KR20090131845A - Genes which are related to 4-coumaric acid, caffeic acid and ferulic acid biosynthesis and a method of production using therof - Google Patents

Abstract

PURPOSE: A gene relating to biosynthesis of 4-coumaric acid, caffeic acid, and ferulic acid is provided to use as an antioxidant and inhibitor of melanogenesis. CONSTITUTION: A gene construct for producing 4-coumaric acid and caffeic acid contains a gene encoding a tyrosine ammonia lyase(TAL) of sequence number 9 and gene encoding a 4-coumarate 3-hydroxylase(C3H) of sequence number 10. An expression vector for producing 4-coumaric acid and caffeic acid contains gene construct for producing 4-coumaric acid and caffeic acid. A transformant for producing 4-coumaric acid and caffeic acid is produced by transforming a host cell with the expression vector.

Description

Genes involved in 4-coumarin acid, caffeic acid and ferulic acid biosynthesis and production methods using the same {Genes which are related to 4-Coumaric acid, caffeic acid and ferulic acid biosynthesis and a method of production using therof}

The present invention relates to a gene involved in the biosynthesis of 4-coumarin acid (4-Coumaric acid), caffeic acid (caffeic acid) and ferulic acid (ferulic acid) and a production method using the same.

Phenolic compounds, such as 4-Coumaric acid, caffeic acid and ferulic acid, are cancer-inhibiting substances. In addition, 4-coumarin acid has been described in many studies as an inhibitor of melanin production and has an inhibitory effect on bacterial growth. Caffeic acid acts as a carcinogen and is known to be an antioxidant in and out of the body and has been shown to be more effective than other antioxidants. In addition, it not only reduces the production of aflatoxin by more than 95%, but also causes oxidative stress and may interfere with the production of aflatoxin. In addition, ferulic acid is extracted from the resin of the plant in 1866 and named (Hlasiwetz H et al . , Ann . 138: 61, 1866), and has a mild antioxidant activity against various active oxygen species derived from oxygen molecules, It has been reported to exhibit potent antioxidant effects on oxidative transition metals such as iron and copper ions (Smart MG et al . , Aust . J. Plant Physiol . 6: 485, 1979). Therefore, it is used as an additive to prevent automatic oxidation of natural oils such as linseed oil and to prevent oxidation of other active ingredients contained in the product by transition metals or other active oxygen species introduced (Tsukiya T et. al . , Jpn . Kokai 75: 18621, 1975).

4-coumarin acid, caffeic acid and ferulic acid are known as intermediates of phenylpropanoid series and flavonoid compounds, which are mainly produced in plants. Therefore, genes involved in biosynthesis of the intermediate have been reported in many organisms, including plants, and recently, to establish artificial biosynthetic pathways for flavonoid production, Arabidopsis By transducing genes related to thaliana- derived flavonoid biosynthesis into Escherichia coli, there have been reports of successful biosynthesis of 4-coumarin acid, an intermediate of ferulic acid (Watts KT et. al . , Chembiochem 5 (4): 500-507, 2004). There are two representative biosynthetic pathways of ferulic acid from amino acids (see Fig. 1): 1) Finally, ferulic acid is obtained by using L-tyrosine as a precursor and 4-coumarin acid and caffeic acid as intermediates. Route to biosynthesis; And 2) a route for finally biosynthesizing ferulic acid using L-phenylalanine as a precursor and cinnamic acid and caffeic acid as intermediates. The work of Watts et al. Relates to the artificial construction of a pathway for biosynthesis of 4-coumarin acid from L-phenylalanine via cinnamonic acid.

As such, when producing useful compounds using recombinant microbial technology, E. coli is known for its genetic information, which is well established, has various vector systems, and has the advantage of being able to cultivate rapidly at high concentration in relatively inexpensive medium. It is used. In particular, when constructing the ferulic acid biosynthetic pathway for E. coli producing L-tyrosine, a starting material of the ferulic acid biosynthetic pathway, it will be possible to produce a large amount of ferulic acid without metabolic control of the initial starting material production.

Therefore, the inventors of the present invention, L- tyrosine as a precursor to E. coli, 4-coumarin acid and caffeic acid as an intermediate, and finally to build an artificial biosynthetic pathway for biosynthesis of ferulic acid, the artificial biosynthetic pathway 4 -Confirmed that coumarin acid, caffeic acid and ferulic acid can be biosynthesized and completed the present invention.

An object of the present invention is a recombinant that inserts a gene encoding Tyrosine ammonia lyase (hereinafter referred to as TAL) and a gene encoding 4-coumarate 3-hydroxylase (hereinafter referred to as C3H). It is to provide a vector and a strain transformed with the recombinant vector.

Another object of the present invention to provide a method for producing caffeic acid using the strain.

Another object of the present invention is to provide a method for producing ferulic acid using a strain transformed with a recombinant vector inserted with a gene encoding Caffeic acid O-methyltransferase (hereinafter referred to as COMT). will be.

Another object of the present invention is to provide a recombinant vector in which a gene encoding TAL, a gene encoding C3H, and a gene encoding COMT and a strain transformed with the recombinant vector are provided.

Another object of the present invention is to provide a method for producing ferulic acid using the strain.

In order to achieve the above object, the present invention provides a gene encoding Tyrosine ammonia lyase (hereinafter referred to as SEQ ID NO: 9), and 4-coumarin acid 3-hydroxylase described as SEQ ID NO: 10 (hereinafter referred to as TAL). Provided is a gene construct for 4-coumarin acid and caffeic acid linked to a gene encoding 4-coumarate 3-hydroxylase (hereinafter, C3H).

In addition, the present invention provides an expression vector comprising the gene construct.

The present invention also provides a transformant prepared by transforming a host cell with the expression vector.

In addition, the present invention 1) preparing an expression vector comprising the gene construct for producing 4-coumarin acid and caffeic acid;

2) transforming the expression vector of step 1) into a host cell;

3) culturing the transformant of step 2);

4) inducing protein expression of the cultured transformant of step 3) and then further culturing; And,

5) It provides a 4-coumarin acid and caffeic acid production method comprising the step of obtaining 4-coumarin acid and caffeic acid in the culture of step 4).

In addition, the present invention comprises the steps of 1) preparing an expression vector comprising a gene encoding Caffeic acid O-methyltransferase (hereinafter referred to as COMT), as described in SEQ ID NO: 11;

2) transforming the expression vector of step 1) into a host cell;

3) culturing the transformant of step 2);

4) inducing protein expression of the cultured transformant of step 3) and then further culturing in a medium comprising caffeic acid; And,

5) It provides a ferulic acid production method comprising the step of obtaining the ferulic acid in the culture of step 4).

In addition, the present invention provides a gene for ferulic acid production, in which the gene encoding TAL, described by SEQ ID NO: 9, the gene encoding C3H, described by SEQ ID NO: 10, and the gene encoding COMT, described by SEQ ID NO: 11, are linked. Provide a construct.

In addition, the present invention provides an expression vector comprising the gene construct.

The present invention also provides a transformant prepared by transforming a host cell with the expression vector.

In addition, the present invention comprises the steps of 1) preparing an expression vector comprising the gene construct for producing ferulic acid;

2) transforming the expression vector of step 1) into a host cell;

3) culturing the transformant of step 2);

4) inducing protein expression of the cultured transformant of step 3) and then further culturing; And,

5) It provides a ferulic acid production method comprising the step of obtaining the ferulic acid in the culture of step 4).

Hereinafter, the present invention will be described in detail.

The present invention relates to a gene encoding Tyrosine ammonia lyase (hereinafter referred to as SEQ ID NO: 9) and to 4-coumarin acid 3-hydroxylase described as SEQ ID NO: 10; Hereinafter, a gene construct for 4-coumarin acid and caffeic acid production, to which a gene encoding C3H) is linked, is provided.

The TAL is an enzyme for converting L-tyrosine (L-Tyrosine) to 4-coumarin acid (4-Coumaric acid), in a specific embodiment of the present invention, obtained from the chromosome of Saccharothrix espanaensis , After confirming the nucleotide sequence (SEQ ID NO: 9), the expression vector containing the gene (see FIG. 2A) was transformed and cultured in E. coli, and the 4-coumarin acid was successfully biosynthesized by further incubation after inducing protein expression. Confirmation using HPLC (see FIG. 3). In addition, the C3H is an enzyme that acts to produce a caffeic acid by attaching a hydroxyl group to a carbon position 3 of the phenol ring in 4-coumarin acid, in a specific embodiment of the present invention, Saccharothrix espanaensis After confirming the nucleotide sequence (SEQ ID NO: 10) of the gene encoding the C3H obtained from the chromosome of, an expression vector containing the gene (see FIG. 2B) was prepared, and the TAL, which is set forth in SEQ ID NO: 9, was encoded. A gene encoding TAL and SEQ ID NO: 10 described in SEQ ID NO: 9, prepared using an expression vector containing the gene to be expressed, and an expression vector comprising the gene encoding C3H described in SEQ ID NO: 10. The expression vector (see FIG. 4), which is linked to a gene encoding C3H, was transformed and cultured in E. coli, followed by induction of protein expression to further culture of 4-coumarin acid. The cafe acid biosynthesis is successfully confirmed by using HPLC (see Fig. 5). Thus, the gene construct linked to the gene encoding TAL, which is described by SEQ ID NO: 9 and the gene encoding C3H, which is described by SEQ ID NO: 10, may be usefully used for biosynthesis of 4-coumarin acid and caffeic acid. have.

In addition, the present invention provides an expression vector comprising the gene construct.

In a specific embodiment of the present invention, E. coli is expressed in an expression vector (see FIG. 4) containing a gene encoding TAL and a gene encoding C3H described in SEQ ID NO: 10, linked thereto. Inverted and incubated, 4-coumarin acid and caffeic acid were successfully biosynthesized using HPLC after induction of protein expression (see FIG. 5). Thus, the expression vector of the present invention can be usefully used for the biosynthesis of 4-coumarin acid and caffeic acid.

The gene construct may be operably linked to a skeletal vector. As the skeletal vector, various vectors capable of transforming E. coli selected from the group consisting of pET-28a (+), pT7, pET / Rb, pGEX, pET28a, pET-22b (+), and pGEX may be used, but are not limited thereto. It is not. In a specific embodiment of the present invention, the expression vector is a gene encoding the TAL, and the gene encoding the C3H, described in SEQ ID NO: 10, and the gene linked to the pET-28a (+) skeleton vector described in SEQ ID NO: 9 By including the construct, the TAL and C3H could be expressed as recombinant proteins, that is, the biosynthesis of the 4-coumarin acid and caffeic acid could be successfully achieved using the recombinant protein.

The expression vector of the present invention is a conventional cloning method (Sambrook J et. al ., the supra). In particular, an appropriate adapter may be linked to the gene construct prior to insertion to facilitate cloning of the gene construct.

The present invention also provides a transformant prepared by transforming a host cell with the expression vector.

In a specific embodiment of the present invention, E. coli is expressed in an expression vector (see FIG. 4) containing a gene encoding TAL and a gene encoding C3H described in SEQ ID NO: 10, linked thereto. Inverted and incubated, 4-coumarin acid and caffeic acid were successfully biosynthesized using HPLC after induction of protein expression (see FIG. 5). Thus, the transformant of the present invention can be usefully used for the biosynthesis of 4-coumarin acid and caffeic acid.

The host cell may be 1) biosynthesis of L-tyrosine, and can be used as long as it can not produce 4-coumarin acid and caffeic acid, but is preferably Escherichia coli, which can biosynthesize L-tyrosine in a large amount, and limited thereto. It doesn't happen. Or 2) L-tyrosine as a precursor, 4-coumarin acid can be produced, and any one can be used as long as it cannot produce caffeic acid. Preferably, 4-coumarin is used as L-tyrosine as a precursor. Escherichia coli, which can mass produce acids, may be used, but is not limited thereto. Or 3) L-phenylalanine as a precursor, cinnamic acid as an intermediate, and 4-coumarin acid can be biosynthesized, and caffeic acid can be used in the host cell. Preferably, it is E. coli, which can produce 4-coumarin acid using L-phenylalanine as a precursor, but is not limited thereto. In the case of 1), it is possible to biosynthesize 4-coumarin acid and caffeic acid by using L-tyrosine as a precursor using the enzyme expressed in the gene construct of the present invention. In addition, in the case of 2) and 3), it is possible to biosynthesize caffeic acid by using 4-coumarin acid as a precursor by the gene conduit of the present invention.

In addition, the present invention comprises a gene construct for producing 4-coumarin acid and caffeic acid, to which a gene encoding TAL, as described in SEQ ID NO: 9, and a gene encoding C3H, described as SEQ ID NO: 10, are linked. Preparing an expression vector;

2) transforming the expression vector of step 1) into a host cell;

3) culturing the transformant of step 2);

4) inducing protein expression of the cultured transformant of step 3) and then further culturing; And,

5) It provides a 4-coumarin acid and caffeic acid production method comprising the step of obtaining 4-coumarin acid and caffeic acid in the culture of step 4).

In a specific embodiment of the present invention, an expression vector (see FIG. 4) transfected with an expression vector (see FIG. 4) containing a gene encoding TAL and a gene encoding C3H described in SEQ ID NO: 10 is linked to SEQ ID NO. Inverted and cultured in LB medium, followed by induction of protein expression and further incubation in M9C medium to identify peaks with the same UV spectra at the same time period as 4-coumarin acid or caffeic acid standard, thereby identifying 4-coumarin acid and caffeic acid. Production was confirmed (see FIGS. 3 and 5). Thus, the transformant of the present invention can be usefully used for the biosynthesis of 4-coumarin acid and caffeic acid.

In step 4), the transformants were prepared in LB, YT, 2YT, M9 and M9C medium (modified M9 minimal media; added CaCO ₃ 25 g / L, glucose 40 g / L; 50 μg / L Kan, 1 mM IPTG) and the like. It may be further cultured, and preferably cultured in M9C medium.

Obtaining step 5) can be carried out by extraction using an organic solvent and then using HPLC. The organic solvent may be any one selected from the group consisting of ethyl acetate, acetone and chloroform, but is not limited thereto, and any organic solvent known to those skilled in the art to be used for extraction of phenolic compounds may be used. It is obvious that it is possible.

In addition, the present invention comprises the steps of 1) preparing an expression vector comprising a gene encoding Caffeic acid O-methyltransferase (hereinafter referred to as COMT), as described in SEQ ID NO: 11;

2) transforming the expression vector of step 1) into a host cell;

3) culturing the transformant of step 2);

4) inducing protein expression of the cultured transformant of step 3) and then further culturing in a medium comprising caffeic acid; And,

5) It provides a ferulic acid production method comprising the step of obtaining the ferulic acid in the culture of step 4).

The COMT is an enzyme that acts to produce perolinic acid by methylation by attaching a hydroxyl group to the carbon position 3 of the phenol ring in the caffeic acid and replacing it with a methoxyl group. In a specific example, after confirming the nucleotide sequence (SEQ ID NO: 11) of the gene encoding COMT obtained from the mRNA of Arabidopsis thaliana , the expression vector containing the gene (see FIG. 2C) was transformed into E. coli and cultured. Production of ferulic acid was confirmed by identifying the peaks with the same UV spectra at the same time period as the ferulic acid standard by inducing protein expression and then further culture in a medium containing caffeic acid (see FIG. 6). Thus, the transformant of the present invention can be usefully used for the biosynthesis of ferulic acid.

Any host can be used as long as it can not produce ferulic acid in the host cell of step 2), but it is preferably E. coli, but is not limited thereto. In a specific embodiment of the present invention, by adding caffeic acid to the culture medium when culturing the transformant, ferulic acid could be generated using the caffeic acid as a precursor.

In step 4), the transformant may be further cultured in LB, YT, 2YT, M9 and M9C medium, etc., preferably in M9C medium.

Obtaining step 5) can be carried out by extraction using an organic solvent and then using HPLC. The organic solvent may be any one selected from the group consisting of ethyl acetate, acetone and chloroform, but is not limited thereto, and any organic solvent known to those skilled in the art to be used for extraction of phenolic compounds may be used. It is obvious that it is possible.

In addition, the present invention provides a gene for ferulic acid production, in which the gene encoding TAL, described by SEQ ID NO: 9, the gene encoding C3H, described by SEQ ID NO: 10, and the gene encoding COMT, described by SEQ ID NO: 11, are linked. Provide a construct.

In addition, the present invention provides an expression vector comprising the gene construct.

The present invention also provides a transformant prepared by transforming a host cell with the expression vector.

In a specific embodiment of the present invention, the gene encoding TAL, which is set forth in SEQ ID NO: 9; E. coli was transformed and cultured with an expression vector (see FIG. 7) containing a gene encoding C3H, which is set forth in SEQ ID NO: 10, and a COMT encoding gene, which was set forth in SEQ ID NO: 11, linked thereto, to induce protein expression. After further incubation, the ferulic acid was successfully biosynthesized using HPLC (see FIG. 5). In addition, as a small amount of ferulic acid is detected in E. coli, which does not induce expression by IPTG, there is no protein expression vector or T7 inhibitor other than the pET vector. Even in host cells, ferulic acid can be produced if traces of enzymes are present. Thus, the gene construct of the present invention, the expression vector and the transformant comprising the same can be usefully used for the biosynthesis of ferulic acid.

That is, the gene construct may be operably linked to a skeletal vector, wherein the skeletal vector is from the group consisting of pET-28a (+), pT7, pET / Rb, pGEX, pET28a, pET-22b (+) and pGEX. Various vectors capable of transforming E. coli to be selected may be used, but are not limited thereto. In particular, a system without T7 promoter regulation by IPTG may be used.

The host cell may be 1) biosynthesis of L-tyrosine, and can be used as long as it can not produce 4-coumarin acid, caffeic acid and ferulic acid, preferably Escherichia coli that can biosynthesize L-tyrosine in large quantities May be used, but is not limited thereto. Or 2) L-tyrosine as a precursor to the host cell, and can be produced as long as it can produce 4-coumarin acid, and can not produce caffeic acid and ferulic acid, but preferably L-tyrosine as a precursor E. coli can be used to mass-produce 4-coumarin acid, but is not limited thereto. Or 3) L-phenylalanine as a precursor, cinnamic acid as an intermediate, and 4-coumarin acid can be biosynthesized, and any host cell can be used if the host cell cannot produce caffeic acid and ferulic acid. However, Escherichia coli, which can preferably produce 4-coumarin acid using L-phenylalanine as a precursor, can be used, but is not limited thereto. Or 4) L-tyrosine as a precursor to the host cell, and can be produced as long as it can produce 4-coumarin acid and caffeic acid, and can not produce ferulic acid, but preferably L-tyrosine as a precursor E. coli can be used to mass-produce 4-coumarin acid, but is not limited thereto. Or 5) L-phenylalanine as a precursor, cinnamic acid as an intermediate, and 4-coumarin acid and caffeic acid can be biosynthesized, and any host cell can be used. However, Escherichia coli, which can preferably produce 4-coumarin acid and caffeic acid by using L-phenylalanine as a precursor, is not limited thereto. In the case of 1), it is possible to biosynthesize 4-coumarin acid and caffeic acid by using L-tyrosine as a precursor using the enzyme expressed in the gene construct of the present invention. In addition, in the case of 2) and 3), it is possible to biosynthesize caffeic acid by using 4-coumarin acid as a precursor by the gene conduit of the present invention. In addition, in the case of 4) and 5), it is possible to biosynthesize ferulic acid using 4-coumarin acid as a precursor and caffeic acid as an intermediate by the gene construct of the present invention.

In addition, the present invention provides a method for producing ferulic acid, comprising: 1) a gene encoding TAL, described by SEQ ID NO: 9, a gene encoding C3H, described by SEQ ID NO: 10, and a gene encoding COMT, described by SEQ ID NO: 11; Preparing an expression vector comprising a gene construct for the drug;

2) transforming the expression vector of step 1) into a host cell;

3) culturing the transformant of step 2);

4) inducing protein expression of the cultured transformant of step 3) and then further culturing; And,

5) It provides a ferulic acid production method comprising the step of obtaining the ferulic acid in the culture of step 4).

In a specific embodiment of the present invention, the gene encoding TAL, which is set forth in SEQ ID NO: 9; E. coli was transformed and cultured with an expression vector (see FIG. 7) containing a gene encoding C3H, which is set forth in SEQ ID NO: 10, and a COMT encoding gene, which was set forth in SEQ ID NO: 11, linked thereto, to induce protein expression. After further culture, the production of ferulic acid was confirmed by identifying peaks with the same UV spectra at the same time period as the ferulic acid standard (see FIG. 8). Thus, the transformant of the present invention can be usefully used for the biosynthesis of ferulic acid.

In step 4), the transformant may be further cultured in LB, YT, 2YT, M9, M9C medium and the like, and preferably cultured in M9C medium.

Obtaining step 5) can be carried out by extraction using an organic solvent and then using HPLC. The organic solvent may be any one selected from the group consisting of ethyl acetate, acetone and chloroform, but is not limited thereto, and any organic solvent known to those skilled in the art to be used for extraction of phenolic compounds may be used. It is obvious that it is possible.

4-Coumaric acid, caffeic acid and ferulic acid produced by the method of the present invention can be used as carcinogens, melanogenesis inhibitors and antioxidants.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the present invention, but not to limit the content of the present invention.

Genetic engineering of the final biosynthesis of ferulic acid with L-tyrosine as a precursor and 4-Coumaric acid and caffeic acid as intermediates It was intended to build artificially in E. coli by the technique (Fig. 1).

Specifically, 1) sam8 encoding Tyrosine ammonia lyase (hereinafter, TAL), an enzyme that converts L-tyrosine to 4-coumarin acid, was obtained from Actinomycetes Saccharothrix espanaensis (KCTC9392); 2) Actinomycetes Saccharothrix sam5 encoding 4-coumarin acid 3-hydroxylase (hereinafter referred to as C3H), an enzyme that converts 4-coumarin acid to caffeic acid. obtained from espanaensis (KCTC9392); 3) cafe acid O- methyl transferase (Caffeic acid O-methyltransferase, an enzyme for converting the cafe acid to ferulic acid; to give the com encrypting or less, COMT) from Arabidopsis thaliana.

< Example  1> tyrosine ammonia Lyase  gene sam8 Cloning  And check functionality

Tyrosine ammonia lyase acts to produce 4-coumarin acid by removing the amino group of tyrosine.

<1-1> sam8 Cloning

Using the chromosome of Saccharothrix espanaensis (KCTC9392) as a template, the gene sam8 (1,533 bp) of the TAL was obtained by PCR using the TAL-N and TAL-C primers shown in Table 1.

<1-1-1> mold DNA  purchase

Saccharothrix espanaensis strains were added to actinomycetes medium R2YE medium (103 g sucrose in 1 liter of DDW, K ₂ SO ₄ 0.25 g, MgCl ₂ 6H ₂ O 10.12 g, glucose 10 g, casamino acids 0.1 g, yeast extract 5 g, 20% L-proline 15 ml, 5.73% TES Buffer 100 ml, 10N NaOH 500 μl, 10X Trace element solution 20 10 μl, 0.5 ml KH ₂ PO ₄ , 80 ml 3.68% CaCl ₂ 2H ₂ O) and 30 ml were incubated at 28 ° C. for 2-3 days to recover. The cells were added with 10 ml of TE buffer solution (10 mM Tris-HCL pH 8.0, 1 mM EDTA) containing 10 mg lysozyme and treated at 37 ° C. for 15 minutes. 1 ml of 20% SDS was added to the solution, and the mixture was slowly mixed. Then, 1.5 ml of 5 M NaCl and 10 ml of phenol were added thereto, and the mixture was slowly shaken at room temperature for 20 minutes. After phenol extraction, centrifugation at 3500 rpm for 10 minutes, transfer the supernatant to a new container, add the same amount of chloroform, shake it slowly for 10 minutes, and then put the supernatant into a sterile 50 ml container. After the same amount of isopropanol was added to separate the two layers, the chromosomal DNA formed between the separated layers was recovered by a glass rod. The recovered chromosomal DNA was dissolved in a small amount of TE buffer, and then RNase (20 μg / ml; Invitrogen, USA) was added and reacted at 50 ° C. for 1 hour to obtain purified chromosomal DNA.

<1-1-2> PCR  Product yield

The PCR reaction was obtained by 0.5 µL of DNA polymerase (Ex Taq polymerase, Takara, Japan), 25 µL of TAL-N (SEQ ID NO: 1) and TAL-C (SEQ ID NO: 2) primer pair, obtained by the above method. 0.5 μl template DNA, 2 μl of 2.5 mM dNTP mixture, 2.5 μl of 10X reaction buffer were added to the final 25 μl, and then denatured at 97 ° C. for 5 minutes, 35 seconds at 94 ° C., 35 seconds at 60 ° C. and 72 ° C. The reaction was performed 28 times for 45 seconds at, and extended for 7 minutes at 72 ° C. to terminate the reaction.

<1-1-3> PCR  Sequence analysis of the product

The PCR product was cloned into pCR2.1 TOPO vector (Invitrogen ^™ life technologies, USA) and then transformed into E. coli again. After culturing the E. coli in LB medium to amplify the vector cloned PCR product, and confirmed the nucleotide sequence of the PCR product introduced into the vector, the sequence (SEQ ID NO: 9) is a previously reported sam8 gene ( GeneBank # DQ357071) and the 576th nucleotide G from the starting point was confirmed that the point mutation to C (silent mutation).

<1-1-4> sam8  Gene Cloning

The PCR product was digested with restriction enzymes Bgl II and Hind III, and then inserted into a pET-28a (+) vector (Invitrogen, USA) digested with restriction enzymes BamH I and Hind III to insert a pET-TAL vector (FIG. 2A). After obtaining, the pET-TAL vector was transformed into E. coli.

designation SEQ ID NO: order TAL-N One AGATCT ACGCAGGTCGTGGAACGTCAGGCTG TAL-C 2 AAGCTT GTGTGCTCATCCGAAATCCTTC Sam5-F 3 CATATG ACCATCACGTCACCTGCGCCGG Sam5-R 4 AAGCTT CAGGTGCCGGGGTTGATCAGGTCGG COM-F 5 CATATG GGTTCAACGGCAGAGAC COM-R 6 AAGCTT AGAGCTTCTTGAGTAACT pET-CPac 7 TTAATTAA TGCGCCGCTACAGGGCGCGTCC pET-NPac 8 TTAATTAA TCGCCGCGACAATTTGCGACGG

<1-2> 4- Coumarin acid  Confirm creation

The production of 4-coumarin acid of E. coli transformed with the pET-TAL vector was confirmed.

<1-2-1> 4- Coumarin acid  produce

The E. coli was inoculated in 30 ml of LB medium (50 μg / L Kanamycin) to incubate at OD ₆₀₀ 0.6 at 26 ° C., and protein expression was induced with IPTG 1 mM after 10 minutes cold shock. After further incubation at 26 ° C. for 5 hours, cells were obtained and obtained in 30 ml M9C (modified M9 minimal media; added CaCO ₃ 25 g / l, glucose 40 g / l; 50 μg / l Kan, 1 mM IPTG) medium. Transferred and incubated at 26 ° C. for 36 hours.

<1-2-2> 4- Coumarin acid  extraction

The same amount of ethyl acetate (ethylacetate; JTBaker, USA) was added to the culture solution and shaken for 2 hours. Then, after centrifugation for 10 minutes at 3000 rpm, the supernatant was concentrated under reduced pressure. After dissolving the concentrated extract in methanol (Merck, USA), CH ₃ CN-H ₂ O (JTBaker, USA) using a YMC J'sphere ODS-H80, 150x4.6 mm ID, (YMC, Japan) column HPLC analysis was performed by flowing the mobile phase (0.05% TFA; Sigma-Aldrich, USA) at a gradient of 1 mL / min. At this time, 4-coumarin acid standard was purchased from Sigma (C9008; USA) and analyzed.

As a result, the extract identified peaks with the same UV spectra at the same time period (5.8 minutes) as the 4-coumarin acid standard (FIG. 3).

< Example  2> 4-coumarin acid 3-hydroxylase gene sam5 Cloning  And check functionality

4-coumarin acid 3-hydroxylase acts to produce caffeic acid by attaching a hydroxyl group to the carbon position 3 of the phenol ring in 4-coumarin acid.

<2-1> sam5 Cloning

Using the chromosome of Saccharothrix espanaensis (KCTC9392) as a template, the C3H gene sam5 (1,539 bp) was obtained by PCR using the Sam5-F and Sam5-R primers shown in Table 1.

Specifically, after the PCR reaction using the template DNA obtained in Example 1-1 and Sam5-F (SEQ ID NO: 3) and Sam5-R (SEQ ID NO: 4) primer pair and Example 1-1 , As a result of analyzing the nucleotide sequence thereof, the sequence (SEQ ID NO: 10) was previously reported sam5 The gene was identified as having the same gene (GeneBank # DQ357071).

In addition, the PCR product was digested with restriction enzymes NdeI and HindIII , and then inserted into a pET-28a (+) vector digested with restriction enzymes NdeI and HindIII to obtain a pET-Sam5 vector (FIG. 2B).

<2-2> sam8 And sam5 Cloning

First, using the pET-TAL vector as a template DNA, PCR using the TAL-N and pET-CPac (SEQ ID NO: 7) primer pair in the same manner as in Example 1-1, and restriction enzymes Bgl II and Pac I Treated. Further, using the pET-Sam5 vector as the template DNA, PCR using the pET-NPac (SEQ ID NO: 8) and Sam5-R primer pairs in the same manner as in Example 1-1, and restriction enzymes Pac I and Hind III Treated. The limits to the respective PCR product in which the enzyme treatment with restriction enzymes BamH I and Hind III and connecting the pET-28a (+) vector processing to obtain the sam8 and pET-vector sam5 T5 is connected (Fig. 4). The sam8 and sam5 genes of this vector have a T7 promoter and a terminator, respectively.

<2-3> Cafe Iksan  Confirm creation

The production of caffeic acid of E. coli transformed with the pET-T5 vector was confirmed.

Specifically, the transformed E. coli was cultured in the same manner as in Example 1-2 to induce protein expression, and after further incubation, the cells were recovered to extract caffeic acid, and HPLC analysis was performed. At this time, the caffeic acid standard was purchased from Sigma (C0625; USA) and analyzed.

As a result, the extract confirmed the peak with the same UV spectra at the same time zone (4.2 minutes) as the caffeic acid standard (Fig. 5). In addition, 4-coumarinic acid production was also confirmed by the action of sam8 .

< Example  3> Cafe Iksan  O- Methyltransferase  gene com Cloning  And check functionality

Caffeic acid O-methyltransferase acts to produce ferulic acid by methylation by attaching a hydroxyl group to the carbon position 3 of the phenol ring in the caffeic acid.

<3-1> com Cloning

Arabidopsis Using mRNA of thaliana, the COM com gene (1,092 bp) was obtained by PCR using the COM-F and COM-R primers shown in Table 1.

<3-1-1> mold DNA  purchase

20 Day Pure Cultured Baby Pole ( Arabidopsis thaliana ) The leaves of seedlings were harvested and RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, USA) according to the manufacturer's method. 10 ng of the RNA as a template, the antisense primer of the COMT gene com CDNA was made using the COM-R (SEQ ID NO: 6) primer using the SuperScript ^™ III First-Strand Synthesis System (Invitrogen, USA) following the manufacturer's method.

<3-1-2> com Cloning

Specifically, the PCR reaction was performed using the pair of the COM-F (SEQ ID NO: 5) and COM-R (SEQ ID NO: 6) primers and the template cDNA obtained in Example 3-1 by the method of Example 1-1. , As a result of analyzing the nucleotide sequence thereof, the sequence (SEQ ID NO: 11) has a previously reported com gene (GeneBank # AY062837) and 504 nucleotide T to C, 702 nucleotide C to T, and 837 from the starting point It was confirmed that the first nucleotide G was point mutated to A (silent mutation).

In addition, the PCR product was digested with restriction enzymes Nde I and Hind III and then inserted into a pET-28a (+) vector digested with restriction enzymes Nde I and Hind III to obtain a pET-COM vector (FIG. 2C).

<3-2> Ferulic acid  Confirm creation

The production of E. coli transformed with the pET-COM vector was confirmed.

Specifically, the transformed E. coli was cultured in the same manner as in Example 1-2 to induce protein expression. At this time, caffeic acid was injected at a concentration of 0.01 mg / ml. After further incubation, the cells were harvested to extract ferulic acid and subjected to HPLC analysis. At this time, the ferulic acid standard was purchased from Fluka (46280; USA) and analyzed.

As a result, the extract identified peaks with the same UV spectra at the same time period (6.6 minutes) as the ferulic acid standard (FIG. 6).

< Example  4> sam8 , sam5  And com  Through simultaneous expression of three genes Ferulic acid  production

<4-1> Expression Vector Preparation

A vector was constructed in which three genes, sam8 , sam5 and com , were sequentially linked.

Specifically, a PCR reaction was performed using TAL-N and pET-CPac primer pairs and the pET-TAL vector obtained in Example 1-1 using template DNA by the method of Example 1-1 to obtain a sam8 PCR product. In addition, PCR reaction was performed using pET-NPac and pET-CPac primer pairs and the pET-Sam5 vector obtained in Example 2-1 using template DNA to obtain a sam5 PCR product, and also, pET-NPac and COM PCR reaction was performed using the -R primer pair and the pET-COM vector obtained in Example 3-1 using template DNA to obtain a com PCR product. The sam8 PCR product was digested with restriction enzymes Bgl II and Pac I, the sam5 PCR product was digested with restriction enzymes Pac I, and the com PCR product was digested with restriction enzymes Pac I and Hind III. In addition, the pET-28a (+) vector was digested with restriction enzymes BamH I and Hind III, and then subjected to CIAP (TAKARA, Japan) treatment to increase ligation efficiency. Thereafter, the PCR products of the three genes were linked to the vector and transformed into E. coli. At this time, the cleaved sam8 PCR product was linked to the BamHI position of the cleaved vector, and the cleaved com PCR product was linked to the Hind III position of the vector. In addition, since the cleaved sam5 PCR product was cleaved on both sides with the cleavage enzyme Pac I, it could be linked in the opposite direction to the translation echo during cloning, but the clone finally identified through sequencing (pET-T5M) was identified as the three genes. It was confirmed that the translation in the same direction as the echo (Fig. 7). The sam8, sam5, and com genes of the thus constructed vector each have a T7 promoter and a terminator.

<4-2> Ferulic acid  Confirm creation

The production of caffeic acid of E. coli transformed with the pET-T5M was confirmed.

Specifically, the transformed E. coli was cultured in the same manner as in Example 1-2 to induce or not induce protein expression with IPTG, and after further incubation, the cells were recovered to extract ferulic acid, followed by HPLC analysis. Was performed.

As a result, the extract identified peaks with the same UV spectra at the same time period (6.6 minutes) as the ferulic acid standard (FIG. 8). In addition, small amounts of ferulic acid were detected in E. coli, which did not induce protein expression with IPTG.

1 is a diagram showing a biosynthetic pathway of the phenylpropanoid series (Phenylpropanoid).

2 is a diagram showing a cleavage map of pET-TAL, pET-Sam5 and pET-com vectors.

3 is a diagram showing the results of confirming the production of 4-coumarin acid in E. coli transformed with the pET-TAL vector.

Figure 4 encodes a gene ( sam8 ) and 4-coumarin acid 3-hydroxylase (hereinafter C3H) encoding tyrosine ammonia lyase (hereinafter referred to as TAL) related to caffeic acid biosynthesis Figure shows a cleavage map of the pET-T5 vector containing the gene ( sam5 ).

5 is a diagram showing the results confirming the caffeic acid production in E. coli transformed with the pET-T5 vector.

6 is a diagram showing the results of confirming ferulic acid production in Escherichia coli transformed with a pET-com vector.

7 is a diagram showing a cleavage map of the pET-T5M vector containing a gene ( com ) encoding sam8 , sam5 and Caffeic acid O-methyltransferase (hereinafter, COMT).

8 is a diagram showing the results of confirming ferulic acid production in Escherichia coli transformed with a pET-T5M vector:

Lane 1 (black line): strain which did not induce IPTG protein expression; And,

Lane 2 (blue line): A strain which induced IPTG protein expression.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Genes which are related to 4-Coumaric acid, caffeic acid and          ferulic acid biosynthesis and a method of production using          about <130> 8P-05-72 <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> TAL-N <400> 1 agatctacgc aggtcgtgga acgtcaggct g 31 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> TAL-C <400> 2 aagcttgtgt gctcatccga aatccttc 28 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Sam5-F <400> 3 catatgacca tcacgtcacc tgcgccgg 28 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Sam5-R <400> 4 aagcttcagg tgccggggtt gatcaggtcg g 31 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> COM-F <400> 5 catatgggtt caacggcaga gac 23 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> COM-R <400> 6 aagcttagag cttcttgagt aact 24 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pET-CPac <400> 7 ttaattaatg cgccgctaca gggcgcgtcc 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> pET-NPac <400> 8 ttaattaatc gccgcgacaa tttgcgacgg 30 <210> 9 <211> 1533 <212> DNA <213> Saccharothrix espanaensis <400> 9 atgacgcagg tcgtggaacg tcaggctgat cggctcagca gcagggagta cctggcccgg 60 gtcgtgcgca gcgccgggtg ggacgccggt ctcacctcgt gcaccgacga ggagatcgtc 120 cggatgggcg cgagcgcgcg caccatcgag gagtacctga agtccgacaa gcccatctac 180 ggcctgacgc agggcttcgg tccgctggtg ctgttcgacg ccgactcgga gctggagcag 240 ggcggctcgc tgatctcgca cctgggcacc ggccagggcg cgccactggc cccggaggtg 300 tcgcggctga tcctctggct gcgcatccag aacatgcgca aggggtactc ggcggtctcg 360 ccggtgttct ggcagaagct cgccgacctg tggaacaagg ggttcacccc ggcgatcccc 420 cggcacggca cggtcagcgc gagcggcgac ctgcaaccgc tggcgcacgc cgcgctcgcc 480 ttcaccggtg tcggcgaggc gtggacccgg gacgccgacg gccggtggtc caccgtgccg 540 gccgtggacg cgctcgccgc gctgggggcg gagcccttcg actggccggt gcgcgaggcg 600 ctggcgttcg tcaacgggac cggcgcgagc ctcgcggtgg ctgtgctcaa ccaccggtcc 660 gccctgcggc tggtccgcgc ctgcgccgtg ctctccgcgc ggctggcgac cctgctgggg 720 gccaatcccg agcactacga cgtggggcac ggtgtcgcgc gcggccaggt cggtcagctg 780 accgcggcgg agtggatccg gcaggggctg ccccggggca tggtgcgcga cggcagccgc 840 ccgctccagg agccgtacag cctgcggtgc gcgccgcagg tgctcggcgc ggtgctcgac 900 cagctcgacg gcgcgggcga cgtgctggcg cgggaggtcg acggctgcca ggacaacccg 960 atcacctacg agggcgagct gctgcacggc ggcaacttcc acgccatgcc ggtgggtttc 1020 gcctccgacc agatcgggtt ggccatgcac atggccgcct acctggccga gcgccagctg 1080 ggtctgctgg tcagcccggt gaccaacggc gacctgccgc ccatgctcac cccgcgcgcc 1140 gggcgcggtg ccgggctggc cggggtgcag atcagcgcga cctcgttcgt ctcgcggatc 1200 cggcagctgg tgttccccgc ctcgctgacc accctgccga ccaacggctg gaaccaggac 1260 cacgtgccga tggcgctcaa cggggcgaac tcggtgttcg aggcgttgga gctcggctgg 1320 ctgacggtcg ggtcgctggc ggtgggcgtc gcgcagctcg cggccatgac cggccacgcc 1380 gcggagggcg tctgggcgga gctggccggg atctgcccgc cgctggacgc cgaccgcccg 1440 ctgggcgccg aggtgcgcgc cgcgcgcgac ctgctgtccg cgcacgcgga ccaactgctc 1500 gtcgacgagg cagacgggaa ggatttcgga tga 1533 <210> 10 <211> 1539 <212> DNA <213> Saccharothrix espanaensis <400> 10 atgaccatca cgtcacctgc gccggcgggc cggctcaaca acgtccgccc gatgacgggc 60 gaggagtacc tggaatcact gcgggacggc cgagaggtct acatctacgg cgagcgggtc 120 gacgacgtca ccacgcacct ggccttccgc aacagcgtgc gctccatcgc gcggctctac 180 gacgtgctgc acgacccggc gtccgaaggt gtgctgcggg tgcccaccga caccggcaac 240 ggcgggttca cccacccgtt cttcaagacc gcccggtcgt cggaggacct ggtcgccgcg 300 cgcgaggcca tcgtcggctg gcagcggctg gtgtacgggt ggatgggccg caccccggac 360 tacaaggcgg cgttcttcgg cacgctcgac gccaacgccg agttctacgg gccgttcgag 420 gccaacgccc gccgctggta ccgcgacgcc caggaacggg tgctgtactt caaccacgcg 480 atcgtgcacc cgccggtcga ccgggaccgg cccgccgacc ggaccgccga catctgcgtg 540 cacgtggagg aggagaccga cagcgggttg atcgtctccg gcgccaaggt ggtcgcgacc 600 ggctccgcga tgaccaacgc gaacctcatc gcgcactacg ggcttccggt gcgggacaag 660 aagttcggcc tggtgttcac ggtcccgatg aactcgcccg gcctcaagct catctgccgc 720 acctcctacg agctgatggt cgcgacgcag ggctcgccct tcgactaccc gctgtcgagc 780 cggctcgacg agaacgactc gatcatgatc ttcgaccggg tgctggtgcc ctgggagaac 840 gtgttcatgt acgacgcggg cgcggccaac tccttcgcca ccgggtcagg cttcctcgaa 900 cgcttcacct tccacggctg cacccgcctc gcggtcaagc tggacttcat cgccggctgc 960 gtcatgaagg cggtggaggt caccggcacc acgcacttcc ggggcgtgca ggcgcaggtc 1020 ggcgaagtgc tcaactggcg cgacgtgttc tggggcctgt ccgacgcgat ggccaagtcg 1080 ccgaactcgt gggtcggcgg ctcggtgcag ccgaacctca actacgggct cgcgtaccgc 1140 accttcatgg gcgtgggcta cccgcgcatc aaggagatca tccagcagac cctcggcagc 1200 gggttgatct acctgaactc ctcggccgcc gactggaaga accccgacgt ccgcccgtac 1260 ctcgaccgct acctgcgcgg ctcgcggggc atccaggcga tcgaccgggt caagctgctg 1320 aagctgctgt gggacgcggt cggcaccgag ttcgccggcc ggcacgagct ctacgagcgc 1380 aactacggcg gcgaccacga gggcatccgg gtgcagaccc tgcaggcgta ccaggcgaac 1440 ggccaagccg ccgcgctcaa gggtttcgcc gagcagtgca tgtccgagta cgacctcgac 1500 ggctggacga ggcccgacct gatcaacccc ggcacctga 1539 <210> 11 <211> 1092 <212> DNA <213> Arabidopsis thaliana <400> 11 atgggttcaa cggcagagac acaattaact ccggtgcaag tcaccgacga cgaagctgcc 60 ctcttcgcca tgcaactagc cagtgcttcc gttcttccga tggctttaaa atccgcctta 120 gagcttgacc ttcttgagat tatggccaag aatggttctc ccatgtctcc taccgagatc 180 gcttctaaac ttccgaccaa aaaccctgaa gctccggtca tgctcgaccg tatcctccgt 240 cttcttacgt cttactccgt cttaacctgc tccaaccgta aactttccgg tgatggcgtt 300 gaacggattt acgggcttgg tccggtttgc aagtatttga ccaagaacga agatggtgtt 360 tccattgctg ctctttgtct tatgaaccaa gacaaggttc tcatggaaag ctggtaccat 420 ttgaaggatg caattcttga tggtgggatt ccattcaaca aggcttatgg aatgagcgcg 480 ttcgagtacc acgggactga ccctagattc aacaaggtct ttaacaatgg aatgtctaac 540 cattccacaa tcaccatgaa gaagattctt gagacctata agggttttga aggattgact 600 tctttggttg atgttggtgg tggcattggt gctacactca aaatgattgt ctccaagtac 660 cctaatctta aaggcatcaa ctttgatctc ccacatgtca ttgaagatgc tccttctcat 720 cctggtattg agcatgttgg aggagatatg tttgtaagtg tccctaaagg tgatgccata 780 ttcatgaagt ggatatgtca tgactggagt gacgaacatt gcgtgaaatt cttgaaaaac 840 tgctacgagt cacttccaga ggatggaaaa gtgatattag cagagtgtat acttccagag 900 acaccagact caagcctctc aaccaaacaa gtagtccatg tcgattgcat tatgttggct 960 cacaatcccg gaggcaaaga acgaaccgag aaagagtttg aggcattagc caaagcatca 1020 ggcttcaagg gcatcaaagt tgtctgcgac gcttttggtg ttaaccttat tgagttactc 1080 aagaagctct aa 1092  

Claims (21)

A gene encoding Tyrosine ammonia lyase (hereinafter referred to as TAL), and 4-coumarate 3-hydroxylase (hereinafter referred to as C3H), described as SEQ ID NO: 10; Gene construct for 4-coumarin acid and caffeic acid linked genes encoding Expression vector for producing 4-coumarin acid and caffeic acid comprising the gene construct of claim 1. A transformant for producing 4-coumarin acid and caffeic acid prepared by transforming a host cell with the expression vector of claim 2. 4. The transformant for producing 4-coumarin acid and caffeic acid according to claim 3, wherein the host cell can biosynthesize L-tyrosine and cannot produce 4-coumarin acid and caffeic acid. 4. The transformant for production of 4-coumarin acid and caffeic acid according to claim 3, wherein the host cell uses L-tyrosine as a precursor and can produce 4-coumarin acid, and cannot produce caffeic acid. 4. The host cell according to claim 3, wherein the host cell has L-phenylalanine as a precursor and cinnamic acid as an intermediate to biosynthesize 4-coumarin acid, and cannot produce caffeic acid. Transformants for the production of coumarin acid and caffeic acid. 1) preparing the expression vector of claim 2; 2) transforming the expression vector of step 1) into a host cell; 3) culturing the transformant of step 2); 4) inducing protein expression of the cultured transformant of step 3) and then further culturing; And, 5) 4-coumarin acid and caffeic acid production method comprising the step of obtaining 4-coumarin acid and caffeic acid in the culture of step 4). The method of claim 7, wherein in step 4) the transformant is further cultured in M9C medium (modified M9 minimal media; added CaCO ₃ 25 g / L, glucose 40 g / L; 50 μg / L Kan, 1 mM IPTG) 4-coumarin acid and caffeic acid production method characterized by.  1) preparing an expression vector comprising a gene encoding Caffeic acid O-methyltransferase (hereinafter, COMT); 2) transforming the expression vector of step 1) into a host cell; 3) culturing the transformant of step 2); 4) inducing protein expression of the cultured transformant of step 3) and then further culturing in a medium comprising caffeic acid; And, 5) Ferulic acid production method comprising the step of obtaining the ferulic acid in the culture of step 4). 10. The method of claim 9, wherein the host cell of step 2) is unable to produce ferulic acid. 10. The method of claim 9, wherein in step 4), the transformant is cultured in M9C medium containing caffeic acid. A gene construct for ferulic acid production, wherein a gene encoding TAL, set forth in SEQ ID NO: 9, a gene encoding C3H, described in SEQ ID NO: 10, and a gene encoding COMT, described in SEQ ID NO: 11, are linked. An expression vector for producing ferulic acid comprising the gene construct of claim 12. A transformant for producing ferulic acid produced by transforming a host cell with the expression vector of claim 13. 15. The transformant for ferulic acid production according to claim 14, wherein the host cell is capable of biosynthesizing L-tyrosine and is unable to produce 4-coumarin acid, caffeic acid and ferulic acid. 15. The transformant for ferulic acid production according to claim 14, wherein the host cell uses L-tyrosine as a precursor, can produce 4-coumarin acid, and cannot produce caffeic acid and ferulic acid. 15. The host cell according to claim 14, wherein L-phenylalanine is used as a precursor and cinnamic acid is used as an intermediate to biosynthesize 4-coumarin acid, and caffeic acid and ferulic acid cannot be produced. Transformant for producing ferulic acid. 15. The transformant for producing ferulic acid according to claim 14, wherein the host cell uses L-tyrosine as a precursor, can produce 4-coumarin acid and caffeic acid, and cannot produce ferulic acid. 15. The host cell according to claim 14, wherein the host cell has L-phenylalanine as a precursor and cinnamic acid as an intermediate to biosynthesize 4-coumarin acid and caffeic acid, and cannot produce ferulic acid. Transformant for producing ferulic acid. 1) preparing the expression vector of claim 13; 2) transforming the expression vector of step 1) into a host cell; 3) culturing the transformant of step 2); 4) inducing protein expression of the cultured transformant of step 3) and then further culturing; And, 5) Ferulic acid production method comprising the step of obtaining the ferulic acid in the culture of step 4). The method of claim 20, wherein the transformant in step 4) is further cultured in M9C medium.

Images