KR20110053105A - Reporter system comprising dual promoter and methods for analyzing the differentiation of embryonic stem cells into neural lineage - Google Patents

Abstract

PURPOSE: A reporter system for detecting single or double promoter transcription activity using Sox3 promoter and Nestin promoter is provided to quickly and accurately detect differentiation process. CONSTITUTION: A composition for detecting promoter activity for detect differentiation from embryonic stem cells to nervous cells contains an agent for measuring Sox3 promoter and Nestin promoter activities. The embryonic stem cells are derived from human. The agent for measuring the promoter activities contains: Sox3 promoter; a reporter gene which is operatively linked to Sox3 promoter; Nestin promoter; and a reporter gene which is operatively linked to Nestin promoter.

Description

Reporter system comprising dual promoter and methods for analyzing the differentiation of embryonic stem cells into neural lineage}

The present invention relates to a method for detecting the differentiation of pluripotent stem cells from neural lineage cells using a reporter system for detecting single or double promoter transcriptional activity using Sox3 promoter and Nestin promoter. A composition for detection, a kit for detecting a promoter activity comprising the composition, a differentiation regulator for regulating the promoter activity, and a method for searching for the differentiation control candidate.

Recently, cell replacement therapy using stem cells has been suggested as a fundamental method for restoring the function of cells destroyed or damaged by disease. Differentiated cells derived from human stem cells can be an important biological resource that can be used to promote the repair and regeneration of tissues or cells that are difficult to treat after injury, and efforts for technology development have been extensively made. In particular, human embryonic stem cells established from blastocyst stage internal cell mass during the development of fertilized eggs can continue to proliferate in undifferentiated state, unless given a specific differentiation environment. Because of its ability to differentiate into tissue cells, it is evaluated as an important cell source for the development of cell therapies.

Neural stem cells / neuronal progenitor cells have the ability to continue proliferation, that is, self-replicating ability, and differentiate into three constituent cells such as neurons, asrocytes, and oligodendrocytes, which constitute the central nervous system. It can be defined as an undifferentiated cell with multipotent ability. Neural stem cells differentiate into neurons / neurons or glia cells through the steps of neural precursor cells or glia precursor cells that produce specific nervous system cells. Therefore, studies on the mechanisms or control mechanisms that induce differentiation into these neurons or glia cells are of great importance not only in the study of nervous system development, but also in the study of pathogenesis of brain diseases and strategies for treating brain diseases.

Neurons have the characteristic that all cell division ends when development occurs, the neurons do not continue to divide during the later growth period, once damaged is difficult to regenerate. With the current technology, it is almost impossible to secure and supply human adult stem cells originating from the brain or nerve tissue, which can be used to develop cell therapies for cerebral nervous system diseases. Cells may be an important source of cells in the development of regenerative medical technology in this field. Accordingly, neural cell cells (specifically neural stem cells / neural progenitors, neuronal cells, astrocytes or oligodendrocytes) from human embryonic stem cells are described below. The term 'nerve cells' is a concept that includes all of the cells) is being actively researched, high efficiency differentiation induction technology, pure separation, which can obtain quantitative and qualitatively superior neuronal differentiated cells Technology, screening technology, etc. are being developed in parallel to increase the efficiency of cell therapy development.

Accordingly, in the present invention, as a result of intensive efforts to develop a method for selectively and efficiently determining differentiation of embryonic stem cells into neural cells, the Sox3 promoter and Nestin promoter, which are neuronal markers for inducing neural differentiation, are included. The human embryonic stem cell stable cell line capable of detecting the transcriptional activity of the fluorescent reporter gene was established, and the present invention was completed by developing a method capable of detecting differentiation into neuronal cells using the same.

An object of the present invention is a Sox3 promoter And it provides a composition for detecting the promoter activity for detecting whether differentiation from embryonic stem cells to neuronal cells, including an agent for measuring Nestin promoter activity.

Another object of the present invention to provide an embryonic stem cell comprising the composition.

Another object of the present invention is a Sox3 promoter And to check the activity level of the Nestin promoter to provide a method for detecting whether differentiation from embryonic stem cells to nervous system cells.

Another object of the present invention is a Sox3 promoter And it provides a method and material for controlling the differentiation of embryonic stem cells from neuronal cells by increasing or decreasing Nestin promoter activity.

Another object of the present invention is to process a candidate substance that is expected to regulate differentiation into neuronal cells in embryonic stem cells; And Sox3 promoters in embryonic stem cells And it provides a method for screening differentiation regulating agents and molecular targets from embryonic stem cells to neuronal cells comprising the step of measuring the transcriptional activity of the Nestin promoter downstream gene or the expression of the protein encoded by the gene.

As one aspect for achieving the above object, the present invention provides Sox3 promoter And it relates to a composition for detecting the promoter activity for detecting whether differentiation from embryonic stem cells to neuronal cells, including a preparation for measuring the activity of the Nestin promoter.

The cells differentiated into neural system cells of the present invention may be multipotent or pluripotent stem cells, and are preferably pluripotent stem cells. More preferably, pluripotent cells may be embryonic stem cells (ESCs), which include both wild-type embryonic stem cells or genetically modified embryonic stem cells. In addition, the multipotent or pluripotent cells of the present invention may be derived from humans, primates, rodents, birds, etc., specifically, humans, monkeys, pigs, horses, cattle (cows), sheep (sheeps), dogs (cats), mice (mice) and rabbits (rabbits) can be derived from all animals, preferably human origin.

Nucleic acid sequences that can be used to detect the differentiation into neuronal cells of the present invention is a nucleic acid of significantly increased activity in cells differentiated from embryonic stem cells to neuronal cells, preferably Sox3 promoter And Nestin promoter sequence. The promoter sequence can be easily obtained through the NCBI or through gene banks known in the art. Specifically, the human Sox3 promoter is a SRY-related X which is a gene named abbreviation for sex determining region Y (SRY) -box 3 It is a promoter present upstream of the -linked gene. The Sox3 promoter is also a member of the SOX (SRY-related HMG-box) family of transcription factors, and is a promoter for genes involved in determining fetal development and cell fate, and is located at Xq27.1. The protein to be encoded is a Sox3 protein whose sequence is defined as gene bank CAA50465 and consists of 443 amino acids.

The Nestin promoter is a promoter for the gene present at 1q23.1, and the gene encoded by the promoter is defined as NC_000001.9 and may also be named NES, FLJ21841 or Nbla00170. The protein encoded and expressed by the Nestin promoter is defined by NCBI reverence sequence No. NP — 006608.1 and consists of 1621 amino acid sequences.

Promoter used in the present invention includes the functional equivalent of the nucleic acid molecules constituting the promoter, the deletion, substitution, insertion or a portion of the nucleotide sequence by artificial modification Variants modified by combination, or functional fragments of said polynucleotides that perform the same function.

The promoter downstream gene of the present invention is a Sox3 promoter And a gene operably linked to each of the Nestin promoters, and any gene capable of measuring the activity of the promoter may be used without limitation, and as long as the activity is maintained, some sequences include all modified, deleted, parental, and inserted genes. do. Preferably the gene is a reporter gene

In addition, the protein encoded by the promoter of the present invention is a polypeptide encoded by the gene located downstream of the promoter of the present invention, can be used to determine whether differentiation from embryonic stem cells to neural progenitor cells. As long as it is present, the amino acid residues of the natural amino acid sequence may be substituted, deleted, and / or added with other residues, to variously modified forms. Preferably the protein is a reporter protein.

Sox3 gene can be used as a neuronal marker, and even though studies on the promoter activity of Sox3 gene have been conducted (Gene 344 (2005), pp. 287 297.), stable cell lines using the activity of Sox3 promoter No studies have been conducted on lines or transgenic mice. In the case of the Nestin gene, it is well known that the Nestin gene itself is used as an early neuronal marker gene, and it is used for research to confirm neuronal differentiation through expression of GFP (green fluorescent substance) gene using the activity of the Nestin promoter. have. In particular, Nestin - GFP transgenic mice are frequently used in neuronal research (Neuroreport. 2000 Jun 26; 11 (9): 1991-6.). However, despite the difficulty of isolating terminal mature mature differentiated cells only by identifying downstream genes by the promoter of the Nestin gene, which is an early neuronal marker and neural precursor marker. However, no one discloses how to use two or more specific promoters as a complete and mature identification method, and which of the various marker-related sequences used to date are effective for binding. In addition, prior art has suggested the availability of differentiation detection into neurons using the activity of the Nestin promoter in human embryonic germ cells (US Patent No. 6,562,619). However, these results are also the results of individual studies of Sox3 , Nestin genes or promoters, and do not provide results in human embryonic stem cells. Sox3 promoter as described above And Nestin promoter can increase the expression activity of the downstream genes in the differentiation of embryonic stem cells into neurons. Therefore, by determining the transcriptional level and translational level of the downstream gene of the promoter of the present invention, the embryonic stem cells can be used as an early marker for detecting whether the neuronal cell differentiation, the cells that differentiate into neuronal cells Judgment can be made early in the eruption. When confirming the downstream gene expression by both promoters using all of the promoter sequences at the same time, compared to the case of detecting whether the differentiation using only one of them, to provide a significantly superior accuracy for the degree and whether differentiation Can be. The inventors first identified the fact that they provide higher sensitivity, accuracy and specificity for identifying and selecting differentiation into neuronal cells than when using only a single promoter marker.

The "agents that measure the activity of Sox3 promoter and / or Nestin promoter" of the present invention are Sox3 promoter And / or any agent that can measure the activity of the Nestin promoter can be used without limitation, preferably the agent is a reporter gene operably linked to the promoter of the invention. The Sox3 promoter and the reporter gene located downstream thereof, and the Nestin promoter and the reporter gene located downstream thereof may be prepared in the form of a structure capable of transferring the genome to the cell and may be transformed into embryonic stem cells. Preferably the structure is a vector. The vector of the present invention can be produced in a suitable form according to the needs of those skilled in the art, and the two promoters and the downstream genes can be prepared in one vector or in one vector.

As used herein, the term "vector" refers to a gene construct, which is an expression vector capable of expressing a protein of interest in a suitable host cell, and which contains essential regulatory elements operably linked to express the gene insert.

"Operably linked" of the present invention means that when the gene is linked downstream of the promoter sequence of the present invention, the gene is linked in a form capable of expression, and any sequence is added to achieve the above object. It may be included as. Examples of any of the above sequences include an operator sequence, a sequence for in frame, and a cis element, such as an enhancer, and a splicing signal, in addition to the gene of the present invention. (splicing signal), poly A addition signal (poly A addition signal), a selection marker (selection marker), a ribosome binding sequence (ribosome binding sequence, SD sequence) and the like may be further included. As examples of selection markers, chloramphenicol resistance genes, ampicillin resistance genes, dihydrofolate reductase, neomycin resistance genes, and the like may be used, but additional components for operably linked by the above examples are limited. It is not.

Preferably the vector of the present invention is Sox3 promoter And a reporter gene downstream of each of the Nestin promoters, more preferably the vector is a vector composed of Sox3 promoter-DsRed, which may be a cleavage map (pLenti6-Sox3-DsRed) on the left side of FIG. 2A, with a Nestin promoter-EGFP. As a constructed vector, a cleavage map (pLenti6-Nestin-EGFP) on the right side of FIG. 2A may be indicated.

In addition, the reporter gene can be used without limitation as long as the gene is expressed according to the promoter activity of the upstream (upstream) to confirm its expression in the cell, and preferably, the reporter gene is any reporter gene capable of color development. It includes. Examples of reporter genes include green fluorescent protein (GFP), modified green fluorescent protein, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), enhanced red fluorescence Protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), and enhanced indigo fluorescent protein (ECFP) and Renila luciferase, red fluorescent protein (DsRed) and the like, but are not limited to the above examples.

In the present invention, specifically, the two promoters of the present invention and reporter genes capable of detecting its expression downstream of each of the promoters (clones) by cloning and transfecting the embryonic stem cells (transfection) as a result, the nervous system In the early stages of cell differentiation, it was confirmed that the two reporter genes exhibited fluorescence. This also overexpressed activity of such a promoter, the results confirmed whether increased in proportion to Sox3 and Nestin within the cell hyeonryanggwa, was confirmed cell hayeoteum expressing the increase in the Sox3 and Nestin, which is expressed in cells wherein the expression level is already known into neural cells Considering the level is similar to the amount, it can be seen that the activity measurement of the two promoters of the present invention can be used as an effective marker for detecting differentiation from embryonic stem cells to neuronal cells.

In addition, the effect of using the two promoters and genes operably linked to the downstream of each of the promoters, higher sensitivity in judging the differentiation into neuronal cells than when using only one promoter and the downstream genes, Accuracy and specificity. In other words, by using the Sox3 promoter and the Nestin promoter as a combination marker (or double marker) at the same time, it was confirmed that high specificity and accuracy can be obtained, and the detection efficiency is significantly increased.

As another aspect, the present invention relates to an embryonic stem cell comprising the composition. In more detail, the embryonic stem cells of the present invention can be prepared by transforming a vector comprising a Sox3 promoter and a Nestin promoter, and a reporter gene operably linked downstream of each promoter.

The method of introducing a vector of the present invention into an embryonic stem cell can be used without limitation methods known in the art, for example, methods using calcium chloride (CaCl ₂ ) and heat shock, electroporation ( electroporation, particle gun bombardment, silicon carbide whiskers, sonication, precipitation using PEG (polyethylenglycol), natural introduction methods, etc. The method of introducing the vector of the present invention is not limited.

As another aspect, the present invention relates to a method for detecting the differentiation from embryonic stem cells to neuronal cells by checking the activity levels of Sox3 promoter and Nestin promoter.

Determination of the transcription level of the downstream genes of the promoter of the present invention can be used without limitation known methods for measuring the expression level of a specific gene, preferably reverse-transcription polymerase chain reaction (RT-PCR) or real-time polymerase chain reaction (Real time PCR) can be used to measure the expression level of the gene level. In addition, confirming the expression level of the protein encoded by the downstream genes of the promoter of the present invention, if the downstream gene is a reporter gene with color development, the expression of the gene, such as the measurement of fluorescence intensity and the amount of color development is measured This can be confirmed by.

Preferably the method comprises the steps of: (a) inducing differentiation from embryonic stem cells to neuronal cells using differentiation inducers; (b) obtaining a nucleic acid sample or protein sample of embryonic stem cells and stem cells which are expected to have differentiation induced; (c) measuring mRNA transcription amount of Sox3 promoter and Nestin promoter downstream gene or expression amount of protein encoded by the gene in the nucleic acid sample or protein sample; And (d) determining that embryonic stem cells have been differentiated into neuronal cells when the amount of transcription of the gene or the expression of the protein of step (c) is increased. Whether to induce differentiation into cells and the stage and extent of differentiation can be determined.

Specifically, the step of inducing differentiation into neuronal cells in the step (a) may be used without limitation the method of differentiation into neuronal cells used in the art, according to the choice of those skilled in the art by adding appropriate differentiation inducing substances and culture conditions By setting. Preferably, the method may be cultured so that embryonic stem cells can form EB using EB (embryoid body) medium, and then transferred to NES (Neuroectodermal sphere) medium to induce differentiation into neuronal cells. Differentiation induction method is not limited by.

In the step (c), the mRNA transcription amount measurement of the gene may be performed by measuring the transcription level of the downstream gene of the promoter of the present invention, polymerase chain reaction (PCR), real time polymerase chain reaction (Real time PCR) And electrophoresis. In a preferred embodiment of the present invention it was confirmed that the transcription level is significantly increased in the cell-specific differentiated downstream genes of the present invention cells.

In addition, the method for detecting at the protein level the differentiation of embryonic stem cells from the embryonic stem cells of the present invention can be confirmed by the expression of genes operably linked to the downstream of the promoter of the present invention. In particular, when the downstream gene is a gene involved in color development and fluorescence as a reporter gene, methods such as fluorescence microscopy and flow cytometric analysis can be used.

In addition, when the degree of color development is increased by the reporter gene, in order to confirm whether the corresponding cells have successfully differentiated into neuronal cells, it is possible to further confirm whether the expression of the protein with increased expression by differentiating the original cells into neural cells. have. In a preferred embodiment of the present invention, as a result of performing immunochemistry on the cells that have been determined to differentiate into neuronal cells by the development of the reporter gene, they are neural stem cell markers in almost all cells determined to be neuronal cells by the development of the reporter gene. It was confirmed that Nestin and Tuj1 were expressed (Example 7). This means that it has high specificity and accuracy as compared to the conventional method of confirming whether one gene is expressed and confirms the degree of differentiation, and when using the reporter system of the present invention, separate protein expression is confirmed. It means that the process is unnecessary.

In another aspect, the invention provides a Sox3 promoter And a method of regulating differentiation from embryonic stem cells to neuronal cells by increasing or decreasing the expression of genes downstream of the Nestin promoter.

In the present invention, a method of increasing gene expression for inducing differentiation into an effective neuronal cell may use various methods known in the art for increasing gene expression in a cell, and preferably, a vector comprising the genes may be prepared. These cells can be transduced.

In addition, the method for lowering the gene expression rate in order to prevent differentiation into neuronal cells in the present invention may use a method known in the art that can delete genes in cells or lose gene function through gene mutation, Preferably, small hairpin RNA (shRNA) or siRNA for the genes can be designed, and they can be transduced into cells to lower the expression of these genes.

In the case of using such a control method, not only the promoter by introducing the reporter system, but also the activity of the promoter originally contained in the stem cells can be regulated, thereby ultimately facilitating the promotion or suppression of the differentiation of embryonic stem cells. do.

 In the present invention, a regulator for inducing differentiation may include a molecule capable of increasing the expression rate of the gene, preferably a vector capable of overexpressing the gene, and a regulator for preventing differentiation may lower the expression rate of the gene. Molecules, preferably siRNA or shRNA, etc. for the gene. In addition, the promoters of the present invention appear to be very closely related to differentiation regulators for differentiation into neuronal cells, and therefore, their inhibitory or promoters can be used to increase or inhibit differentiation efficiently and conveniently. Therefore, the agent for differentiation into neuronal cells of the present invention can be used as an agent for the prevention and treatment of neurological diseases including stroke, spinal cord injury, and specifically, such neurological diseases include, for example, stroke, Parkinson's disease, Alzheimer's disease, Pick's disease, Huntington's disease, Amyotrophic lateral sclerosis, traumatic central nervous system diseases, and spinal cord injury disease And the like, the disease that can be used by the nervous system cells of the present invention by the above examples are not limited.

In another aspect, the present invention provides a method for treating embryonic stem cells, the method comprising: treating candidate stem cells expected to regulate differentiation into neuronal cells; And measuring the transcriptional activity of Sox3 promoter and Nestin promoter downstream genes or the expression level of proteins encoded by the genes in embryonic stem cells and stem cells expected to be differentiated. A method for screening differentiation regulating materials in a furnace is provided.

As used herein, the term "candidate substance" refers to any substance that is expected to indirectly or directly inhibit or induce changes in the amount of gene expression significantly occurring in cells upon induction of differentiation into neuronal cells. Differentiation modulators selected by the candidate screening can be adjusted to induce differentiation by further increasing the activity of Sox3 promoter and Nesti n promoter or to inhibit differentiation by decreasing their activity.

Thus, the activity of a promoter of the present invention on neuronal cells in the presence and absence of differentiation control candidates is regulated to compare differentiation from embryonic stem cells to neuronal cells by comparing the increase or decrease in the amount of downstream gene expression of the promoter. In addition, it can be usefully used to search for differentiation control factors.

Sox3 promoter of the invention And Nestin promoters, and reporter genes operably linked downstream thereof, can quickly and accurately detect the process of differentiation from embryonic stem cells to neuronal cells, effectively selecting cells that differentiate into neuronal cells and characterizing them. I can figure it out. Also from this, it provides an effective means that can be utilized to develop cell therapy of neurological diseases. In addition, by inhibiting or promoting the promoter of the present invention and its downstream gene or the protein encoded by the gene, it can be used in the search for candidates that can control differentiation into neuronal cells, the candidate selected by the above method the nervous system It can be used as a differentiation regulator for controlling differentiation into cells.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for carrying out the present invention by way of example, but the scope of the present invention is not limited to these examples.

Example 1 Human Embryonic Stem Cell Culture

In the present invention, human embryonic stem cells (hESCs) were cultured by using a mouse embryonic fibroblast (MEF) obtained from a 13.5-day-old CF1 mouse fetus as a feeder cell. Feeder cells were cultured in DMEM (high glucose, Invitrogen) containing 10% FBS (Gibco), 0.1 mM β-mercaptoethanol, 0.1 mM non-essential amino acids, and then 3000 rad gamma to stop mitosis. The radiation was irradiated. Thereafter, MEF feeder cells irradiated with gamma radiation at a concentration of 3 × 10 ⁵ were seeded on a 60 mm petri dish coated with 0.1% gelatin. The day after seeding the feeder cells, hESCs were seeded, hESC medium (Dulbecco's modified Eagle's medium) / F12 (Gibco, Rockville, MD, USA), 20% Knockout SR (Gibco), 0.1 mM β- Mercaptoethanol (Sigma, St Luis, MO, USA), 2 mM glutamine (Gibco), 0.1 mM non-essential amino acid (Gibco), 100 U / ml penicillin-streptomycin (streptomycin) (Gibco), 4 ng / ml bFGF (Invitrogen). Each day, the culture medium was replaced and cultured. The hESCs cultured for 5-7 days were cut into 250x250 mm using tissue chopper (Mickle Engineering), and then the enzyme using 1 mg / ml collagenase (Gibco) was used. Subcultured in an enzymatic manner.

Example 2. Sox3 Promoter and Nestin Preparation of the Promoter Vector

<2-1> Lenti Virus Vector Construction

To prepare pLenti6- Sox3 promoter-DsRed, genomic DNA was extracted from hESCs and PCR-amplified the Sox3 promoter and Nestin promoter using the following primer sets. Sox3 promoter sense primer is 5'- TGC GGG CTG GCC GGG GG -3 '(SEQ ID NO: 1), Sox3 promoter antisense primer is 5'- GGG GTT CTT GAG TTC AGT CTC CAG AAG GCT G -3' (SEQ ID NO: 2) to be. Nestin promoter sense primers are 5'- GGA GCA GGA GAA ACA GGG CCT ACA GAG CC -3 '(SEQ ID NO: 3), Nestin promoter antisense primers are 5'- AAG TCT TGG AGC CAC CGC C -3' (SEQ ID NO: 4) to be. After PPCR, the products of the 711 bp Sox3 promoter and the 1855 bp Nestin promoter, respectively, were obtained (FIG. 1), and each product was inserted into a pENTR5'-TOPO vector (Invitrogen) using a TA cloning method. pENTR5'- Sox3 and pENTR5'- Nestin were prepared. To confirm the activity of the Sox3 promoter, pDsRed2 (Clontech) vector containing fluorescence-expressing DsRed gene was used as a template for the sense primer 5'- CAC C AT GGC CTC CTC CGA GAA C-3 '(SEQ ID NO: 5) and antisense primer. PCR amplification using 5'-CAG GAA CAG GTG GTG GCG GC-3 '(SEQ ID NO: 6). The PCR product of the amplified DsRed gene contains the CACC sequence for directional cloning in the pENTR / D-TOPO vector (Invitrogen, Carlsbad, CA) (underlined). The resulting 675bp sized product was inserted into pENTR / D-TOPO vector to prepare pENTR / D-TOPO- DsRed . To confirm the activity of the Nestin promoter, pEGFP-N3 (Clontech) vector with fluorescence expressing EGFP gene was used as a template for the sense primer 5'- CAC C AT GGT GAG CAA GGG CGA G-3 '(SEQ ID NO: 7), PCR amplification using antisense primer 5′-CTT GTA CAG CTC GTC CAT GCC GAG-3 ′ (SEQ ID NO: 8). The PCR product of the amplified EGFP gene contains a CACC sequence for directional cloning in the pENTR / D-TOPO vector (Invitrogen, Carlsbad, Calif.) (Underlined). The resulting 717 bp product was inserted into the pENTR / D-TOPO vector to prepare pENTR / D-TOPO-EGFP. The pLenti6- Sox3 promoters-the DsRed and pLenti6- Nestin promoters-were inserted into the pLenti6 / R4R2 / V5-DEST destination vector by LR clonase reaction using a gateway system (Invitrogen) using entry vectors as the entry clones, respectively. EGFP was constructed (FIG. 2A).

<2-2> Non-viral Plasmid Vector Construction

To prepare Sox3 promoter-EGFP, genomic DNA was extracted from hESCs and PCR-amplified Sox3 promoter using the following primer sets. Sense primer 5'- CAT TGCGGGCTGGCCGG AAGCTT-3 '(SEQ ID NO: 9), as, for convenience of cloning was inserted into the HindIII restriction site (underlined), the antisense primer 5'- CTA GGTTCTTGAGTTCAGTCTCCA GGATCC-3' ( As SEQ ID NO: 10), the BamHI restriction site was inserted (underlined). After PCR, the 729 bp-sized product was treated with HindIII and BamHI restriction enzymes, and the 711 bp Sox3 promoter product was obtained and inserted into the pEGFP-1 vector (Clontech) treated with the same restriction enzyme, pEGFP-1. Sox3 promoter vector was constructed (FIG. 2B).

To prepare the Nestin promoter-EGFP, genomic DNA was extracted from the hESCs and then PCR amplified the Nestin promoter using the following primer sets. The sense primer was 5'-AGT AAG CTT GGA GCA GGA GAA ACA GGG CC-3 '(SEQ ID NO: 11), and the HindIII restriction enzyme site was inserted (underlined) for cloning convenience, and the antisense primer was 5'- As ATA GGT ACC AAG TCT TGG AGC CAC CGC C-3 ′ (SEQ ID NO: 12), a KpnI restriction enzyme site was inserted (underlined portion). After PCR, the resulting 1873p-sized product was treated with HindIII and KpnI restriction enzymes to obtain a 1855 bp Nestin promoter product, and inserted into pEGFP-1 vector (Clontech) treated with the same restriction enzyme, pEGFP-1. Nestin promoter vector was constructed (FIG. 2B).

Example 3. Construction and Identification of Neuronal Cell Specific Promoter-expressing Cell Lines

<3-1> Construction of Sox3 promoter-DsRed expressing cell line through Lentivirus-mediated infection

The pLenti6- Sox3 promoter-DsRed vector prepared in Example 2-1 was transfected into the HEK293T packaging cell line (Invitrogen) using lipofectamine2000 (Invitrogen). Specifically , 3.0 μg of Sox3 promoter-DsRed vector DNA and 6.0 μg of packaging mix plasmid were mixed with 500 ul of serum-free Opti-MEM medium (Gibco) and 36 ul of lipofectamine2000 reagent was added to 500 ul of serum-free Opti-MEM medium. It was placed and left at room temperature for 5 minutes. 500 ul of the diluted plasmid solution and 500 ul of the diluted lipofectamine2000 reagent are mixed and allowed to stand at room temperature for 20 minutes to form a plasmid-lipofectamine2000 complex, and then the 1000 ul of the solution is added to the culture medium in which the HEK293T packaging cells are cultured, and gently shaken to mix. Then incubated for 24 hours. The next day, the medium was changed and supernatant was taken from the culture for 24 hours, and then filtered with 0.45 um (Millipore) to remove cell debris. After 30 ml of the filtered supernatant was centrifuged at 20,000 rpm for 2 hours, the supernatant was removed, and 500 ul of HPSS (Gibco) was added to the remaining precipitate to concentrate the virus. HESCs cultured for 5-7 days were cut into 250x250 mm using tissue chopper (Mickle Engineering), and then treated with 1 mg / ml collagenase (Gibco) and coated with Matrigel (Becton Dickinson). Incubated in a conditioned medium (conditioned medium). The next day, 200 ul of concentrated virus solution and 6-8 μg / ml polybrene (sigma) were added to hESCs and cultured for 24 hours. As shown in FIG. 2A, since the Sox3 promoter-DsRed vector contains a blasticidin resistance gene, when the vector is properly transfected into a cell, the cell line has a blasticidin marker. Resistance to blasticidine. Therefore, from the next day, 1 μg / ml blasticidine was added to hESC medium. Thereafter, the medium was incubated for 3 weeks while changing the medium every two days. After 3 weeks, when the cells formed a circular colony, the colonies were transferred to a 4-well plate. Thereafter, the cells were transferred to a 35 mm, 60 mm petri dish and the cell number was increased.

In this way, the genome DNA of the isolated and constructed cell line was separated through the following process and used as a template for PCR (Polymerase Chain Reaction). The cell lines were collected and incubated for 1 hour with extraction buffer containing 1 M KCl, 1 M MgCl ₂ , 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 μg / mL proteinase K at 55 ° C. did. Proteinase K was inactivated by heating at 95 ° C for 10 minutes, and the supernatant containing genome DNA was stored at 4 ° C. The genome DNA obtained by the above process was used as a template, and 5'-AGCTCCTGGGGATTTGGGGT-3 '(SEQ ID NO: 13) and 5'-AACCCTGTCAAGGCAGACCG-3' (SEQ ID NO: 14) were used as Sox3 promoter primers, and 5'-GAAGGTGAAGGTCGGAGTC- PCR was performed using Taq polymerase (Takara) using 3 '(SEQ ID NO: 15) and 5'-GAAGATGGTGATGGGATTTC-3' (SEQ ID NO: 16) as the GAPDH primers: denaturation was carried out at 94 ° C 30 Secondly, annealing was performed at 55 ° C. for 30 seconds and extension reaction was performed at 72 ° C. for 1 minute, for a total of 30 cycles. The PCR product was then electrophoresed on a 1.5% agarose gel to confirm that the DNA of the region containing Sox3 promoter- DsRed was synthesized (FIG. 3A). From this, it was confirmed that the cell line constructed by the above method was transfected by Sox3 promoter-DsRed.

<3-2> Construction of Nestin Promoter-EGFP Expressing Cell Line through Lipofectamine2000 Transfection

The Nestin promoter-EGFP vector prepared in Example 2-2 was transfected into hESCs using lipofectamine2000 (Gibco) as follows. HESCs cultured for 5-7 days were cut into 250x250 mm using tissue chopper (Mickle Engineering), and then treated with 1 mg / ml collagenase IV (Gibco) and coated with Matrigel (Becton Dickinson). Incubated in a conditioned medium (conditioned medium). 4.0 μg of plasmid DNA was mixed with 500 μl of serum-free Opti-MEM medium (Gibco), 10 μl of lipofectamine2000 reagent was added to 500 μl of serum-free Opti-MEM medium, and left at room temperature for 5 minutes. 500 ul of the diluted plasmid solution and 500 ul of the diluted lipofectamine2000 reagent are mixed and allowed to stand at room temperature for 20 minutes to form a plasmid-lipofectamine2000 complex.The 1000 ul of the solution is added to the medium in which the hESCs are incubated and gently mixed. Incubated for 24 hours. As shown in Figure 2b, the Nestin promoter- EGFP vector contains a neomycin phosphotransferase gene that is resistant to neomycin. Through this, when the vector is properly transfected into the cell, the cell line has a neomycin marker and thus has resistance to G-418, thereby avoiding the toxic effects of G-418 and proliferating. Therefore, from the next day, the cells were cultured using a medium containing 200 μg / ml of Geneticine in the hESCs medium, and then cultured for 3 weeks while changing the medium every 2 days. Once the colonies were formed, the colonies were transferred to 4-well plates. Thereafter, the cells were transferred to a 35 mm, 60 mm petri dish and the cell number was increased.

In this way, the genome DNA of the isolated and constructed cell line was separated through the following process and used as a template for PCR (Polymerase Chain Reaction). The cell lines were collected and incubated for 1 hour with extraction buffer containing 1 M KCl, 1 M MgCl ₂ , 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 μg / mL proteinase K at 55 ° C. did. After heating for 10 minutes to 95 to inactivate proteinase K, the supernatant containing the genome DNA was stored at 4 ℃. The genome DNA obtained by the above process was used as a template, and 5'-AGAATCGCAAAACCAGCAAG-3 '(SEQ ID NO: 17) and 5'-AGCATGTGTGTGTGCCTCTG-3' (SEQ ID NO: 18) were used as Nestin promoter primers, and 5'-GAAGGTGAAGGTCGGAGTC- PCR was performed using Taq polymerase (Takara) using 3 'and 5'-GAAGATGGTGATGGGATTTC-3' as GAPDH primers: denaturation at 94 ° C for 30 seconds, annealing at 55 ° C for 30 seconds, The extension reaction was carried out for 30 minutes at 72 ℃. The PCR product was then electrophoresed on a 1.5% agarose gel to confirm that the DNA of the region containing Sox3 promoter- DsRed was synthesized (FIG. 3B). From this, it was confirmed that the cell line constructed by the above method was transfected by the Nestin promoter- EGFP .

<3-3> Construction of Sox3 Promoter- DsRed and Nestin Promoter- EGFP Co-expressing Cell Lines through Lentivirus - Mediated Infection and Lipofectamine2000 Transfection

In the Sox3 promoter-DsRed cell line constructed using Lentivirus-mediated infection in Example 3-1, the Nestin promoter- EGFP vector prepared in Example 2-2 was prepared in the same manner as in Example 3-2. Transfection was performed using lipofectamine2000 (Invitrogen). As shown in FIG. 2B, since the Nestin promoter-EGFP vector contains a neomycin resistance gene, 200 μg / ml of geneticine (Geneticine) was added to hESC medium. Thereafter, the medium was incubated for 3 weeks while changing the medium every 2 days. After 3 weeks, when the cells formed circular colonies, the colonies were transferred to a 4-well plate. Thereafter, the cells were transferred to a 35 mm, 60 mm petri dish and the cell number was increased.

Thus, the genome DNA of the isolated and constructed cell line was separated through the following process and used as a template of PCR (Polymerase Chain Reaction). The cell lines were collected and incubated for 1 hour with extraction buffer containing 1 M KCl, 1 M MgCl ₂ , 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 μg / mL proteinase K at 55 ° C. did. Proteinase K was inactivated by heating at 95 ° C for 10 minutes, and the supernatant containing genome DNA was stored at 4 ° C. Since the genome DNA obtained by the above process was used as a template and the transfection of Sox3 promoter- DsRed was already confirmed in Example 3-1, the EGFP gene could be amplified to confirm the transfection of Nestin promoter- EGFP . 5'-TATATCATGGCCGACAAGCA-3 '(SEQ ID NO: 19) and 5'-GAACTCCAGCAGGACCATGT-3' (SEQ ID NO: 20) primers and 5'-GAAGGTGAAGGTCGGAGTC-3 'and 5'-GAAGATGGTGATGGGATTTC-3' as GAPDH primers, PCR was carried out using Taq polymerase (Takara) as follows: 28 cycles of denaturation at 94 ° C, annealing at 58 ° C for 30 seconds, and extension reaction at 72 ° C for 1 minute. . Then, PCR products were electrophoresed on a 1.5% agarose gel to confirm that DNA of the EGFP gene region possessed by the Nestin promoter-EGFP vector was synthesized (FIG. 3C). From this, it was confirmed that the cell line constructed by the above method was transfected with two neuronal marker promoters, Sox3 promoter- DsRed and Nestin promoter- EGFP .

Example 4 Preparation of Neuroectodermal Spheres (NESs) from Human Embryonic Stem Cells

HESCs cultured for 6-7 days were cut into 500x500 mm using tissue chopper (Mickle Engineering), and then treated with collagenase at a concentration of 1 mg / ml to separate into even cell masses. Carefully transfer the separated hESCs to a bacterial plate carefully to avoid breaking them into an embryoid body body (Dulbecco's modified Eagle's medium (DMEM) / F12 (Gibco), 10% Knockout SR (Gibco) ), 0.1 mM β-mercaptoethanol (Sigma), 2 mM glutamine (Gitamine, Gibco), 0.1 mM non-essential amino acid (Gibco), 100 U / ml penicillin-streptomycin (streptomycin) (Gibco)) was cultured to form EB. At this time, the culture medium and the plate were replaced every day. EB cultured in EB (embryoid body) cultures for 6 days was treated with NES medium (DMEM / F12, B27 supplement (1:50), N2 supplement (1: 100), 100 U / ml penicillin-streptomycin (streptomycin). (Gibco), 20 ng / ml bFGF (Invitrogen), 20 ng / ml human epidermal growth factor (EGF) (Invitrogen) and 10 ng / ml human leukemia inhibitory factor (LIF, Sigma) Differentiate into cells and allow them to grow sufficiently (change medium every other day). Once a week using a tissue chopper was cut to 100x100 mm and subcultured.

Example 5. Investigation of promoter transcriptional activity using neuronal cell-specific promoter-expressing cell lines

<5-1> Promoter Activity Studies Using Sox3 Promoter- DsRed and Nestin Promoter- EGFP Expressing Cell Lines

Sox3 promoter- DsRed and Nestin promoter- EGFP expressing hESCs were differentiated into neuroectodermal spheres (NESs) by the method of Example 4 above. Differentiation into neural progenitor cells (NESs) using these cell lines results in the generation of neural progenitor cells expressing DsRed (red fluorescence) and EGFP (green fluorescence) by Sox3 and Nestin promoters, respectively. This was confirmed by observing with a fluorescence microscope (Fig. 4a). As a result, it can be seen that the neural rosettes are formed as in the neural progenitor cells (NESs) differentiated from the control hESCs. However, Sox3 promoter-DsRed and Nestin promoter - the nerve Old World inlet to each expressing DsRed (red fluorescence) and the EGFP (green fluorescence) by the Sox3 promoter and Nestin promoter EGFP expression hESCs nerve Old World inlet (NESs) created by using the It was confirmed that it was made.

<5-2> Promoter Activity Studies Using Sox3 Promoter-DsRed and Nestin Promoter-EGFP Coexpressing Cell Lines

Sox3 promoter- DsRed and Nestin promoter- EGFP co-expressing hESCs were differentiated into neural progenitor cells (NESs) by the method of Example 4 above. When a neural precursor cell differentiation port using this cell line, the expression of DsRed (red fluorescence) by Sox3 promoter, and neurons expressing EGFP (green fluorescence) by Nestin promoter will be made. This was confirmed by observing with a fluorescence microscope (Fig. 4b). As a result, fluorescence was not expressed in the EB formation step. When the cells were changed into neuronal cell media to differentiate into neural progenitor cells, DsRed (red fluorescence) was expressed by the Sox3 promoter from the early neuronal differentiation step, and Nestin Neuronal cells expressing EGFP (green fluorescence) could be observed by the promoter (FIG. 4B). Through this, when the Sox3 promoter and the Nestin promoter, which are specifically expressed from the beginning of differentiation, are used as the combination marker and the double marker, the detection efficiency is remarkably increased since it is possible to confirm the differentiation into neurons with high sensitivity and specificity. .

Example 6 RT-PCR Analysis of Neuronal Cell Specific Genes

<6-1> RT-PCR Analysis of Neuronal Specific Genes Using Sox3 Promoter- DsRed and Nestin Promoter- EGF P Expressing Cell Lines

To confirm the expression of neuronal cell specific marker genes, human neural progenitor cells differentiated from control hESCs, human neural progenitors (hNP), and Sox3 promoter-DsRed expressing human embryonic stem cell lines (hNP- Sox3 ) and total RNA 2 mg isolated from hNP- Nestin differentiated from Nestin promoter-EGFP-expressing human embryonic stem cell line using a Superscript kit (Invitrogen) as a template for 42 and 90 minutes Reverse transcription. The base sequence of the primer set used for the PCR reaction was Sox1 sense primer 5'-GGGAAAACGGGCAAAATAAT-3 '(SEQ ID NO: 21) Sox1 antisense primer 5'-CCATCTGGGCTTCAAGTGTT-3' (SEQ ID NO: 22) Sox3 sense primer 5'-GACGCCTTGTTTAGCTTTGC-3 ' (SEQ ID NO: 23) Sox3 antisense primer 5'-TTCTCCCATTCACTCCTTGG-3 '(SEQ ID NO: 24) Musashi1 sense primer 5'-ACCCCCACATTCTCTCACTG-3' (SEQ ID NO: 25) Musashi1 antisense primer 5'-AAACCCAAAACACGAACAGAGC-3 '(SEQ ID NO: 26) Musashi2 sense primer 5'-TTTGTAGGCGGGTTATCTGC-3 '(SEQ ID NO: 27) Musashi2 antisense primer 5'-GCCATAGCTTGGAGCAAATC-3' (SEQ ID NO: 28) Tuj1 sense primer 5'-ACCTCAACCACCTGGTATCG-3 '(SEQ ID NO: 29) Tuj1 antisense primer 5' -GGGATCCACTCCACGAAGTA-3 '(SEQ ID NO: 30) Pax6 sense primer 5'-ATGAGGCTCAAATGCGACTT-3' (SEQ ID NO: 31) Pax6 antisense primer 5'-CATTTGGCCCTTCGATTAGA-3 '(SEQ ID NO: 32) Nestin sense primer 5'-AACAGCGACGGAGGTC TCTA-3 '(SEQ ID NO: 33) Nestin antisense primer 5'-TTCTCTTGTCCCGCAGACTT-3' (SEQ ID NO: 34), and amplification of GAPDH used as a control was 5'-GAAGGTGAAGGTCGGAGTC-3 'and 5'-GAAGATGGTGATGGGATTTC-3' Used as. RT-PCR reaction conditions used for this amplification were denatured at 94 ° C. for 5 minutes, followed by 30 times at 94 ° C., 30 seconds at 58 ° C., 30 seconds at 72 ° C., and 30 times at 72 ° C. A polymerization reaction was performed for 1 minute. As a result, the RT-PCR product was electrophoresed on 1.5% agarose gel to differentiate human neuroprogenitor cells (hNP-Sox3) and Nestin promoter-EGFP expressing human embryos from Sox3 promoter-DsRed expressing hESCs. Expression of Sox1, Sox3 , Musashi1, Musashi2, Tuj1, Pax6, Nestin and control GAPDH in human neuronal progenitor cells (hNP- Nestin ) differentiated from stem cell lines was confirmed (Fig. 5a). The expression of the molecular markers in the cells prepared by the method of the present invention was examined by RT-PCR, and then differentiated from human neuroprogenitor cells differentiated from control human embryonic stem cell lines and Sox3 promoter-DsRed and Nestin promoter-EGFP expressing hESCs. It was confirmed that the expression of neuronal specific markers such as Sox1, Sox3, Musashi1, Musashi2, Tuj1, Pax6, Nestin and Pax6 in human neural progenitor cells was almost similar.

<6-2> RT-PCR Analysis of Neuronal Cell Specific Genes Using Sox3 Promoter- DsRed and Nestin Promoter- EGFP Coexpressing Cell Lines

Sox1, Sox3, Musashi1, Musashi2, Tuj1, Pax6, Nestin, and human neural precursor cells (hNP- Sox3 + Nestin ) differentiated from Sox3 promoter- DsRed and Nestin promoter- EGFP co-expressing hESCs by the method of Example 6-1. Expression of control GAPDH was confirmed, respectively (FIG. 5B). The expression of the molecular markers in the cells prepared by the method of the present invention was examined by RT-PCR. As a result, human neural progenitor cells differentiated from control hESCs and human neurons differentiated from Sox3 promoter- DsRed and Nestin promoter- EGFP co-expressing hESCs. Expression of neuronal specific markers such as Sox1, Sox3, Musashi1, Musashi2, Tuj1, Pax6, Nestin in progenitor cells (hNP- Sox3 + Nestin ) is almost similar to human neuronal precursor cells (hNP) differentiated from control human embryonic stem cells It was confirmed that it is expressed as an aspect.

Example 7 Immunocytochemistry Analysis of Specific Proteins of Neuronal Cells

The neural progenitor cells (NESs) obtained in Example 4 were attached onto Matrigel (Becton Dickinson) -coated cover glass and incubated in NES medium for 24 hours. After removing the medium, the remaining medium residue was washed three times with PBS and fixed for 30 minutes with PBS containing 4% paraformaldehyde. After washing three times with PBS, the solution was infiltrated with PBS containing 0.1% Triton-X100 for 10 minutes and blocked by reacting with 10% NGS (normal goat serum) for 1 hour. Then, the antibody was mixed with PBS / 0.1% BSA / 5% NGS and the following concentrations were treated to the cells and reacted at 4 ° C. for 20 hours. Anti- nestin antibody (Chemicon, MAB5326, mouse monoclonal IgG) was 1/200, and anti-Tuj1 antibody (covance, MMS-435P, mouse monoclonal IgG) was used at a concentration of 1/200. At the end of the primary antibody reaction, the cells were washed with PBS and treated with a suitable secondary antibody for 1 hour at room temperature. Nuclei were stained using DAPI. After all reactions were mounted (mounted) to confirm the staining with a fluorescence microscope and photographed (Fig. 6). As a result, it was confirmed that Nestin and Tuj1, which are neurological specific markers, were expressed in almost all cells. In addition, it was confirmed that these neurological specific markers co-express DsRed (red fluorescence) and EGFP (green fluorescence) by Sox3 promoter and Nestin promoter, respectively.

1 is a diagram showing the nucleotide sequence of the Sox3 promoter and Nestin promoter.

FIG. 2 shows a vector comprising a Sox3 promoter and a Nestin promoter, FIG. 2A shows a pLenti6- Sox3 promoter- DsRed and pLenti6- Nestin promoter- DsRed vector, and FIG. 2B shows the EGFP as a Sox3 promoter and a Nestin promoter. The figure shows the vector configured to be located downstream of each.

3 is a result of confirming whether the prepared vector has been successfully transfected into embryonic stem cell line, Figure 3a is the result of performing electrophoresis on cells transfected with Sox3 promoter- DsRed , Figure 3b is Nestin promoter- Electrophoresis was performed on the cells transfected with EGFP . Figure 3c is a photograph confirming the simultaneous transfection by Sox3 promoter- DsRed and Nestin promoter- EGFP .

Figure 4 Somatic stem cells are differentiated into neuronal cells Sox3 promoter And a picture confirming whether the Nestin promoter is activated, Figure 4a is a Sox3 promoter And Nestin promoter It is a graph confirming that red and green fluorescence are developed for each. 4b is a photograph showing that red fluorescent light by Sox3 and green fluorescent light by Nestin are developed in one cell line for Sox3 and Nestin .

5 is a photograph confirming the expression of neural system specific marker genes (sox1, Sox3 , musashi1 musashi2, Tuj1, Pax6, Nestin ) and control GAPDH in nervous system differentiation-induced cells. Figure 5a is a control ES cells and the neural cells differentiated therefrom, Sox3 - induced cell differentiation in the building are transfected with a vector that contains the reporter gene, embryonic stem cells and neural cells therefrom (hNP- Sox3) and Nestin - Reporter Gene It is a picture confirming the expression of the neuronal specific marker genes for each of the embryonic stem cells constructed by transfecting with a vector containing and cells induced differentiation into the neuronal cells (hNP- Nestin ). FIG. 5B shows differentiation-induced cells into neural cells from embryonic stem cells constructed by transfecting with control embryonic stem cells and neuronal cells differentiated therefrom, a vector comprising a Sox3 promoter-reporter gene and a Nestin promoter-reporter gene (hNP- Sox3 + Nestin ) is a picture confirming the expression of the neuronal specific marker gene.

Figure 6 shows the results of confirming the expression of nervous system specific proteins (Tuj1 and Nestin ) by immunochemical analysis.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Reporter system comprising dual promoter and methods for          analyzing the differentiation into neural lineage <130> PA090180 / KR <160> 34 <170> KopatentIn 1.71 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Sox3 promoter <400> 1 tgcgggctgg ccggggg 17 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Sox3 promoter <400> 2 ggggttcttg agttcagtct ccagaaggct g 31 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Nestin promoter <400> 3 ggagcaggag aaacagggcc tacagagcc 29 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Nestin promoter <400> 4 aagtcttgga gccaccgcc 19 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of DsRed gene <400> 5 caccatggcc tcctccgaga ac 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of DsRed gene <400> 6 caggaacagg tggtggcggc 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of EGFP gene <400> 7 caccatggtg agcaagggcg ag 22 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of EGFP gene <400> 8 cttgtacagc tcgtccatgc cgag 24 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Sox3 promoter with HindIII restriction site <400> 9 cataagcttt gcgggctggc cgg 23 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Sox3 promoter with BamHI restriction site <400> 10 ctaggatccg gttcttgagt tcagtctcca 30 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Nestin promoter with HindIII restriction site <400> 11 agtaagcttg gagcaggaga aacagggcc 29 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Nestin promoter with BamHI restriction site <400> 12 ataggtacca agtcttggag ccaccgcc 28 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Sox3 promoter for PCR <400> 13 agctcctggg gatttggggt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Sox3 promoter for PCR <400> 14 aaccctgtca aggcagaccg 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of GAPDH <400> 15 gaaggtgaag gtcggagtc 19 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of GAPDH <400> 16 gaagatggtg atgggatttc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forword primer of Nestin promoter <400> 17 agaatcgcaa aaccagcaag 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Nestin promoter <400> 18 agcatgtgtg tgtgcctctg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forword primer of EGFP for amplification <400> 19 tatatcatgg ccgacaagca 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of EGFP for amplification <400> 20 gaactccagc aggaccatgt 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Sox1 <400> 21 gggaaaacgg gcaaaataat 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Sox 1 <400> 22 ccatctgggc ttcaagtgtt 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Sox3 <400> 23 gacgccttgt ttagctttgc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Sox 3 <400> 24 ttctcccatt cactccttgg 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Musashi 1 <400> 25 acccccacat tctctcactg 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Musashi 1 <400> 26 aaacccaaaa cacgaacagc 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Musashi2 <400> 27 tttgtaggcg ggttatctgc 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Musashi2 <400> 28 gccatagctt ggagcaaatc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Tuj1 <400> 29 acctcaacca cctggtatcg 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Tuj1 <400> 30 gggatccact ccacgaagta 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Pax6 <400> 31 atgaggctca aatgcgactt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Pax 6 <400> 32 catttggccc ttcgattaga 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Nestin <400> 33 aacagcgacg gaggtctcta 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Nestin <400> 34 ttctcttgtc ccgcagactt 20  

Claims (13)

Sox3 promoter And a composition for measuring nestin promoter activity, the composition for detecting promoter activity for detecting whether differentiation from embryonic stem cells to neuronal cells. The composition of claim 1, wherein the embryonic stem cells are derived from humans. The composition of claim 1, wherein the agent measuring promoter activity is a vector comprising a Sox3 promoter and a reporter gene operably linked with the Sox3 promoter, and a Nestin promoter and a reporter gene operably linked with the Nestin promoter. The reporter gene of claim 3, wherein the reporter gene operably linked to the Sox3 promoter and the Sox3 promoter is pLenti6-Sox3-DsRed, represented by the cleavage map of FIG. 2A, and the reporter gene operably linked to the Nestin promoter and the Nestin promoter. Is pLenti6-Nestin-EGFP represented by the cleavage map of FIG. 2A. The method of claim 3, wherein the reporter gene is a green fluorescent protein (GFP), modified green fluorescent protein (modified green fluorescent protein), enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP) , Enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), enhanced Indigo blue fluorescent protein (ECFP), DsRed and Renila luciferase. Embryonic stem cell comprising the composition according to any one of claims 1 to 5. A method for detecting the differentiation of embryonic stem cells into neuronal cells by checking the activity levels of Sox3 promoter and Nestin promoter. The method of claim 7, wherein (a) inducing differentiation from embryonic stem cells to neuronal cells using differentiation inducing substances; (b) obtaining a nucleic acid sample or protein sample of embryonic stem cells and stem cells which are expected to have differentiation induced; (c) measuring the mRNA transcription amount of the Sox3 promoter and the Nestin promoter downstream gene or the protein expression encoded by the gene in the nucleic acid sample or protein sample; And (d) determining that embryonic stem cells have differentiated into neuronal cells when the amount of transcription of the gene of step (c) or the amount of expression of the protein is increased. The method of claim 7, wherein the expression level of the gene in step (c) is confirmed by reverse transcription polymerase chain reaction (RT-PCR) or real time polymerase chain reaction (Real time PCR). The method of claim 7, wherein the downstream gene is a green fluorescent protein (GFP), modified green fluorescent protein (modified green fluorescent protein), enhanced green fluorescent protein (ERFP), blue fluorescent protein (BFP) , Enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), indigo fluorescent protein (CFP), enhanced indigo fluorescent protein (ECFP), DsRed and Renilla Luciferase (Renila) luciferase). The method of claim 7, wherein the step of measuring the expression level of the protein in step (c) is to compare the color development level of the downstream gene expressed by the Sox3 promoter and Nestin promoter with the color development level in the protein sample of embryonic stem cells And a step. A method of regulating differentiation from embryonic stem cells to neuronal cells by increasing or decreasing Sox3 promoter and Nestin promoter activity. Treating embryonic stem cells with candidate substances expected to regulate differentiation into neuronal cells; And measuring the transcriptional activity of Sox3 promoter and Nestin promoter downstream genes or the expression level of proteins encoded by the genes in embryonic stem cells and stem cells expected to be differentiated. Method for screening differentiation regulating substances in furnace.

Images