KR20110038380A - Rt-pcr for differentiation of seven serotypes of foot-and-mouth disease virus - Google Patents

Abstract

PURPOSE: A method for diagnosing gene for distinguishing seven kinds of serotype of foot-and-mouth disease is provided to ensure fastness and convenience. CONSTITUTION: A method for diagnosing gene for distinguishing seven kinds of serotype of foot-and-mouth comprises a step of diagnosing seven type of serotype(O, A, Asia 1, C, SAT 1, SAT 2, and SAT 3) by different band size. The diagnosis method comprises: a step of diagnosing type O and Asia 1, type A and C, and type SAT 1, SAT 2, and SAT 3. SAT 1, SAT 2 and SAT 3 has common band size. A primer for amplifying type O has a base sequence of sequence numbers 1, 2, 3, and 5.

Description

RT-PCR for differentiation of seven serotypes of foot-and-mouth disease virus}

The present invention relates to a gene diagnostic method that distinguishes seven types of foot-and-mouth disease.

Figure 1 is a conventional foot and mouth disease serotype discrimination primers (Vangrysperre and De Clercq., Arch. Virol. (1996)) O (O / SKR / 2002), A (A22 Iraq), Asia 1 (Asia 1 / Figure shows the results of electrophoresis after RT-PCR application to foot-and-mouth virus of type MOG / 05).

When applying primers to check blood type O, type 402bp in type O and Asia type 1, type 292bp in type 1 Asia and type A when applying primers to type A The band size is expected to be 732bp at, and the band is indicated by a white box.

Figure 2 is a result of checking the band by electrophoresis after putting the RNA of the seven serotype virus isolates in the RT-PCR mix containing the prepared primer. The isolate name of the virus used in the experiment is shown above the electrophoresis picture.

Figure 3 is performed after RT-PCR using a differentiating primer set to discriminate between 1) type O and Asia type 1, 2) type A and type C, and 3) SAT 1, SAT 2, and SAT 3 during mixed infection. It is the result of mobilization. The band of each serotype is indicated by a white arrow. RNA used was extracted in the same isolate as in FIG. 2.

4 measures the sensitivity of established genetic assays. 10-fold dilution based on the copy number of viral RNA followed by RT-PCR and electrophoresis. The bottom of the gel picture shows the expected detection limit. The RNA copy number of foot-and-mouth virus was calculated using real-time RT-PCR with the aim of a 3D gene segment capable of identifying all seven serotypes.

Foot-and-mouth disease (FMD) is a viral bullous disease that infects animals with two hoofs and is characterized by rapid replication and rapid spread. Because of its economic importance, the disease is classified as a List disease by the International Water Services Bureau (OIE), and it is a very important factor in the trade between livestock products. The pathogen is a single-stranded bipolar RNA virus belonging to the genus Piconaviridae and Apthovirus, with seven different serotypes (A, O, C, Asia1, SAT 1, SAT 2, SAT 3). Are classified as).

Since foot-and-mouth disease is not cross-protected by antibodies by serotype, prompt judgment of serotypes is very important for the implementation of vaccine policy when foot-and-mouth disease occurs. There is a need for rapid diagnostics in situations where multiple serotypes are present (eg Vietnam), as well as in emergencies in clean-up countries such as Korea, as well as in South-East Asian countries where foot-and-mouth disease occurs frequently (eg Vietnam). .

Representative methods for identifying foot-and-mouth disease serotypes include conventional RT-PCR, Antigen enzyme-linked immunosorbent assay, and Nucleotide sequencing (World Organization for Animal Health (OIE). ), Manual of Diagnostic Tests and Vaccines for Terrestrial Animals). Of these, the gene diagnosis method has the advantage of being capable of rapid diagnosis (3-4 hours) at a low cost without requiring advanced experimental techniques compared to the other two methods. In addition, the sensitivity has been shown to be superior to the antigen ELISA (ELISA). Despite these advantages, they have been used globally for differentiating foot-and-mouth disease serotypes, and are being used by the OIE / FAO World Reference Laboratory for FMD (WRL), Pirbright, Primers developed in the UK (Vangrysperre W et al, Arch Virol. 1996. 141 (2): 331-44; Reid SM et al. J. Virol. Metho. 1999. 83 (1-2): 113-23; Reid SM et al. Arch. Virol. 2001. 146 (12): 2421-2434) showed specific reaction of type O specific primers to Asia type 1 virus (Asia1 / MOG / 05) (FIG. 1). At present, Asia 1 has recently occurred throughout Asia and neighboring countries of Korea (Mongolia, China, and North Korea). Therefore, it is difficult to use the existing genetic diagnostic method in consideration of the dynamic situation around Korea. In addition, more than 10 years after the production (developed in 1996), the need for a new primer considering the recently occurring viral genetic information.

Accordingly, an object of the present invention for solving the above problems is to establish a genetic diagnostic method that is practically used in various Asian countries without specific non-specific strain of the virus strain (strain) currently in Asia.

In order to achieve the above object, the gene diagnosis method for differentiating seven types of foot-and-mouth disease according to the present invention, the seven serotypes (O, A, Asia 1, C, SAT 1, SAT 2, SAT 3) different Diagnose the band size, the SAT 1, SAT 2, SAT 3 is characterized by having a common band size.

In addition, the gene diagnosis method for different types of foot-and-mouth disease according to the present invention is characterized by the simultaneous diagnosis and type O type and Asia type 1.

In addition, the gene diagnosis method for distinguishing 7 types of foot-and-mouth disease according to the present invention is characterized by simultaneous diagnosis and discriminating foot-and-mouth disease type A and C type.

In addition, the gene diagnosis method for distinguishing seven types of foot-and-mouth disease according to the present invention is characterized by simultaneous diagnosis of foot-and-mouth disease SAT 1, SAT 2, SAT 3 type.

In addition, the gene diagnosis method for differentiating seven types of foot-and-mouth disease according to the present invention is to diagnose the seven serotypes (O, A, Asia 1, C, SAT 1, SAT 2, SAT 3) with different band sizes It features.

In this case, when all seven serotypes are to be diagnosed in one tube, specificity and sensitivity may be reduced, and therefore, it is preferable to diagnose the above simultaneous diagnosis set or seven serotypes separately.

In addition, the gene diagnosis method for differentiating seven types of foot-and-mouth disease according to the present invention is characterized by providing a base sequence of each primer used in the diagnostic method.

In addition, the gene diagnostic kit for discriminating 7 types of foot-and-mouth disease according to the present invention, 1) O type and Asia type 1, 2) A type and C type, 3) SAT 1, SAT 2, SAT 3 type It is characterized in that the diagnostic gene diagnostic method is carried out at the same time.

According to the gene diagnosis method for distinguishing 7 types of foot-and-mouth disease according to the present invention, a new primer sequence that is non-specific and capable of discriminating 7 serotypes was newly designed, and only RNA samples were added using a Premix type kit. Responsiveness and one-step RT-PCR at the same temperature ensure rapid and convenient diagnostic time.

Strategies for reacting 1) O and Asia 1, 2) A and C, 3) SAT 1, SAT 2, and SAT 3 in one tube to minimize nonspecificity and identify mixed infections Prepared. In addition, the practical application was confirmed in the Republic of Korea and other Asian countries that lacked professional manpower and conditions and mixed various types of foot-and-mouth disease.

Hereinafter, embodiments of the present invention will be described in detail with reference to FIGS. 2 to 4.

Conventionally, the application of the primers (Vangrysperre and De Clercq., Arch. Virol. (1996)), which has been used for differentiating serotypes, has not been specifically diagnosed in Asia type 1 Mongolian strain (Asia 1 / MOG / 05). .

Hereinafter, the present invention will be described in more detail with reference to examples and test examples, but the present invention is not limited thereto, and modifications, substitutions, and insertions that are commonly known by those skilled in the art can be performed. It is included in the scope of the invention.

Example 1: Preparation of primers used for establishing and diagnosing foot and mouth disease serotype differentiation strategy.

Simultaneous diagnosis was made possible to minimize the interference phenomenon for differentiation of foot-and-mouth serotypes. Simultaneous diagnosis was performed using three sets of 1) Type O and Asia Type 1, 2) Type A and Type C, and 3) SAT 1, SAT 2, and SAT 3. Within each set, serotype differentiation was possible by band size on electrophoresis. Primers are blast (NCBI) and Bio edit program (Hall, TA Bio edit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98 / NT.1999. Nucleic Acids Symp Ser 41: 95-98), and the genetic information of the isolates used in the design is shown in C. Carrillo's article, Table 1 (C. Carrillo et al, 2005. J. Virol. Vol79, 6487-). 6504) and Asia 1 / MOG / 05 (Genebank accesion no.EF614458). The base sequences of the designed primers are shown in Table 1 below. Primer sequences were prepared from oligonucleotides by Bioneer Corporation (Republic of Korea).

Table 1. Diagnostic primers used in this study

No Name Specificity Direction Sequence size bp (type) One O-F1a O, Asia type multiplex Forward GGTGCCATCAAGGCAACTCGTGT
(SEQ ID NO 1)

190 (O) O-F1b Forward GTGCCATCAAAGCCACTCGGGT
(SEQ ID NO: 2) O-F1c Forward GCCATCAAAGCGACCCGGGT
(SEQ ID NO: 3) Asia1_F1 Forward CGACTGCCTACCAGAAGMARCCCA
(SEQ ID NO: 4)

390 (Asia 1) All7_2AbR Reverse AARAAGAARGGYCCRGGGTT
(SEQ ID NO: 5) 2 All4_VP1 F A, C type multiplex Forward TGCCACNGTNGARAACTAYGGHGG
(SEQ ID NO: 6)
540 (A)


270 (C) A_R Reverse TCATGCGCACGAGRAAGCTCGTG
(SEQ ID NO: 7) C_R Reverse GGGATTGGTTGTGTTGTYAAGTGCAGAAAC
(SEQ ID NO: 8) 3 SAT common F1 SAT 1,2,3 common Forward ACACTTYCGYGACACCATGAA
(SEQ ID NO: 9)

496 (SAT) SAT common R Reverse CCTYCGTTCAGGCGYTTGT
(SEQ ID NO: 10)

Test Example 1 Confirmation of Specific Diagnostic Results

In order to determine whether it is possible to discriminate each virus serotype using the prepared primers, one-step RT-PCR was performed using each foot-and-mouth virus RNA and electrophoresed.

Foot and mouth disease virus was prepared for seven serotype RNA extraction. Of the seven foot and mouth virus, O / SKR / 2002 is separated from Korea, and five species (O1 Manisa, Asia 1 / CAM / 9/80, A22 / IRQ 24/64, C3 / Resende, SAT 1 / BOT 1/68, SAT 2 / ZIM 5/81 and SAT 3 / ZIM 4/81) were introduced from the UK's Ferbright Institute and Asia 1 / MOG / 05 from the Central Mongolian Veterinary Research Institute. IBRS-2 cell line was used for virus propagation. These cells were grown in a 37 ° C incubator with 5% carbon dioxide in Dulbecco's modified Eagle's medium (D-MEM) containing 10% fetal bovine serum (FBS) and antibiotics.

After proliferating in the cells, the virus was confirmed by CPE (cytopathic effect), and frozen at -70 ° C and thawed twice, and centrifuged to harvest. The titer of harvested virus was calculated using the formula of Reed and Muench method to calculate 50% tissue culture infective dose (TCID ₅₀ ).

The nucleic acid of each virus was extracted using the RNA / DNA extraction kit (Intron) as the virus supernatant and stored at -70 ° C. The extraction procedure followed the kit's manual.

RNA was taken out at -70 ° C and dissolved in the One-step RT-PCR process using Maxime RT-PCR Premix kit (Intron, Republic of Korea). In brief, 1 μl of 5 pmol forward and reverse primer, 3 μl of RNA template, and 16 μl of RNase-free water are added to the RT-PCR Premix. RT-PCR was performed using GeneAmp PCR system 9700 (Applied Biosystem). RT-PCR conditions are shown in Table 2. After RT-PCR, the band was confirmed by electrophoresis.

Table 2. RT-PCR Reaction Conditions

RT-PCR cycle Temperature (℃) Time 1 cycle  RT-reaction 45 30 minutes  Inactivation of RTase 94 5 minutes 40 cycle  Denaturation 94 30 sec  Annealing 55 30 sec  Extension 72 1 minute

As a result of electrophoresis, nonspecific serotypes were not observed when each primer set was applied in 7 types of foot-and-mouth disease, and the band of the intended size was confirmed (FIGS. 2A and 2B). In addition, it was proved that each serotype can be distinguished even when several serotypes are present in a mixture (FIG. 3).

Test Example 2 Sensitivity Measurement and Specificity of Diagnostic Primer

FMDV extracted RNA from 3 × 10 ⁵ TCID ₅₀ virus supernatants by RNA / DNA extraction kit (Intron). After diluting the extracted RNA by 10-fold step, one-step Primescript RT-PCR kit (TAKARA, Japan) and ABI 7500 Real-time PCR System (Applied Biosystem, USA) were used to calculate the number of copies of FMDV. RT-PCR was performed. Primers to identify all 7 types of foot-and-mouth disease are primers 5'-GGA ACY GGG TTT TAY AAA CCT GTR AT-3 'and antisense 5'-CCT CTC CTT TGC ACG CCG TGG GA- 3 'was used. The probe used a 5'-CCC ADC GCA GGT AAA GYG ATC TGT A-3 'labeled FAM at the 5' end and TAMRA at the 3 'end. One-step RT-PCR was performed under the same conditions as in Table 2 by applying the viral nucleic acid of the copy number to each primer set. After RT-PCR, sensitivity was confirmed through a band identified by electrophoresis. When set 1 (O, Asia1) and set 2 (A, C) were used to identify foot-and-mouth disease serotypes, 10 ² to 10 ³ copies could be identified, and when applied to SAT type using set 3, 10 Confirmation was possible from ³ to 10 ⁴ (FIG. 4). Table 3 shows the sensitivity measured for each serotype.

Table 3. Detection limits by primer set

No. Diagnosis Target Applied virus strain Detection limit
(RNA copy no.) Set 1 O, Asia 1 O / SKR / 2002 1 × 10 ³ Asia 1 / MOG / 05 5 × 10 ³ Set 2 A, C A22 / IRQ / 24/64 5 × 10 ² C3 / Resende 5 × 10 ² Set 3 SAT 1, 2, 3 SAT 1 / BOT 1/68 5 × 10 ³ SAT 2 / ZIM 5/81 5 × 10 ⁴ SAT 3/4/81 5 × 10 ³

<Test Example 3> Demonstration test by applying outdoor samples from Mongolia and Vietnam foot-and-mouth disease

Of the established foot-and-mouth disease diagnostic sets, set 1 (O, Aisa1) and set 2 (A, C) were subjected to an empirical test using outdoor samples from Vietnam and Mongolia. RNA extraction and one-step RT-PCR followed the procedure of <Test Example 1>.

In Vietnam, the results were compared using a panel with antigenic ELISA results (Table 4). There was one sample that was determined to be the same serotype in antigen ELISA positive samples (100% specificity) and specifically positive in type O specific primers for samples that were negative in antigen ELISA (Table 5).

The same experiment was carried out using an outdoor panel of Mongolia (Table 5) and the results were compared with real-time RT-PCR, which can discriminate only positive and negative. As a result, the serotype differentiation specificity was 100% when the genetic diagnostic set for serotype differentiation was applied (Table 6).

However, two samples measured below 500 copies in real-time RT-PCR could not be diagnosed with this method. This result is consistent with the set-by-set detection limits in Table 3. Field empirical testing in Vietnam and Mongolia for the present invention showed better sensitivity and 100% serotype differential specificity than antigen ELISA.

Table 4. Application of Outdoor Samples in Vietnam

country diagnosis primer serotype Diagnosis result by serotype (number of samples) ^c O (25) Asia 1 (6) Voice (5) Voice (1) ^b Vietnam Gene simultaneous
diagnosis set 1 O ^a 25 0 0 One Asia 1 ^a 0 6 0 0 set 2 A ^a 0 0 0 0 O ^a 0 0 0 0

^a serotype differential specificity 100%

^b Sensitivity is superior to antigen ELISA. Antigen ELISA negative samples were positive for set 1 and 2

^c positive, negative and serotype discrimination compared to antigenic ELISA results

Table 5. Provisional Panels Provided by Mongolia

Serial number Sampling place registration date Breeder Collection One Bayan-ulgii 2002.08 Cattle epithelium 2 Bayan-ulgii 2002.08 Cattle epithelium 3 Hovd erdeneburen 2002. Cattle epithelium 4 Dornogovi Sainshand 2004.02 Cattle epithelium 5 Dornogovi Sainshand 2004.02 Cattle epithelium 6 Dornogovi Sainshand 2004.02 Gazella heart tissue 7 Dornod Bayantumen 2005.08 Cattle epithelium 8 Dornod Bayantumen 2005.08 Cattle epithelium 9 Dornod Bayantumen 2005.08 Cattle epithelium 10 Ulaanbaatar Zaisan 2006.04 Cattle Probang samples 11 Ulaanbaatar Zaisan 2006.04 Cattle Probang samples 12 Ulaanbaatar Zaisan 2006.04 Cattle Probang samples 13 Ulaanbaatar Zaisan 2006.04 Cattle Probang samples 14 Ulaanbaatar Zaisan 2006.04 Cattle Probang samples 15 Dornod Bayantumen 2007.10.08 Gazella pharyngeal tissue 16 Dornod Bayantumen 2007.10.08 Gazella pharyngeal tissue 17 Dornod Bayantumen 2007.10.08 Gazella pharyngeal tissue 18 Dornod Bayantumen 2007.10.08 Gazella pharyngeal tissue 19 Dornod Bayantumen 2007.10.08 Gazella pharyngeal tissue 20 Dornod Bayantumen 2007.10.08 Gazella pharyngeal tissue 21 Cuhbaatar asgat 2007.10.09 Gazella pharyngeal tissue 22 Cuhbaatar asgat 2007.10.09 Gazella pharyngeal tissue 23 Cuhbaatar asgat 2007.10.09 Gazella pharyngeal tissue 24 Cuhbaatar asgat 2007.10.09 Gazella pharyngeal tissue 25 Cuhbaatar asgat 2007.10.09 Gazella pharyngeal tissue 26 Dornogovi Sainshand 2007.10.11 Gazella pharyngeal tissue 27 Dornogovi Sainshand 2007.10.11 Gazella pharyngeal tissue 28 Dornogovi Sainshand 2007.10.11 Gazella pharyngeal tissue 29 Dornogovi Sainshand 2007.10.11 Gazella pharyngeal tissue 30 Dornogovi Sainshand 2007.10.11 Gazella pharyngeal tissue 31 Dornogovi Sainshand 2007.10.11 Gazella pharyngeal tissue 32 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 33 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 34 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 35 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 36 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 37 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 38 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 39 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 40 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 41 Dundgovi Deren 2007.10.14 Gazella pharyngeal tissue 42 Ulaanbaatar 2007.10.17 Cattle tongue epthelium 43 Ulaanbaatar 2007.10.17 Cattle tongue epthelium 44 Ulaanbaatar 2007.10.17 Cattle tongue epthelium 45 Ulaanbaatar 2007.10.17 Cattle tongue epthelium

Table 6. Application of Outdoor Samples in Mongolia

country diagnosis primer serotype Diagnosis result by serotype (number of samples) ^c O (4) Asia 1 (3) Voice (38) Mongolia Gene simultaneous
diagnosis set 2 O ^a 2 ^b 0 0 Asia 1 ^a 0 3 0 set 3 A ^a 0 0 0 O ^a 0 0 0

^a serotype differential specificity 100%

^b Two samples tested positive for real-time RT-PCR are outside the detection limits of this diagnostic.

^c Positive and negative judgments were based on real-time PCR results.

As described above, gene diagnosis for foot-and-mouth disease serotype differentiation provided by the present invention can discriminate seven serotypes by electrophoresis DNA size using newly designed primers, and extract RNA from a sample, One -step RT-PCR can be used to diagnose. In addition, it is possible to put the RNA sample into three tubes at the same time to proceed amplification under the same conditions, it is possible to distinguish serotypes while reducing cross-contamination. Therefore, kitting this diagnostic method can distinguish foot-and-mouth disease serotypes in a short time with easy use and low cost in Korea and other Asian countries.

Figure 1 is a photograph showing the results of electrophoresis when applying a conventional primer (Vangrysperre and De Clercq., Arch. Virol. (1996)).

Figure 2a and Figure 2b is a photograph showing the results of electrophoresis when applying serotype differentiation primers to foot-and-mouth virus according to the present invention.

Figure 3 is a photograph showing the results of applying the differential primer of the present invention when mixed infection.

Figures 4a to 4c is a photograph showing the sensitivity measurement at the time of application of foot and mouth virus of the present invention.

Claims (11)

Genetic analysis method for differentiating seven serotypes of foot-and-mouth disease, characterized by diagnosing seven serotypes (O, A, Asia 1, C, SAT 1, SAT 2, SAT 3) with different band sizes. The method of claim 1, wherein the type 0 and Asia type 1 are diagnosed simultaneously and differentiated. The method of claim 1, Gene diagnosis method for 7 kinds of foot-and-mouth disease, characterized in that the differential diagnosis and type A and C type. The method of claim 1, Genetic diagnostic method for differentiating seven types of foot-and-mouth disease, characterized in that the simultaneous diagnosis of the SAT 1, SAT 2 and SAT 3 type. The method of claim 1, Said SAT 1, SAT 2 and SAT 3 has a common band size gene diagnostic method for different types of foot-and-mouth disease 7 characterized in that the common band size. 6. The method according to any one of claims 1 to 5, A method for diagnosing genes for differentiating seven serotypes of foot-and-mouth disease, characterized by providing a base sequence of a primer that amplifies only O-type serotypes as set forth in SEQ ID NOs: 1, 2, 3, and 5. 6. The method according to any one of claims 1 to 5, A method for diagnosing genes for differentiating seven serotypes of foot-and-mouth disease, characterized by providing a base sequence of a primer for amplifying only the Asian type 1 serotypes as set forth in SEQ ID NOs: 4 and 5. 6. The method according to any one of claims 1 to 5, A method for diagnosing genes for discriminating seven types of foot-and-mouth disease, characterized in that it provides a nucleotide sequence of a primer that amplifies only the A type serotype shown in SEQ ID NOs: 5 and 7. 6. The method according to any one of claims 1 to 5, A method for diagnosing a gene for differentiating seven serotypes of foot-and-mouth disease, characterized by providing a base sequence of a primer that amplifies only the C-type serotype shown in SEQ ID NOs: 6 and 8. 6. The method according to any one of claims 1 to 5, A method for diagnosing genes for differentiating seven serotypes of foot-and-mouth disease, comprising providing a base sequence of a primer for amplifying only the SAT 1, 2 and 3 serotypes set forth in SEQ ID NOs: 5 and 10. Genetic diagnostic kit for discriminating seven types of foot-and-mouth disease, characterized by simultaneously performing a genetic diagnostic method for discriminating between O type and Asia type 1, A type and C type, and SAT 1, SAT 2 and SAT 3.

Images