by comparing the increase or decrease in the expression level of the downstream gene of the promoter. It may be further used usefully for screening differentiation control factors.

When using the Nkx2.5 promoter and MLC2v promoter of the present invention, and a reporter gene operably linked downstream thereof, a single reporter assay method is used to determine the differentiation induction state, extent, and timing of differentiation from embryonic stem cells to myocardial cells. Can be detected quickly and accurately, thereby effectively selecting myocardial system cells and providing an effective means for providing to patients in need thereof, such as those suffering from diseases requiring myocardial regeneration or other heart diseases. In addition, by inhibiting or promoting the promoter of the present invention and its downstream gene or the protein encoded by the gene, it can be used to search for candidates and molecular targets that can regulate differentiation into myocardial cells, and the candidate selected by the method The substance can be used as a differentiation regulator that regulates the differentiation into myocardial cells.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for carrying out the present invention by way of example, but the scope of the present invention is not limited to these examples.

Example 1 Human Embryonic Stem Cell Culture

In the present invention, human embryonic stem cells (hESCs) were cultured using a mouse embryonic fibroblast (MEF) obtained from a 13.5-day-old CF1 mouse fetus as a feeder cell. Feeder cells were cultured in DMEM (high glucose, Invitrogen) containing 10% FBS (Gibco), 0.1 mM β-mercaptoethanol and 0.1 mM non-essential amino acids, and then 3000 rad gamma to stop mitosis. The radiation was irradiated. Thereafter, MEF feeder cells irradiated with gamma radiation at a concentration of 3 × 10 ⁵ were seeded on a 60 mm petri dish coated with 0.1% gelatin. The day after seeding the feeder cells, hESCs were seeded, hESCs medium (Dulbecco's modified Eagle's medium) / F12 (Gibco, Rockville, MD, USA), 20% Knockout SR (Gibco), 0.1 mM β-mercaptoethanol (Sigma, St Luis, MO, USA), 2 mM glutamine (Gibco), 0.1 mM non-essential amino acid (Gibco), 100 U / ml penicillin- Streptomycin (Gibco), 4 ng / ml bFGF (Invitrogen) was incubated. Each day, the culture medium was changed and cultured, and hESCs cultured for 5-7 days were cut into 250x250 mm using tissue chopper (Mickle Engineering), and then 1 mg / ml collagenase IV (Gibco) was used. Passage was enzymatically enzymatic.

Example 2. Nkx2.5  Promoter and MLC2v Preparation of the Promoter Vector

<2-1> Lenti Virus Vector Construction

In order to prepare pLenti6- Nkx2.5 promoter- EGFP and pLenti6- MLC2v promoter- DsRed , genomic DNA was extracted from hESCs and PCR-amplified Nkx2.5 promoter and MLC2v promoter using the following primer sets. Nkx2.5 promoter sense primer is 5'-GATCACCCCACTTGCCCTGCC-3 '(SEQ ID NO: 1), and Nkx2.5 promoter antisense primer is 5'-GAGCGATGAGCAGTTTCG -3' (SEQ ID NO: 2). The MLC2v promoter sense primer is 5'- GCCACAGTGCCAGCCTTCATGG-3 '(SEQ ID NO: 3), and the MLC2v promoter antisense primer is 5'- GTGGAAAGGACCCAGCACTG-3' (SEQ ID NO: 4). After PCR, the products of the 978 bp Nkx2.5 promoter and the 562 bp MLC2v promoter, respectively, were obtained (FIG. 1), and each product was purified using the TA cloning method. The pENTR5'-TOPO vector (Invitrogen) Insert into pENTR5'- Nkx2. 5 and pENTR5'- MLC2v were prepared. To confirm the activity of Nkx2.5 promoter, pEGFP-N3 (Clontech) vector containing fluorescence-expressing EGFP gene was used as a template.Sense primer 5'- CAC C AT GGT GAG CAA GGG CGA G-3 '(SEQ ID NO: 5 ), PCR amplification using antisense primer 5'- CTT GTA CAG CTC GTC CAT GCC GAG-3 '(SEQ ID NO: 6). The PCR product of the amplified EGFP gene contains a CACC sequence for directional cloning in the pENTR / D-TOPO vector (Invitrogen, Carlsbad, Calif.) (Underlined). The resulting 717 bp product was inserted into the pENTR / D-TOPO vector to prepare pENTR / D-TOPO- EGFP . To confirm the activity of the MLC2v promoter, pDsRed2 (Clontech) vector containing fluorescence-expressing DsRed gene was used as a template for the sense primer 5'- CAC C AT GGC CTC CTC CGA GAA C-3 '(SEQ ID NO: 7) PCR amplification using 5'-CAG GAA CAG GTG GTG GCG GC-3 '(SEQ ID NO: 8). PCR products of the amplified DsRed gene were subjected to directional cloning in the pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA). To do this, the CACC sequence is included (underlined). The resulting 675bp sized product was inserted into pENTR / D-TOPO vector to prepare pENTR / D-TOPO- DsRed . The pLenti6- Nkx2.5 promoter- EGFP and pLenti6- MLC2V were inserted into the pLenti6 / R4R2 / V5-DEST destination vector by LR clonase reaction using a gateway system (Invitrogen) using the prepared vectors as entry clones. Promoter- DsRed was constructed (FIG. 2A).

<2-2> Non-viral Plasmid Vector Construction

To prepare Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP , genomic DNA was extracted from hESCs and PCR amplified Nkx2.5 promoter and MLC2v promoter using the following primer sets. The Nkx2.5 promoter sense primer was 5'- GTA GAATTC GATCACCCCACTTGCCCTG-3 '(SEQ ID NO: 9), and an EcoRI restriction enzyme site was inserted (underlined) for cloning convenience, and the Nkx2.5 promoter antisense primer was 5'. - GAT GAGCGATGAGCAGTTTCG GGATCC-3 '(SEQ ID NO: 10) as was inserted into the BamHI restriction site (underlined). After PCR, the 996 bp-sized product was treated with EcoRI and BamHI restriction enzymes, and then a 978 bp Nkx2.5 promoter product was obtained and inserted into the pEGFP-1 vector (Clontech) treated with the same restriction enzyme, pEGFP. -1- Nkx2.5 promoter vector was constructed (FIG. 2B). The MLC2v promoter sense primer was 5'-GAT AGATCT GCCACAGTGCCAGCCTTCATG-3 '(SEQ ID NO: 11), and a BglII restriction enzyme site was inserted (underlined) for cloning convenience, and the MLC2v promoter antisense primer was 5'-GAA GTCGAC GTGGAAAGGACCCAGCACTG As -3 '(SEQ ID NO: 12), the SalI restriction enzyme site was inserted (underlined portion). After PCR, the resulting 580bp-sized product was treated with BglII and SalI restriction enzymes, and then the 562bp MLC2v promoter product was obtained and inserted into pEGFP-1 vector (Clontech) treated with the same restriction enzyme, pEGFP-1. MLC2v promoter vector was constructed (FIG. 2B).

Example 3. Construction and Confirmation of Cardiomyocyte Specific Promoter Expression Cell Line

<3-1> Construction of Nkx2.5 Promoter- EGF P and MLC2v Promoter- EGFP Expressing Cell Lines by Lipofectamine2000 Transfection

Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP vectors prepared in Example 2-2 were transfected into hESCs using lipofectamine2000 (Gibco) as follows. The hESCs cultured for 5-7 days were cut into 250x250 mm using tissue chopper (Mickle Engineering), and then treated with 1 mg / ml collagenase IV (Gibco) to obtain Matrigel (Becton Dickinson). The coated culture dish was incubated with conditioned medium. 4.0 μg of plasmid DNA was mixed with 500 μl of serum-free Opti-MEM medium (Gibco), 10 μl of lipofectamine2000 reagent was added to 500 μl of serum-free Opti-MEM medium, and left at room temperature for 5 minutes. 500 ul of the diluted plasmid solution and 500 ul of the diluted lipofectamine2000 reagent are mixed and allowed to stand at room temperature for 20 minutes to form a plasmid-lipofectamine2000 complex.The 1000 ul of the solution is added to the medium in which the hESCs are incubated and gently mixed. Incubated for 24 hours. As shown in FIG. 2B, the Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP vectors contain a neomycin phosphotransferase gene that is resistant to neomycin. Through this, when the vector is properly transfected into the cell, hESCs have neomycin markers and thus have resistance to G-418, thereby avoiding the proliferation of G-418 and proliferating. Therefore, from the next day, the cells were cultured using hESC medium in which 200 μg / ml of Geneticine was added, followed by culturing for 3 weeks with changing the medium every 2 days. Once the colonies were formed, the colonies were transferred to 4-well plates. Then, transfer to a 35mm, 60mm culture dish, and increased the number of cells.

Thus, the genome DNA of the isolated and constructed cell line was separated through the following process and used as a template of PCR (Polymerase Chain Reaction). The cell lines were collected for 1 hour with extraction buffer containing 1 M KCl, 1 M MgCl ₂ , 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 μg / mL proteinase K at 55 ° C. Incubated. Proteinase K was inactivated by heating at 95 ° C for 10 minutes, and the supernatant containing genome DNA was stored at 4 ° C. 5'-CGCATGATTGAACAAGATGG-3 '(SEQ ID NO: 13) and 5'-ATACTTTCTCGGCAGGAGCA-3' (SEQ ID NO: 14) primer and 5 capable of amplifying a neomycin gene using the genome DNA obtained by the above process as a template PCR was carried out using Taq polymerase (Takara) using '-GAAGGTGAAGGTCGGAGTC-3' (SEQ ID NO: 15) and 5'-GAAGATGGTGATGGGATTTC-3 '(SEQ ID NO: 16) as a GAPDH primer: denaturation A total of 28 cycles were performed for 30 seconds at 94 ° C, annealing for 30 seconds at 58 ° C, and extension for 1 minute at 72 ° C. Then, the PCR product was electrophoresed on a 1.5% agarose gel to confirm that the DNA of the neomycin gene region that the Nkx2.5 promoter-EGFP and MLC2v promoter-EGFP vectors simultaneously possess was synthesized (FIG. 3A). From this, it was confirmed that the cell line constructed by the above method was transfected with Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP .

<3-2> Construction of Nkx2.5 Promoter- EGFP and MLC2v Promoter- DsRed Coexpressing Cell Lines Via Lipofectamine 2000 Transfection and Lentivirus- Mediated Infection

To the Nkx2.5 promoter- EGFP cell line constructed by transfection using lipofectamine 2000 (Gibco) in Example 3-1, the pLenti6- MLC2v promoter- DsRed vector prepared in Example 2-1, HEK293T packaging cell line (Invitrogen) was transfected with lipofectamine 2000 (Invitrogen). Specifically , the MLC2v promoter- DsRed vector DNA 3.0, packaging mix plasmid 6.0 was mixed with 500 ul of serum-free Opti-MEM medium (Gibco), and 36 ul of lipofectamine 2000 reagent was added to 500 ul of serum-free Opti-MEM medium. It was left to stand at room temperature for 5 minutes. 500 ul of the diluted plasmid solution and 500 ul of the diluted lipofectamine2000 reagent are mixed and allowed to stand at room temperature for 20 minutes to form a plasmid-lipofectamine2000 complex, and then the 1000 ul of the solution is added to the culture medium in which the HEK293T packaging cells are cultured, and gently shaken to mix. Then incubated for 24 hours. The next day, the medium was changed and supernatant was taken from the culture for 24 hours, and then filtered with 0.45um (Millipore) to remove cell debris. After 30 ml of the filtered supernatant was centrifuged at 20,000 rpm for 2 hours, the supernatant was removed, and 500 ul of HPSS (Gibco) was added to the remaining precipitate to concentrate the virus. The hESCs cultured for 5-7 days were cut into 250x250 mm using tissue chopper (Mickle Engineering), and then treated with 1 mg / ml collagenase IV (Gibco), thereby treating Matrigel (Becton Dickinson). Incubated in a conditioned medium in a coated dish. The next day, 200ul of concentrated virus solution and 6-8 μg / ml polybrene (sigma) were added to the Nkx2.5 promoter- EGFP cell line, followed by culture for 24 hours, and the medium was changed. As shown in Figure 2a, since the pLenti6- MLC2v promoter- DsRed vector contains a blasticidin resistance gene, when the vector is appropriately transfected into the cell, the cell line has a blasticidin marker. It has resistance to blasticidine. Therefore, from the next day, 1 μg / ml blasticidine was added to hESCs medium. Thereafter, the culture medium was incubated for 3 weeks with a change every 2 days. After 3 weeks, when the cells formed a circular colony, the colonies were transferred to a 4-well plate. Then, transfer to a 35mm, 60mm culture dish, and increased the number of cells.

In this way, the genome DNA of the isolated and constructed cell line was separated through the following process and used as a template for PCR (Polymerase Chain Reaction). The cell lines were collected and incubated for 1 hour with extraction buffer containing 1 M KCl, 1 M MgCl ₂ , 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 μg / mL proteinase K at 55 ° C. did. Proteinase K was inactivated by heating at 95 ° C for 10 minutes, and the supernatant containing genome DNA was stored at 4 ° C. Since the genome DNA obtained by the above procedure was used as a template, and the transfection of Nkx2.5 promoter- EGFP was already confirmed in Example 3-1, the amplification of the DsRed gene was performed to confirm the transfection of the MLC2v promoter- DsRed . Using 5'-TCCAAGGTGTACGTGAAGCA-3 '(SEQ ID NO: 17) and 5'-CCCATGGTCTTCTTCTGCAT-3' (SEQ ID NO: 18) primers and 5'-GAAGGTGAAGGTCGGAGTC-3 'and 5'-GAAGATGGTGATGGGATTTC-3' as GAPDH primers PCR was carried out using Taq polymerase (Takara) as follows: denaturation was performed at 94 ° C for 30 seconds, annealing at 58 ° C for 30 seconds, and extension reaction at 72 ° C for 1 minute. Was performed. Then, PCR products were electrophoresed on a 1.5% agarose gel to confirm that the DNA of the DsRed gene region contained in the MLC2v promoter - DsRed vector was synthesized (FIG. 3B). From this, it was confirmed that the cell line constructed by the above method was transfected by two cardiomyocyte marker promoters, Nkx2.5 promoter- EGFP and MLC2v promoter- DsRed .

Example 4 Preparation of Cardiomyocytes from Human Embryonic Stem Cells

HESCs cultured for 6-7 days were cut into 500x500 mm using tissue chopper (Mickle Engineering), and then treated with collagenase at a concentration of 1 mg / ml to separate into even cell masses. Carefully transfer the isolated hESCs to bacteria plates and transfer them to a bacterial plate.These are known as CMiocardiomyocytes (Knockout-DMEM (Gibco), 20% FBS (Gibco), 0.1 mM β-mercaptoethanol (Sigma). ), 1 mM L-glutamine (Gibco), 1% non-essential amino acid (Gibco), 100 U / ml penicillin-streptomycin (Gibco) to form EB Incubated. At this time, the culture medium and the plate were replaced every day. EBs cultured in Cardiomyocyte differentiation medium (CDM) for 5 days were attached to a 60 mm culture dish coated with 0.1% gelatin, cultured in the same CDM for at least 10 days to differentiate into cardiomyocytes and fully grown (2 Change of medium once a day). Three days after attachment, beating was observed.

Example 5 Promoter Activity Examination Using Cardiomyocyte Specific Promoter Cell Line

<5-1> Promoter activity investigation using Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP expressing cell lines

Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP expressing human embryonic stem cell lines were differentiated into cardiomyocytes by the method of Example 4 above. When these cells are differentiated into cardiomyocytes, cardiomyocytes expressing EGFP (green fluorescence) are produced by Nkx2.5 promoter and MLC2v promoter, respectively. This was confirmed by observing with a fluorescence microscope (Fig. 4a). As a result, cardiomyocytes prepared using Nkx2.5 promoter- EGFP expressing hESCs were confirmed to have been formed in the cardiomyocyte differentiation medium for 10 days or more, and thus, myocardial cells expressing EGFP (green fluorescence) were produced by Nkx2.5 promoter. And heartbeat could be observed (FIG. 4A, dashed line). However, expression of EGFP (green fluorescence) by the Nkx2.5 promoter was confirmed from EB state cultured 5 days prior to attachment. This may be because the EGFP (green fluorescence) was expressed from the EB state by the Nkx2.5 promoter, an early marker of cardiomyocytes, because the medium forming EB also used CDM. MLC2v Promoter-Cardiomyocytes made using EGFP- expressing hESCs were confirmed to have produced cardiomyocytes expressing EGFP (green fluorescence) by MLC2v promoter when cultured in cardiomyocyte differentiation media for 10 days or more. Observation was possible (FIG. 4A, dotted line).

<5-2> Promoter activity using Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP coexpressed cell lines

Nkx2.5 promoter- EGFP and MLC2v promoter- DsRed coexpressed hESCs were differentiated into cardiomyocytes by the method of Example 4 above. Differentiation into cardiomyocytes using these cell lines results in the production of cardiomyocytes expressing EGFP (green fluorescence) by the Nkx2.5 promoter and DsRed (red fluorescence) by the MLC2v promoter. This was confirmed by observing with a fluorescence microscope (Fig. 4b). As a result, EGFP (green fluorescence) began to be expressed by the Nkx2.5 promoter- EGFP from the initial cardiomyocyte differentiation stage including the EB formation stage, and after attachment of EB, in cardiomyocyte differentiation medium (CDM). When cultured for 10 days or more, it was confirmed that the cardiomyocytes expressing DsRed (red fluorescence) were produced by the MLC2v promoter, and heartbeat (beating) was also observed (FIG. 4B, dotted line). In this case, when two markers, Nkx2.5 , which are specifically expressed at the early stage of differentiation, and MLC2v , which are specifically expressed at the late stage of differentiation, are used as a combination marker and a double marker, they have high sensitivity and specificity to cardiomyocytes. In addition to confirming the differentiation, it was confirmed that the specific expression time and the percentage of differentiated cells can be detected.

Example 6 RT-PCR Analysis of Cardiomyocyte Specific Genes

<6-1> RT-PCR analysis of cardiomyocyte specific genes using Nkx2.5 promoter- EGFP and MLC2V promoter- EGFP expressing cell lines

To confirm the expression of cardiomyocyte specific marker genes, the control hESCs, human cardiomyocytes differentiated therefrom (hCM), and human cardiomyocytes differentiated from Nkx2.5 promoter- EGFP expressing hESCs (hCM-Nkx2 .5) and 2 mg of total RNA isolated from human cardiomyocytes (hCM- MLC2V ) differentiated from MLC2v promoter- EGFP expressing hESCs as a template using a Superscript kit (Invitrogen) for 90 minutes at 42 ° C for reverse transcription. I was. The base sequence of the primer set used for the PCR reaction is Nkx2.5 sense primer 5'-GGTCTATGAACTGGAGCGGC-3 '(SEQ ID NO: 19) Nkx2.5 antisense primer 5'-ATAGGCGGGGTAGGCGTTAT-3' (SEQ ID NO: 20) MLC2A sense primer 5'- GCTCTTTGGGGAGAAGCTCA-3 '(SEQ ID NO: 21) MLC2A antisense primer 5'-CGTCTCCATGGGTGATGATG-3' (SEQ ID NO: 22) α- MHC sense primer 5'-GTCATTGCTGAAACCGAGAATG-3 '(SEQ ID NO: 23) α- MHC antisense primer 5'-GCAAAGTACTGGATGAC -3 '(SEQ ID NO: 24) β- MHC sense primer 5'-AGATGGATGCTGACCTGTCC-3' (SEQ ID NO: 25) β- MHC antisense primer 5'-GGTTTTTCCTGTCCTCCTCC-3 '(SEQ ID NO: 26) Isl1 sense primer 5'-GTGGTCTTCTCCGGCTGCTTGTGG- 3 '(SEQ ID NO: 27) Isl1 antisense primer 5'-GGGATCCACTCCACGAAGTA-3' (SEQ ID NO: 28) Tbx20 sense primer 5'-CTGAGCCACTGATCCCCACCAC-3 '(SEQ ID NO: 29) Tbx20 antisense primer 5'-CTCAGGATCCACCCCCGAAAAG-3' 30) ANP Sense Primer 5'-G AACCAGAGGGGAGAGACAGAG-3 '(SEQ ID NO: 31) ANP Antisense Primer 5'-CCCTCAGCTTGCTTTTTAGGAG-3' (SEQ ID NO: 32) GATA4 Sense Primer 5'- GGTTCCCAGGCCTCTTGCAATGCGG-3 '(SEQ ID NO: 33) GATA4 Antisense Primer 5'-AGTGGCATTGCTGGAGTTA SEQ ID NO: 34) Mef2c Sense Primer 5'-AGATACCCACAACACACCACGCGCC-3 '(SEQ ID NO: 35) Mef2c Antisense Primer 5'-ATCCTTCAGAGAGTCGCATGC-3' (SEQ ID NO: 36) Oct4 Sense Primer and 5'-GAGAAGGATGTGGTCCGAGTGTG-3 '(SEQ ID NO: 37) GAPDH amplification using Oct4 antisense primer 5'-CAGAGGAAAGGACACTGGTCCC-3 '(SEQ ID NO: 38) as a control, 5'-GAAGGTGAAGGTCGGAGTC-3' and 5'-GAAGATGGTGATGGGATTTC-3 'were used as primers. RT-PCR reaction conditions used for this amplification were denatured at 94 ° C. for 5 minutes, followed by 30 times at 94 ° C., 30 seconds at 58 ° C., 30 seconds at 72 ° C., and 30 times at 72 ° C. A polymerization reaction was performed for 1 minute. As a result, the RT-PCR product was electrophoresed on 1.5% agarose gel to differentiate human cardiomyocytes (hCM-Nkx2.5) and MLC2v promoter- EGFP, differentiated from Nkx2.5 promoter- EGFP expressing hESCs. Expression of Nkx2.5, MLC2A, α-MHC, β-MHC, Isl1, Tbx20, ANP, GATA4, MEF2C and control GAPDH in human cardiomyocytes (hCM- MLC2v ) differentiated from expressing hESCs was confirmed, respectively (FIG. 5A). ). Expression of the molecular markers in the cells prepared by the method of the present invention was examined by RT-PCR, and human cardiomyocytes differentiated from control hESCs and human cardiomyocytes differentiated from Nkx2.5 promoter- EGFP expressing hESCs (hCM- Nkx2). .5 ) and cardiomyocyte specificity such as Nkx2.5, MLC2A, α-MHC, β-MHC, Isl1, Tbx20, ANP, GATA4 and MEF2C in human cardiomyocytes (hCM- MLC2v ) differentiated from MLC2v promoter- EGFP expressing hESCs It was confirmed that the expression of the marker is expressed in almost similar manner.

Example 7 Immunocytochemistry Analysis of Specific Proteins in Cardiomyocytes

The cardiomyocytes (CM) obtained in Example 4 were attached to a cover glass coated with 0.1% gelatin and incubated for 10 days in CDM. After removing the medium, the remaining medium residue was washed three times with PBS and fixed for 30 minutes with PBS containing 4% paraformaldehyde. After washing three times with PBS, the solution was infiltrated with PBS containing 0.1% Triton-X100 for 10 minutes and blocked by reacting with 10% NGS (normal goat serum) for 1 hour. Then, the antibody was mixed with PBS / 0.1% BSA / 5% NGS and the following concentrations were treated to the cells and reacted at 4 ° C. for 20 hours. Anti-cTnT antibody (R & D, MAB1874, mouse monoclonal IgG) was 1/20 and anti-α-actinin antibody (Sigma, A7811, mouse monoclonal IgG) was used at a concentration of 1/200. At the end of the primary antibody reaction, the cells were washed with PBS and treated with a suitable secondary antibody for 1 hour at room temperature. Nuclei were stained using DAPI. After all reactions were mounted (mounted) to confirm the staining with a fluorescence microscope and photographed (Fig. 6). As a result, the cardiomyocyte markers cTnT and α-actinin were expressed in almost all cells. In addition, it was confirmed that these cardiomyocyte markers are co- expressed with EGFP (green fluorescence) expressed by the NKX2.5 promoter and the MLC2v promoter, respectively.

1 is a diagram showing the nucleotide sequence of the Nkx2.5 promoter and MLC2v promoter.

Figure 2 shows a vector comprising the Nkx2.5 promoter and the MLC2v promoter, Figure 2a shows the pLenti6- Nkx2.5 promoter- EGFP and pLenti6- MLC2v promoter- DsRed vector, Figure 2b is a Nkx2.5 The figure shows the vector configured to place EGFP downstream of each of the promoter and the MLC2v promoter.

3 is a result of confirming whether the prepared vector was successfully transfected into the embryonic stem cell line by electrophoresis, Figure 3a is a photograph confirming that each of the Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP transfected, 3b is a photograph confirming simultaneous transfection by Nkx2.5 promoter- EGFP and MLC2v promoter- EGFP .

FIG. 4 is a photograph confirming whether embryonic stem cells are differentiated into cardiomyocytes to activate the Nkx2.5 and MLC2v promoters. FIG. 4A is a photograph confirming that green fluorescence is developed for each of Nkx2.5 and MLC2v . 4b is a photograph confirming that Nkx2.5 and MLC2v initially develop green fluorescence by Nkx2.5 and red fluorescence by MLC2v in later cell lines.

Figure 5 shows the expression of cardiomyocyte marker genes ( Nkx2.5, MLC2A, α-MHC, β-MHC, Isl1, Tbx20, ANP, GATA4, MEF2C ) and control GAPDH in embryonic stem cells and cells induced differentiation into cardiomyocytes. This is the result of checking. 5a shows control embryonic stem cells and cardiomyocytes differentiated therefrom, embryonic stem cells constructed by transfection with a vector containing a Nkx2.5 -reporter gene (hES- Nkx2.5 ) and cells induced to differentiate into cardiomyocytes ( Cardiomyocyte marker genes for embryonic stem cells (hES- MLC2v ) constructed by transfection with vectors containing hCM- Nkx2.5 ) and MLC2v -reporter genes and cells induced to differentiate into cardiomyocytes (hCM- MLC2v ) It is a photograph confirming the expression of. 5b shows control embryonic stem cells and cardiomyocytes differentiated therefrom, embryonic stem cells (hES- Nkx2.5 + MLC2v ) constructed by transfection with a vector containing the Nkx2.5 -reporter gene and the MLC2v -reporter gene at the same time. It is a photograph confirming the expression of the cardiomyocyte marker gene for the cells differentiated into cardiomyocytes (hCM- Nkx2.5 + MLC2v ).

6 shows the results of confirming the expression of cardiomyocyte specific proteins (cTnT and a-actinin) through immunochemical analysis.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Reporter system comprising dual promoter and methods for          analyzing the differentiation of embryonic stem cells into          cardiac lineage <130> PA090179 / KR <160> 38 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Nkx2.5 <400> 1 gatcacccca cttgccctgc c 21 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Nkx2.5 <400> 2 gagcgatgag cagtttcg 18 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MLC2v <400> 3 gccacagtgc cagccttcat gg 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MLC2v <400> 4 gtggaaagga cccagcactg 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of EGFP gene <400> 5 caccatggtg agcaagggcg ag 22 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of EGFP gene <400> 6 cttgtacagc tcgtccatgc cgag 24 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of DsRed gene <400> 7 caccatggcc tcctccgaga ac 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of DsRed gene <400> 8 caggaacagg tggtggcggc 20 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Nkx2.5 promoter with EcoRI restriction site <400> 9 gtagaattcg atcaccccac ttgccctg 28 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Nkx2.5 promoter with BamHI restriction site <400> 10 gatggatccg agcgatgagc agtttcg 27 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MLC2v promoter with BglII restriction site <400> 11 gatagatctg ccacagtgcc agccttcatg 30 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MLC2v promoter with SalI restriction site <400> 12 gaagtcgacg tggaaaggac ccagcactg 29 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of neomycin gene for amplification <400> 13 cgcatgattg aacaagatgg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of neomycin gene for amplification <400> 14 atactttctc ggcaggagca 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of GAPDH <400> 15 gaaggtgaag gtcggagtc 19 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of GAPDH <400> 16 gaagatggtg atgggatttc 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of DsRed gene for amplification <400> 17 ccaaggtgta cgtgaagca 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of DsRed gene for amplification <400> 18 cccatggtct tcttctgcat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Nkx2.5 <400> 19 ggtctatgaa ctggagcggc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Nkx2.5 <400> 20 ataggcgggg taggcgttat 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MLC2A <400> 21 gctctttggg gagaagctca 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MLC2A <400> 22 cgtctccatg ggtgatgatg 20 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of alpha-MHC <400> 23 gtcattgctg aaaccgagaa tg 22 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of alpha-MHC <400> 24 gcaaagtact ggatgacacg ct 22 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of beta-MHC <400> 25 agatggatgc tgacctgtcc 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of beta-MHC <400> 26 ggtttttcct gtcctcctcc 20 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Isl 1 <400> 27 gtggtcttct ccggctgctt gtgg 24 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Isl 1 <400> 28 gggatccact ccacgaagta 20 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Tbx20 <400> 29 ctgagccact gatccccacc ac 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Tbx20 <400> 30 ctcaggatcc acccccgaaa ag 22 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of ANP <400> 31 gaaccagagg ggagagacag ag 22 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of ANP <400> 32 ccctcagctt gctttttagg ag 22 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sense primer of GATA4 <400> 33 ggttcccagg cctcttgcaa tgcgg 25 <210> 34 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of GATA4 <400> 34 agtggcattg ctggagttac cgctg 25 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Mef2c <400> 35 agatacccac aacacaccac gcgcc 25 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Mef2c <400> 36 atccttcaga gagtcgcatg c 21 <210> 37 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Oct 4 <400> 37 gagaaggatg tggtccgagt gtg 23 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Oct 4 <400> 38 cagaggaaag gacactggtc cc 22  

Claims (13)

A composition for detecting promoter activity for detecting whether differentiation from embryonic stem cells to cardiomyocytes, comprising an Nkx2.5 promoter at the beginning of differentiation and an agent measuring the activity of the MLC2v promoter at the end of differentiation. The composition of claim 1, wherein the embryonic stem cells are derived from humans. The method of claim 1, wherein the agent measuring the promoter activity is Nkx2.5 promoter and the Nkx2.5 promoter and the operably linked reporter gene, and MLC2v promoter and a vector comprising a reporter gene operably linked with the promoter MLC2v Phosphorus composition. According to claim 3, wherein the Nkx2.5 promoter and the reporter gene operably linked to the Nkx2.5 promoter is pLenti6- Nkx2.5 -EGFP represented by the cleavage map of Figure 2a, the MLC2v promoter and the MLC2v promoter Wherein the operably linked reporter gene is pLenti6- MLC2V- DsRed, represented by the cleavage map of FIG. 2A. The method of claim 3, wherein the reporter gene is a green fluorescent protein (GFP), modified green fluorescent protein (modified green fluorescent protein), enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP) , Enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), enhanced Indigo blue fluorescent protein (ECFP), DsRed and Renila luciferase. Embryonic stem cell comprising the composition according to any one of claims 1 to 5. Method for detecting the differentiation of embryonic stem cells from neuronal cells by checking the activity level of Nkx2.5 promoter and MLC2v promoter. The method of claim 7, wherein (a) inducing differentiation from embryonic stem cells to cardiomyocytes using differentiation-inducing substances; (b) obtaining a nucleic acid sample or protein sample of embryonic stem cells and stem cells which are expected to have differentiation induced; (c) measuring the mRNA transcription amount of the Nkx2.5 promoter and the MLC2v promoter downstream gene or the protein expression encoded by the gene in the nucleic acid sample or protein sample; And (d) determining that embryonic stem cells have differentiated into cardiomyocytes when the amount of transcription of the gene of step (c) or the amount of expression of the protein is increased. The method of claim 7, wherein the expression level of the gene in step (c) is confirmed by reverse transcription polymerase chain reaction (RT-PCR) or real time polymerase chain reaction (Real time PCR). The method of claim 7, wherein the downstream gene is a green fluorescent protein (GFP), modified green fluorescent protein (modified green fluorescent protein), enhanced green fluorescent protein (ERFP), blue fluorescent protein (BFP) , Enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), enhanced indigo fluorescent protein (ECFP), DsRed and Renilla Luciferase (Renila) luciferase). According to claim 7, wherein the step of measuring the expression level of the protein in step (c) is the coloration level of the downstream gene expressed by the Nkx2.5 promoter and MLC2v promoter and the color development level in the protein sample of embryonic stem cells And comparing the same. A method of regulating differentiation from embryonic stem cells to neuronal cells by increasing or decreasing the Nkx2.5 promoter and MLC2v promoter activity. Treating embryonic stem cells with candidate substances expected to regulate differentiation into cardiomyocytes; And measuring the transcriptional activity of the Nkx2.5 promoter and MLC2v promoter downstream genes or expression levels of the proteins encoded by the genes in the embryonic stem cells, screening differentiation regulating agents from embryonic stem cells to cardiomyocytes. How to.

Images