KR20100040488A - A composition comprising 5'-nitro-indirubinoxime, an indirubine derivative, for treating and preventing inflammatory diseases - Google Patents

Abstract

PURPOSE: A composition containing 5'-nitro-indirubinoxime is provided to prevent and treat inflammatory such as artery scleroma. CONSTITUTION: A pharmaceutical composition for preventing and treating inflammatory diseases contains 0.1-50 weight% of 5'-nitro-indirubinoxime as an active ingredient. Inflammatory diseases are artery scleroma, arthritis, hypertension, diabetes or cancer. A health food for preventing and treating inflammatory diseases contains 5'-nitro-indirubinoxime as an active ingredient. The health food is used in the form of powder, granule, tablet, capsule, or beverage.

Description

A composition comprising 5'-nitro-indirubinoxime, an indirubine derivative, for treating and preventing inflammatory diseases, containing 5'-nitro-indirubinoxime, a derivative of indirubin, as an active ingredient

The present invention relates to a composition or health functional food for the prevention and treatment of inflammatory diseases containing 5′-nitro-indirubinoxime compound which is a derivative of indirubin as an active ingredient.

Ross R. N Engl J Med 1999; 340: 115-26.

Fan J, Watanabe T. J Atheroscler Thromb 2003; 10: 63-71.

[Reference 3] Springer TA. Cell 1994; 76: 301-14.

4 Modur V, Zimmerman GA, Prescott SM, et al. J Biol Chem 1996; 271: 13094-102.

[5] Satriano JA, Shuldiner M, Hora K, et al. J Clin Invest 1993; 92: 1564-71.

Sica A, Wang JM, Colotta F, et al. J Immunol 1990; 144: 3034-8.

7 Rollins BJ, Yoshimura T, Leonard EJ, et al. Am J Pathol 1990; 136: 1229-33.

8 Takeya M, Yoshimura T, Leonard EJ, et al. Hum Pathol 1993; 24: 534-9.

9 Nelken NA, Coughlin SR, Gordon D, et al. J Clin Invest 1991; 88: 1121-7.

References 10 Huber AR, Kunkel SL, Todd RF 3rd, et al. Science 1991; 254: 99-102.

[11] Gerszten RE, Garcia-Zepeda EA, Lim YC, et al. Nature 1999; 398: 718-23.

12. Boisvert WA, Santiago R, Curtiss LK, et al. J Clin Invest 1998; 101: 353-63.

13 Renauld JC, J. Clin. Pathol . 54 , pp. 577589, 2001.

14 Blake GJ, Ridker PM, Eur. Heart J. 23 , pp. 345347, 2002.

15. Kim SA, Kim YC, Kim SW, et al. Clin Cancer Res 2007; 13: 253-9.

Inflammation plays an important role in the development of atherosclerosis, and the representative inflammatory cytokine, TNF-α (Tumor necrosis factor-α), induces an inflammatory response by increasing the expression of adhesion molecules or increasing the secretion of inflammatory mediators. Atherosclerosis and its complications are one of the most common causes of human death. Although the pathological factors of atherosclerosis are not fully understood, inflammation is known to be a major factor in the development of atherosclerosis (Ross R. N Engl J Med 1999; 340: 115-26; Fan J, Watanabe T. J Atheroscler Thromb 2003; 10: 63-71).

TNF-α is a major inflammatory cytokine that mediates systemic inflammation and immune responses. In the vascular endothelium, TNF-α induces an inflammatory response by increasing adhesion molecule expression and secretion of inflammatory mediators (Springer TA. Cell 1994; 76: 301-14; Modur V, Zimmerman GA, Prescott SM, et al. J Biol Chem 1996; 271: 13094-102). MCP-1 and IL-8 are expressed in the endothelium by various stimuli such as TNF-α and IL-1β (Satriano JA, Shuldiner M, Hora K, et al. J Clin Invest 1993; 92: 1564-71; Sica A, Wang JM, Colotta F, et al. J Immunol 1990; 144: 3034-8; Rollins BJ, Yoshimura T, Leonard EJ, et al. Am J Pathol 1990; 136: 1229-33). MCP-1 is a chemotactic material for monocyte infiltration. Various studies have demonstrated that MCP-1 is a major factor in initiating the inflammatory response to induce atherosclerosis (Takeya M, Yoshimura T, Leonard EJ, et al. Hum Pathol 1993; 24: 534-9; Nelken NA, Coughlin SR , Gordon D, et al. J Clin Invest 1991; 88: 1121-7). In addition, IL-8 has been shown to be a chemotactic factor that promotes endothelial cell translocation of neutrophils leukocytes / monocytes (Huber AR, Kunkel SL, Todd RF 3rd, et al. Science 1991; 254: 99-102; Gerszten RE , Garcia-Zepeda EA, Lim YC, et al. Nature 1999; 398: 718-2310). IL-8 receptor deficient mice have also been reported to have poorly accumulated monocytes in vascular lesions and thus have a very low incidence of atherosclerosis (Boisvert WA, Santiago R, Curtiss LK, et al. J Clin Invest 1998; 101: 353- 63).

Inflammatory responses at the site of infection are initiated by the response of macrophages to pathogens. Reactive reactive oxygen species and reactive nitrogen species produced by macrophages activated by pathogens, inflammatory mediators such as prostaglandins, leukotrienes, and inflammatory cytokines such as TNF-α, IL-6 and IL-8, etc. It is known to be involved in this inflammatory response (Renauld JC, J. Clin. Pathol . 54 , pp.577589, 2001; Blake GJ, Ridker PM, Eur. Heart J. 23 , pp.345347, 2002). The activation of NF-κB, a transcription factor of genes involved in the production of these inflammatory mediators, is very important for the inflammation-related action of macrophages. Inflammatory genes such as inducible nitric oxide synthase (iNOS2), cyclooxygenase (COX-2), TNF-α, IL-6, and IL-8 are found in macrophages. It has been reported to be transcribed by κB.

Indirubin is an active ingredient of Polygonum tinctorium Lour plants, and recently the inventors have synthesized a new indirubin derivative compound, 5'-nitro-indirubinoxime (5'-NIO), in vitro than other indirubin derivatives. In vitro and in vivo experiments showed more potential anticancer activity (Kim SA, Kim YC, Kim SW, et al. Clin Cancer Res 2007; 13: 253-9) . To date, most of the studies have focused on the study of the anticancer activity of indirubin, and the description of the anti-inflammatory activity of the 5'-NIO compound, which is a derivative of indirubin synthesized by the present inventors, has been reported or disclosed. none.

Therefore, the present inventors have investigated the effect of the expression of MCP-1 and IL-8 on TNF-α-induced HUVEC cells (human umbilical vein endothelial cells) of 5'-NIO compound, a derivative of indirubin, and U937 cell adhesion assay. By confirming the effect on the expression of ICAM-1 (intercellular adhesion molecule-1), the present invention was completed.

In order to achieve the above object, the present invention provides a 5'-nitro-indirubinoxime compound which is a derivative of indirubin represented by the following structural formula (a) It provides a pharmaceutical composition for the prevention and treatment.

(a)

(a)

The present invention also provides a health functional food for the prevention and improvement of inflammatory diseases containing 5'-nitro- indirubinoxime compound as an active ingredient.

Inflammatory diseases as defined herein include atherosclerosis, arthritis, hypertension, diabetes or cancer, preferably atherosclerosis.

      Hereinafter, the present invention will be described in detail.

      The 5'-nitro-indirubinoxime compound, which is a derivative of indirubin of the present invention, can be obtained by synthesis in the following manner.

      To a solution of a mixture of indoxyl acetate and isatin analogs dissolved in water or an alcohol such as methanol or ethanol, preferably in methanol, sodium carbonate in a nitrogen atmosphere at about 10 to 50 캜, preferably at room temperature A first step of mixing for about 1 to 6 hours, preferably 2 to 3 hours; The precipitate produced in the above step is filtered and treated with indirubin in a second step of washing with water or about 1 to 5 times with a washing solvent such as methanol, ethanol, preferably methanol, and the like with cold water and drying under reduced pressure. Can be obtained.

The indirubin obtained by the above method was dissolved in a pyridine solvent and dissolved by addition of hydroxylamine hydrochloride, followed by heating at about 50 to 100 ° C., preferably at 80 to 90 ° C. for about 1 to 5 hours, preferably 2 hours. Reacting the first step; After cooling the reaction to room temperature, the resulting product was neutralized with a strong acid solution, preferably about 1 to 3N hydrochloric acid, and then the solvent was evaporated under reduced pressure, and the resulting precipitate was filtered and washed several times with water. '-Nitro-indirubinoxime can be obtained.

Accordingly, the present invention provides a pharmaceutical composition containing the compound obtained by the above production method as an active ingredient.

Inflammatory disease was confirmed that the compound of the present invention exhibits potent anti-inflammatory activity through the activity of inhibiting the expression of TNF-α-induced cytotoxicity, MCP-1, IL-8, ICAM-1 and NF-kB Useful for the treatment and prevention of

Pharmaceutical composition for the prevention and treatment of inflammatory diseases of the present invention, the extract comprises 0.1 to 50% by weight based on the total weight of the composition.

Pharmaceutical compositions comprising the compounds according to the invention can be used in the form of oral dosage forms, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injectable solutions, respectively, according to conventional methods. Can be.

      Carriers, excipients and diluents which may be included in the compositions comprising the compounds according to the invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium Phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants are usually used.

      Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations include at least one excipient such as starch, calcium carbonate, sucrose in the compound. Or lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

      Oral liquid preparations include suspensions, solvents, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate and the like can be used.

      As the base of the suppository, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

      Preferred dosages of the compounds of the present invention depend on the condition and weight of the patient, the extent of the disease, the form of the drug, the route of administration and the duration, but may be appropriately selected by those skilled in the art.

      However, for the desired effect, the compounds of the present invention are preferably administered at 0.0001 to 100 mg / kg, preferably at 0.001 to 10 mg / kg. Administration may be administered once a day or may be divided several times. The dosage does not limit the scope of the invention in any aspect.

       The compounds of the present invention can be administered to mammals such as mice, mice, livestock, humans, etc. by various routes. All modes of administration can be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

       The present invention provides a dietary supplement for the prevention and improvement of an inflammatory disease containing a 5'-nitro-indirubinoxime compound.

       Foods to which the compounds of the present invention can be added include, for example, various foods, beverages, gums, teas, vitamin complexes, and health functional foods.

It may also be added to food or beverages for the purpose of preventing inflammatory diseases. At this time, the amount of the compound in the food or beverage is generally added to the dietary supplement composition of the present invention to 0.01 to 50% by weight, preferably 0.01 to 15% by weight of the total food weight, the health beverage composition is 100 ml It can be added in a ratio of 0.02 to 5 g, preferably 0.3 to 1 g based on the amount.

Health functional food of the present invention includes the form of tablets, capsules, pills, liquids and the like.

The health beverage composition of the present invention is not particularly limited in the other components except for containing the compounds as essential ingredients in the indicated ratios, and may contain various flavors or natural carbohydrates as additional ingredients, such as ordinary drinks. Examples of the above-mentioned natural carbohydrates are monosaccharides, for example, disaccharides such as glucose and fructose, for example polysaccharides such as maltose and sucrose, for example, conventional sugars such as dextrin, cyclodextrin and the like. And sugar alcohols such as xylitol, sorbitol, and erythritol.

As flavoring agents other than those mentioned above, natural flavoring agents (tauumatin, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used. The proportion of such natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition to the above, the compounds of the present invention include various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, coloring and neutralizing agents (such as cheese and chocolate), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.

In addition, the compounds of the present invention may contain flesh for the production of natural fruit juices and fruit juice beverages and vegetable beverages. These components can be used independently or in combination. The proportion of such additives is not so critical, but is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

5'-nitro-indirubinoxim compound of the present invention, TNF-α-induced cytotoxicity inhibitory effect in HUVEC cells, MCP-1, IL-8, ICAM-1 and NF-κB expression inhibitory effect, U937 It shows a cell adhesion inhibitory effect, it can be usefully used as a pharmaceutical composition and health functional food for the prevention and treatment of inflammatory diseases.

Hereinafter, the present invention will be described in detail by the following reference examples, examples and experimental examples.

However, the following Reference Examples, Examples, and Experimental Examples are merely illustrative of the present invention, and the content of the present invention is not limited thereto.

Example 1. 5'-nitro-indirubinoxim Preparation of compounds

176 mg (1 mmol) of indoxyl acetate (I3500, Sigma-Aldrich, St. Louis, MO) and 1 mmol of 256 mg (2.5 mmol) of Na ₂ CO ₃ dissolved in 5 ml of methanol in a nitrogen atmosphere. After the addition of isatitin (114618, Sigma-Aldrich, St. Louis, MO) analog solution, the reaction mixture is mixed for 2-3 hours at room temperature. The dark violet precipitate produced above was filtered, washed twice with methanol and several times with cold water, and the obtained precipitate was dried under reduced pressure to obtain indirubin. In order to obtain 5'-nitro-indirubicinsim, a derivative of indirubin, the indirubin obtained above was dissolved in 10 ml of pyridine and dissolved in 6 mmol of hydroxylamine hydrochloride. Then heat was applied at 80 ~ 90 ° C for 2 hours. After the reaction temperature was lowered to room temperature, the resulting product was neutralized with 1N HCl, the reaction solvent was evaporated under reduced pressure, and the precipitate was filtered and washed several times with water to obtain 5'-nitro-indirubinoxim (hereinafter, '5'-NIO'was obtained, and was used as a sample of the following experimental example.

5′-NIO: —NO ₂ (5′-Nitro-1 H , 1 ′ H- [2,3 ′] biindolylidene-3,2′-dione 3-oxime);

¹ H-NMR (300 MHz, DMSO-d ₆ ) δ (ppm) 13.92 (1H, s, NOH) 11.90 (1H, s, NH), 11.44 (1H, s, N'-H), 9.47 (1H, s), 8.27 (1H, d, J = 7.5 Hz), 8.10 (1H, dd, J = 2.3, 8.4 Hz), 7.48 (2H, m), 7.09 (2H, m);

MS (MALDI -TOF) m / z: 321.0.

Reference Example 1. Experimental Materials

HUVEC cells and EGM-2 medium are LONZA (Walkersville, MD), U937 cells are KCLB (Seoul, Korea), RPMI1640 medium and calcein AM are Invitrogen (Carlsbad, CA), and recombinant human TNF-α is R & D System (Minieporis, MN), Thiazoryl Blue Tetrazolium Bromide was purchased from Sigma-Aldrich (St. Louis, MO).

Reference Example 2. Cell Culture

HUVEC cells were treated with 5% CO at 37 ° C. in EGM-2 medium supplemented with reagents provided in the Single Quots kit (LONZA, Walkersville, MD).₂Incubated at. U937 cells were cultured in RPMI1640 medium supplemented with 10% fecal calf serum (FCS), 100 U / ml penicillin and 100 μg / ml streptomycin.

Experimental Example 1. Inhibition of cell proliferation by MTT assay

In order to confirm the inhibitory effect on HUVEC cell proliferation of indirubin and 5'-nitro-indirubinoxime (5'-NIO) obtained in Example 1 (Kim SA, Kim YC, Kim SW, et al. Clin. Cancer Res. 2007; 13: 253-9).

HUVEC cells were incubated overnight at a concentration of 1 × 10 ⁵ cells / ml in 12 well plates, and the indirubin and 5′-NIO obtained in Example 1 were prepared at concentrations of 0.1, 0.25, 0.5, 1 and 2 μM, respectively. Treatment was performed for 24 hours. Each well was washed twice with PBS and 0.25 ml of cell culture and 25 μl of MTT solution (5 mg / ml) were added. After incubation for 3 hours, the medium was removed and 125 μl of acid-isopropanol (0.04 M HCL in isopropanol) was added to measure absorbance at 570 nm.

As a result, as shown in Figure 1, both indirubin and 5'-NIO was confirmed to inhibit cell proliferation. In particular, it could be seen that 2 μM indirubin and 2 μM 5′-NIO exhibited inhibition rates of about 48.4 and 50.9%, respectively.

Experimental Example 2 Cytotoxic Inhibitory Effect by LDH Assay

LDH (lactate) according to the method of CytoTox 96 non-radioactive assay kit to measure the effect of indirubin and 5′-NIO on HUVEC cytotoxicity obtained in Example 1 above dehydrogenase) activity was measured.

HUVEC cells were incubated overnight at a concentration of 1 × 10 ⁵ cells / ml in 12 well plates and treated with 10 ng / ml TNF-α and / or 2 μM of 5′-NIO. After 24 hours of treatment, 50 μl of cell culture was taken, the same amount of substrate solution was added, and the reaction was carried out at room temperature for 30 minutes, and then cytotoxicity was examined by measuring absorbance at 490 nm.

As a result, as shown in FIG. 2, HUVEC cells treated with 10 ng / ml TNF-α showed 3.3-fold cytotoxicity compared to the control group. However, when treated with indirubin or 5'-NIO alone it was confirmed that there is no cytotoxicity. In addition, it was confirmed that indirubin and 5′-NIO inhibited cytotoxicity by TNF-α treatment. In particular, the effect of 5′-NIO was confirmed to be effective enough to suppress the level similar to that of the control group.

Experimental Example 3. RT-PCR

In order to confirm the inhibitory effect on the expression of MCP-1 and IL-8 mRNA, which are cytokines induced by TNF-α in HUVEC cells of indirubin and 5'-NIO obtained in Example 1, Was performed.

3.1 RNA isolation

HUVEC cells were treated with TNF-α 10 ng / ml and / or 2 μM of indirubin and 5'-NIO for 24 hours, and then total RNA was isolated using Trizol reagent (TRIzol, Invitrogen). The concentration of RNA could be confirmed by electrophoresis on denaturing agarose gel.

3.2 RT-PCR

Semi-quantitative RT-PCR (Semi-quantitative RT-PCR) was performed using the SuperScript ™ One-Step RT-PCR System. The specific primers shown in Table 1 were used and the cycle conditions of RT-PCR were as follows: 1 cycle 30 minutes 50 ° C., 1 cycle 2 minutes 94 ° C., 27 cycles 15 seconds 94 ° C., 30 seconds 55 ° C. and 1 minute 72 ° C., final extension 10 min 72 ° C. The final PCR product was confirmed by ethidium bromide staining by 1.5% agarose gel electrophoresis.

gene primer Sequence (5'-3 ') Size (bp) MCP-1 Foward AAGATCTCAGTGCAGAGGCTCG 419 Reverse CCAGGGGTAGAACTGTGGTTCAA IL-8 Foward TCTGCAGCTCTGTGTGAAGGT 747 Reverse TGTGGATCCTGGCTAGCAGA IL-6 Foward CAGAGCTGTGCAGATGAGTACAAAA 489 Reverse TCAAACTGCATAGCCACTTTCCA GAPDH Foward CCAAGGTCATCCATGACAACTTTG 464 Reverse GTCATACCAGGAAATGAGCTTGACA

As a result, as shown in Figure 3 when treated with TNF-α alone, it was confirmed that the MCP-1 and IL-8 mRNA levels significantly increased compared to the control group, and when simultaneous treatment with TNF-α and indirubin While there was no change, simultaneous treatment with TNF-α and 5'-NIO significantly reduced MCP-1 and IL-8 mRNA levels. In addition, treatment with indirubin or 5′-NIO alone had no effect on MCP-1 and IL-8 mRNA levels. Accordingly, the anti-inflammatory effect of 5′-NIO in HUVEC cells could be confirmed.

Experimental Example 4 MCP-1 and IL-8 Analysis by ELISA Assay

Always obtained in Example 1-2 In order to measure the secretion of MCP-1 and IL-8 in HUVEC cells by 5'-NIO, the experiment was performed as follows using a DuoSet ELISA Development System (R & D Systems).

HUVEC cells were incubated overnight at a concentration of 1 × 10 ⁵ cells / ml in 12 well plates and then treated with TNF-α 10 ng / ml and / or 5′-NIO for 24 hours. Thereafter, 100 µl of the medium was taken and added to the ELISA plate treated with the antibody of MCP-1 or IL-8, and reacted at room temperature for 2 hours. After washing 3 times with 400 μl of washing buffer, 100 μl of detection antibody was added and reacted at room temperature for 2 hours. Again, 400 μl of wash buffer was added to wash the wells of the plate three times, and then 100 μl of streptavidin-HRP solution was added thereto and reacted at room temperature for 20 minutes. After washing the wells of the plate three times with 400 μl of washing buffer, 100 μl of the substrate solution was added and reacted at room temperature for 20 minutes. After stopping the reaction by adding 50 µl of the stop solution, the absorbance was measured at 450 nm.

As shown in FIG. 4, as in the mRNA expression inhibitory effect, it was confirmed that 5′-NIO significantly inhibited protein expression of MCP-1 and IL-8 in a concentration-dependent manner.

Experimental Example 5. U937 Cell Attachment Assay

In order to determine the effect of 5′-NIO obtained on U937 cell adhesion to vascular endothelial cells obtained in Example 1-2, U937 cells were calcein AM Fluorescent Dye (1 μg / ml). Labeling at 37 ° C. for 30 minutes. Cells were then washed with PBS and suspended again in EGM-2 medium. HUVEC cells were incubated in a 35 mm dish and then treated with 5'-NIO (2 μΜ) and TNF-α (10 ng / ml) for 3 hours. The HUVEC cells were then incubated with U937 cells labeled with calcein AM fluorescein reagent for 3 hours. Unattached U937 cells were removed by washing three times with PBS. Finally, HUVEC cells were fixed for 10 minutes in 4% paraformaldehyde in PBS, followed by fluorescence microscopy with CRYSTAL / MOUNT ™ mounting medium (Biomeda corp., Fostercity, Calif.).

 As a result, as shown in FIG. 5, TNF-α induced adhesion of U937 cells to HUVEC cells. However, simultaneous treatment of 5'-NIO and TNF-α could significantly inhibit TNF-α-induced adhesion of U937 cells. On the other hand, treatment with 5'-NIO alone It could be confirmed that it is not crazy.

Experimental Example 6. Western blot analysis

Increased expression of adhesion molecules such as ICAM-1 and E-selectin increases the adhesion of monocytes / macrophages to vascular endothelial. Therefore, the effects on the expression of ICAM-1 and NFκB in HUVEC cells of 5'-NIO obtained in Example 1-2 were investigated through the following experiment.

HUVEC cells were incubated overnight at a concentration of 1 × 10 ⁵ cells / ml in 12 well plates and treated with TNF-α 10 ng / ml and / or 2′M of 5′-NIO for 24 hours. Cells were washed twice with cold PBS, then RIPA buffer (1% NP40, 0.5% sodium deoxycholate), 1 mmol / L phenylmethylsulfonyl fluoride, 1 μg / ml aprotinin (aprotinin) and PBS containing 1 mmol / L sodium orthovanadate. The lysed cells were incubated at 4 ° C. for 30 minutes and then centrifuged at 10,000 × g for 10 minutes. Protein (10 μg / line) was analyzed by SDS-PAGE and then using antibodies to ICAM-1 or NFκB p65 (Santa Cruz Biotechnology, SantaCruz, CA), or β-actin (Abcam, Cambridge, MA). Immunoblot.

As shown in FIG. 6, when TNF-α and 5′-NIO were simultaneously treated, it was confirmed that the level of ICAM-1 was significantly decreased according to the concentration of 5′-NIO. The transcription factor NF-κB is involved in the expression of various immunoregulatory genes, including cytokines and adhesion molecules. Since nuclear translocation of NF-κB is a very important regulatory step in order to show activity, the present inventors have confirmed the effect on subcellular localization of 5′-NIO. It was confirmed that p65 showed an increased distribution in the nucleus by TNF-α stimulation. However, 5'-NIO significantly reduced the p65 nuclear translocation induced by TNF-α, confirming that the anti-inflammatory effect of 5'-NIO was shown by inhibiting the NF-κB signaling system.

Examples of the formulation of the composition are described below, but are not intended to limit the present invention but to explain in detail only.

Formulation Example 1 Preparation of Powder

5′-NIO 20 mg

Lactose 100 mg

Talc 10 mg

      The above ingredients are mixed and filled in an airtight cloth to prepare a powder.

Formulation Example 2 Preparation of Tablet

5′-NIO 10 mg

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

     After mixing the above components, tablets are prepared by tableting according to a conventional method for preparing tablets.

Formulation Example 3 Preparation of Capsule

5′-NIO 10 mg

3 mg of crystalline cellulose

Lactose 14.8 mg

Magnesium Stearate 0.2 mg

     According to a conventional capsule preparation method, the above ingredients are mixed and filled into gelatin capsules to prepare capsules.

Formulation Example 4 Preparation of Injection

5′-NIO 10 mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Na ₂ HPO ₄ 12H ₂ O 26 mg

      According to the conventional method for preparing an injection, the amount of the above ingredient is prepared per ampoule (2 ml).

Formulation Example 5 Preparation of Liquid

5′-NIO 20 mg

10 g of isomerized sugar

5 g of mannitol

Purified water

      According to the conventional method for preparing a liquid, each component is added and dissolved in purified water, lemon flavor is added, the above components are mixed, purified water is added, the whole is adjusted to 100 ml by adding purified water, and then filled in a brown bottle. The solution is prepared by sterilization.

Formulation Example 6 Preparation of Healthy Food

5′-NIO 1000 mg

Vitamin mixture proper amount

70 μg of Vitamin A Acetate

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

0.2 μg of vitamin B12

Vitamin C 10 mg

10 μg biotin

Nicotinic Acid 1.7 mg

Folate 50 ㎍

Calcium Pantothenate 0.5mg

Mineral mixture

Ferrous Sulfate 1.75 mg

Zinc Oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium Citrate 90 mg

Calcium Carbonate 100 mg

Magnesium chloride 24.8 mg

     Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

Formulation Example 7 Preparation of Healthy Drink

5′-NIO 1000 mg

Citric acid 1000 mg

100 g oligosaccharides

Plum concentrate 2 g

1 g of taurine

Add 900 ml of purified water

     After mixing the above components according to a conventional healthy beverage manufacturing method, and then stirred and heated at 85 ℃ for about 1 hour, the resulting solution is filtered and obtained in a sterilized 2 L container, sealed and sterilized and then refrigerated and stored in the present invention For the preparation of healthy beverage compositions.

Although the composition ratio is a composition suitable for a preferred beverage in a preferred embodiment, the composition ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, demand country, use purpose.

[National R & D project supporting this invention]

[Task unique number]

R13-2005-013-01000-0

[Name of Buddha]

Korea Science Foundation

[Name of research project]

Center for Basic Medical Research (MRC)

[Name of Research Project]

Identification of Useful Substances and Derivation of Derivatives for Anti-Arteriosclerosis Herbal Medicines

[Host]

Korea Science Foundation, Dongguk University, Gyeongsangbuk-do

[Research period]

2005.06.01 ~ 2010.02.28

1 is a diagram showing the inhibitory effect of HUVEC cell proliferation of indirubin and 5′-NIO through MTT assay,

2 is a diagram showing the effect of inhibiting HUVEC cytotoxicity induced by TNF-α of indirubin and 5′-NIO through LDH assay,

3 is a diagram showing the effect of inhibiting the expression of MCP-1 and IL-8 mRNA induced by TNF-α of indirubin and 5′-NIO by RT-PCR method,

4 is a diagram showing the effect of inhibiting the secretion of MCP-1 (A) and IL-8 (B) induced by TNF-α of 5'-NIO through ELISA assay,

5 is a diagram showing the effect of inhibiting U937 cell adhesion of 5′-NIO to HUVEC cells,

6 is a diagram showing the effect of inhibiting the expression of ICAM-1 induced by TNF-α of 5′-NIO,

7 is a diagram showing the effect of inhibiting the activity of TNF-α induced NF-κB of 5′-NIO (nuclear fraction: N; cytoplasmic fraction: C).

<110> Industry Academy Cooperation Foundation of Dongguk University <120> A composition comprising 5'-nitro-indirubinoxime, an indirubine          derivative, for treating and preventing inflammatory diseases <130> DIF / 09-14 / SJ <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCP-1 foward <400> 1 aagatctcag tgcagaggct cg 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MCP-1 Reverse <400> 2 ccaggggtag aactgtggtt caa 23 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IL-8 Foward <400> 3 tctgcagctc tgtgtgaagg t 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-8 Reverse <400> 4 tgtggatcct ggctagcaga 20 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-6 Forward <400> 5 cagagctgtg cagatgagta caaaa 25 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IL-6 Reverse <400> 6 tcaaactgca tagccacttt cca 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward <400> 7 ccaaggtcat ccatgacaac tttg 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse <400> 8 gtcataccag gaaatgagct tgaca 25  

Claims (6)

A pharmaceutical composition for preventing and treating inflammatory diseases containing 5′-nitro-indirubinoxime compound as an active ingredient. The pharmaceutical composition of claim 1, wherein the inflammatory disease is arteriosclerosis, arthritis, hypertension, diabetes, or cancer. The method according to claim 1, wherein the compound acts through an inhibitory effect of TNF-α-induced cytotoxicity, through an active mechanism that inhibits the expression of MCP-1, IL-8, ICAM-1 and NF-kB Pharmaceutic composition. The pharmaceutical composition according to claim 1, wherein the compound is 0.1 to 50% by weight based on the total weight of the composition. Health functional food for the prevention and improvement of inflammatory diseases containing 5′-nitro-indirubinoxime compound as an active ingredient. A dietary supplement according to claim 5 which is a powder, granule, tablet, capsule or beverage.

Images