KR20100072898A - Primer set for detection of honey bee viral diseases iapv using the lamp method, detection method and detection kit using the same - Google Patents

Abstract

PURPOSE: A primer set for diagnosing honeybee IAPV(israel acute paralysis virus) infection using a LAMP(Loop-mediated isothermal amplification) method is provided to quickly and accurately diagnose honeybee infection. CONSTITUTION: A primer set for diagnosing honeybee virus IAPV infection using a LAMP method comprises an inner-forward primer of sequence number 1, an inner-reverse primer of sequence number 2, an outer-forward primer of sequence number 3, and an outer-reverse primer of sequence number 4. The honeybee IAPV infection is diagnosed by amplifying LAMP using the primer set at 55-60°C. The method further comprises a step of adding fluorescence for confirming an infection. A kit for diagnosing IAPV infection comprises the primer set.

Description

Primer set for detection of honey bee viral diseases IAPV using the LAMP method, detection method and detection kit using the same}

The present invention relates to a primer set for diagnosing honey bee virus IAPV (Israel acute paralysis virus) infection using a loop-mediated isothermal amplification (LAMP) method, a method for diagnosing a honey bee virus IAPV infection and a diagnostic kit using the same. The present invention relates to a primer set for bee virus IAPV infection diagnosis using LAMP method, a method for diagnosing bee virus IAPV infection using the same, and a kit for diagnosing IAPV infection.

There are more than 18 known bee diseases caused by viruses (Allen, M., and BV Ball. 1996. The incidence and world distribution of the honey bee viruses. Bee World. 77: 141-162). No appropriate treatment has been suggested, and strong group training and maintenance are known as the only preventive measures that can lead to natural treatment. In particular, these bee viruses continue to weaken the Bong-gun, causing mixed infection with other pathogens, and these mixed infections cause serious damage to the Bong-gun, including the collapse of the Bong-gun.

In addition, since the recently reported Colony Collapse Disorder (CCD) has been reported, it was once again highlighted that honeybees play an important role as pollinators, and much research has been conducted to determine the cause of CCD. To date, no clear cause is known (Cooper, EL 2007. Colony collapse disorder may affect complementary and alternative medicine.eCAM. 4: 275-277). Cox-Foster et al. Suggested the possibility of IAPV (israel acute paralysis virus), a bee virus, as one of the major causes of CCD, through metagenome analysis (IAPV). Cox-Foster, DL, S. Conlan, EC Holmes, G. Palacios, JD Evans, NA Moran, PL Quan, T. Briese, M. Hornig, DM Geiser, V. Martinson, DV Engelsdorp, AL Kalkstein, A. Drysdale , J. Hui, J. Zhai, L. Cui, SK Hutchison, JF Simons, M. Egholm, JS Pettis, and WI Lipkin. 2007. A metagenomic survey of microbes in honey bee colony collapse disorder.Science. 318: 283- 287).

Similar phenomena have been reported in Korea, and the existence of IAPV, which is reported as the cause of CCD, has been confirmed, and new studies on IAPV diagnosis have been reported (Kang Min-hee, Kim Il-wook, Yoo Mi-sun, Kwon Soon-hwan, Yoon Byeong-su. 2008. Development of PCR Method for Diagnosing Israel Acute Paralysis Virus (IAPV), Journal of The Korean Beekeeping Society, 23: 29-36.

No treatment has been reported to date for viral diseases. In particular, since IAPV is also infected by reusing IAPV-consumed consumption, the damage can be spread by reusing beekeepers at beekeepers. In addition, IAPV-infected bongs show a decay of bongs, with a significant number of worker bees disappearing, so if the beekeeper could diagnose the IAPV infection itself, it would be of great help in controlling disease, improving productivity and using related equipment. Studies have been conducted to detect bee disease in Korea, and research has been attempted to detect disease at bee farms.

To date, bee pathogenic virus diagnosis has been usefully used as a diagnostic tool such as general PCR and real-time PCR (Kang Min-hee, Kim Il-wook, Yoo Mi-sun, Kwon Soon-hwan, Yoon Byeong-su. 2008. Israel Acute Paralysis Virus in Honeybees) Development of PCR Methods for Diagnosis (IAPV) Journal of the Korean Beekeeping Society, 23: 29-36), has been the most useful tool for exploring the presence and effects of pathogenic viruses. However, PCR-based screening methods have the limitation of being a laboratory test using a laboratory apparatus such as a thermocycler, which places many limitations on the immediate testing of disease samples at the beekeeper's site.

Recently, a more advanced loop-mediated isothermal amplification (LAMP) method has been developed than PCR-based diagnostic methods (Notomi, T. 2007. Loop-mediated isothermal amplification. Nippon Rinsho. 65: 957-961, It is mainly called isothermal PCR (LAMP method), and two pairs of primers (one pair inner primer and one pair outer primer) are used. In later stages, the amplification is performed by recognizing independent 4 digits, which has high specificity, and it has been noted that the experiment can be performed with a simple incubator without the dependence of a precision equipment thermocycler (Savon et al. , 2004; Seki et. al. , 2005) .These characteristics, together with the precision that the LAMP method amplifies specific genes such as PCR, are immediately relevant to the testing of diseases at the beekeeping site without precise equipment. With the potential for use, it was expected to be a new test that could be used for instant diagnosis in beekeeping where field testing was important.

However, even though it was possible to detect specific genes related to IAPV using the LAMP method, laboratory equipment and techniques such as electrophoresis are needed to confirm the results. Therefore, for the practical application of the detection method using LAMP, an easy method that can be performed in the field not only at the detection stage but also at the confirmation stage of the results is required.

Accordingly, the present inventors completed the present invention after searching for a method for quickly and accurately diagnosing whether honeybees were infected with IAPV in accordance with the above-described conventional requirements.

Accordingly, an object of the present invention is to provide a primer set for diagnosing honey bee virus IAPV infection using LAMP method which can quickly and accurately confirm the result of IAPV infection.

It is another object of the present invention to provide a method for diagnosing bee virus IAPV infection, which enables the naked eye to quickly and sensitively identify the result of IAPV infection as a bee virus using the primer set.

It is another object of the present invention to provide a diagnostic kit that can easily confirm the diagnosis of honey bee virus IAPV infection.

In order to achieve the above object, the present invention is characterized by consisting of an inner-forward primer of SEQ ID NO: 1, an inner-reverse primer of SEQ ID NO: 2, an outer-forward primer of SEQ ID NO: 3 and an outer-reverse primer of SEQ ID NO: 4 Provided is a primer set for diagnosing bee virus IAPV infection using the LAMP method.

In another aspect, the present invention provides a bee virus IAPV infection diagnostic method comprising the step of amplifying LAMP using the primer set.

The method for diagnosing bee virus IAPV infection may further include adding a luminescent material for visual confirmation of infection to the product generated by amplifying the LAMP. The light emitting material is preferably SybrGreen.

The present invention also provides a kit for diagnosing bee virus IAPV infection, comprising the primer set.

The primer set for diagnosing IAPV infection according to the present invention is a bee without complex processes such as electrophoresis by putting a sample material in a diagnostic kit including the same and incubating it with LAMP method and then injecting a luminescent substance, SybrGreen, and observing green fluorescence. There is an advantage that it is possible to visually check whether or not IAPV is infected with high sensitivity.

The present invention provides a primer set for easily identifying the honeybee virus IAPV infection diagnosis by the LAMP method.

Four primers are required for the LAMP method, which requires an inner-forward primer, an inner-reverse primer, an outer-forward primer, and an outer-reverse primer. Each primer according to the present invention is shown in Table 1 below, in Table 1 inner-forward primer (IAPV-InnerF) is SEQ ID NO: 1, inner-reverse primer (IAPV-InnerR) is SEQ ID NO: 2, outer The forward primer (IAPV-OutF) is shown in SEQ ID NO: 3 and the outer-reverse primer (IAPV-OutR) in SEQ ID NO: 4.

Oligo name Sequence (5 '→ 3') nt * IAPV-InnerF CCATGAATTGAGCATTTTCATACTCG-TTTT-CAGAAAATGGCAAGTGGTGTTG 52 IAPV-InnerR GGAACCTTCATTGGCATTCTTACC-TTTT-CTTCTGTCCATCAGAGCATAGCC 51 IAPV-OutF AAAGAATTTCAGAGATGAAATTTTAT 26 IAPV-OutR ACGCTTAATTGCCTGTTTCTT 21

* nt : nucleotides

According to the present invention provides a method for diagnosing bee virus IAPV infection comprising the step of amplifying LAMP using the primer set according to the present invention described above. At this time, the step of adding the light emitting material for visual confirmation of the infection to the product produced by the LAMP amplification can be further carried out.

The LAMP method applied above can be easily carried out by applying a known method. For example, in the present invention, a reaction solution consisting of 164IAPV used as an amplification template, the primer set described above, and a conventional buffer solution is prepared, and a sample is added thereto to proceed with DNA synthesis, followed by addition of a luminescent material.

DNA synthesis, i.e., amplification is performed under isothermal conditions, with a preferred temperature range of 55-60 ° C. If it is out of the temperature range, there is a problem that the amplification proceeds slowly or does not occur.

The light emitting material may be generally used in the art, but preferably SybrGreen is used.

The SybrGreen was added to enable the reading of the result without the need for additional experiments by using the property of binding to the DNA double strand. In particular, the SybrGreen is a substance that is inserted into the double DNA strand and expresses green fluorescence upon ultraviolet irradiation. Therefore, the sample infected with IAPV amplified by the LAMP method using the primer set according to the present invention, and after the addition of SybrGreen to the amplified product is irradiated with ultraviolet rays to give a green fluorescence. That is, the present invention indicates that the green fluorescence in the SybrGreen staining after the LAMP amplification test without additional experiments such as electrophoresis means that the disease is infected, and if the green fluorescence does not indicate the non-infection, the honeybee is infected with IAPV. It can be confirmed with the naked eye quickly and with high sensitivity.

The present invention provides a diagnostic kit comprising the primer set. The diagnostic kit may be manufactured to include a reaction solution except for a sample, if necessary, which can be easily performed by applying a known technique.

Hereinafter, the present invention will be described in more detail with reference to the following examples, which are illustrative only for describing the present invention, and thus, the nature and contents of the technical spirit of the present invention are not changed or reduced.

Example 1 LAMP Mold

The 164IAPV clone (Kang et al., 2008), used as a template for LAMP, is a clone of 2917-3483nt (nucleotide) portion on the IAPV genome (EF219380). The plasmid DNA was absorbed at OD 260 nm using a spectrophotometer to calculate its concentration, and stored at -20 ° C. Restriction enzyme was used as Apa I, reacted for 1 hour 30 minutes at 37 ° C., cleaved, and treated with 65 ° C. for 20 minutes to inactivate the enzyme, which was then used as a template for LAMP. The 164IAPV thus obtained was 3.567kb, which is the size of 3.0kb of the vector and 567bp of the insert.

Example 2 Pure Separation and cDNA Synthesis of RNA for Standard Assay

Total RNA was extracted to detect IAPV by LAMP method from honey bee samples infected with virus. RNA extraction was performed using Total RNA Extraction Kit (Intron, Korea), and the experimental method was performed according to the manufacturer's instructions.

To do this, first, two or three IAPV-infected bee samples were placed in MagNa Lyser Green Beads tube (Roche, Germany), and 1 ml of lysis buffer (Intron, Korea) and 200 μl of chloroform stored at 4 ° C were added. Grinding was carried out using MagNA Lyser (Roche, Germany) for 6,000 rpm for 40 seconds and centrifuged (13,000 rpm, 4 ° C., 10 min). 400 μl of the supernatant was collected and allowed to stand for 1 minute at room temperature by adding 400 μl of binding buffer, and then the entire mixture was transferred to a binding column, and the passed solution was removed after centrifugation. 700 μl of washing buffer A was added to the column, followed by centrifugation to remove the pass-through. 700 μl of washing buffer B was added to the column, followed by centrifugation. Was removed. Centrifuge the column for 1-2 minutes to remove residual ethanol remaining in the column, transfer the column to a new tube, add 40 μl of RNase free water, and let stand for 1 minute at room temperature. The total RNA was extracted by centrifugation. Total RNA extracted was measured at the concentration of RNA at OD 260nm.

The extracted total RNA was used to synthesize cDNA through reverse transcriptase reaction. Reverse transcriptase reaction was allowed to stand for 2-3 μg total RNA and 100 pmol oligo dT at 65 ° C for 10 minutes, 10 × reaction buffer, 100 mM DTT, dNTP (2.5 mM each), 200 unit M-MLV reverse transcriptase (Bioneer, Korea), 10 unit RNase inhibitor (Takara, Japan) was used for 90 minutes at 40 ℃.

The honeybee samples used above were samples of adult and larvae exhibiting symptoms of disease in domestic bee farms and bees being bred in Gyeonggi University apiary. The samples were visually examined, dissected and microscopically as soon as they arrived at the laboratory. They were used for pure separation of RNA as soon as possible.

Example 3 Preparation of Specific Primer Set for LAMP

Inner-F, a forward primer in the primer set for IAPV specific LAMP shown in Table 1, is a sequence that forms a loop with a complementary inner-sense, TTTT linker, and loop of the IAPV anti-sense sequence. Inner-R, a reverse primer, was also designed as a complementary inner-antisense sequence of the IAPV sense sequence, a TTTT linker, and a loop-antisense portion forming a loop. . The Outer-F primer and Outer-R were designed to be located on the outer side of the inner primer, respectively. Oligonucleotide production was commissioned by Bionics, Korea, and PAGE purified for inner primers.

Example 4 IAPV Diagnosis Using the Prepared Primer Set

164IAPV 1 × 104copies / μl used as amplification template, primer set shown in Table 1 (20pmole for Inner-F and Inner-R, 10pmole for Outer-F and Outer-R, respectively), 1 × ThermoPol Reaction buffer (20mM Tris -HCl, pH8.8), 10mM KCl, 10mM (NH4) 2SO4, 2mM MgSO4, 0.1% Triton X-100, NEB, 0.4 μ M dNTP, 1M betaine (Sigma), 8U Bst DNA polymerase large fragment (New England Biolabs ) A total of 25 μl of the reaction solution. In the case of the Bst DNA polymerase large fragment, since the enzyme is inactivated when it is 80 ° C. or higher, only DNAs are dissociated at 95 ° C. for 5 minutes, immediately transferred to ice, and then added. Thereafter, the cDNA sample isolated in Example 2 was added and DNA synthesis was performed at 60 ° C. for 1 hour, and the reaction was terminated after inactivation at 80 ° C. for 10 minutes.

After the LAMP reaction, SybrGreen was added to the amplification product. In this case, 1 μl of 10 × SybrGreen Gel Stain I 10,000 × concentration (Molecular Probes, Leiden, The Netherlands) was used for SybrGreen.

The SybrGreen addition result is shown in FIG. 1 (see 3 in FIG. 1). At this time, Figure 1 shows the results of the control carried out in the same manner as above without the cDNA isolated in Example 2 (see number 1 in Figure 1). In addition, the cDNA isolated in Example 2 was PCR amplified, and the results of the comparative example in which SybrGreen was added thereto were also shown (see No. 2 in FIG. 1). 2 shows the results of electrophoresis of the three samples.

As can be seen in Figure 1 by adding SybrGreen to the amplified IAPV specific LAMP product according to the present invention it was confirmed that the mixture shows a strong green fluorescence. On the other hand, it was confirmed that the mixture turned orange in the control group without anything, and the green fluorescence color was shown in the PCR result, but it was hardly distinguished from the control group. Therefore, the present invention has an effect of diagnosing IAPV infection with high sensitivity even with a small amount of samples. This effect can also be confirmed through FIG.

Example 5 Measurement of Reaction Optimal Isothermal Temperature of IAPV Specific LAMP

In order to measure the optimum isothermal temperature of the specific LAMP reaction of 164IAPV, the cDNA sample isolated in Example 2 was added and the synthesis of DNA for 1 hour was performed at 55 ° C., 60 ° C. and 65 ° C., respectively. It carried out by the same method as 4. After each LAMP reaction, the amplified products were confirmed by electrophoresis, and the results are shown in FIG. 3.

As shown in FIG. 3, the amplification did not occur at an isothermal temperature of 65 ° C. (see No. 3 in FIG. 3), and thus the optimum isothermal DNA synthesis temperature is 55-60 ° C. (see No. 1 and No. 2 in FIG. 3). You can check it.

Figure 1 shows the results of the SybrGreen test of the product prepared in Example 4, No. 1 is negative control (control), No. 2 PCR product (Comparative Example) and No. 3 is the LAMP product according to the present invention.

Figure 2 shows the results of the electrophoresis of the product prepared in Example 4, M is the molecular marker (molecular marker), 1 negative control, 2 PCR products, 3 shows the LAMP product.

Figure 3 shows the results of the electrophoresis of the product prepared in Example 5, the first is 55 ℃, the second is 60 ℃, the third is a product synthesized DNA at 65 ℃.

<110> Kyonggi University Industry & Academia Cooperation Foundation <120> Primer set for detection of honey bee viral disesase IAPV using          the LAMP method, detection method and detection kit using the          same <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for detecting honey bee viral disease IAPV          in LAMP method. <400> 1 ccatgaattg agcattttca tactcgtttt cagaaaatgg caagtggtgt tg 52 <210> 2 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Inner reverse primer for detecting honey bee viral disease IAPV          in LAMP method <400> 2 ggaaccttca ttggcattct taccttttct tctgtccatc agagcatagc c 51 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for detecting honey bee viral disease IAPV          in LAMP method <400> 3 aaagaatttc agagatgaaa ttttat 26 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Outer reverse primer for detecting honey bee viral disease IAPV          in LAMP method <400> 4 acgcttaatt gcctgtttct t 21  

Claims (6)

For diagnosing bee virus IAPV infection using the LAMP method, characterized by consisting of an inner-forward primer of SEQ ID NO: 1, an inner-reverse primer of SEQ ID NO: 2, an outer-forward primer of SEQ ID NO: 3, and an outer-reverse primer of SEQ ID NO: 4 Primer set. A method for diagnosing bee virus IAPV infection, comprising amplifying LAMP using the primer set of claim 1. The method of claim 2, further comprising adding a luminescent material for visual confirmation of infection to the product generated by amplifying the LAMP. The method for diagnosing bee virus IAPV infection according to claim 3, wherein the LAMP amplification is performed at 55 to 60 ° C. The method of claim 3, wherein the luminescent material is SybrGreen. Bee virus IAPV infection diagnostic kit comprising the primer set of claim 1.

Images