KR20100084996A - Method for producing physiologically active protein or peptide using immunoglobulin fragment - Google Patents

Abstract

PURPOSE: A method for massively preparing physiologically active protein using immunoglubulin fragment is provided. CONSTITUTION: A method for massively preparing physiologically active protein or peptide using immunoglobulin fragment comprises: a step of introducing DNA encoding the protein or peptide to cells and culturing the cells; a step of collecting fusion proteins from the cell culture medium; and a step of isolating physiologically active protein or peptide. The fusion protein additionally contains enzyme specific cleavage sequence between the protein or peptide and immunoglobulin fragment. The cleavage sequence is recognized by trypsin, trombone, TEV protease, prescission protease, or enterokinase.

Description

Method for producing bioactive protein or peptide using immunoglobulin fragments {METHOD FOR PRODUCING PHYSIOLOGICALLY ACTIVE PROTEIN OR PEPTIDE USING IMMUNOGLOBULIN FRAGMENT}

The present invention provides a method for mass-producing the bioactive protein or peptide using a fusion protein in which a therapeutically useful bioactive protein or peptide is fused with an immunoglobulin fragment, the fusion protein, DNA encoding the same, comprising the DNA A vector and a cell transformed with the vector.

Peptides, which are emerging as promising therapeutic alternatives to protein medicines, are mainly produced by various chemical synthesis methods. However, there are disadvantages in that the method is complicated, by-products are generated, and production costs are high.

 Recent developments in recombinant DNA technology have made it possible to produce large amounts of proteins with peptides of 50 amino acids or more amino acids at a reasonable cost by recombinant methods. However, using such a recombinant method, when some small peptides, such as hormones and cytokines, are expressed in the host cell, it is difficult to obtain a natural form of the peptide due to protease of the host cell. In addition, many proteins and peptides expressed in bacteria have additional methionine residues at their amino terminus, which not only affect the activity and stability of the protein or amino acid, but are also used as therapeutic drugs. It can also give you immunogenicity.

This problem can be solved by recombinantly producing the protein or peptide to be produced as a fusion protein with a specific protein. In general, many foreign proteins and peptides are LacZ, GST, thfB, bla, E. coli maltose-binding protein (MBP) which show high expression yields in bacteria and animal cells (di Guan et al . , 1988, Gene, 67, 21-30) and E. coli thioredoxin (LaVallie et al., 1995, Curr. Opin. Biotechnol . 6, 501-506) and a fusion gene of a protein or peptide gene It is produced in the form of a fusion protein obtained using. Such fusion protein expression methods enable high-level expression of proteins or peptides to be produced in large quantities, increase the stability and water solubility of proteins and peptides, and enable isolation and purification by the affinity of the fusion proteins themselves.

 Proteins or peptides produced in the form of fusion proteins cannot themselves be used as therapeutic agents and end products. Therefore, in order to isolate and recover the pure target protein and peptide, a genetically engineered protease cleavage site is inserted at the junction of the fusion partner protein and the target protein or peptide to produce the fusion protein, and then the fusion protein is cleaved with the protease. However, this is very limited.

Accordingly, the present inventors have intensively developed a method for producing a large amount of a bioactive protein or peptide using a fusion protein. As a result, a) cells encoding DNA encoding a fusion protein of an immunoglobulin fragment and a bioactive protein or peptide are used. After being introduced into, culturing the cells; And b) obtaining the fusion protein from the cell culture liquid obtained in step a), and then completing the present invention by discovering the method of the present invention comprising separating the bioactive protein or peptide therefrom.

It is an object of the present invention to provide a method for mass production of a bioactive protein or peptide using a fusion protein in which a therapeutically useful bioactive protein or peptide is fused with an immunoglobulin fragment.

It is another object of the present invention to provide the fusion protein, DNA encoding the same, a vector comprising the DNA and a cell transformed with the vector.

It is another object of the present invention to provide a method of using an immunoglobulin fragment as a fusion partner for mass production of bioactive proteins or peptides.

In order to achieve the above object, the present invention comprises the steps of: a) introducing a DNA encoding a fusion protein of an immunoglobulin fragment and a bioactive protein or peptide into the cell, and then culturing the cell; And b) obtaining a fusion protein from the cell culture solution obtained in step a), and then separating the bioactive protein or peptide therefrom.

In order to achieve the above another object, the present invention provides the fusion protein, DNA encoding the same, a vector comprising the DNA and a cell transformed with the vector.

In order to achieve the above another object, the present invention provides a method of using an immunoglobulin fragment as a fusion partner for mass production of bioactive proteins or peptides.

Using the methods of the present invention, it is possible to produce large quantities of bioactive proteins or peptides that are therapeutically useful but have very low expression levels or are difficult to synthesize.

1 is a schematic of the cloning process for fusing immunoglobulin fragments with ubiquitin specific cleavage sequences.
Figure 2 is a schematic diagram of a cloning process for fusing proteins and peptides to pFUBPTH1-84 in the expression vector of the present invention.
3 is a schematic diagram of a cloning process for fusion of an IGF-1 peptide with an immunoglobulin fragment comprising an EK specific degradation sequence.
Figure 4 is a schematic diagram of the expression vector production process by the in-frame fusion method of the immunoglobulin fragment and the fuxeon peptide.
5 is a result of analyzing the isolated glucagon peptide by SDS-PAGE by treating the fusion protein expressed from the expression vector of the present invention with ubiquitin hydrolase.
Figure 6 is the result of analysis of purified glucagon (A), IGF-1 (B), PTH 1 ~ 84 (C) and fuxion (D) by SDS-PAGE.

Hereinafter, the present invention will be described in detail.

In the present invention, a) introducing a DNA encoding a fusion protein of an immunoglobulin fragment and a bioactive protein or peptide into the cell, and then culturing the cell; And b) obtaining a fusion protein from the cell culture solution obtained in step a), and then separating the bioactive protein or peptide therefrom, using the immunoglobulin fragment as a fusion partner to mass produce the bioactive protein or peptide. Provide a way to.

In the present invention, the fusion protein is an immunoglobulin fragment sequence and the desired bioactive protein or peptide sequence are fused with each other, and a chemical or enzyme is specifically recognized between the immunoglobulin fragment sequence and the bioactive protein or peptide sequence. Amino acid cleavage sequences (chemical or enzyme specific cleavage sequences) that can be cleaved.

Specifically, the production method comprises the steps of: 1) preparing a vector comprising a DNA encoding an immunoglobulin fragment, an enzyme specific cleavage sequence, and a fusion protein consisting of a bioactive protein or peptide; 2) transforming said vector into a host cell; 3) culturing the transformed cells; 4) recovering and refolding the fusion protein cultured above; And 5) separating a bioactive protein or peptide from the fusion protein using an enzyme.

The “immunoglobulin fragment” used as a fusion partner in the present invention may be a constant region of IgG, IgA, IgE, IgM or IgD, combinations or hybrids of human, mouse, pig, rabbit or rat, preferably IgG1 , IgG2, IgG3 or IgG4 constant regions, combinations thereof or hybrids, more preferably IgG4 constant regions.

As used herein, "combination" means that when forming a dimer or multimer, the polypeptide encoding the short chain immunoglobulin constant region binds to the polypeptide encoding the short chain immunoglobulin constant region of different origin, and "hybrid". By "is meant that there are at least two immunoglobulin constant region sequences of different origin within the single chain immunoglobulin constant region.

The immunoglobulin fragment is all or a fragment thereof of one or more domains selected from the group consisting of CH1 domain, CH2 domain, CH3 domain and CH4 domain, which are constant regions of an immunoglobulin heavy chain, and CL domain, which is a constant region of a light chain. For example a CH1 domain, a CH2 domain, a CH3 domain or a CH4 domain; CH1 and CH2 domains; CH2 and CH3 domains; CH1, CH2 and CH3 domains, and the like, and the arrangement of the domains is not particularly limited.

Preferably, the immunoglobulin fragment may comprise CH1, CH2 and CH3 domains, or may further comprise a CH4 domain (for IgM). In addition, the immunoglobulin fragment is an Fc fragment or derivative thereof of a heavy chain constant region including all or a portion of a hinge region, or an Fc fragment or derivative thereof that does not include all or a portion of the hinge region. In this case, the hinge region may be natural and may be modified by deletion, insertion, non-conservative or conservative substitution.

The “Fc fragment derivative” refers to a variant in which one or more amino acid residues are changed from the amino acid sequence of a native immunoglobulin fragment, and can be artificially produced by mutation methods known in the art.

As one preferred example, the immunoglobulin fragments of the invention comprise CH1, CH2 and CH3 domains of IgG4 constant regions. As another example, an immunoglobulin fragment of the invention is an Fc fragment or derivative thereof comprising the hinge region of IgG4 and the CH2 and CH3 domains of an IgG4 constant region. Preferably, it is an Fc fragment or derivative thereof consisting of the CH2, CH3 domain of an IgG4 hinge region and an IgG4 constant region, encoded by the nucleotide sequence of SEQ ID NO: 1.

A "bioactive protein or peptide" in the present invention may be a protein or peptide that is therapeutically useful but especially has low expression levels or is difficult to synthesize.

Specifically, the physiologically active protein or peptide is a blood factor, digestive hormone, adrenal cortex hormone, thyroid hormone, intestinal hormone, cytokine, enzyme, growth factor, neuropeptide (neuropeptide), pituitary hormone, hypothalamic hormone, anti-virus It may be selected from the group consisting of peptides and non-natural peptide derivatives having physiological activity.

The bioactive protein or peptide is preferably a erythrocyte growth factor, granulocyte-macrophage colony stimulating factor, amylin, glucagon, insulin, somatostatin, peptide YY, NPY (neuropeptide Y) , Angiotensin, bradykinin, calcitonin, corticotropin, eledoisin, gastrin, leptin, oxytocin, vasopressin, luteinizing hormone, luteinizing hormone, follicle stimulating hormone, parathyroid hormone Hormones, secretin, sermorelin, human growth hormone (hGH), growth hormone releasing peptides, granulocyte colony stimulating factors, interferon (IFN), interleukin, Prolactin releasing peptide, orexin, thyroid releasing peptide, cholecystokinin, gastrin inhibitory peptide, calmodulin, Gastric releasing peptide, motilin, vasoactive intestinal peptide, atrial natriuretic peptide (ANP), barin natriuretic peptide (BNP), C C-type natriuretic peptide (CNP), neurokinin A, neuromedin, neuromedin, renin, endothelin, sarafotoxin peptide, carcar Carsomorphin peptide, demorphin, dynorphin, endorphin, endorphin, enkepalin, T cell factor, tumor necrosis factor, tumor necrosis factor receptor, urokinase receptor, tumor suppressor , Collagenase inhibitors, thymopoietin, thymulin, thymopentin, thymoin, thymic humoral factor, adrenomodullin, allah Tostatin (allatostatin), amyloid beta-protein fragment, antimicrobial peptide, antioxidant peptide, bombesin, osteocalcin, CART peptide, E-selectin, ICAM-1, VCAM -1, leucokine, kringle-5, laminin, inhibin, gallanin, fibronectin, pancreastatin and fuzeon It can be selected from the group consisting of As long as some amino acid residues of the peptide are substituted, added, or deleted, so long as they have a substantially equivalent or increased function, activity or stability with the natural form of the peptide, they are included in the scope of the bioactive peptide of the present invention. Such proteins or peptides may be produced in high efficiency by the present invention and used therapeutically.

As used herein, the term "chemical or enzyme specific cleavage sequence" refers to one or two or more contiguous amino acid sequences that can be cleaved by any chemical or enzyme specifically. For example, it is reported that cynogen-bromide recognizes and cleaves a single methionine amino acid, and trypsin recognizes and cleaves a single arginine or lysine or two consecutive arginine-arginine, lysine-lysine amino acid sequences (US Pat. 6,010,883). In addition, enterokinase (enterokinase) recognizes the sequence of Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 57) to cleave the peptide chain at the lysine position, Xa protease factor is Ile-Glu-Asp-Gly-Arg ↓ sequence (SEQ ID NO: 58), thrombin for Leu-Val-Pro-Arg ↓ Gly-Ser sequence (SEQ ID NO: 59), TEV protease for Glu-Asn-Leu-Tyr-Phe-Gln ↓ Gly sequence ( SEQ ID NO: 60) and the PreScission ™ protease recognize and cleave the Leu-Glu-Val-Leu-Phe-Gln ↓ Gly-Pro sequence (SEQ ID NO: 61) (Raymond. C. stevens., Structure, 2000, vol 8 No 9, 177-185). Here, the symbol ↓ indicates a cleavage site. In addition, the signal peptidase recognizes and cleaves a signal sequence, and the ubiquitin C-terminal hydrolase L3 recognizes and cleaves a sequence of three parts.

MQIF ¹⁾ VKTLTGKTIT LEVESSDTIDNVKSKIQDKEGIPPD ²⁾ QQRLIFAGKQL EDGRTLSDY NIQKESTL ³⁾ HLVLRLRGG ↓ (Keith. D. wilkins., J. Mol. Biol . (1999) 291, 1067-1077) (SEQ ID NO: 62)

The chemical or enzyme specific cleavage sequence is preferably a protein selected from the group consisting of trypsin, thrombin, TEV protease, PreScission protease, enterokinase and ubiquitin hydrolase, more preferably enterokinase or ubiquitin C-terminal singer Characterized in that it is recognized by the degrading enzyme L3, particularly preferably the ubiquitin C-terminal hydrolase L3.

In the present invention, by using the ubiquitin hydrolase can recognize the tertiary structure of proteins and peptides, specific cleavage of the C terminus can be used to isolate only the desired protein. Since these ubiquitin hydrolases are small in size, they yield a high yield of purely obtained final peptide ( Bull. Korean Chem. Soc . 2007, Vol. 28, No. 9), and cleavage even under environmental conditions containing high concentrations of salts. Excellent efficiency and economical.

As used herein, the term "fusion protein of an immunoglobulin fragment and a bioactive protein or peptide" or "fusion protein" means that one or more polypeptides including an immunoglobulin are linked into a single polypeptide through a peptide bond. And one or more genes including an immunoglobulin gene are fused by a recombinant method and translated into one polypeptide. For the purposes of the invention, the fusion of immunoglobulin fragments with bioactive proteins or peptides is a nucleic acid sequence encoding an immunoglobulin fragment, a sequence encoding a protein or peptide of interest and an amino acid cleavage that the chemical or enzyme can specifically recognize and cleave. Means fusion with a sequence.

Fusion partners can be used to: 1) impart high expression levels of proteins or peptides with low expression levels or difficult to artificially synthesize by recombinant methods, and 2) induce secretion of the medium or cells into the extracellular matrix. , 3) to increase the solubility or impart stability of the expressed protein or peptide, and 4) to facilitate purification of the protein or peptide. Such fusion partners are typically His-Tag, T7-Tag, S-tag, Flag peptides, ubiquitin, NusA, chloramphenicol acetyltransferase, streptococcal G protein, dihydrofolate reductase (dihydrofolate) reductases, cellulose binding domains (CBD's), galactose binding proteins, calmodulin binding proteins (CBP), hemagglutinin influenza virus (HAI), green fluorescent proteins; GFP), chitin binding domain, outer membrane protein T (ompT), outer membrane protein A (ompA), pelB, DsbA (disulfide bond formation promoter A), DsbC (disulfide bond formation promoter C), HSB-tag, Polyarginine, polycysteine, polyphenylalanine, c-myc, T7gen10, KSI, LacZ (β-galactosidase), glutathione-S-transferase, thfB, bla, E. coli MBP and E. coli thioredoxin are widely used.

LacZ (β-galactosidase), glutathione-S-transferase, thfB, bla, and E. coli MBP, which are commonly used as fusion partners, generally provide water-soluble properties to the expressed fusion proteins and facilitate purification. To be used. However, they are often expressed as insoluble aggregates depending on proteins or peptides fused to a fusion partner, and thus they are limited to only some proteins or peptides having suitable characteristics. In addition, since only a fusion protein expressed in water solubility can be used by the purification method by the affinity of the fusion partner, the fusion protein expressed in insoluble aggregates is difficult to purify, and has a disadvantage of poor refolding.

On the other hand, the fusion protein of the present invention is easy to express in the form of water-soluble and insoluble aggregates in the host cell according to the expression strategy, and especially when expressed in insoluble aggregates, shows easy expression and shows high expression levels. It can be used for expression of peptides. In addition, both purification with a protein A affinity column using affinity of immunoglobulins and purification with ionic binding resins have possible advantages.

Immunoglobulin fragments, fusion partners used in the present invention, can express high levels of the desired proteins and peptides to be fused in the form of water-soluble and insoluble aggregates and facilitate purification. Specifically, the immunoglobulin fragments used as fusion partners in the present invention exhibit not only high expression levels with high efficiency in microbial host cells such as E. coli, but also the target protein or peptide to be conjugated to give high expression levels. It is a new convergence partner with the ability.

The present invention also provides a fusion protein comprising an immunoglobulin fragment and a bioactive protein or peptide represented by the amino acid sequence of SEQ ID NO: 3.

The present invention also provides a DNA encoding the fusion protein, a vector containing the DNA, and a transformant transformed with the vector.

According to one embodiment of the invention, the transformant is E. coli HMF001 (Accession Number: KCCM10980P), HMF002, HMF003 (Accession Number: KCCM10981P), HMF004, HMF005, HMF006, HMF007, HMF008, HMF009, HMF0010, HMF0011 and HMF0012 E. coli HMF001 and HMF003 was deposited on the Korea microbial conservation center (KCCM) as the accession number KCCM-10980P and KCCM-10981P as of January 15, 2009, respectively.

The present invention also provides a method of using an immunoglobulin fragment as a fusion partner for mass production of bioactive proteins or peptides.

Hereinafter, the present invention will be described in more detail with reference to Examples, and the following Examples are merely illustrative of the present invention, but are not limited thereto.

Example 1: Construction of Fusion Protein Expression Vectors

1. Construction of Immunoglobulin Fragment-Ubiquitin Fusion Protein Expression Vectors

Expression vectors encoding fusion proteins of immunoglobulin fragments and ubiquitin were constructed. The expression vector comprises a nucleotide sequence (SEQ ID NO: 1) encoding a human-derived immunoglobulin Fc fragment consisting of the IgG4 hinge region and the CH2 and CH3 domains of an IgG4 constant region, and which the protease can specifically recognize. It is linked with the nucleotide sequence (SEQ ID NO: 2) encoding the ubiquitin protein, including, and prepared as follows.

Human immunoglobulin fragment DNA was synthesized from cDNA library of blood (clontech laboratories Inc.). First, the forward oligonucleotide (SEQ ID NO: 4) is synthesized to include the initiating ATG codon and the NdeI restriction enzyme site, and the reverse oligonucleotide (SEQ ID NO: 5) is amino for in-frame fusion with ubiquitin. Synthesis was carried out without insertion of restriction enzyme sites at the terminal sites. This was used to amplify the DNA encoding the fragment of the immunoglobulin by PCR. The PCR conditions were 30 seconds at annealing temperature 60 ℃, extension was carried out 30 cycles from 68 ℃ 50 seconds.

5 'GGAATTCCATATGCCATCATGCCCAGCACCTGAG 3' (SEQ ID NO: 4)

5 'TTTACCCAGAGACAGGGAGAGGCTCTTCTGTGTG 3' (SEQ ID NO: 5)

Ubiquitin DNA comprising sequences that the protease can specifically recognize were synthesized from the cDNA library. For in-frame linkage with immunoglobulin fragments, the forward oligonucleotides (SEQ ID NO: 6) are synthesized to contain only the sequences encoding the ubiquitin protein, and the reverse oligonucleotides (SEQ ID NO: 7) encode restriction site MSCI and BamHI sequences. It was synthesized to include. This oligonucleotide was used to amplify the DNA encoding the fragment of the ubiquitin protein by PCR. The PCR conditions were 30 seconds at annealing temperature of 60 ℃, extension was carried out 30 cycles from 68 ℃ to 30 seconds.

 5 'ATGCAGATTTTCGTCAAGACTTTGACCGGTAAAAC 3' (SEQ ID NO .: 6)

 5 ’GCGGATCCTTTGGCCACCTCTTAGCCTTAGCACAAGATG 3’ (SEQ ID NO .: 7)

The immunoglobulin fragment DNA (666bp) and ubiquitin DNA (228bp) obtained above were cloned into pET22b vector (Novagen). The pET22b vector was treated with the restriction enzymes NdeI and BamHI to remove signal sequences, the immunoglobulin fragment PCR products prepared above were treated with NdeI, and the ubiquitin PCR product was treated with BamHI to clone pET22b with T4 DNA ligase. Inserted into vector. The resulting expression vector is named pCarrierA-UB fusion protein expression vector, and a schematic diagram thereof is shown in FIG. 1. At this time, the protein product expressed from the immunoglobulin fragment DNA was named "CarrierA".

The pCarrierA-UB fusion protein expression vector comprises the amino acid sequence of SEQ ID NO: 3 under the control of the T7 promoter and expressed the fusion protein in the form of inclusion bodies in the host cell.

2. Synthesis of Peptides

Glucagon (29a.a), Salmon Calcitonin (32a.a), PYY (3-36, 34a.a), PTH (1-84, 84a.a), PTH (1-34, 34a.a), IGF- 1 (70a.a), leptin (167a.a) and fuzeon (36a.a) peptides were synthesized by LCR (ligation chain reaction) and PCR methods by preparing oligonucleotides containing the sequence of each peptide. . Specifically, 10 pmol of the nucleotide containing the peptide sequence is added to a reaction tube containing a mixture of 0.1 mM dNTP, 10X reaction buffer, 1 unit of pfu polymerase, and LCR using Veriti PCR cycler (Veriti, applied biosystem). And PCR was performed.

Unless stated otherwise in the present invention, the reaction conditions of PCR are 30 cycles annealing: 60 seconds at 60 ° C., extension: 68 ° C. to 30 seconds. 30 cycles in 20 seconds.

a) Synthesis of Glucagon Peptides

Glucagon peptides were synthesized by LCR using oligonucleotides of SEQ ID NOs: 8-14. At this time, in order to facilitate in-frame cloning, one base of "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 8), and a SalI restriction site was inserted into the reverse oligo nucleotide (SEQ ID NO: 14).

5 'CCATTCACAGGGCACATTCACCAGTGACTACAG 3' (SEQ ID NO .: 8)

5 'CAAGTATCTGGACTCCAGGCGTGCCCAAGATTTT 3' (SEQ ID NO .: 9)

5 'GTGCAGTGGTTGATGAATACCTGAGTCGACCGCA 3' (SEQ ID NO: 10)

5 ’TGTGCCCTGTGAATGG 3’ (SEQ ID NO .: 11)

5 'GGAGTCCAGATACTTGCTGTAGTCACTGGTGAA 3' (SEQ ID NO .: 12)

5 'TCATCAACCACTGCACAAAATCTTGGGCACGCCT 3' (SEQ ID NO .: 13)

5 'TGCGGTCGACTCAGGTAT 3' (SEQ ID NO .: 14)

b) Synthesis of Salmon calcitonin peptide

Salmon calcitonin peptides were synthesized by the method of LCR using oligonucleotides of SEQ ID NOs: 15-21. At this time, in order to facilitate in-frame cloning, one base "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 15), and a SalI restriction site was inserted into the reverse oligonucleotide (SEQ ID NO: 21).

5 'CTGCTCCAATCTCTCTACTTGCGTTCTGGGGAAGTTGA 3' (SEQ ID NO .: 15)

5 'GTCAGGAATTACATAAGCTGCAAACTTACCCGCG 3' (SEQ ID NO .: 16)

5 'TACCAACACTGGTTCTGGTACACCTTGAGTCGACCGCA 3' (SEQ ID NO .: 17)

5 ’CAAGTAGAGAGATTGGAGCAG 3’ (SEQ ID NO .: 18)

5 'CTTATGTAATTCCTGACTCAACTTCCCCAGAACG 3' (SEQ ID NO .: 19)

5 'CAGAACCAGTGTTGGTACGCGGGTAAGTTTGCAG 3' (SEQ ID NO .: 20)

5 'TGCGGTCGACTCAAGGTGTAC 3' (SEQ ID NO .: 21)

C) Synthesis of Peptide YY (3-36) Peptide

PYY (3 to 36) peptide was synthesized by the method of LCR using oligonucleotides of SEQ ID NOs: 22 to 28. At this time, in order to facilitate in-frame cloning, one base "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 22), and a SalI restriction site was inserted into the reverse oligonucleotide (SEQ ID NO: 28).

5 ’CATCAAACCCGAGGCTCCCGGCGAAGACGCCTCGCCGGAGG 3 (SEQ ID NO .: 22)

5 'AGCTGAACCGCTACTACGCCTCCCTGCGCCACTACC 3' (SEQ ID NO .: 23)

5 'TCAACCTGGTCACCCGGCAGCGGTATTGAGTCGACCGCA 3' (SEQ ID NO .: 24)

5 'CGCCGGGAGCCTCGGGTTTGATG 3' (SEQ ID NO .: 25)

5 ’CGTAGTAGCGGTTCAGCTCCTCCGGCGAGGCGTCTT 3’ (SEQ ID NO .: 26)

5 ’CCGGGTGACCAGGTTGAGGTAGTGGCGCAGGGAGG 3’ (SEQ ID NO .: 27)

5 'TGCGGTCGACTCAATACCGCTG 3' (SEQ ID NO .: 28)

d) Synthesis of PTH (parathormone) (1-84) peptide

 PTH (1-84) peptides prepared oligonucleotides of SEQ ID NOs: 29 and 30 from human placental cDNA libraries (OriGene technologies, Inc.) and were amplified by PCR using them. At this time, in order to facilitate in-frame cloning, one base of "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 29), and the SalI restriction site was inserted into the reverse oligonucleotide (SEQ ID NO: 30).

5 'CTCTGTGAGTGAAATACAGCTTATGCATAACCTGG 3' (SEQ ID NO .: 29)

5 'ACGCGTCGACTTATCACTGGGATTTAGCTTTAGTT 3' (SEQ ID NO .: 30)

e) Synthesis of PTH (1-34) Peptides

PTH (1 to 34) peptide was synthesized by PCR using oligonucleotides of SEQ ID NOs: 31 and 32, using the PTH (1 to 84) PCR product as a template. At this time, in order to facilitate in-frame cloning, one base of "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 31), and a SalI restriction site was inserted into the reverse oligo nucleotide (SEQ ID NO: 32).

5 'CTCTGTGAGTGAAATACAGCTTATGCATAACCTGG 3' (SEQ ID NO .: 31)

5 'ACGCGTCGACTCAAAAATTGTGCACATCCTGCAGC 3' (SEQ ID NO .: 32)

f) synthesis of IGF-1 peptide

IGF (insulin like growth factor) -1 peptide was prepared from oligonucleotides (DoriGene technologies, Inc.) human oligonucleotides of SEQ ID NOS: 33-35 and amplified by PCR using the oligonucleotides. At this time, in order to facilitate in-frame cloning, one base "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 33), and a SalI restriction site was inserted into the reverse oligonucleotide (SEQ ID NO: 34).

5 'CGGACCGGAGACGCTCTGCGGGGCTGAGCTGGTGG 3' (SEQ ID NO: 33)

5 'ACGCGTCGACTTATCAAGCTGACTTGGCAGGCTTG 3' (SEQ ID NO .: 34)

5 'GGAATTCCATATGGGACCGGAGACGCTCTGCGGGGC 3' (SEQ ID NO .: 35)

g) leptin protein synthesis

Leptin protein was prepared from the human leptin cDNA library (OriGene technologies, Inc.) oligonucleotides of SEQ ID NOs: 36 and 37 and amplified by PCR using them. At this time, in order to facilitate in-frame cloning, one base of "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 36), and a SalI restriction site was inserted into the reverse oligonucleotide (SEQ ID NO: 37).

5 'CGTGCCCATCCAAAAAGTCCAAGATGACACC 3' (SEQ ID NO: 36)

5 'ACGCGTCGACTCAGCACCCAGGGCTGAGGTCCAGC 3' (SEQ ID NO .: 37)

h) fuzeon peptide synthesis

Fuzeon peptides were synthesized by LCR method using oligonucleotides of SEQ ID NOs: 38-44. At this time, in order to facilitate in-frame cloning, one base of "C" was added to the 5 'forward oligonucleotide (SEQ ID NO: 38), and a SalI restriction site was inserted into the reverse oligonucleotide (SEQ ID NO: 44).

5 'CTATACCAGTTTAATTCATAGCTTAAT 3' (SEQ ID NO .: 38)

5 ’GTCAGAATCAGCAGGAGAAAAACGAAC 3’ (SEQ ID NO .: 39)

5 ’CTGGAATTAGATAAATGGGCCTCGCTG 3’ (SEQ ID NO .: 40)

5 ’GTTCTGAGTCGACCGCA 3’ (SEQ ID NO .: 41)

5 'TGATTCTGACTTTCTTCAATTAAGCTAT 3' (SEQ ID NO .: 42)

5 'CTAATTCCAGCAGTTCTTGTTCGTTTTT 3' (SEQ ID NO: 43)

5 'TGCGGTCGACTCAGAACCAATTCCACAGCGAGGCC 3' (SEQ ID NO: 44)

3. Preparation of Fusion Proteins of Immunoglobulin Fragments-Ubiquitin (UB) -Bioactive Proteins or Peptides

 A fusion protein was prepared in which the immunoglobulin fragment-UB fusion protein and the bioactive peptide were fused. The fusion protein was prepared using an in-frame fusion method between an immunoglobulin fragment-UB fusion protein expression vector and a peptide coding sequence.

First, the DNA encoding each peptide amplified in Example 1-2 was cut with restriction enzyme SalI, and then the size of each peptide (PTH1-84; 252bp, PTH1-34; 102bp, glucagon; 87bp, scalcitonin DNAs corresponding to 96 bp, IGF-1; 210 bp, PYY3 to 36; 102 bp, and fuxion; 108 bp) were isolated.

In addition, the immunoglobulin fragment-UB fusion protein expression vector (pCarrierA-UB) was cleaved using MSCI and SalI restriction sites, and purified. The immunoglobulin fragment-UB protein fusion vector was isolated using pure T4 DNA ligase and peptides, and the expression vector encoding the obtained peptide fusion was immunoglobulin fragment-UB-PTH (1-84) (pFUBPTH1-84). ), Immunoglobulin fragment-UB-PTH (1-34) (pFUBPTH1-34), immunoglobulin fragment-UB-IGF-1 (pFUBIGF), immunoglobulin fragment-UB-scalcitonin (pFUBCal), immunoglobulin fragment-UB -Glucagon (pFUBGluca), immunoglobulin fragment-UB-PYY (3-36) (pFUBPYY3-36), immunoglobulin fragment -UB-leptin (pFUBLep) and immunoglobulin fragment -UB-fuzeon (pFUBFuzeon). Schematic diagram of the manufacturing process of pFUBPTH1-84 in the expression vector is shown in Figure 2, the other vectors were prepared in a similar manner. This protein fusion expression vector expressed the fusion protein in the form of inclusion bodies in the cytoplasm in the host cell.

4. Preparation of Immunoglobulin Fragments-EK-IGF-1 Fusion Proteins

An expression vector was constructed to express the immunoglobulin-EK-IGF-1 fusion protein. The expression vector includes a nucleotide sequence (SEQ ID NO: 1) encoding an immunoglobulin Fc fragment derived from human, and the 3 'end of the sequence encoding the immunoglobulin fragment is specifically recognized by EK (enterokinase). It is linked to the 5 'end of the sequence encoding the IGF-1 peptide containing a possible nucleotide sequence (SEQ ID NO: 63).

The expression vector was prepared as follows. Human immunoglobulin fragment DNA was synthesized from cDNA library of blood (Clontech Laboratories, Inc.). First, the forward oligonucleotide (SEQ ID NO: 45) is synthesized to include the starting ATG codon and the NdeI restriction enzyme site, and the reverse oligonucleotide (SEQ ID NO: 46) is the nucleotide sequence that EK can specifically recognize (SEQ ID NO: : 63). The DNA encoding the immunoglobulin fragment and EK recognition sequence was amplified by PCR. The PCR was carried out for 30 cycles at annealing at 60 ° C. for 30 seconds and extension at 68 ° C. for 50 seconds.

5 'GGAAATCCATATGCCATCATGCCCAGCACCTGAGT 3' (SEQ ID NO: 45)

5 'CCCTTGTCGTCGTCGTCTTTACCCAGAGACAGGGA 3' (SEQ ID NO .: 46)

IGF-1 peptide was amplified by PCR using SEQ ID NOs: 47 and 48. At this time, the 5 'forward oligonucleotide (SEQ ID NO: 47) inserted a sequence complementary to the EK recognition sequence, and inserted the BamHI restriction site into the reverse oligonucleotide (SEQ ID NO: 48).

5 'AAAGACGACGACGACAAGGGACCGGAGACGCTCTG 3' (SEQ ID NO .: 47)

5 'CGCGGATCCTCAAGCTGACTTGGCAGGCTTGAG 3' (SEQ ID NO .: 48)

The DNA of the immunoglobulin fragment-EK-IGF-1 was prepared by PCR using the above-described immunoglobulin fragment and DNA encoding the EK recognition sequence and DNA encoding the IGF-1 peptide. Subsequently, the pET22b vector was treated with the restriction enzymes NdeI and BamHI to remove the signal sequence, and the fusion DNA of the immunoglobulin fragment-EK-IGF-1 prepared above was treated with NdeI and BamHI, followed by T4 DNA ligase. To each other. The resulting fusion protein expression vector was designated as immunoglobulin fragment-EK-IGF-1 (pFEKIGF), and a schematic diagram of the expression vector is shown in FIG. 3.

5. Preparation of Immunoglobulin Fragments-Fugeon, Immunoglobulin Fragments-Fugeon-Fugeon and Immunoglobulin Fragments-C34 Fuzeon Fusion Proteins

(5-1) Preparation of immunoglobulin fragment-fuzeon expression vector

An expression vector was prepared to express a fusion protein of an immunoglobulin fragment and a fuxion peptide. The expression vector comprises a sequence encoding a human-derived immunoglobulin Fc fragment (SEQ ID NO: 1), wherein the 3 'end of the sequence encoding the immunoglobulin fragment is the 5' end of the sequence encoding the fuzeon peptide. And in-frame convergence.

The expression vector was prepared as follows. Human immunoglobulin fragment DNA was synthesized from cDNA library of blood (Clontech Laboratories, Inc.). First, the forward oligonucleotide (SEQ ID NO: 49) is synthesized to include the initiating ATG codon and the NdeI restriction enzyme site, and the reverse oligonucleotide (SEQ ID NO: 50) is 5 for in-frame fusion with the coding sequence. 'It was synthesized by inserting only the phosphate modification (p) without inserting the restriction enzyme site into the terminal site. Using this, the immunoglobulin fragment DNA was amplified by PCR, and the PCR was performed 30 cycles at annealing at 60 ° C. for 30 seconds and at an extension of 68 ° C. for 50 seconds.

5 'GGAAATCCATATGCCATCATGCCCAGCACCTGAG 3' (SEQ ID NO: 49)

5 'p-TTTACCCAGAGACAGGGAGAGGCTCTTCTGTGTG 3' (SEQ ID NO: 50)

Fuzeon peptide was synthesized using the immunoglobulin fragment-UB-fuzeon gene of Example 3-1 as template DNA. In this case, for in-frame fusion with the sequence encoding the immunoglobulin fragment, the forward oligonucleotide (SEQ ID NO: 51) was inserted by inserting only a phosphate modification, and the reverse oligonucleotide (SEQ ID NO: 52) was synthesized by inserting a BamHI restriction site. . This was used to amplify the DNA encoding the fragment of the fuzeon peptide by PCR. The PCR was carried out for 30 cycles of annealing at 60 ° C. for 20 seconds and extension at 68 ° C. for 20 seconds.

5 'p-TATACCAGTTTAATTCATAGCTTAATTGAAGAAAG 3' (SEQ ID NO .: 51)

5 'CGCGGATCCTCAGAACCGGTTCCACAGCGAGGCC 3' (SEQ ID NO: 52)

Subsequently, the pET22b vector was treated with the restriction enzymes NdeI and BamHI to remove the signal sequence, and the immunoglobulin fragment PCR product was treated with NdeI and the fuzeon PCR product with BamHI, followed by conjugation using T4 DNA ligase. The fusion protein expression vector obtained through the conjugation process was designated as immunoglobulin fragment-fuzeon (pFFuzeon), and a schematic diagram of the expression vector is shown in FIG. 4.

(5-2) Construction of Immunoglobulin Fragment-Fugeon-Fugeon Expression Vector

An expression vector was prepared to express the fusion protein of an immunoglobulin fragment-fuxion protein and a fuxion peptide.

The expression vector comprises a DNA base sequence encoding a fusion protein of the immunoglobulin fragment and the fuxion peptide of Example 5-1, wherein the 3 'end of the fusion protein DNA is the 5' end of the fuzeon peptide-encoding sequence. And in-frame convergence.

The expression vector was prepared as follows. The fusion protein DNA of the immunoglobulin fragment and the fuzeon peptide was prepared by PCR using the gene of the immunoglobulin fragment-fuzeon expression vector of Example 5-1 as a template DNA (30 seconds at annealing at 60 ° C., 60 at 68 ° C. for extension). 30 cycles). In this case, the forward oligonucleotide uses the sequence of SEQ ID NO: 49, and the reverse oligonucleotide (SEQ ID NO: 53) does not insert the restriction enzyme site at the 5 'terminal for in-frame fusion with the fuzeon peptide-coding sequence. Instead, only phosphate formula (p) was inserted and synthesized.

5 'p-GAACCAATTCCACAGCGAGGCCCATTTATCTA 3' (SEQ ID NO .: 53)

Fuzeon peptides were synthesized using SEQ ID NOs: 51 and 52, as described in Example 5-1 above.

The pET22b vector was then treated with the restriction enzymes NdeI and BamHI to remove signal sequences, the immunoglobulin fragment-fuzeon PCR product was treated with NdeI, and the fuzeon PCR product was treated with BamHI, followed by conjugation using T4 DNA ligase. Was performed. The fusion protein expression vector obtained through the conjugation process was designated as immunoglobulin fragment-fuxeon-fuzeon (pFFuzeon-Fuzeon), and a schematic diagram of the expression vector is shown in FIG. 4.

(5-3) Construction of immunoglobulin fragment-C34 fuxion expression vector

An expression vector was prepared to express a fusion protein of an immunoglobulin fragment and a C34 fuzeon peptide.

The expression vector includes a sequence encoding a human-derived immunoglobulin Fc fragment (SEQ ID NO: 1), and a sequence encoding the 3 'end of the immunoglobulin fragment-encoding sequence and a fragment of the C34 fuzeon peptide (SEQ ID NO: The 5 'end of (64) is connected by in-frame fusion method.

The expression vector was prepared as follows. Human immunoglobulin fragment DNA was synthesized from cDNA library of blood (Clontech Laboratories, Inc.). Specifically, the forward oligonucleotide uses the sequence of SEQ ID NO: 49, and the reverse oligonucleotide (SEQ ID NO: 54) is a restriction enzyme site at the 5 'end for in-frame fusion with the C34 fuzeon peptide-encoding sequence. Without inserting, only the 5'-terminal sequence of the C34 fuzeon peptide and the phosphate modification were inserted and synthesized.

5 'p-CGATCCCATTCCATCCATTTACCCAGAGACAGGGAGAGGC 3' (SEQ ID NO: 54)

C34 fuzeon peptide was synthesized by PCR using the immunoglobulin fragment-UB-fuzeon gene of Example 3-1 as template DNA. For in-frame fusion with an immunoglobulin fragment-coding sequence, only the phosphate modification was inserted at the 5 'end of the forward oligonucleotide (SEQ ID NO: 55), and the SalI restriction site (SEQ ID NO: 56) was inserted into the reverse oligonucleotide. . DNA (SEQ ID NO: 64) encoding a fragment of the C34 fuzeon peptide was amplified by PCR (30 cycles at 60 seconds at annealing at 60 ° C., 60 seconds at extension 68 ° C.).

5 'p-GGATCGCGAAATTAACAACTATACCAGTTTAATTCATAGC 3' (SEQ ID NO: 55)

5 'ACGCGTCGACTCAGAACCAATTCCACAGCGAGGCC 3' (SEQ ID NO: 56)

The pET22b vector was then treated with the restriction enzymes NdeI and SalI to remove the signal sequence, the immunoglobulin fragment PCR product was treated with the restriction enzyme NdeI with the C34 fuzeon PCR product with SalI, and the conjugation process was performed using T4 DNA ligase. Was performed. The fusion protein expression vector obtained through the conjugation process was designated as immunoglobulin fragment-C34 fuzeon (pFC34Fuzeon), and a schematic diagram of the expression vector is shown in FIG. 4.

Example 2: Expression of Recombinant Fusion Proteins / Peptide

BL21DE3 ( E. coli B F-dcm ompT hsdS (rB-mB-) gal λ (DE3); Stratagene) was transformed with the fusion protein expression vector prepared in Example 1. As a transformation method, the method recommended by Stratagene was used. Each single colony transformed with each fusion protein expression vector was taken and inoculated in 2X Luria Broth (LB) medium containing ampicillin (50ug / ml) and incubated at 37 ° C for 15 hours. The strain culture was mixed with 30% glycerol at a ratio of 1: 1 (v / v), and 1 ml of 2X LB was dispensed into cryo-tubes and stored at -140 ° C. This was used as a cell stock for the production of recombinant fusion proteins. Transformants prepared as described above are shown in Table 1 named as follows. In addition, HMF001 transformed with the expression vector pFUBPTH1-84 and HMF003 transformed with the expression vector pFUBIGF were deposited with KCCM10980P and KCCM10981P, respectively, as of January 15, 2009, to the Korea Microorganism Conservation Center (KCCM).

Expression vector Transformant pFUBPTH1-84 HMF001 (Accession No. KCCM10980P) pFUBPTH1-34 HMF002 pFUBIGF HMF003 (Accession No. KCCM10981P) pFUBCal HMF004 pFUBGluca HMF005 pFUBPYY3-36 HMF006 pFUBLep HMF007 pFEKIGF HMF008 pFUBFuzeon HMF009 pFFuzeon HMF0010 pFFuzeon-Fuzeon HMF0011 pFC34Fuzeon HMF0012

For expression of the fusion proteins, each cell stock 1 vial was dissolved and inoculated in 500 ml of 2X LB and shaken at 37 ° C. for 14-16 hours. When the value of OD.600 nm indicates 5.0, the species culture was added to 1.7 L of fermentation medium (2% tryptone, 1% yeast extract and 1% NaCl) using a 5L fermenter (MDL-8C, BEMARUBISHI, Japan). Inoculation and initial batch fermentation were started. Culture conditions were maintained at a pH of 6.70 using a temperature of 37 ℃, air volume 20 sL / min (1vvm), stirring speed 500rpm and 30% aqueous ammonia.

Fermentation proceeded in a fed-batch culture when the nutrients in the culture were limited, adding a feeding solution (20X yeast extract and 35% glucose). The growth of the strain was monitored by OD values, and introduced with IPTG at a final concentration of 100 uM at OD values above 70. The culture proceeds further to about 23-25 hours after introduction, and after the incubation, the recombinant strain is harvested using a centrifuge and stored at -80 ° C until use. Fermented recombinant fusion protein exhibited an expression level of about 5 g / L (about 30% (w / w) of total protein).

Example 3: Recovery and Refolding of Recombinant Fusion Protein / Peptide

Cells were disrupted and refolded to convert the recombinant fusion proteins / peptides expressed in Example 2 into soluble form.

15 g (wet weight) of cell pellet was suspended in 500 ml lysis buffer (50 mM Tris-HCl, pH 9.0, 1 mM EDTA, pH 8.0), 0.2 M NaCl and 0.5% Triton X-100. Cells were disrupted at 15,000 psi pressure using a Microfluidizer processor M-110EH (AC Technology Corp. Model M1475C). Crushed cell lysates were centrifuged at 12,000 × G for 30 min at 40 ° C. to discard the supernatant and resuspended in 500 ml wash buffer (0.25% Triton X-100 and 10 mM Tris-HCl, pH9.0). The pellet was resuspended in 10 mM Tris-HCl (pH9.0) or distilled water by centrifugation at 40 DEG C for 30 minutes at 12,000XG, and then centrifuged in the same manner. The pellet was taken and resuspended in 200 ml solubilization buffer (8M urea, 50 mM Tris-HCl, pH 8.0) and stirred at room temperature for 2 hours. The mixture was centrifuged at 12,000 × G for 30 minutes at 40 ° C., then the supernatant was taken, and 1 mM cysteine was added thereto and stirred for 30 minutes. Refolding buffer (2M urea, 0.75M arginine, 0.5mM cysteine, 50mM Tris-HCl, pH8.5) was added to refold the proteins in the mixture for 12-16 hours.

Example 4: Purification of Recombinant Fusion Proteins / Peptide

1) Protein A Affinity Column Chromatography

In order to purely separate only the recombinant fusion protein and peptide from the refolding sample obtained in Example 3, the protein A affinity column chromatography (HiTrap rprotein A HP; Amersham Bioscience AB) was purified. First, the salt was removed with a Desalting column and replaced with 10 mM Tris-HCl (pH 8.0) buffer. The sample was bound to a Protein A column using affinity with the immunoglobulin fragment (Recombinant fusion protein / peptide) to the Protein A column, and then flowed by 0.1M citric acid (pH 3.0) to elute the protein. About 1/10 of the volume of the eluted sample was added to Tris-HCl buffer to maintain the pH of the eluted sample at 7.0-8.0.

2) Q HP column chromatography

Anion exchange columns (Amersham Bioscience AB) were used to separate recombinant fusion proteins / peptides partially purified by Protein A column chromatography. First, salts were removed using a dissolving column and replaced with 10 mM Tris-HCl (pH 8.0) buffer. Load the Q HP column equilibrated with Buffer A (10 mM Tris-HCl, pH8.0) and pour 5CV of Buffer B (10 mM Tris-HCl, pH8.0 + 1M NaCl) in a 0-100% gradient to recombinant fusion protein / The peptide was eluted. The dissolution interval was 5-20 ms / cm.

Example 5: Pure Separation of Peptides

1) r Enterokinase  through Peptide  cut( cleavage )

In Example 4, the fusion proteins and peptides purified by the Protein A and Q HP columns were concentrated to a concentration of 1 mg / ml using Vivapin 20 (Sartorious stedim biotech). 10X rEK digestion buffer, a mixture of 10 units rEK (Novagen) was added to the fusion protein concentrate was reacted for 16 hours at 20 ℃. 15% Criterion SDS-PAGE (bio-rad) was used to confirm the efficiency of the peptides cleaved by r enterokinase.

2) Cleavage of Peptides via H6-UBP (Ubiquintin hydrolase)

 The fusion proteins and peptides partially purified by the Protein A and Q HP columns in Example 4 were concentrated to 1 mg / ml using Vivapin 20 (Sartorious stedim biotech). H6-UBP (Advanced protein technologies corp.) Was added to the fusion protein concentrate in a ratio of 50: 1 to 100: 1 (substrate: enzyme) and reacted at 30 ° C. for 2 to 3 hours. The yield of peptides cleaved by H6-UBP was confirmed using 15% Criterion SDS-PAGE (bio-rad). SDS-PAGE results of samples containing fusion proteins of immunoglobulin fragments and glucagon peptides obtained at each step of the purification process are shown in FIG. 5.

Lane 1 in Figure 5 lane 1 is the fusion protein after refolding; Lane 2 was partially purified fusion protein (prior to ubiquitin hydrolysis) via a Q column; Lanes 3 to 6 are hydrolysis products by concentration of fusion protein and ubiquitin (3 is fusion protein 2mg: ubiquitin 80ug; 4 is fusion protein 2mg: ubiquitin 40ug; 5 is fusion protein 4mg: ubiquitin 80ug; and 6 is fusion protein 6mg: Ubiquitin 80 ug), respectively. As shown in Figure 5, it can be seen that glucagon peptide was separated from the fusion protein through the H6-UBP enzyme reaction.

3) Pure separation of peptides by SEC column chromatography

SEC column chromatography was performed to purely separate peptides isolated from fusion proteins. The reaction solution used for peptide cleavage with rEK and H6-UBP in Examples 5-1 and 5-2 was applied to a Sephadex 75 column to separate proteins and peptides eluted by the difference in size. First, a buffer containing 10 mM Tris-Cl (pH 8.0) + 100 mM NaCl was flowed at a flow rate of 2 ml / min to stabilize the column, and then the reaction solution was loaded and cut by changing the flow rate of the buffer to 1 ml / min. Only pure proteins and peptides were eluted. The SDS-PAGE results of glucagon, IGF-1, PTH 1-84 and fuzeon peptides isolated from the proteins and peptides are shown in FIGS. 6A to D, respectively, and the yields of the respective proteins / peptides were measured. It is shown in Table 2 below.

No. Protein / Peptide Yield (Yield, mg / L)) One PTH 1-84 202 2 Glucagon 62 3 IGF-1 50 4 Fuxion 154

While the existing peptides were difficult to produce using microorganisms, it can be seen that the microorganisms can be expressed in high yield using the microorganisms.

Example 6: Amino Terminal Sequence Analysis of Peptides

In order to confirm that the amino terminal sequence of the purely isolated peptide through SEC, the amino terminal sequence was analyzed, the results are shown in Table 3 below. As shown in Table 3, it was found that the original sequence and the isolated peptide sequence of each peptide were identical.

Peptide Original sequence Separation peptide sequence SEQ ID NO: Glucagon His-Ser-Gln-Gly-Thr His-Ser-Gln-Gly-Thr 65 Salmon Calcitonin Cys-Ser-Asn-Leu-Ser Cys-Ser-Asn-Leu-Ser 66 PTH1 ~ 84 Ser-Val-Ser-Glu-Ile Ser-Val-Ser-Glu-Ile 67 PTH 1-34 Ser-Val-Ser-Glu-Ile Ser-Val-Ser-Glu-Ile 68 IGF-1 Gly-Pro-Glu-Thr-Leu Gly-Pro-Glu-Thr-Leu 69 Fuzeon Tyr-Thr-Ser-Leu-Ile Tyr-Thr-Ser-Leu-Ile 70

Korea Microorganism Conservation Center (overseas) KCCM10980 20090108 Korea Microorganism Conservation Center (overseas) KCCM10981 20090108

<110> HANMI PHARM. CO., LTD. <120> Method for producing physiologically active protein or peptide          using immunoglobulin fragment <130> FPD200912-0100 <150> KR2009-4234 <151> 2009-01-19 <160> 70 <170> KopatentIn 1.71 <210> 1 <211> 666 <212> DNA <213> Artificial Sequence <220> <223> immunoglobulin fragment (CarrierA) <400> 1 atgccatcat gcccagcacc tgagttcctg gggggaccat cagtcttcct gttcccccca 60 aaacccaagg acactctcat gatctcccgg acccctgagg tcacgtgcgt ggtggtggac 120 gtgagccagg aagaccccga ggtccagttc aactggtacg tggatggcgt ggaggtgcat 180 aatgccaaga caaagccgcg ggaggagcag ttcaacagca cgtaccgtgt ggtcagcgtc 240 ctcaccgtcc tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtctccaac 300 aaaggcctcc cgtcctccat cgagaaaacc atctccaaag ccaaagggca gccccgagag 360 ccacaggtgt acaccctgcc cccatcccag gaggagatga ccaagaacca ggtcagcctg 420 acctgcctgg tcaaaggctt ctaccccagc gacatcgccg tggagtggga gagcaatggg 480 cagccggaga acaactacaa gaccacgcct cccgtgctgg actccgacgg ctccttcttc 540 ctctacagca ggctaaccgt ggacaagagc aggtggcagg aggggaatgt cttctcatgc 600 tccgtgatgc atgaggctct gcacaaccac tacacacaga agagcctctc cctgtctctg 660 ggtaaa 666 <210> 2 <211> 228 <212> DNA <213> Artificial Sequence <220> <223> Ubiquitin <400> 2 atgcagattt tcgtcaagac tttgaccggt aaaaccataa cattggaagt tgaatcttcc 60 gataccatcg acaacgttaa gtcgaaaatt caagacaagg aaggtatccc tccagatcaa 120 caaagattga tctttgccgg taagcagcta gaagacggta gaacgctgtc tgattacaac 180 attcagaagg agtccacctt acatcttgtg ctaaggctaa gaggtggc 228 <210> 3 <211> 298 <212> PRT <213> Artificial Sequence <220> <223> Carrier A-UB protein <400> 3 Pro Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu   1 5 10 15 Phe Pro Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro              20 25 30 Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val          35 40 45 Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr      50 55 60 Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val  65 70 75 80 Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys                  85 90 95 Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser             100 105 110 Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro         115 120 125 Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val     130 135 140 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 145 150 155 160 Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp                 165 170 175 Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp             180 185 190 Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His         195 200 205 Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys Met Gln     210 215 220 Ile Phe Val Lys Thr Leu Thr Gly Lys Thr Ile Thr Leu Glu Val Glu 225 230 235 240 Ser Ser Asp Thr Ile Asp Asn Val Lys Ser Lys Ile Gln Asp Lys Glu                 245 250 255 Gly Ile Pro Pro Asp Gln Gln Arg Leu Ile Phe Ala Gly Lys Gln Leu             260 265 270 Glu Asp Gly Arg Thr Leu Ser Asp Tyr Asn Ile Gln Lys Glu Ser Thr         275 280 285 Leu His Leu Val Leu Arg Leu Arg Gly Gly     290 295 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for immunoglobulin fragment <400> 4 ggaattccat atgccatcat gcccagcacc tgag 34 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for immunoglobulin fragment <400> 5 tttacccaga gacagggaga ggctcttctg tgtg 34 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for ubiquitin <400> 6 atgcagattt tcgtcaagac tttgaccggt aaaac 35 <210> 7 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for ubiquitin <400> 7 gcggatcctt tggccacctc ttagccttag cacaagatg 39 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 8 ccattcacag ggcacattca ccagtgacta cag 33 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 9 caagtatctg gactccaggc gtgcccaaga tttt 34 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 10 gtgcagtggt tgatgaatac ctgagtcgac cgca 34 <210> 11 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 11 tgtgccctgt gaatgg 16 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 12 ggagtccaga tacttgctgt agtcactggt gaa 33 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 13 tcatcaacca ctgcacaaaa tcttgggcac gcct 34 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for glucagon peptide <400> 14 tgcggtcgac tcaggtat 18 <210> 15 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 15 ctgctccaat ctctctactt gcgttctggg gaagttga 38 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 16 gtcaggaatt acataagctg caaacttacc cgcg 34 <210> 17 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 17 taccaacact ggttctggta caccttgagt cgaccgca 38 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 18 caagtagaga gattggagca g 21 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 19 cttatgtaat tcctgactca acttccccag aacg 34 <210> 20 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 20 cagaaccagt gttggtacgc gggtaagttt gcag 34 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for salmon calcitonin peptide <400> 21 tgcggtcgac tcaaggtgta c 21 <210> 22 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 22 catcaaaccc gaggctcccg gcgaagacgc ctcgccggag g 41 <210> 23 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 23 agctgaaccg ctactacgcc tccctgcgcc actacc 36 <210> 24 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 24 tcaacctggt cacccggcag cggtattgag tcgaccgca 39 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 25 cgccgggagc ctcgggtttg atg 23 <210> 26 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 26 cgtagtagcg gttcagctcc tccggcgagg cgtctt 36 <210> 27 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 27 ccgggtgacc aggttgaggt agtggcgcag ggagg 35 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PYY (3-36) peptide <400> 28 tgcggtcgac tcaataccgc tg 22 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PTH (1-84) peptide <400> 29 ctctgtgagt gaaatacagc ttatgcataa cctgg 35 <210> 30 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PTH (1-84) peptide <400> 30 acgcgtcgac ttatcactgg gatttagctt tagtt 35 <210> 31 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PTH (1-34) peptide <400> 31 ctctgtgagt gaaatacagc ttatgcataa cctgg 35 <210> 32 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for PTH (1-34) peptide <400> 32 acgcgtcgac tcaaaaattg tgcacatcct gcagc 35 <210> 33 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for IGF-1 peptide <400> 33 cggaccggag acgctctgcg gggctgagct ggtgg 35 <210> 34 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for IGF-1 peptide <400> 34 acgcgtcgac ttatcaagct gacttggcag gcttg 35 <210> 35 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for IGF-1 peptide <400> 35 ggaattccat atgggaccgg agacgctctg cggggc 36 <210> 36 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for leptin peptide <400> 36 cgtgcccatc caaaaagtcc aagatgacac c 31 <210> 37 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for leptin peptide <400> 37 acgcgtcgac tcagcaccca gggctgaggt ccagc 35 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 38 ctataccagt ttaattcata gcttaat 27 <210> 39 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 39 gtcagaatca gcaggagaaa aacgaac 27 <210> 40 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 40 ctggaattag ataaatgggc ctcgctg 27 <210> 41 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 41 gttctgagtc gaccgca 17 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 42 tgattctgac tttcttcaat taagctat 28 <210> 43 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 43 ctaattccag cagttcttgt tcgttttt 28 <210> 44 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for fuzeon peptide <400> 44 tgcggtcgac tcagaaccaa ttccacagcg aggcc 35 <210> 45 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for immunoglobulin fragment <400> 45 ggaaatccat atgccatcat gcccagcacc tgagt 35 <210> 46 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for immunoglobulin fragment <400> 46 cccttgtcgt cgtcgtcttt acccagagac aggga 35 <210> 47 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for IGF-1 peptide <400> 47 aaagacgacg acgacaaggg accggagacg ctctg 35 <210> 48 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> oligonucleotide for IGF-1 peptide <400> 48 cgcggatcct caagctgact tggcaggctt gag 33 <210> 49 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for immunoglobulin fragment <400> 49 ggaaatccat atgccatcat gcccagcacc tgagggaaat ccatatgcca tcatgcccag 60 cacctgag 68 <210> 50 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for immunoglobulin fragment <400> 50 tttacccaga gacagggaga ggctcttctg tgtg 34 <210> 51 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for fuzeon peptide <400> 51 tataccagtt taattcatag cttaattgaa gaaag 35 <210> 52 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for fuzeon peptide <400> 52 cgcggatcct cagaaccggt tccacagcga ggcc 34 <210> 53 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for immunoglobulin fragment-fuzeon peptide <400> 53 gaaccaattc cacagcgagg cccatttatc ta 32 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for immunoglobulin fragment <400> 54 cgatcccatt ccatccattt acccagagac agggagaggc 40 <210> 55 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for C34 fuzeon peptide <400> 55 ggatcgcgaa attaacaact ataccagttt aattcatagc 40 <210> 56 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> oligonucleopeptide for C34 fuzeon peptide <400> 56 acgcgtcgac tcagaaccaa ttccacagcg aggcc 35 <210> 57 <211> 5 <212> PRT 213 EK-specific cleavage amino acid sequence <400> 57 Asp Asp Asp Asp Lys   1 5 <210> 58 <211> 5 <212> PRT Xa protease factor-specific cleavage amino acid sequence <400> 58 Ile Glu Asp Gly Arg   1 5 <210> 59 <211> 6 <212> PRT <213> trombin-specific cleavage amino acid sequence <400> 59 Leu Val Pro Arg Gly Ser   1 5 <210> 60 <211> 7 <212> PRT TEV protease-specific cleavage amino acid sequence <400> 60 Glu Asn Leu Tyr Phe Gln Gly   1 5 <210> 61 <211> 8 <212> PRT <213> PreScissionTM protease-specific cleavage amino acid sequence <400> 61 Leu Glu Val Leu Phe Gln Gly Pro   1 5 <210> 62 <211> 76 <212> PRT L-specific cleavage amino acid sequence <400> 62 Met Gln Ile Phe Val Lys Thr Leu Thr Gly Lys Thr Ile Thr Leu Glu   1 5 10 15 Val Glu Ser Ser Asp Thr Ile Asp Asn Val Lys Ser Lys Ile Gln Asp              20 25 30 Lys Glu Gly Ile Pro Pro Asp Gln Gln Arg Leu Ile Phe Ala Gly Lys          35 40 45 Gln Leu Glu Asp Gly Arg Thr Leu Ser Asp Tyr Asn Ile Gln Lys Glu      50 55 60 Ser Thr Leu His Leu Val Leu Arg Leu Arg Gly Gly  65 70 75 <210> 63 <211> 15 <212> DNA <213> Artificial Sequence <220> 223 EK-specific cleavage DNA sequence <400> 63 gacgacgacg acaag 15 <210> 64 <211> 138 <212> DNA <213> Artificial Sequence <220> <223> C34 fuzeon peptide <400> 64 tggatggaat gggatcgcga aattaacaac tataccagtt taattcatag cttaattgaa 60 gaaagtcaga atcagcagga gaaaaacgaa caagaactgc tggaattaga taaatgggcc 120 tcgctgtgga attggttc 138 <210> 65 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino terminal sequences of the isolated glucagon peptides <400> 65 His Ser Gln Gly Thr   1 5 <210> 66 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino terminal sequences of the isolated salmon calcitonin          peptides <400> 66 Cys Ser Asn Leu Ser   1 5 <210> 67 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino terminal sequences of the isolated PTH 1-84 peptides <400> 67 Ser Val Ser Glu Ile   1 5 <210> 68 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino terminal sequences of the isolated PTH 1-34 peptides <400> 68 Ser Val Ser Glu Ile   1 5 <210> 69 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino terminal sequences of the isolated IGF-1 peptides <400> 69 Gly Pro Glu Thr Leu   1 5 <210> 70 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> amino terminal sequences of the isolated fuzeon peptides <400> 70 Tyr Thr Ser Leu Ile   1 5

Claims (14)

a) introducing DNA encoding a fusion protein of an immunoglobulin fragment and a bioactive protein or peptide into the cell, and then culturing the cell; And
b) obtaining a fusion protein from the cell culture liquid obtained in step a), and then separating the bioactive protein or peptide therefrom
A method of mass-producing a bioactive protein or peptide using an immunoglobulin fragment comprising a fusion partner. The method of claim 1,
The fusion protein further comprises an enzyme specific cleavage sequence between the bioactive protein or peptide and the immunoglobulin fragment. The method of claim 2,
Wherein said enzyme specific cleavage sequence is recognized by a protein selected from the group consisting of trypsin, thrombin, TEV protease, PreScission protease, enterokinase and ubiquitin hydrolase. The method of claim 1,
Wherein said immunoglobulin fragment is selected from constant regions of IgG, IgA, IgE, IgM or IgD, combinations or hybrids of human, mouse, pig, rabbit or rat. The method of claim 4, wherein
Wherein said immunoglobulin fragment is selected from constant regions of IgG1, IgG2, IgG3 or IgG4, combinations thereof or hybrids. The method of claim 5, wherein
The immunoglobulin fragment is an IgG4 constant region. The method of claim 1,
The physiologically active protein or peptide is a blood factor, digestive hormone, adrenal cortex hormone, thyroid hormone, intestinal hormone, cytokine, enzyme, growth factor, neuropeptide (neuropeptide), pituitary hormone, hypothalamic hormone, anti-viral peptide and physiological Non-natural peptide derivative having activity. The method of claim 7, wherein
The bioactive protein or peptide is a red blood cell growth factor, granulocyte-macrophage colony stimulating factor, amylin, glucagon, insulin, somatostatin, peptide YY, NPY (neuropeptide Y), angiotensin, brady Kinin, calcitonin, corticotropin, eledoisin, gastrin, leptin, oxytocin, vasopressin, luteinizing hormone, luteinizing hormone, follicle stimulating hormone, parathyroid hormone, sacretin secretin, sermorelin, human growth hormone (hGH), growth hormone releasing peptide, granulocyte colony stimulating factor, interferon (IFN), interleukin, prolactin releasing peptide, Orexin, thyroid-releasing peptide, cholecystokinin, gastrin inhibitory peptide, calmodulin, gastrin free Gastric releasing peptide, motilin, vasoactive intestinal peptide, atrial natriuretic peptide (ANP), barin natriuretic peptide (BNP), C-type C-type natriuretic peptide (CNP), neurokinin A, neuromedin, neuromedin, renin, endothelin, sarafotoxin peptide, carsomorphine Peptides (carsomorphin peptide), demorphin, denorphin, dynorphin, endorphin, endorphin, enkepalin, T cell factor, tumor necrosis factor, tumor necrosis factor receptor, urokinase receptor, tumor suppressor, cola Genease inhibitors, thymopoietin, thymulin, thymopentin, thymosin, thymic humoral factor, adrenomodullin, allatostatin (allatostatin), oh Amyloid beta-protein fragments, antimicrobial peptides, antioxidant peptides, bombesin, osteocalcin, CART peptides, E-selectin, ICAM-1, VCAM-1, Group consisting of leucokine, kringle-5, laminin, inhibin, gallanin, fibronectin, pancreastatin and fuzeon Selected from A fusion protein of an immunoglobulin fragment and a bioactive protein or peptide, represented by the amino acid sequence of SEQ ID NO: 3. DNA encoding the fusion protein of claim 9. A vector comprising the DNA of claim 10. A transformant transformed with the vector of claim 11. The method of claim 12,
The transformant is selected from the group consisting of E. coli HMF001 (Accession No .: KCCM-10980P), HMF002, HMF003 (Accession No .: KCCM-10981P), HMF004, HMF005, HMF006, HMF007, HMF008, HMF009, HMF0010, HMF0011 and HMF0012 Characterized by a transformant. Using immunoglobulin fragments as fusion partners for mass production of bioactive proteins or peptides.

Images