KR20090127500A - Marker for selecting brown planthopper-resistant rice cultivar - Google Patents

Abstract

PURPOSE: A marker for screening brown plant hopper-resistance rice plant is provided to simply and stably select individual or species having brown plant hopper resistance. CONSTITUTION: A marker for screening brown plant hopper-resistance rice plant comprises a primer set containing an oligonucleotide of 15 or more serial nucleotides in sequence number 1 and an oligonucleotide of 15 or more serial nucleotides in sequence number 2. A method for screening rice plant species having brown plant hopper resistance comprises: a step of isolating genome DNA from rice plant sample; a step of amplifying target sequence using primer set of sequence numbers 1 and 2; and a step of detecting PCR product.

Description

Marker for selecting brown planthopper-resistant rice cultivar

The present invention relates to a marker for selecting a rice plant resistant rice variety, a method for selecting a rice plant resistant rice variety using the marker, and a kit for selecting a rice plant resistant rice variety comprising the marker.

Rice ( Oryza sativa L) is the main food source for the world's population. Significant decreases in annual rice yield are caused by insect infestations, and brown planthopper (BPH) is the most destructive pest to rice crops in Asia. BPH often results in severe losses of up to 60% of rice yield in susceptible varieties.

Current control is mainly used for chemical control, but the use of resistant varieties to cultivate a number of resistant varieties to reduce the damage. However, when developing resistant varieties, it is not easy to select a line or an individual that has a resistance gene.

On the other hand, with recent advances in molecular biology, high density molecular genetic maps using DNA markers have been prepared, enabling the selection of certain traits of plants with DNA markers (gene tagging). At this time, DNA fingerprinting using polymorphism of specific DNA structures of living organisms is used. This method is hardly influenced by the environment, and the variation rate of DNA is about 1/109 a year, which makes it very stable. Can be used to determine genotype. Among them, PCR (Polymerase Chain Reaction) method synthesizes a small nucleic acid fragment (hereinafter referred to as a primer) consisting of 10-20 nucleotides with a nucleic acid of an organism and then adds a heat-resistant DNA DNA polymerase. It is a way to make the reaction repeated. This requires only a small amount of DNA (1-50ng) compared to other methods and has the advantage of being able to confirm the result easily and quickly.

Resistant varieties are the most economical and effective way to fight BPH pests. Therefore, breeding of insect resistant rice varieties is a top priority in crop improvement programs. To date, a number of major BPH resistance genes have been identified in indica rice and wild rice varieties.

Indica rice cultivars have a relatively higher level of BPH resistance than Japonica cultivars, and among 19 reported resistance genes, 11 have been identified in Indica cultivars (Zhang Q (2007) Proc Natl Acad Sci USA 104: 16402-16409). Bph1, the first dominant resistance locus identified from Mudgo , an indica BPH resistant strain, was mapped onto the long arm of chromosome 12 (Kim SM, Sohn JK (2005) Mol Cells 20: 30-34).

Many genes involved in having BPH resistance have been identified in rice using a variety of molecular methods such as cDNA arrays, suppression subtractive hybridization (SSH), and representational difference analysis (RDA) (Ren et al. (2004) Plant Breeding 123: 342-348). The gene belongs to several functional groups such as signaling pathways, oxidative stress / apoptosis, wound response and pathogen related proteins. We have previously developed an efficient RDA method for detecting transcripts exclusively expressed in SNBC61 , a BPH-resistant NIL (near isogenic line) derived from the backcrossing of Samgang rice with Bph1 and Nakdong rice , a BPH sensitive line (Park et al. (2007) Theor Appl Genet 115: 537-547. The isolated gene appears to be upregulated in the resistance line and is located close to the known quantitative trait loci (QTL) for BPH resistance.

The present invention has been made in accordance with the above-described demands, and the expression level of an isolated RDA clone using a modified RDA method capable of detecting rare transcripts differentially expressed in the resistant NIL (near isogenic line) SNBC61 . Was analyzed by RT-PCT and the chromosomal location of the RDA clone was compared with Bph1 , a major BPH resistance gene. Interestingly, one of the RDA clones encoding hypothetical lipoxygenase was mapped close to the Bph1 locus, and furthermore, the cleaved amplified polymorphic sequence (CAPS) analysis completed the present invention by demonstrating that Bph1 markers are co-separated with resistance. .

In order to solve the above problems, the present invention provides a marker for selecting a rice plant resistant rice varieties that can easily and simply and stably select individuals or lines having a rice plant resistance gene.

The present invention also provides a method for selecting rice cultivars resistant rice varieties using the marker.

The present invention also provides a kit for selecting a rice plant resistant rice variety comprising the marker.

Using the marker of the present invention, it is possible to easily and conveniently and stably select an individual or lineage having a ricehopper resistance gene. In addition, the molecular marker may be useful for rice breeding that improves BPH resistance through marker-assisted selection (MAS).

In order to achieve the object of the present invention, the present invention provides a marker for selecting a rice plant resistant rice varieties that can easily and easily and stably select individuals or lines having a rice plant resistance gene. The marker comprises at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. 1 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO. It may be composed of a primer set comprising one or more oligonucleotides selected from the group consisting of.

The marker is preferably in the sequence of SEQ ID NO: 2 and at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of segments of at least 16, 17 or more, 18 or more consecutive nucleotides in the sequence of SEQ ID NO: 1 It may be a primer set comprising at least one oligonucleotide selected from the group consisting of oligonucleotides consisting of at least 16, at least 17, at least 18 consecutive nucleotide segments.

The marker may most preferably consist of a primer set of SEQ ID NO: 1 and SEQ ID NO: 2.

In the present invention, "primer" refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product. The length and sequence of the primers should allow to start the synthesis of extension products. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.

In the present invention, oligonucleotides used as primers may also comprise nucleotide analogues such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

In order to achieve another object of the present invention, the present invention

Separating genomic DNA from the rice sample;

Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using primer sets of SEQ ID NOs: 1 and 2; And

It provides a method for screening rice plant resistant rice varieties comprising the step of detecting the amplification products.

The method includes separating genomic DNA from a rice sample. As a method for separating genomic DNA from the sample, a method known in the art may be used, for example, a wizard prep kit (Promega) may be used. Using the isolated genomic DNA as a template, amplification reactions can be amplified using a primer set of SEQ ID NOs: 1 and 2 according to an embodiment of the present invention as a primer. Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Qβ replication or for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers specifically binding to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radiation. Preferably, the labeling substance is Cy-5 or Cy-3. When amplifying the target sequence, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer to allow the target sequence to be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as ³² P or ³⁵ S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. One or more sets of oligonucleotide primers used to amplify the target sequence are as described above.

The method of the present invention includes detecting the amplification product. The detection of the amplification product can be carried out by cleaving the amplification product with restriction enzymes and then gel electrophoresis of the cleavage product. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. The restriction enzyme may be SphI.

In order to achieve another object of the present invention, the present invention

Primer sets of SEQ ID NOs: 1 and 2; Restriction enzymes; And it provides a kit for screening rice plant resistant rice varieties, including a reagent for performing the amplification reaction.

In the kit, the restriction enzyme is SphI and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, and a buffer. Since the primer set of the present invention is a CAPS marker, it requires restriction enzymes in addition to the primer set and reagents for carrying out the amplification reaction. That is, the CAPS markers must be cleaved with the corresponding restriction enzymes after the amplification reaction to distinguish the amplification products. In addition, the kit of the present invention may further include a user manual describing the conditions for performing the optimal reaction.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example

Materials and methods

Plant material

64 SNBC NILs derived from five backcrosses between Nakdong rice as the donor of Bph1 locus and Nakdong rice as the recurrent parental line were used (Park et al. (2007) Theor Appl Genet 115: 537-547) . Among these, SNBC61 was mainly used for RDA experiments because it maintained a high level of resistance to BPH biotype 1 in all bioanalyses for RDA experiments (Lee et al. (2005) Korean J Breed 37: 295-299).

RDA  Experiment

SNBC61 after exposure to BPH insects And difference products from previous RDA experiments using total RNA extracted from Nakdong rice were used as testers. As a driver, all eight OsBphi ( O ryza ) identified from the above experiment s ativa BPH - i nducible ) clone was used (FIG. 1). The modified 'double-RDA' experiment was performed according to the procedure described previously (Park et al. (2007) Theor Appl Genet 115: 537-547).

DNA  Sequence analysis

Differentially expressed products were purified using QIAEX II kit (Qiagen, Valencia, Calif.) And subcloned using TOPO TA Cloning Kit (Invitrogen, Carlsbad, Calif.) For sequencing. RDA sequences were deposited in the NCBI database (http://www.ncbi.nlm.nih.gov). Sequence similarity of OsBphi clones was analyzed by performing BLASTN searches using RDA sequences as queries against genome sequences (Yu et al. (2002) Science 296: 79-92; International Rice Genome Sequencing Project 2005). The locus and full length cDNA for OsBphi clones were identified by BLASTN search against TIGR (http://tigrblast.tigr.org/euk-blast/index.cgi?project=osa1) and NCBI database. The hypothetical function of the OsBphi gene was predicted by performing a BLASTP search using its derived amino acid sequence.

Osbphi  Chromosome Location of Genes

OsBphi gene was located on rice chromosome by performing BLASTN search using RDA sequence against GRAMENE database (http://www.gramene.org). Sequence information for relevant markers was obtained from the NCBI and GRAMENE databases.

DNA  Gel Blot  analysis

Nakdong Rice, Samgang Rice, and SNBC61 Approximately 3 [mu] g of genomic DNA derived was digested with Eco RI or Hin dIII, followed by hybridization experiments. Hybridization was performed using [α- ³² P] dCTP-labeled OsBphi RDA-specific probes according to standard procedures under high stringency conditions (Yi et al. (2004) Theor Appl Genet 109: 978-985). . Hybridization signals were recorded using phosphorimager (Typhoon, Amersham Biosciences).

Semiquantitative RT - PCR  analysis

First strand cDNA for semiquantitative RT-PCR analysis was prepared according to the procedure described previously (Cho et al. (2006) Planta 224: 598-611). Total RNA was isolated from the well-developed third or fourth leaf stems of Nakdong rice and SNBC61 for a period of 2-8 days after BPH feeding. PCR products for each OsBphi gene were amplified using gene specific primers (Table 1).

Table 1. Primers used for RT-PCR analysis

Clone Forward primer (5 '→ 3') Reverse primer (5 '→ 3') OsBphi237 CAGAGAACTATTTTTGCGTCTGTGC (SEQ ID NO: 3) ACTGCAAGCGGGCACATCAG (SEQ ID NO: 4) OsBphi252 ATCTCCGCGATACTCATCATCCTC (SEQ ID NO: 5) GTGCTACTAGACACGTTCCCATCG (SEQ ID NO: 6) OsBphi262 GGAGACAAATCAACCGAATACT (SEQ ID NO: 7) GTTGTCCTCCATCATGTGAC (SEQ ID NO: 8) Ubiquitin5 GACTACAACATCCAGAAGGAGTC (SEQ ID NO: 9) TCATCTAATAACCAGTTCGATTTC (SEQ ID NO: 10)

Ubiquitin5 ( Ubi5 ) gene was used as an internal standard for gene expression profiling (Kim et al. (2003) Plant Mol Biol 50: 1203-1213). PCR reactions were performed as previously described (Park et al. (2007) Theor Appl Genet 115: 537-547). PCR cycle numbers are as follows: OsBphi237 (28 cycles); OsBphi252 (29 cycles); OsBphi262 (30 cycles). The experiment was repeated three more times.

NIL Phenotypic Analysis of

To measure the BPH resistance of 64 SNBC NILs, three-week old seedlings were invaded with BPH Biotype 1 as previously described (Park et al. (2007) Theor Appl Genet 115: 537-547). The second or third larvae of the insects were maintained in cages at a density of approximately 10 insects per seedling over two days during the feeding experiment.

CAPS  analysis

Rice genomic DNA was isolated from young leaves by a simple miniprep method (Chen DH, Ronald PC (1999) Plant Mol Biol Rep 17: 53-57). 30 μl volume (100 pM of each primer, 200 μM of each dNTPs, 10 mM Tris-HCl pH 9.0, 2 mM MgCl ₂ , 50 mM KCl, 0.1% Triton) using 50 ng genomic DNA as a template for CAPS analysis X-100 and 0.5 U Taq polymerase). Sph I cleaved PCR products were then sized on 1.5% agarose gels. PCR primers were used for the analysis of OsBphi252 CAPS markers: 5'-CCGTCAGGGTGCTACTAGA-3 '(SEQ ID NO: 1) and 5'-GATACCCATCTCCATCACG-3' (SEQ ID NO: 2).

Example  One: BPH  Identification of Reactive Genes

We previously used BPH-supplied SNBC61 as a tester And Eight OsBphi genes specifically upregulated in resistant NIL SNBC61 were isolated by RDA using cDNA of Nakdong rice as a driver (Park et al. (2007) Theor Appl Genet 115: 537-547). Here, we attempted to isolate additional rare transcripts from BPH reactive genes using a modified 'double-RDA' method. The total final difference product from the previous RDA was reused as a tester and all isolated OsBphi clones were used as drivers (FIG. 1). We isolated a total of 78 RDA clones, which were then analyzed by DNA sequencing. Except for five clones, the RDA was identical to three unique genes whose sequence was registered in the GenBank database with the following registration number: for OsBphi237 About EU513006, OsBphi252 EU513010 for EU513009 and OsBphi262 . The remaining five clones were identical to one of the previously identified OsBphi clones (Park et al. (2007) Theor Appl Genet 115: 537-547).

Example  2: Osbphi  Sequence similarity analysis of genes

Using the BLAST search using the RDA sequence as a query against the TIGR and NCBI databases, the locus, full length cDNA and hypothetical function of the two OsBphi genes OsBphi252 and OsBphi262 were identified (Table 2).

Table 2. Sequence similarity and hypothetical function of OsBphi gene

gene TIGR locus Full length cDNA sameness E value Virtual function OsBphi237 - - - - - OsBphi252 Os12g37260 AJ270938 98% 1e-99 Lipoxygenase OsBphi262 Os05g33400 AK070554 97% 1e-124 Unknown

OsBphi237 did not match any known DNA sequences from rice or other organisms (Table 2), suggesting that the RDA sequences are unique to the BPH resistant SNBC61 and Samkang rice genomes. The assay is OsBphi252 and OsBphi262 Was located on chromosomes 12 and 5, respectively. The two OsBphi clones showed significant homology with known full length cDNAs. OsBphi252 appears to encode a protein similar to the rice chemically induced cDNA1 ( RCI- 1 ) rice chloroplast lipoxygenase gene (Schaffrath et al. (2000) Eur J Biochem 267: 5935-5942). OsBphi262 encoded a protein with unknown function. In contrast, the OsBphi237 RDA sequence did not show any similarity to known proteins.

Example  3: Osbphi  Chromosome Location of Genes

In order to determine the exact chromosomal location for the OsBphi252 and OsBphi262 genes, the OsBphi sequences were selected from Indica 93-11 (Yu et al. (2002) Science 296: 79-92) and Japonica. Nippon Barre ( japonica Nipponbare ) It was aligned with the rice genome sequence of (International Rice Genome Sequencing Project 2005). The analysis showed that the sequences of OsBphi252 and OsBphi262 It showed high sequence similarity with that of the Indica variant and lower similarity with that of the Japonica variant (Table 3).

Table 3. Sequence similarity between the OsBphi gene and the Indica and Japonica rice genomes

gene Indica Japonica Accession E value chromosome Accession E value chromosome OsBphi237 - - - - - - OsBphi252 AAAA02034988 6e-102 12 NC_008405.1 1e-98 12 OsBphi262 AAAA02017145 5e-134 5 NC_008398.1 7e-122 5

This is consistent with the fact that indica rice varieties exhibit a relatively higher level of BPH resistance than japonica species. The results also suggest the possibility that a separate OsBphi genetic origin BPH resistant donor parents of indica varieties of samgangbyeo SNBC61.

The chromosomal location of the OsBphi gene was determined and compared with the previously identified location of the introgressed SSR marker of the resistant donor parental cerebellar rice in NIL SNBC61 (Park et al. (2007) Theor Appl Genet 115: 537-547 ). OsBphi252 and OsBphi262 were found to be located close to the transgenic SSR marker or previously reported OsBphi gene (FIG. 2), which supports the efficiency of our RDA method. OsBphi262 is a transgenic SSR marker on chromosome 5, RM163 and RM459 and previously reported OsBphi66 Mapped nearby. OsBphi252 appears to be located close to four transgenic SSR markers including RM28493 on chromosome 12. Interestingly, we found that OsBphi252 is located close to Bph1 , the major BPH resistance locus.

Example  4: Osbphi  Molecular Identification of Genomic Regions

The genome structure of the OsBphi gene was investigated in Samgang rice, a BPH resistant donor, Nakdong rice, a BPH-sensitive strain, and NIL SNBC61 . Genomic DNA gel-blot experiments showed that all OsBphi in SNBC61 The genome region of the gene was the same as that of Samgang rice, but different from that of Nakdong rice, a BPH sensitive strain (FIG. 3). OsBphi237 Showed the same dominant hybridization band as the BPH resistant genomes of SNBC61 and Samgangbap. The other two genes, OsBphi252 And OsBphi262 Is resistant ( SNBC61 And polymorphic bands between samgang rice) and susceptible (nakdong rice) varieties, while the two resistant lines were monomorphic. The results suggest that the OsBphi genomic region in SNBC61 corresponds to the allele of Samgang rice, a resistant parental line.

Example  5: BPH  In response to an invasion Osbphi  Gene expression analysis

The expression of OsBphi gene was examined in resistant SNBC61 and susceptible Nakdong rice varieties during BPH challenge (FIG. 4). RT-PCR Experiment with OsBphi237 Expression was upregulated in BPH resistant SNBC61 line. In contrast, OsBphi237 transcript was not detected in susceptible Nakdong rice, consistent with the results showing that gene specific probes do not show hybridization bands in DNA gel-blot analysis (FIG. 3A). OsBphi252 appears to be very upregulated on day 1 after BPH feeding and maintained high expression during BPH feeding in SNBC61 (FIG. 4). In contrast, in Nakdong rice, OsBphi252 expression decreased after reaching maximum levels 1 to 2 days after BPH feeding. Also, OsBphi262 Gene expression was very upregulated in SNBC61 but weakly upregulated in Nakdong rice.

Example  6: SNBC NIL of CAPS  analysis

The chromosomal location of OsBphi252 near the known Bph1 locus allowed us to investigate whether the OsBphi gene is associated with major BPH resistance genes. 64 BC ₅ F ₅ from Samgang and Nakdong Rice Backcrossed pure SNBC was analyzed. The resistant phenotype of all NILs was first determined during BPH invasion. As a result, SNBC NIL was classified as 33 resistant and 31 sensitive lines (FIG. 5). OsBphi252 can be used efficiently in large population analysis CAPS markers for were developed by PCR using gene specific primers. Sequence analysis of PCR products derived from Samgang rice and Nakdong rice showed variations in the sequences comprising the Sph I restriction sites between the two varieties (data not shown). The Sph I-cleaved PCR product then showed a single 323 bp length band in resistant strains and two bands 111 and 212 bp in susceptible strains (FIG. 5). OsBphi252 All genotypes for the locus were then determined on the SNBC line using CAPS markers. The results showed that all 33 resistant NILs produced the Samkang rice allele of OsBphi252, and all susceptible lines produced the Nakdong rice allele. Of the 33 resistive lines, four exhibited both resistive and susceptible alleles: SNBC17 , 21 , 54 and 64 (FIG. 5). This strongly suggests that OsBphi252 is closely associated with Bph1 resistance genes.

1 shows a schematic of a 'double-RDA' experiment based on a two step RDA procedure. Difference product and all isolated OsBphi clones from the first RDA were used as testers and drivers respectively in the second RDA.

2 shows the chromosomal location of the isolated OsBphi gene (underlined italic). The previously isolated OsBphi gene (Park et al. (2007) Theor Appl Genet 115: 537-547) is shown in italics. The RM markers represent the transgenic SSR markers of the resistant donor parental Samgang rice in NIL SNBC61 with a Nakdong rice background. Bph1 locus (shown as filled boxes) is described by Huang et al. (1997) Mol Breed 3: 105-113 and Sharma et al. (2003) from Euphytica 129: 109-117.

FIG. 3 shows genomic DNA gel-blot analysis of Samkangp rice (S), Nakdong rice (N) and SNBC61 (61). DNA digested with Eco RI or Hin dIII was hybridized with OsBphi -specific probes: ( a ) OsBphi237 , ( b ) OsBphi252 , and ( c ) OsBphi262

4 is a semiquantitative RT-PCR analysis of the OsBphi gene in resistant SNBC61 and susceptible Nakdong rice during BPH feeding. Total RNA was extracted from rice seedlings after different BPH feed times. Lane 1 (control); Lane 2 (2 hours) after BPH feed; Lane 3 (day 1); Lane 4 (2 days); Lane 5 (4 days); Lane 6 (8 days). Primers for the rice Ubi5 gene were used as internal controls.

Figure 5 Samkangbyeo using OsBphi252 CAPS marker primer (S) And Nakdong Rice CAPS analysis of 64 backcrossed lines derived from crosses between (N). All PCR products were cut with Sph I. Resistant alleles represent a single band (323 bp length) and susceptible alleles represent two bands (111 and 212 bp). Phenotypes for each NIL are expressed as resistance (R) and sensitivity (S). M, DNA ladder

<110> University-Industry Cooperation Group of Kyung Hee University <120> Marker for selecting brown planthopper-resistant rice cultivar <130> PN08095 <160> 10 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CAPS marker <400> 1 ccgtcagggt gctactaga 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CAPS marker <400> 2 gatacccatc tccatcacg 19 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 cagagaacta tttttgcgtc tgtgc 25 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 actgcaagcg ggcacatcag 20 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 atctccgcga tactcatcat cctc 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 6 gtgctactag acacgttccc atcg 24 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 7 ggagacaaat caaccgaata ct 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 8 gttgtcctcc atcatgtgac 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 gactacaaca tccagaagga gtc 23 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 10 tcatctaata accagttcga tttc 24  

Claims (7)

At least one oligonucleotide selected from the group consisting of fragments of at least 15 contiguous nucleotides in the sequence of SEQ ID NO: 1 and oligonucleotides consisting of fragments of at least 15 contiguous nucleotides A marker for selecting a rice plant resistant rice variety, comprising a set of primers comprising at least one oligonucleotide selected from the group. The marker according to claim 1, which is composed of primer sets of SEQ ID NOs: 1 and 2. Separating genomic DNA from the rice sample; Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using primer sets of SEQ ID NOs: 1 and 2; And And detecting the amplified product. The method of claim 3, wherein the amplified target sequence is labeled with a substance that emits fluorescence, phosphorescence, or radioactivity. The method of claim 3, wherein the detection of the amplification product is performed by cleaving the amplification product with restriction enzymes and then gel electrophoresis of the cleavage product. Primer sets of SEQ ID NOs: 1 and 2; Restriction enzymes; And a kit for selecting a rice plant resistant rice variety comprising a reagent for performing an amplification reaction. The kit of claim 6, wherein the restriction enzyme is SphI and the reagent for conducting the amplification reaction comprises DNA polymerase, dNTPs, and a buffer.

Images