KR20100006228A - Loss-of-function atubph1 and atubph2 mutant plants increasing resistance against plant stress and transgenic plants transformed by atubph1 and atubph2 promoting plant growth - Google Patents

Abstract

PURPOSE: A transformed plant is provided to promote growth against and enhance resistance to dry stress. CONSTITUTION: A plant which promoted plant growth is obtained by transforming an Arabidopsis thaliana-derived AtUBPH1(Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH1(Arabidopsis thaliana U-Box Protein Homolog 22). The AtUBPH1 gene and AtUBPH2 comprises sequence of sequence number2. The plant is dicotyledonous plant.

Description

Mutant-of-function atubph1 and atubph2 mutant plants increasing resistance against plant stress and transgenic plants transformed by AtUBPH1 and AtUBPH2 mutants of the AtPPH1 and AtPPH2 genes that increase plant stress resistance promoting plant growth}

The present invention relates to mutants of the AtUBPH1 and AtUBPH2 genes that increase plant stress resistance, and to transgenic plants that promote growth into which the genes are introduced.

Ubiquitination is a mechanism that all eukaryotes possess. A series of enzymatic activity mechanisms in which a protein consisting of 76 amino acids called ubiquitin in a matrix protein form a chain by covalent bonds. Substrate proteins in which ubiquitation occurs are very diverse, and many studies show that almost all of the physiological activities in the cell are linked to these mechanisms. The E3 ubiquitin ligase, which is particularly involved in abiotic stress, still needs a lot of research.

Patents and commercialization of useful genes isolated from important plant resources, such as domestic native plants, take up a large part of the biotechnology sector. Expectations for the possibility of producing and industrializing (eg, delayed aging plants, changing the color and size of peppers, plants that resist various external stresses, and changing root lengths) are increasing. Furthermore, it can be applied to various agriculturally important crops and contribute to productivity improvement.

Research on environmental stress of such plants is actively underway, and Korean Patent Laid-Open No. 2006-80235 discloses a method for improving stress resistance in plants. In addition, Korean Patent No. 833476 discloses an AtPFP transformed plant having improved plant growth.

The present invention has been made in accordance with the above requirements, the present inventors while studying the biological or abiotic stress resistance of plants, isolates the Arabidopsis AtUBPH1 and AtUBPH2 genes, and by mutating these genes resistance to stress The present invention was completed by confirming that the overexpressing plants of the genes are faster than wild species.

In order to solve the above problems, the present invention is the growth of the transformed plants with a recombinant vector comprising a AtUBPH1 (Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 (Arabidopsis thaliana U-Box Protein Homolog 23) gene of Arabidopsis-derived It provides the plant to be promoted and its seed.

The present invention also provides a recombinant vector comprising the gene.

The present invention also provides a method of promoting the growth of a plant by transforming the recombinant vector into a plant.

The present invention also provides Arabidopsis mutants and seeds thereof having enhanced stress resistance in which both the AtUBPH1 and AtUBPH2 genes are mutated.

The present invention also provides a composition for promoting growth of a plant comprising the gene.

According to the present invention, the AtUBPH1 and AtUBPH2 genes isolated from the present invention and proteins expressed from the genes promote growth of plants against stress, and mutants in which these genes are broken may increase resistance to dry (drought) stress. Can be.

According to an aspect of the invention, the invention of the Arabidopsis thaliana derived AtUBPH1 (Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 (Arabidopsis thaliana U-Box Protein Homolog 23) transformed plants with the recombinant vector containing the gene It provides a plant and its seed which are promoted to grow.

In the present invention, the over-expressing plant transformants of AtUBPH1 and AtUBPH2 genes, which are U-BOX genes, were found to grow faster (see FIG. 3).

The AtUBPH1 or AtUBPH2 gene may be composed of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In addition, variants of such sequences are included within the scope of the present invention. Variants are base sequences that vary in base sequence but have similar functional properties to the base sequences of SEQ ID NO: 1 and SEQ ID NO: 2. Specifically, the AtUBPH1 or AtUBPH2 gene is at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. It may include base sequences having homology.

The “% sequence homology” for a polynucleotide is determined by comparing the two optimally arranged sequences with the comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).

The plant according to the present invention is a food crop selected from the group consisting of rice, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats and sorghum; Vegetable crops selected from the group consisting of Arabidopsis, Chinese cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, pumpkin, green onion, onion, and carrot; Special crops selected from the group consisting of ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; Fruit trees selected from the group consisting of apple trees, pear trees, jujube trees, peaches, lambs, grapes, citrus fruits, persimmons, plums, apricots and bananas; Flowers selected from the group consisting of roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And fodder crops selected from the group consisting of lysis, redclover, orchardgrass, alphaalpha, tolsquescue and perennial lygragrass. Preferably, the plant is Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard, sweet potato, celery, carrot, buttercup, parsley, cabbage, cabbage, gall, watermelon, It may be a dicotyledonous plant such as melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, or pea, and most preferably is Arabidopsis.

The present invention also provides seed of the plant. Preferably, the seed is Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard, sweet potato, celery, carrot, buttercup, parsley, cabbage, cabbage, mustard, watermelon, It is a seed of dicotyledonous plants such as melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, or pea, and most preferably seed of Arabidopsis.

The present invention also provides the Arabidopsis thaliana derived AtUBPH1 (Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 (Arabidopsis thaliana U-Box Protein Homolog 23) A recombinant vector containing the gene.

The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.

The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism.

The recombinant vector of the present invention may be a plant expression vector.

Preferred examples of plant expression vectors are Ti-plasmid vectors which, when present in a suitable host such as Agrobacterium tumerfaciens, can transfer part of themselves, the so-called T-region, into plant cells. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the HvNHX1 gene according to the invention into a plant host are viral vectors such as those derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc., For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous, especially when it is difficult to properly transform a plant host.

The expression vector preferably comprises one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include, but are not limited to, herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol It doesn't happen.

In the plant expression vector according to an embodiment of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

The terminator may use a conventional terminator, and examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ( Ogrobacterium tumefaciens ) Terminator of the Fine (Octopine) gene, etc., but is not limited thereto. With regard to the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

The present invention also provides a method of promoting the growth of a plant, comprising the step of transforming the plant with the recombinant vector according to the present invention, overexpressing the AtUBPH1 or AtUBPH2 gene.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74), electroporation of protoplasts (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102 ), Microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), particle bombardment methods (DNA or RNA-coated) of various plant elements (Klein TM et. al., 1987, Nature 327, 70), infection with (incomplete) virus in agrobacterium tumerfaciens mediated gene transfer by invasion of plants or transformation of mature pollen or vesicles, and the like. have. Preferred methods according to the invention include Agrobacterium mediated DNA delivery. Especially preferred is the use of the so-called binary vector technology as described in EP A 120 516 and US Pat. No. 4,940,838.

The "plant cells" used for plant transformation may be any plant cells. The plant cells may be cultured cells, cultured tissues, cultured organs or whole plants, preferably cultured cells, cultured tissues or cultured organs and more preferably any form of cultured cells. Preferably, the plant is Arabidopsis vulgaris.

"Plant tissue" refers to the tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie single cells, protoplasts. (protoplast), shoots and callus tissue. Plant tissue may be in planta or in organ culture, tissue culture or cell culture.

Plants that can be used as recombinant vectors and host cells used for transformation are as described above.

The present invention also provides Arabidopsis mutants with enhanced stress resistance in which both the AtUBPH1 and AtUBPH2 genes are mutated. The stress may be a biological or abiotic stress, preferably drought (dry) stress. Knockout mutants in which the two genes were mutated were prepared (see FIG. 4), and the mutants of these genes were found to increase resistance due to drought stress (see FIG. 5).

The present invention also provides seeds of said Arabidopsis mutants.

The present invention also provides for a plant comprising a Arabidopsis-derived AtUBPH1 (Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 (Arabidopsis thaliana U-Box Protein Homolog 23) gene growth promoting composition. In the composition of the present invention, the AtUBPH1 gene and AtUBPH2 gene may be composed of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The composition for promoting growth of the plant of the present invention includes the gene AtUBPH1 ( Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 ( Arabidopsis thaliana U-Box Protein Homolog 23) gene derived from Arabidopsis as an active ingredient, the gene AtUBPH1 or AtUBPH2 By transforming the plant will be able to promote the growth of the plant. The plant is as described above.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example

Materials and methods

1. Acquisition of Gene Isolation

In the present invention, the AtUBPH1 and AtUBPH2 genes, whose expression is induced by dry stress, were separated from the Arabidopsis cDNA by a conventional method.

2. Plant Growth Conditions and Sampling

Arabidopsis seeds of the gene were sterilized in 30% Lax and 0.025% Triton X-100 for 10 minutes and washed with water at least 10 times. The treated seeds were planted vertically in MS medium consisting of 3% sucrose, B5 vitamin (12 mg / L) and 0.8% agar and grown in a growth chamber (16 hours light condition / 8 hours dark condition) for about 2 weeks. The plant was carried out with the material. For green whole plant, seeds were planted in a pot of Sunshine MIX # 5 (Sun Gro Horticulture) soil and grown in a growth chamber (16 hours light / 8 hours dark) for about 3 weeks. It was performed by.

3. Stress (salt, low temperature, dry) treatment

In the present invention, to confirm the expression of the gene for the stress of the AtUBPH1 and AtUBPH2 gene, dry stress was sampled 1 hour and 2 hours after exposure to air in the Arabidopsis seedlings grown for 2 weeks in the medium. Salt stress was only sampled for root tissue after 1 hour and 2 hours after treatment with 300 mM sodium chloride in the Arabidopsis grown for 2 weeks. Cold stress was cultured Arabidopsis seedlings grown for 2 weeks in the medium for 6 hours, 12 hours in an incubator maintained at 4 ℃ and sampled tissue.

The various stressed tissues were ground in a mortar with liquid nitrogen and then powdered in a mortar and then 2 ml of extract buffer per gram (4 M guanidine-HCl 20 mM, 10 mM EDTA, 10 mM EGTA, 0.5% sarcosyl, Extracted with pH 9) and β-mercaptoethanol, transferred to conical tubes, mixed with an equal amount of PCI (phenol: chloroform: isoamyl alcohol = 25: 24: 1), shaken for 5 minutes, and then stirred at 3,500 rpm. Centrifugation for 25 minutes (Hanil Centrifuge, HA-1000-3). After centrifugation, the upper organic solvent layer was removed, the same amount of PCI was mixed and shaken, and then the centrifugation process was repeated twice. The aqueous solution layer formed below was subjected to two ethanol precipitation and one LiCl precipitation methods. RNA was isolated.

4. Quantitative Reverse Transcriptase (RT) -PCR

Whole RNA was extracted from the transgenic plants and wild leaves to synthesize single-stranded cDNA using oligo dT primers and MMLV reverse transcriptase. 20 ng of cDNA was used as a template for PCR. Two primers were used at 10 pmole, 5 μl of 10 × Taq polymerase buffer, 8 μl of dNTP mixture (1.25 mM each), and 1 unit of Taq DNA polymer. Lase was added to make 50 μl total volume.

PCR was performed with a Perkin Elmer DNA thermal cycler. First, denatured at 94 ° C. for 2 minutes, followed by repeating 25 times at 94 ° C. for 30 seconds, at 52 ° C. for 30 seconds, and at 72 ° C. for 25 minutes. The reaction was carried out and then stored frozen at -20 ℃. Primers of genes used for PCR are as follows.

AtUBPH1 Foward : 5'- GAATCTCAACGACATGTGTCAGT -3 '(SEQ ID NO: 3)

AtUBPH1 Reverse: 5'- AAGCAGGATACGAATCATACAAA -3 '(SEQ ID NO: 4)

AtUBPH2 Foward : 5'- GCAACGACTCAGAAAATGGG -3 '(SEQ ID NO: 5)

AtUBPH2 Reverse: 5'- CATCAGCAGGGATATGCAAG -3 '(SEQ ID NO: 6)

RD29a Foward: 5'- CAGGTGAATCAGGAGTTGTT -3 '(SEQ ID NO: 7)

RD29a Reverse: 5'- CCGGAAATTTATCCTCTTCT -3 '(SEQ ID NO: 8)

RD22 Foward: 5'- GCAGCGAAGGAGACTCAGCT -3 '(SEQ ID NO: 9)

RD22 Reverse: 5'- GTTCCAAGCTGAGGTGTTCTT -3 '(SEQ ID NO: 10)

18s rRNA Foward: 5'- GCATTTGCCAAGGATGTTTT -3 '(SEQ ID NO: 11)

18s rRNA Reverse: 5'- GTACAAAGGGCAGGGACGTA -3 '(SEQ ID NO: 12)

UBC10 Foward: 5'- ATGGCGTCGAAGCGGATC -3 '(SEQ ID NO: 13)

UBC10 Reverse: 5'- TTAGCCCATGGCATACTTCTG -3 '(SEQ ID NO: 14)

Ubiquitin Foward: 5'- ATGCAGATCTTTGTTAAGACTCTC -3 '(SEQ ID NO: 15)

Ubiquitin Reverse: 5'- TCAACCACCACGGAGCCTGA-3 '(SEQ ID NO: 16)

6. AtUBPH1  And AtUBPH2  Preparation of Vector Constructs of Genes

In the present invention, to encode a protein binding to maltose and a plasmid to be expressed by fusion of AtUBPH1 and AtUBPH2, a primer set having a sequence corresponding to PstI restriction enzyme on the 5 'and 3' sides of the coding portion of AtUBPH1 is encoded by AtUBPH2. PCR was performed using a primer set with sequences corresponding to EcoRI restriction enzymes on the 5 'and 3' sides of the portion. PCR results and pMAL-X vector (New England Biolabs, Beverly, MA) were cut with EcoRI restriction enzyme and then ligated using T4 DNA ligase (New England Bio Lab) enzyme. Recombinant MBP-CaRma1H1 was expressed in Escherichia coli BL21-CodonPlus (DE3) RIL (stratizine) and then purified using amylose column chromatography. Protein was quantified using BSA as standard protein.

In addition, in the present invention, pBI121, which is a binary vector containing a CaMV 35S promoter and a NOS terminator, was used for transformation of Arabidopsis for the production of transformants. For transformation, PCR was performed using high fidelity EX-tag polymerase (Takara, Kyoto, Japan) using pAtUBPH1 and pAtUBPH2 cDNA as templates. As a result, a cDNA fragment containing the translational site of the protein was obtained completely. AtUBPH1 was cut with SmaI, SacI and AtUBPH2 with XbaI, SacI restriction enzyme and introduced into pBI121 vector.

7. To Agrobacterium AtUBPH1  And AtUBPH2  Transformation and Preparation of Transgenic Arabidopsis Plants

The constructed construct was transformed into Agrobacterium (GV3101) using electroporation, and the presence or absence of the gene was confirmed by PCR. The ground part of about 4 weeks of Arabidopsis (columbia [Col-0]) was transformed by immersion in MS medium containing 0.05% silwet for 1 minute and 30 seconds (clough and Bent, 1998, Plant J 16; 735). -743). After culturing in a growth chamber at 23 ° C. for about 3 weeks and receiving seeds (T1), individuals who survived in a medium containing 25 μg / ml kanamycin and 250 μg / ml carbenicillin were selected for the presence of the transgene. Validation was by RT-PCR and Northern blot.

8. Enzyme Activity Analysis of AtUBPH1 and AtUBPH2 Proteins

In the present invention, for the enzymatic activity analysis of AtUBPH1 and AtUBPH2 proteins, subcloning of the ORMs of AtUBPH1 and AtUBPH2 genes to pMAL -X vector was performed in accordance with the MBP (maltose binding protein) frame. 40 mM Tris-HCl, pH 7.5, 5 mM MgCl ₂ , 2 mM ATP, 2 mM dithiothreitol (DTT), 300 ng / μl ubiquitin, 25 μM MG132, 500 ng UBA1, 500 ng UBC8, MBP-AtUBPH1 or 500 ng of MBP-AtUBPH2 was put in each tube and incubated in a 30 ° C. incubator. Sample buffer was added and then boiled at 100 ° C. for 5 minutes and Western blot was performed using anti-MBP (New England Bio Labs) and anti-ubiquitin (Santa Cruz) antibodies.

Example 1 Enzyme Activity Analysis of AtUBPH1 and AtUBPH2 Proteins

1B shows enzymatic activity analysis of AtUBPH1 and AtUBPH2 proteins. MBP (maltose binding protein) was attached to the proteins, and then self-ubiquitation was performed. After culturing UBA1, UBC8, ubiquitin, AtUBPH1 or AtUBPH2 at 30 degrees for 1 hour, MBP and ubiquitin were identified to confirm protein changes. Western blot analysis was performed using a specific antibody. The increase in the molecular weight of the MBP-AtUBPH1 and MBP-AtUBPH2 proteins was confirmed by Western blot analysis using the MBP antibody, and the increase was confirmed using the ubiquitin antibody to confirm whether the increase was due to ubiquitin. Based on the results, AtUBPH1 and AtUBPH2 proteins were found to have the enzymatic activity of ligase to attach ubiquitin protein.

Example  2: due to stress (salt, low temperature, drying) treatment AtUBPH1  And AtUBPH2  Investigation of gene expression

Figure 2 shows the results of RT-PCR analysis of the expression of AtUBPH1 and AtUBPH2 genes under abiotic stress (cold, dry, and saline) conditions. As can be seen in Figure 2, AtUBPH1 and AtUBPH2 genes were found to be induced by low temperature, drying, and salt stress. In addition, it can be seen that the expression of RD29A gene involved in stress resistance is also induced.

Example  3: AtUBPH1  And AtUBPH2  Phenotypic Analysis of Transgenic Arabidopsis Transgenic Genes Overexpressed

3A This is the result of analyzing the phenotype of Arabidopsis transformed with 35S: AtUBPH1 and 35S: AtUBPH2 recombinant vectors containing AtUBPH1 and AtUBPH2 genes. Under normal conditions, the transformants grow faster and grow longer than the wild species. Thus, it can be seen that the AtUBPH1 and AtUBPH2 genes can promote plant growth.

In addition, Figure 3B confirms the overexpressing plants of these genes via RT-PCR. As can be seen in Figure 3B, the overexpressing plant was found to overexpress the AtUBPH1 and AtUBPH2 gene.

Example 4: AtUBPH1  And AtUBPH2  Analysis of Dry Stress Resistance in Arabidopsis with Mutations of Genes

4A is a diagram of mutants of the AtUBPH1 and AtUBPH2 genes. T-DNA is inserted at the exon of two genes. FIG. 4B shows the knockout mutants in which two genes were mutated at the same time by crossing these genes, and T-DNA was inserted by PCR by using these genes and primers near T-DNA. Figure 4C is to extract the RNA of each mutant to examine the expression of the gene by the method of RT-PCR. As shown in FIG. 4C, the expression of AtUBPH1 and AtUBPH2 genes was suppressed.

5A is a phenotypic analysis of drought stress of mutants of AtUBPH1 and AtUBPH2 genes. When water was not given for 12 days, it was found to be more resistant to dry stress than wild species. Figure 5B is a gene expression analysis of the transformants and mutants of the gene when subjected to dry stress for 1 hour. In the case of mutants, it was found that the expression of RD29a and RD22 genes involved in stress resistance was increased, and the overexpressed transgenic plants of the genes were found to be reduced based on the RT-PCR results.

Thus, AtUBPH1 And AtUBPH2 Mutant genes were found to be resistant to drought stress.

1A shows analysis of AtUBPH1 and AtUBPH2 proteins. AtUBPH1 consists of 435 amino acids, AtUBPH2 consists of 411 amino acids, and the gray region indicates the U-BOX domain that the protein has in common. 1B shows enzymatic activity analysis of AtUBPH1 and AtUBPH2 proteins.

Figure 2 shows the results of RT-PCR analysis of the expression of AtUBPH1 and AtUBPH2 genes under abiotic stress (cold, dry, and saline) conditions.

3A is a 35S: AtUBPH1, and 35S: AtUBPH2 a result of analyzing the phenotype of transgenic Arabidopsis with a recombinant vector. 3B shows the overexpressing plants of these genes through RT-PCR.

4A is a diagram of mutants of the AtUBPH1 and AtUBPH2 genes. FIG. 4B shows the knockout mutants in which two genes were mutated at the same time by crossing these genes, and T-DNA was inserted by PCR by using these genes and primers near T-DNA. Figure 4C is to extract the RNA of each mutant to examine the expression of the gene by the method of RT-PCR.

5A is AtUBPH1 and AtUBPH2 Phenotypic analysis of drought stress in mutants of genes. Figure 5B is a gene expression analysis of the transformants and mutants of the gene when subjected to dry stress for 1 hour.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Loss-of-function atubph1 and atubph2 mutant plants increasing          resistance against plant stress and transgenic plants transformed          by AtUBPH1 and AtUBPH2 promoting plant growth <130> PN08112 <160> 16 <170> KopatentIn 1.71 <210> 1 <211> 1645 <212> DNA <213> Arabidopsis thaliana <400> 1 gctaacttat tcaaaccaat tcacatatct cctaaatctc aacgactgca ctttgaagct 60 ttttgtttag attcgttcgt cgtttccatt gattaagtct acttcttttt tttcatattt 120 tcgagcgggt caaatggatc aagagataga gattccttcc ttcttccttt gtccaatctc 180 tctagatatc atgaaagatc cggtgatagt ttccaccgga ataacctacg accgagaaag 240 catcgagaag tggctctttt ccggtaagaa aaactcatgt ccagtcacca aacaagtcat 300 aaccgaaact gatcttaccc caaaccacac tcttcgccgt ttgattcaat cttggtgtac 360 cctcaacgca tcatatggta tagagaggat cccaactcca aaacctccga tctgtaaatc 420 ggagatcgaa aagcttatca aagagtcgtc atcttcgcat ctaaaccaag tcaaatgcct 480 caaacgactt cgtcaaatag tatctgagaa tacaaccaac aaacggtgct tagaagccgc 540 agaagttccg gagtttttgg caaatatcgt aagcaactct gtagatacgt ataactctcc 600 ttcttcttca ctttcttctt cgaatctcaa cgacatgtgt cagtcaaaca tgttggagaa 660 tcgatttgat tcttcaagaa gcttgatgga cgaagcccta agcgtactct accatcttga 720 cacatcggag acagccctca agagtctttt aaacaacaag aaaggaacaa atcttgtgaa 780 aacgttgacg aagattatgc aacgtgggat ctacgagtca agagcctatg cggctttgct 840 tctcaagaag ctcctggaag ttgcggatcc aatgcagatc atattgttgg aacgagaact 900 tttcggtgag gtgattcaaa tcttgcacga ccagatctct cacaaggcga caagatcagc 960 aatgcaaatc ttggtgatca catgtccatg gggaaggaat agacacaagg cagtggaagg 1020 tggaacaatc tcgatgataa tcgagctttt aatggacgat actttctcat cagagagaag 1080 gaattcagag atggcgatgg tggttcttga tatgttatgt cagtgcgcag aaggaagagc 1140 tgagttcttg aatcacggtg ccgctattgc ggttgtgtct aagaagatat tgagggtctc 1200 acaaataact agtgaaaggg cagttagggt tttgctttcg gttgggaggt tctgcgcgac 1260 accctctttg ttgcaggaga tgttgcaatt gggagttgta gcaaagctgt gtctggtact 1320 tcaagttagc tgtggtaaca agactaaaga aaaggctaaa gaattgctta agcttcacgc 1380 tagggtttgg agggaatcac cttgtgtccc aagaaatttg tatgattcgt atcctgcttg 1440 aacaacgtac atgtttgaat aattctcatc agatacaaac aattctttga gaattattct 1500 tcgtataagt tcattttaaa acaaaaaaga gtggtttaaa ttttgctcaa actctgattt 1560 tctttcattt gtttttgttt tattatcttt caatgtttat cattatgtgt agataatagt 1620 ggacatattt tcatgaaatt atgaa 1645 <210> 2 <211> 1619 <212> DNA <213> Arabidopsis thaliana <400> 2 ctaacttatt caaaccaatt cacatcttcc caaacccaac tactacaact tgtattaaga 60 aaaagatata ttcccttagc ttctttgatc aatatattcg tcagggttct cgtcaaagtc 120 ctcagcatct tcatcatatg tccggaggaa taatggatga agagatcgag attcctccgt 180 tcttcctttg tcctatctct ttggagatca tgaaagatcc agtgatagtc tctaccggaa 240 taacctacga cagagacagc atcgagaaat ggctatttgc aggcaagaaa aactcgtgtc 300 cggtcaccaa acaagacata accgacgcgg atctcacccc gaatcacact ctacgccgtc 360 tcatccaatc ttggtgcacc ctaaacgcct cctacggcgt cgagaggatc cctaccccaa 420 gacctccgat ttgtaaatct gagatcgaaa agctcattag agattcagcc tcttcccatg 480 aaaaccaagt caagtgtctc aaacgacttc gtcagattgt gtcggagaac gcgaccaaca 540 agcggtgttt agaggcagcg ggagtaccgg agttcttggc caacatcgta agcaacgact 600 cagaaaatgg gagtttgacc gacgaagccc tcaacttact ttaccacctc gagacctcag 660 agacagtcct caagaatctt ttaaacaaca agaaagataa caatatcgta aagtcgttga 720 cgaagatcat gcagcgtggg atgtacgagt ccagagtcta tgccactttg cttctcaaga 780 acattctcga agtagcggat ccaatgcaga gtatgactct caagccagag gttttcactg 840 aggtcgtcca gatcttggac gaccggatct cgcagaaggc gaccaaagct gccatgcata 900 tattggtgaa catatgccca tggggaagga acagacacaa ggccgtggaa gctggagtaa 960 tctctgtgat catcgagctt ctcatggacg agagcttcac atcagagagg agaggtccag 1020 agatggcgat ggtggttctt gatctgttgt gtcagtgtgc ggagggacga gccgagttct 1080 tgaaccacgg agcagccata gcggtggtgt gcaagaagat acttagggtt tcacagacag 1140 caagcgatag agcggttagg gttttgttgt cggtgggaag gttctgcgca acgcctgctt 1200 tgttgcacga gatgttacag ttgggggttg tagcgaagct ttgtcttgtg cttcaagtaa 1260 gctgtggagg taagaccaaa gagaaggcaa aggagttgct taagttgcac gctagggtct 1320 ggaaggactc gccttgtctc ccaaaaaaca tgattcttgc atatccctgc tgatgaaaac 1380 gaagaaaaca atacaaacaa gtccaattct cagtgagagc aatcacatat atgagagatg 1440 ctgttgaaaa aactaaagga gtattcaatt attcatatca ttaatccaat tttccttagg 1500 tttcttattt cgtacttttg atgttctcaa tgtagataat agtggaaaat gttcatcaaa 1560 tatttttttt tatgaaaaac tgcaaagata tcatatataa aatcacaagt taccaggct 1619 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AtUBPH1 Foward primer <400> 3 gaatctcaac gacatgtgtc agt 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AtUBPH1 Reverse primer <400> 4 aagcaggata cgaatcatac aaa 23 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AtUBPH2 Foward primer <400> 5 gcaacgactc agaaaatggg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AtUBPH2 Reverse primer <400> 6 catcagcagg gatatgcaag 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RD29a Foward primer <400> 7 caggtgaatc aggagttgtt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RD29a Reverse primer <400> 8 ccggaaattt atcctcttct 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RD22 Foward primer <400> 9 gcagcgaagg agactcagct 20 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RD22 Reverse primer <400> 10 gttccaagct gaggtgttct t 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s rRNA Foward primer <400> 11 gcatttgcca aggatgtttt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s rRNA Reverse primer <400> 12 gtacaaaggg cagggacgta 20 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> UBC10 Foward primer <400> 13 atggcgtcga agcggatc 18 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> UBC10 Reverse primer <400> 14 ttagcccatg gcatacttct g 21 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ubiquitin Foward primer <400> 15 atgcagatct ttgttaagac tctc 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ubiquitin Reverse primer <400> 16 tcaaccacca cggagcctga 20  

Claims (13)

Arabidopsis-derived AtUBPH1 (Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 (Arabidopsis thaliana U-Box Protein Homolog 23) of the plant to be transformed plant with a recombinant vector containing the gene is to promote growth. According to claim 1, wherein the AtUBPH1 gene and AtUBPH2 gene is a plant, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The plant of claim 1, wherein the plant is a dicotyledonous plant. Seeds of plants according to claim 1. Recombinant vector containing AtUBPH1 ( Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 ( Arabidopsis thaliana U-Box Protein Homolog 23) gene from Arabidopsis . A method of promoting plant growth, comprising the step of transforming the plant with the recombinant vector of claim 5, wherein the plant is overexpressed in the AtUBPH1 or AtUBPH2 gene. The method of claim 6, wherein the plant is a dicotyledonous plant. Arabidopsis mutants with enhanced resistance to stress, in which the AtUBPH1 and AtUBPH2 genes are mutated. The Arabidopsis mutant of claim 8, wherein the stress is a drought. Seed of the Arabidopsis mutant according to claim 8. Arabidopsis-derived AtUBPH1 (Arabidopsis thaliana U-Box Protein Homolog 22) or AtUBPH2 (Arabidopsis thaliana U-Box Protein Homolog 23) The composition for promoting growth of a plant containing the gene. The composition of claim 11, wherein the AtUBPH1 gene and the AtUBPH2 gene are composed of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2, respectively. 12. The composition of claim 11, wherein the plant is a dicotyledonous plant.

Images