KR20110023641A - Pcr primer and probe for detection of mycoplasma pneumoniae using p1 gene and real-time pcr method using the same - Google Patents

Abstract

PURPOSE: A PCR primer set for detecting mycoplasma pneumoniae using P1 gene is provided to quickly detect the bacteria with high specificity and sensitivity. CONSTITUTION: A PCR primer set for detecting mycroplasma pneumoniae using P1 gene contains oligonucleotides of sequence numbers 3 and 4. A probe for detecting the oligonucleotide is specific to mycroplasma pneumoniae-derived nucleic acid. A method for real time PCR for detecting mycroplasma pneumoniae comprises: a step of performing PCR using the primer set with the nucleic acid isolated from the respiratory test sample as a template; and a step of detecting a target sequence in the test sample.

Description

PCR primer and probe for detection of Mycoplasma pneumoniae using P1 gene and real-time PCR method using the same}

The present invention relates to a PCR primer and probe for detecting Mycoplasma pneumoniae using the P1 gene and a real-time PCR method using the same. More specifically, the present invention provides a PCR primer and probe for detecting mycoplasma pneumoniae using the P1 gene which can quickly detect mycoplasma pneumoniae from respiratory specimens with excellent specificity and sensitivity, and It relates to a real-time PCR method used.

Respiratory infections, the most common cause of visits to medical institutions, are difficult to distinguish the causative agent by clinical symptoms alone, and due to the long time limitations of classical laboratory diagnostic methods, empirical antibiotics are frequently prescribed. On the other hand, the increase in the use of antibiotics has a major adverse effect on public health in terms of the emergence and spread of antibiotic resistant bacteria.

Mycoplasma pneumoniae causes mild respiratory tract infections from mild upper respiratory tract infections to bronchitis and pneumonia. In particular, 10-30% of patients with community pneumonia are known to cause severe cough, long lasting, high fever of more than 38 degrees, the main symptom is head ache, fever, runny nose, sore throat, cough A dry cough that lasts for more than two weeks is sometimes accompanied by a sputum cough. In particular, it is known to occur frequently in school children under 15 years of age, but recently the age of onset gradually decreases, and occurs year-round, but usually has a trend of every three to four years.

In particular, mycoplasma pneumoniae ( M. pneumoniae ) has no cell wall, unlike general bacteria, beta-lactam and cephalosporin antibiotics, including penicillin, which is currently the most commonly used in the treatment of respiratory infections, and has no effect. Macrolide system should be selected. However, mycoplasma pneumoniae infection is difficult to distinguish from other causative organisms based on the clinical symptoms or radiological findings of the patient. .

The diagnosis of mycoplasma pneumoniae infection is mainly dependent on serological methods, but the specificity and sensitivity are low and false-positive reactions. Therefore, the early diagnosis method is limited. In addition, the separation culture method uses a special medium and takes a time for 3-4 weeks, it is impossible to apply to clinical diagnosis. Recently, for early diagnosis of mycoplasma pneumoniae infection, we have attempted to detect mycoplasma pneumoniae ( M. pneumoniae ) using PCR in addition to existing serological methods. The method is shorter in time than the serological method and provides high sensitivity and specificity, thereby increasing its application in clinical practice.

The conventional PCR method uses a 16S rRNA gene as a target gene, and the DD5B and DD54B primers and probes in use are shown in Table 1 (Ref. Journal of Clinical Microbiology (1997) 35 (6): 1592-1594).

Name Sequence (5 '→ 3') Product size DD50B  5'-gca aag tta tgg aaa cat aat gga ggt t (SEQ ID NO: 1)
427 bp DD54B  5'-ggt tag caa cac gtt ttt aaa tat t (SEQ ID NO: 2)

Conventional PCR method, after eliminating Taq DNA polymerase (Solgent SG1002), each primer (20pmol / μl), positive DNA and sterile tertiary distilled water at -20 ℃, dissolved in ice for each PCR reaction prepared in a PCR tube Mixing was made to the reaction solution composition of Table 2 and PCR was carried out according to the reaction conditions shown in Table 3. The PCR results were confirmed by electrophoresis on a 5 μl PCR reaction solution on a 1% agarose gel (see FIG. 1).

ingredient volume  DNA template 5 μl 10 x reaction buffer with 2.5mM MgCl ₂ 5 μl  dNTP mixture (each 10mM) 1 μl  DD50B (20 pmol / μl) 1 μl  DD54B (20 pmol μL) 1 μl  Taq DNA polymerase (0.5U) 0.5 μl  Band doctor 1 μl  Sterile distilled water 35.5 μl  Total volume 50 μl

Reaction temperature time Repetition cycle 94 ℃ 4 minutes 1 time 94 ℃ 30 seconds
30 times 62 ℃ 30 seconds 72 ℃ 1 minute 72 ℃ 10 minutes 1 time

The method for detecting mycoplasma pneumoniae by the conventional PCR method has a problem that it is troublesome to perform electrophoresis, a high possibility of contamination, and difficult to quantitatively analyze.

The inventors have devised a P1 gene-specific primer and probe to solve the above problems and improve the specificity and sensitivity of the detection of mycoplasma pneumoniae from respiratory specimens and the mycoplasma pneumoniae . Specific real-time PCR was established and applied to respiratory specimens.

The present invention has been made to solve the above problems of the prior art, an object of the present invention and P1 gene specific primer with excellent specificity and sensitivity that can detect mycoplasma pneumoniae from respiratory patient samples and To provide a probe.

Another object of the present invention, there is no hassle of electrophoresis, less likely to be contaminated, quantitative analysis and excellent specificity and sensitivity, M. pneumoniae specific real-time using the primer and probe It is to provide a PCR method.

Still another object of the present invention is to provide a kit for detecting mycoplasma pneumoniae , which is easy to use and can detect mycoplasma pneumoniae quickly and accurately in a short time.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

In order to achieve the above object, the present invention is mycoplasma pneumoniae using the P1 gene that can amplify a target sequence specific for mycoplasma pneumoniae comprising the oligonucleotide of SEQ ID NO: 3 and oligonucleotide of SEQ ID NO: 4 Provide a PCR primer for detection.

The present invention also provides a probe for detecting an oligonucleotide specific for a nucleic acid derived from at least one mycoplasma pneumoniae selected from the oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto.

The present invention provides a myco using a P1 gene capable of amplifying a target sequence specific for Mycoplasma pneumoniae comprising the oligonucleotide of SEQ ID NO: 3 and the oligonucleotide of SEQ ID NO: 4 using a nucleic acid isolated from a respiratory sample as a template. Performing PCR using a PCR primer primer set for detecting plasma pneumoniae; And it provides a real-time PCR method for detecting mycoplasma pneumoniae comprising the step of detecting the target sequence in the sample using the obtained PCR product.

The real-time PCR method is to detect a target sequence in a sample using an oligonucleotide detection probe specific for a nucleic acid derived from one or more mycoplasma pneumoniae selected from the oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto. desirable.

The present invention provides a PCR primer set for detecting Mycoplasma pneumoniae using a P1 gene capable of amplifying a target sequence specific for Mycoplasma pneumoniae comprising an oligonucleotide of SEQ ID NO: 3 and an oligonucleotide of SEQ ID NO: 4; And an oligonucleotide detection probe specific for a nucleic acid derived from at least one mycoplasma pneumoniae selected from an oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto. .

Hereinafter, the present invention will be described in more detail.

The present inventors solve the problems of the mycoplasma pneumoniae detection method by the conventional PCR method and at the same time to improve the specificity and sensitivity of the detection of mycoplasma pneumoniae ( M. pneumoniae ) from respiratory patient samples, The probe was designed to establish a mycoplasma pneumoniae specific real-time PCR method and applied to respiratory specimens to complete the present invention.

In order to specifically detect only mycoplasma pneumoniae from respiratory specimens, the present inventors have identified the P1 gene of Mycoplasma pneumoniae (Infection and Immunity, 67 (9): 4557-4562 ( 1999); GenBank No. NC_000912) design a primer and probe combination that binds to the specific sites in the repetitive sequences as shown in Figure 2 and through the BLAST search and other respiratory infection-inducing pathogens and flora After confirming that the reaction did not select finally as shown in Table 4. That is, Table 4 shows the sequences of the primers and probes used in the present invention.

Name Sequence (5 '→ 3')      repMP1b-F  AACGAAAAAGAATTCCATGACATG (SEQ ID NO: 3)      repMP1b-R  AATTCCACACTGTTGTTCTCTG (SEQ ID NO: 4)      Probe  FAM 5'-ACGATGTATCAACCTGAAAAAGTGCCCT-3 'TAMRA (SEQ ID NO: 5)

The present invention provides a myco using a P1 gene capable of amplifying a target sequence specific for Mycoplasma pneumoniae comprising the oligonucleotide of SEQ ID NO: 3 and the oligonucleotide of SEQ ID NO: 4 using a nucleic acid isolated from a respiratory sample as a template. Performing PCR using a PCR primer primer set for detecting plasma pneumoniae; And it provides a real-time PCR method for detecting mycoplasma pneumoniae comprising the step of detecting the target sequence in the sample using the obtained PCR product.

The real-time PCR method is to detect a target sequence in a sample using an oligonucleotide detection probe specific for a nucleic acid derived from one or more mycoplasma pneumoniae selected from the oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto. desirable.

In this case, the probe may be labeled by a detectable means, and particularly when two species are used together, they are labeled by different detectable means. The detectable means means a compound, a biomolecule or a biomolecule mimetic that can be connected to, coupled to, or attached to a probe to identify density, concentration, amount, etc. in a conventional manner. Examples thereof include fluorescent labeling factors, light emitting materials, bioluminescent materials, and isotopes which are commonly used, but are not limited thereto. In general, fluorescent labeling factors are preferred.

The fluorescent labeling factors are readily available since many species are currently commercially available. Examples of fluorescent labeling factors include, but are not limited to, FAM, VIC, TAMRA, JOE, ROX, NED, HEX and TET, SYBR Green, Cy3, Texas Red, Cy5 ^™ , and the like. Details and selection of the fluorescent labeling factors will be apparent to those skilled in the art to which the present invention pertains.

The fluorescent labeling factor may be labeled on the probe by conventional methods, for example, an interchelating method, a TaqMan ^™ probe method, and a molecular beacon method. Since the methods are known in the art, a specific method may be selected in consideration of reaction efficiency, time, fluorescent labeling factor type, and the like. In the present invention, for example, a TaqMan ^™ probe method may be used.

The TaqMan ^TM probe method is a method to add a 5 'terminus to 3 with a reporter fluorescent marker (FAM, etc.), ends up a qualified quencher substance (TAMRA etc.) oligonucleotide (TaqMan ^TM probe) to the PCR reaction solution, Although the probe specifically hybridizes to the template DNA in the annealing step, the fluorescence is inhibited by the quencher on the TaqMan ^TM probe, and the template is produced by the 5 '->3' exonuclease activity of the Taq DNA polymerase in the extension step. Only the TaqMan ^TM probe hybridized to is decomposed and the fluorescent dye is released from the probe, thereby suppressing the inhibition by the quencher and causing fluorescence. That is, if the reporter and the quencher at both ends of the probe are present in close proximity to each other, the fluorescence of the reporter is not detected, but the fluorescence of the reporter is not detected as the amplification proceeds. This is the principle that quantifies.

The PCR method is 10 μl PCR master mix, 1 μl primer repMP1b-F (10 pmol / μl), 1 μl primer repMP1b-R (10 pmol / μl), 1 μl probe (2.5 pmol / μl), sample DNA It is preferred that the total volume is 20 μl, including 2 μl and 5 μl of sterile distilled water (see Table 5).

In addition, the PCR method is a decontamination 50 ℃ 2 minutes 1 time, Initial denaturation (95 ℃ 10 minutes 1 time, Denaturation 95 ℃ 15 seconds 40 times, Extension 60 ℃ 1 minute 40 It is preferable to carry out the ash (see Table 6).

The real-time PCR method is a method for detecting and quantitating fluorescence performed in real time every cycle of PCR based on the principle of DNA polymerase and Fluorescence Resonance Energy Transfer (FRET). This method can identify specific amplification products by distinguishing them from nonspecific amplification products, and the results of analysis can be easily obtained in an automated manner.

Real-time PCR devices that can be used in the present invention include, but are not limited to, ABI Real-time PCR devices 7900, 7700, 7500, 7300, Stratagene's Mx3000p and BioRad's Chromo 4 devices. At the end of PCR, the laser of this real-time PCR device senses the fluorescent labeling factors labeled on the probes of the amplified PCR products to implement the peaks shown in FIG. 3. Thus, the results can be automatically analyzed by executing a program embedded in the device without the electrophoresis process.

Therefore, the primer set, probe and real-time PCR method for detecting mycoplasma pneumoniae using the P1 gene of the present invention can confirm the result in real time faster and more accurately than the conventional detection method.

Furthermore, this method can distinguish the presence of small DNA fragments that were difficult to distinguish by electrophoresis or the identification of PCR products of less than 100 bp by laser sensitization, and there is no concern about contamination by PCR products. All test procedures are operated as an automatic system until the end of the test period. Therefore, it is unlikely that a mistake of a tester or an error of a test will occur, and it is easy to collect and analyze data, and minimize test time and labor required. Very useful.

In particular, the real-time PCR method using the primer and probe developed by the present invention has a high specificity for mycoplasma pneumoniae (see Table 7), and its sensitivity was confirmed to be 1 CCU / ml. The detection method is more sensitive than 10-100 CCU / ml, which is the sensitivity of the general PCR method used to detect 16S rRNA genes (see Table 8). In addition, the real-time PCR method according to the present invention was shown to have a higher sensitivity than the conventional PCR method when applying clinical specimens (see Table 9).

In addition, the present invention is a PCR primer set for detecting mycoplasma pneumoniae using P1 gene which can amplify a target sequence specific for mycoplasma pneumoniae comprising the oligonucleotide of SEQ ID NO: 3 and oligonucleotide of SEQ ID NO: 4 ; And an oligonucleotide detection probe specific for a nucleic acid derived from at least one mycoplasma pneumoniae selected from the oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto.

In the kit of the present invention, the primer sets and probes can be packaged in one reaction vessel, strip or microplate, and packaged by methods known in the art. In addition, the kit of the present invention may further include one or more selected from the group consisting of Taq polymerase, a reaction buffer including MgCl ₂ , dNTP, and a stabilizer, in addition to those known in the art. Other reagents may be additionally included.

The kit of the present invention is easy to use and can quickly and accurately detect mycoplasma pneumoniae ( M. pneumoniae ) within a short time.

It is possible to achieve the effect of rapidly detecting mycoplasma pneumoniae (M. pneumoniae) with excellent specificity and sensitivity from the respiratory patient sample having the above-described configuration.

In addition, according to the present invention, there is no need to perform electrophoresis, there is little possibility of contamination, and quantitative analysis can be achieved.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Hereinafter, the configuration of the present invention will be described in detail with reference to the accompanying drawings.

Materials and Methods

(1) subject specimen

Throat or nasopharyngeal swab

Nasopharyngeal aspirates

Sputum

Bronchoalveolar lavage (BAL, bronchoalveolar lavage)

(2) Use strain and clinical sample

M. pneumoniae ATCC15531 was used as a standard strain and cultured in Glucose-Hayflick's media (PPLO broth + 20% horse serum + 10% yeast extract). Meanwhile, throat seals collected from respiratory patients were used for the confirmation test.

(3) DNA extraction method

Transfer 1 ml of the inoculated sample to a sterile microtube, centrifuge at 15,000 rpm for 60 minutes to settle, and carefully remove the supernatant and leave about 100 μl, including acupuncture. DNA was extracted and used as a template for PCR reaction according to the detailed method presented in GENTRA Puregene Tissue core kit.

(4) Primer and Probe

Primer Express Ver. Repetitive sequences of P1 gene (Infection and Immunity, 67 (9): 4557-4562 (1999); GenBank No. NC_000912) of Mycoplasma pneumoniae using 2.0 software (PE Applied Biosystem) Based on repetitive sequences; repMP1 & repMP2), primer and probe combinations were selected through BLAST search that showed no cross-reaction with respiratory pathogenic bacteria and flora.

(5) Real-time PCR

Using the TaqMan probe method, FAM was attached to the probe and measured by real-time PCR (ABI PRISM 7700 Sequence Detector, Perkin Elmer). RT-PCR reaction solution contains 10 μl 2x Taqman universal PCR master mix, 1 μl primer repMP1b-F (10 pmol / μl), 1 μl primer repMP1b-R (10 pmol / μl), probe (2.5 pmol / μl) 1 μl, template DNA 2 μl was prepared by adding sterile water to a final volume of 20 μl. The reaction conditions were amplified 40 times for 2 minutes at 50 ° C, 10 minutes at 95 ° C, 15 seconds at 95 ° C, and 1 minute at 60 ° C.

Example 1. Mycoplasma pneumoniae ( M. pneumoniae Design of primer and probe set for P1 gene detection

To specifically detect only mycoplasma pneumoniae from respiratory specimens, Primer Express Ver. P1 gene of Mycoplasma pneumoniae (Infection and Immunity, 67 (9): 4557-4562 (1999); GenBank No. NC_000912) using 2.0 software (PE Applied Biosystem) as shown in FIG. By designing a primer and probe combination that binds to a site specific to repetitive sequences and confirming that it does not react with other respiratory infection-induced pathogenic bacteria and flora by BLAST search, it is finally shown in Table 4 below. Selected.

Example 2. Optimization of Real-Time PCR

The primers and probe sets designed above on the DNA of the mycoplasma pneumoniae standard strain ATCC15531 accurately bind to the mycoplasma pneumoniae DNA and generate PCR products accurately. Optimization was performed to determine optimal conditions as shown in Tables 5 and 6 below. Figure 3 shows a gene detection curve by real-time PCR of the optimal conditions for the detection of mycoplasma pneumoniae ( M. pneumoniae ) according to the present invention.

Components Volume (μl) TaqMan universal PCR master mix 10 Primer repMP1b-F (10 pmol/μl) One Primer repMP1b-R (10 pmol / μl) One Probe (2.5 pmol / μl) One Sample DNA 2 Sterile distilled water 5 Total volume (μl) 20

Stage Temperature Duration time Cycles Decontamination 50 ℃ 2 min One Initial denaturation 95 ℃ 10 min One Denaturation 95 ℃ 15 sec
40 Extension 60 ℃ 1 min

Example 3. Investigation of Specificity of Real-Time PCR

In order to determine the specificity of the real-time PCR method using the primers and probes designed by the present inventors, as shown in Table 7 below, DNAs purified from 32 kinds of bacteria, such as bacteria and respiratory flora, which may cause respiratory diseases, were used. PCR was performed according to the optimization conditions of the real-time PCR described above. As a result, amplification products were not detected in 32 respiratory organs except M. pneumoniae , and the real-time PCR method using the designed primers and probes specifically detected M. pneumoniae . It was confirmed.

Groups Bacteria Other Mycoplasma spp . Mycoplasma salivarium Mycoplasma orale Mycoplasma bovis Mycoplasma fermentants Mycoplasma hominis Mycoplasma lipophilum  Atypical pathogens of community-acquired pneumonia Chlamydia pneumoniae Chlamydia psittaci Legionella pnemophilla  Causative bacteria of community-acquired pneumonia Streptococcus pneumoniae Haemophilus influenzae Staphylococcus aureus Moraxella catarrhalis Pseudomonas aeruginosa  Other respiratory pathogens Streptococcus pyogens Neisseria meningitidis Bordetella pertusis  Oral commensal bacteria and other bacteria Streptococcus agalactiae Streptococcus bovis Streptococcus cremolis Streptococcus dysagalactiae Streptococcus epidermis Streptococcus euqi Streptococcus lactis Streptococcus mitis Streptococcus mutans Streptococcus oralis Streptococcus sanguis Streptococcus uberis Acinetobacter baumannii Escherichia coli Enterococcus faecalis

Example 4 Investigation of Sensitivity of Real Time PCR

We tried to verify the usefulness and detection limit of the real-time PCR method using the primer and probe developed by the present invention. After diluting the culture solution (10 ¹⁰ CCU, color change unit) in steps of 1/10, the purified DNA was used as a reaction template. Real-time PCR was carried out in the same manner as the PCR reaction conditions described above, and the reaction product was identified based on the Ct value and was confirmed to be 1 CCU / ml, which is the sensitivity of the conventional PCR method for detecting 16S rRNA genes. It was confirmed that the detection method is more sensitive than CCU / ㎖. Table 8 shows the results of sensitivity investigation of the real-time PCR method using the primer and probe according to the present invention.

CCU / mL 10 ¹⁰ 10 ⁹ 10 ⁸ 10 ⁷ 10 ⁶ 10 ⁵ 10 ⁴ 10 ³ 10 ² 10 ¹ 10 ⁰ 10 ^-1 Ct value 19.8 22.8 25.5 29.3 32.4 34.9 36.9 37.5 38.8 39.1 39.9 -

Example 5 Comparison between Real-Time PCR and General PCR in the Application of Clinical Specimens

M. pneumoniae was detected by real-time PCR and general PCR using DNA extracted from throat specimens of respiratory patients. The result of real-time PCR was 27.9% positive. Was 23.4%, and the detection rate was increased by 4.5% in real time PCR method, and even when applied to actual clinical specimens, the sensitivity was high when using real time PCR method. Table 9 shows the results of comparing the sensitivity of the real-time PCR method and the general PCR method according to the present invention when applying a clinical sample.

Results No. of cases (%) Real-time PCR Conventional PCR Positive 43 (27.9%) 36 (23.4%) Negative 111 (72.1%) 118 (76.6%) Total 154 (100.0%)

The present invention described above is not limited to the above-described embodiments and drawings, and various substitutions, modifications, and changes can be made without departing from the technical spirit of the present invention. It will be apparent to those who have

Figure 1 is an electrophoresis picture showing the results of PCR by the conventional PCR method.

Lane M. 1kb plus DNA ladder (Invitrogen 12308-011), Lane 1.Negative control (sterile distilled water), Lane 2.M. pneumoniae genomic DNA (ATCC29085)

Figure 2 is a schematic diagram showing the repMP1 repeat site in mycoplasma pneumoniae strain ( M. pneumoniae strain M129).

3 is a diagram showing a gene detection curve by the real-time PCR method of the optimal conditions using the primer and probe according to the present invention.

<110> korea Center for Disease Control and Prevention <120> PCR primer and probe for detection of Mycoplasma pneumoniae using          P1 gene and real-time PCR method using the same <130> P11-090626-01 <160> 5 <170> KopatentIn 1.71 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 1 gcaaagttat ggaaacataa tggaggtt 28 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 2 ggttagcaac acgtttttaa atatt 25 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 3 aacgaaaaag aattccatga catg 24 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 4 aattccacac tgttgttctc tg 22 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> PCR PRIMER <400> 5 acgatgtatc aacctgaaaa agtgccct 28  

Claims (9)

A PCR primer set for detecting mycoplasma pneumoniae using a P1 gene capable of amplifying a target sequence specific for mycoplasma pneumoniae comprising an oligonucleotide of SEQ ID NO: 3 and an oligonucleotide of SEQ ID NO: 4. A probe for detecting an oligonucleotide specific for a nucleic acid derived from at least one mycoplasma pneumoniae selected from the oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto. PCR using the primer set according to claim 1 as a template of nucleic acid isolated from a respiratory sample; And Real-time PCR method for detecting mycoplasma pneumoniae comprising the step of detecting the target sequence in the sample using the obtained PCR product. The method of claim 3, wherein the detecting of the target sequence comprises detecting the mycoplasma pneumoniae strain using a probe according to claim 2. The method according to claim 3 or 4, wherein the 3 'end or 5' end of the probe is labeled with a fluorescent factor selected from the group consisting of FAM, VIC, TAMRA, JOE, ROX, NED, HEX and TET. Real-time PCR method for detecting Mycoplasma pneumoniae. The method of claim 5, wherein the PCR method comprises: 10 μl of PCR master mix, 1 μl of primer repMP1b-F (10 pmol / μl), 1 μl of primer repMP1b-R (10 pmol / μl), and a probe (2.5 pmol / μl) ) 1 μl, 2 μl of sample DNA, 5 μl of sterile distilled water, and the total volume is 20 μl. The method of claim 6, wherein the PCR method is decontamination at 50 ° C. for 2 minutes, initial denaturation at 95 ° C. for 10 minutes, denaturation at 95 ° C. for 15 seconds, and 40 times at 60 degrees. Real-time PCR method for detecting Mycoplasma pneumoniae bacteria, characterized in that 40 ℃ 1 min. A set of PCR primers for detecting mycoplasma pneumoniae using a P1 gene capable of amplifying a target sequence specific for the mycoplasma pneumoniae comprising the oligonucleotide of SEQ ID NO: 3 and the oligonucleotide of SEQ ID NO: 4; And A kit for detecting mycoplasma pneumoniae, comprising an oligonucleotide detection probe specific for a nucleic acid derived from at least one mycoplasma pneumoniae selected from the oligonucleotide of SEQ ID NO: 5 and an oligonucleotide complementary thereto. 9. The mycoplasma nuum of claim 8, wherein the 3 'end or 5' end of the probe is labeled with a fluorescent factor selected from the group consisting of FAM, VIC, TAMRA, JOE, ROX, NED, HEX and TET. Monia bacteria detection kit.

Images