KR20090112492A - The bidirectional promoter using Sweet potato leaf curl virus Korean isolate - Google Patents

Abstract

PURPOSE: A bidirectional promoter of sweet potato leaf curl infection DNA virus is provided to produce vector product in molecular biology field and molecular breeding industry. CONSTITUTION: A bidirectional promoter of sweet potato leaf curl infection DNA virus is denoted by the sequence of the sequence number 1. A method for identifying the promoter activity comprises: a step of isolating a site with promoter activity and analyzing cis-acting regulation site; a step of recombining promoter site by using gateway cloning to a plant expression vector for promoter analysis; a step of transforming the recombined promoter site to Agrobacteria tumefaciens strain GV3101; and a step of screening transformant.

Description

Bidirectional promoter using sweet potato leaf curl virus Korean isolate}

The present invention relates to a promoter isolated from an intergenic region of sweet potato leaf curl virus (SPLCV), which is a gemini virus isolated for the first time in Korea. .

Crop molecular breeding is the key to lead the next generation of agriculture in that it is possible to use all kinds of genes as a material and to fine-tune the effects of infinite breeding by pulling down the breeding technology that was possible only in the existing genome. Technology.

In order to maximize the effect of the technology, such crop molecular breeding must be preceded by accumulation of a large amount of genetic data that can represent genes of various plants, a transformation system of various crops must be established, and expression of genes inserted from outside The development of various promoters that can control this should be preceded.

Geminiviruses, which cause leaf swelling in sweet potatoes, belong to the Geminiviridae, which is divided into four genus, of which begomovirus, subgroup III. Whitefly [ Bemisia tabaci (Gennadius)]. Thus, reports on Geminiviruses are often made in tropical or subtropical climates where Garui is suitable. In Asia, geminiviruses were reported in tomato growing regions in China in the 1960s, but they were limited in some regions and the damage was minimal. However, there has been a surge of reports in recent decades that floury is observed in most tomato growing regions of major Asian countries, followed by the testing of geminiviruses.

Begomoviruses reported in Asia, including China, Taiwan, Japan, and India, include Tomato leaf curl virus (ToLCV), Tomato yellow leaf curl virus (TYLCV), Tobacco leaf curl virus (TbLCV), and Honeysuckle yellow vein mosaic virus (HYVMV). The back is dominant. They are generally classified as very specific viruses because they have only one genome, unlike other begomoviruses with two dogs. In addition, it has a common feature of requiring satellite DNA to complete replication. According to the literature and reports to date, one genome has been distributed in the old continent including Africa and Asia, and two genomes have been distributed in the new continent. This phenomenon appears to be interpreted as evolving from a virus with one genome to a virus with two genomes.

Gemini virus found in Korea is also likely to be a begomovirus with one genome. However, since the possibility of other viruses cannot be excluded, PCR was carried out by preparing primers with affinity for various kinds of begomovirus. As a result, Gemini virus isolated from Korea has a relatively high core region of CP. Although it was maintained as, the sequence was found to be many variations occur. Because of this variation, there are many difficulties in obtaining and analyzing the entire nucleotide sequence.

Gemini virus similar to TLCV has been identified in domestic crop cultivation environment, which has not been reported by Gemini virus or reported cases so far, and it is possible to introduce Gemini virus that can seriously damage domestic cultivation environment through various mutations. Or implies a change to an already introduced environment. In addition, the current distribution of the Gemini virus is still in the early stage of the introduction of the Gemini Virus due to the low level of separation of the Gemini Virus, and it may not be established in Korea any time soon due to the change in their recombination rate and infectivity. Since the damage caused by the Gemini virus is considered to continue, it is urgent to prepare countermeasures against these viruses through rapid identification and research.

Therefore, the present inventors have conducted research to develop a vector system for plant transformation as a field capable of detecting SPLCV, using unique characteristics of regional strains of viruses, and applying them from their entire base sequences. Partial sequence of virus having a single-chain DNA genome in the plant was isolated from domestic sweet potato plants (Ipomoea batatas) showing leaf curl disease symptoms, and also analyzed the intergenic region of SPLCV, This fragment was made by transforming and confirming the expression difference through the expression of the reporter protein, the present invention was completed by finding a site that enhances expression than the plant transformation promoter that is being used. Through this, when expressing a foreign gene in a plant capable of SPLCV infection, it can overcome the damage of the plant itself by the existing promoter, and can be applied as a promoter capable of stably expressing the target protein and can generate proteins in both directions. We would like to apply a bidirectional promoter.

The present invention relates to a promoter isolated from the intergenic region of sweet potato leaf curl virus (Sweet potato leaf curl virus) which is the first gemini virus isolated in Korea, which is represented by the nucleotide sequence of SEQ ID NO: It features.

It is possible to contribute to the production of various plant transformants as possible by overcoming the expression stability problem of the plant itself, which is emerging as a problem in plant transformation. Therefore, it is expected to be developed as a plant transformation vector system to form a market as a vector product in the plant biology-related molecular biology and molecular breeding-related industries, and can be expected to commercialize highly efficient variety breeding.

The bidirectional promoter separated from the SPLCV of the present invention is characterized by being represented by the nucleotide sequence of SEQ ID NO: 1.

The site having promoter activity was isolated from the intergenic region of sweet potato leaf curling virus, which is the first gemini virus isolated in Korea, and the cis-acting control site was analyzed using a computer. Based on this, the deletion of the promoter region was made, the plant expression vector for promoter analysis was recombined using a gateway cloning method, and transformed into Agrobacterium tumefaciens strain GV3101, followed by Arabidopsis thaliana ), and transformants that are resistant to the herbicide batha were selected. Promoter activity was observed through the expression of GUS protein in the T2 generation of the selected transformants, and it was confirmed that the promoter activity was stronger around a specific sequence.

The promoter region corresponds to 278 bp in the forward direction from base 2682 to base 131 in the nucleotide sequence of SEQ ID NO: 2, which has bidirectionality.

The invention can be understood in more detail by the following examples. However, the following examples are intended to illustrate the invention and are not intended to limit the protection scope of the invention.

[ Example ]

1. Domestic SPLCV  Gene Isolation and Sequencing

Genomic DNA was extracted from the sweet potato, which had been severely dried by the RDA Crop Science Institute, using the Dellaporta method, and then using the designed primer sequence, 95 ℃ 3 minutes, [94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ° C. 2 min] -30 times, 72 ° C. 10 min PCR reaction conditions to yield 2 microliters of sweet potato genomic DNA, 0.25 pmol of 5′-primer and 3′-primer, 1X PCR buffer and 0.125 mM dNTPs, respectively. A final 20 microliter reaction solution was prepared, amplified the sequences of SP1 and SP2 of SPLCV by PCR, and the bands obtained by electrophoresis of the amplified sequences (Fig. 1) using an RBC gel extraction kit, DNA was recovered from the gel and inserted into the T-vector using Promega's pGEM-T easy vector ligation kit. The ligation reaction solution was added to the bacterial E. coli DH5alpha strain to induce transformation by heat shock at 42 ° C. for 45 seconds and incubated for 12 hours in LB / amp solid medium at 37 ° C. , The resulting bacterial colonies were inoculated in LB / amp liquid medium and shaken for 12 hours at 37 ° C to separate plasmids from them, and the sequencing reaction was performed using the sequencing primers described. After confirming the sequencing results repeated three times, the final sequence was determined and confirmed as the final SPLCV sequence via NCBI BLAST search.

As shown in FIG. 1, SP1 (1632 bp) and SP2 (2138 bp) fragments of expected sizes were amplified through DNA polymerase chain reaction.

Primer sequence and clone information used for SPLCV detection Clone primer Sequence (5 '→ 3') SP1 SPF1  ( forward ) ctc gtg cag ttc tct tgc ta (SEQ ID NO: 3) SPR1  ( reverse ) gca act ggg att cca caa ga (SEQ ID NO: 4) SP2 SPF2  ( forward ) gtg tat cag acc ctg cgt tg (SEQ ID NO: 5) SPR2 (reverse) ata cgg tgc ccg cct ttt gg (SEQ ID NO: 6) SPR3 (reverse) cct tca aaa gtg ggc ccc aca (SEQ ID NO: 7) SPR4  ( reverse ) atg aca ggg cga atg cgc gtt (SEQ ID NO: 8)

In the case of SPLCV, the gene sequences amplified using the primers of FIGS. 2 and 1 were cloned into pGEM-T easy vectors, respectively, and clones containing the entire sequence of the virus corresponding to 1.2 mer by EcoRV digestion from SP1 and SP2 clones. Produced. In the case of SPLCV, only two fragments larger than 1 kb were cloned, which made it difficult to determine the entire sequence. Therefore, the primers for confirming the SPLCV overall sequence was devised as shown in Table 2 and FIG. 3 to perform the sequencing reaction and determine the overall sequence.

Sequencing primers for SPLCV full sequencing primer Sequence (5 '→ 3') 5 SpLCV2ndSeq GAT GTG TGG GTC CCT GTA AG (SEQ ID NO: 9) 5 SpLCV2Seq _ Rc CTT ACA GGG ACC CAC ACA TC (SEQ ID NO: 10) 5 SpLCV3rdSeq AGT AAT CCT GTG TAT CAG AC (SEQ ID NO: 11) 5 SpLCV4thSeq CTG TGC GTG AAT CCA TGC TG (SEQ ID NO: 12) 5 SpLCV5thSeq CCT ATT CTG CTT GGG CCT TC (SEQ ID NO: 13) 5 SpLCVlastSeq AAA GGC GGG CAC CGT ATT AA (SEQ ID NO: 14)

10 μg of isolated genomic DNA was electrophoresed on a 0.8% agarose gel, then transferred to a nylon membrane (Amersham Hybond-N +) for 16 hours, after which a probe DNA fragment made from an infectious clone was P ³² -labelled dCTP. After radiolabeling, hybridization reaction was performed. The ORF of the virus was identified based on the genomic sequence of the identified geminivirus, and the identified ORF was sequenced through homology search [BLAST] of sequences previously reported in GenBank.

2. SPLCV Promote the promoter from

The study of the gene region, which is thought to be the promoter position, proceeds by identifying the cis-element through the in silico analysis and determining the presence or absence of the cis-acting region based on this. . Therefore, In silico analysis confirms the expected cis-acting element in the intergenic region of SPLCV, and randomly adds the outer region of the intergenic region to create a deletion set and activate the promoter. We tried to find out how this affects.

In order to analyze the intergenic region (IR) corresponding to the promoter region of the Geminivirus as a bidirectional origin of a single-stranded DNA virus, eight deletion sets were designed per final virus according to the direction as follows (FIG. 6). , 4 sense directions, 4 antisense directions). In other words, by adding an additional gene frame outside the intergenic region, the fragment including the IR is made into four parts as a whole, and eight of them are designed according to the direction.

Location and orientation of eight promoter deletion sets designed from the intergenic region of SPLCV C-sense V-sense SIR131-2682 SIR2682-131 SIR262-2682 SIR2682-262 SIR131-2557 SIR2557-131 SIR262-2557 SIR2557-262

Eight designed regions of the intergenic region from the sequencing SPLCV were first amplified and isolated by PCR using primers for gateway cloning.

Primer set used for the preparation of primary PCR products for gateway cloning name Starting point Sequence Replication direction 5SP2682Vs 2682 5'- AAAAAGCAGGCT TTGGAGACACGCATAAGTTC -3 '(SEQ ID NO: 15) Virion 5SP2557Vs 2557 5'- AAAAAGCAGGCT TTTTTGTTGGTGGGTGTTTG -3 '(SEQ ID NO: 16) Virion 3SP262Vs 262 5'- AGAAAGCTGGGT AGCTCGAACCCTAAGGTTCC -3 '(SEQ ID NO: 17) Virion 3SP131Vs 131 5'- AGAAAGCTGGGT TCTTGGCGCCCAAGCACGGA -3 '(SEQ ID NO: 18) Virion 5SP262Cs 262 5'- AAAAAGCAGGCT AGCTCGAACCCTAAGGTTCC -3 '(SEQ ID NO: 19) Complementary 5 SP131Cs 131 5'- AAAAAGCAGGCT TCTTGGCGCCCAAGCACGGA -3 '(SEQ ID NO: 20) Complementary 3 SP2557Cs 2557 5'- AGAAAGCTGGGT TTTTTGTTGGTGGGTGTTTG -3 '(SEQ ID NO: 21) Complementary 3 SP2682Cs 2682 5'- AGAAAGCTGGGT TTGGAGACACGCATAAGTTC -3 '(SEQ ID NO: 22) Complementary attB1adaptor - 5'-GGGGACAAGTTTGTACA AAAAAGCAGGCT -3 '(SEQ ID NO: 23) - attB2adaptor - 5'-GGGGACCACTTTGTACA AGAAAGCTGGGT -3 '(SEQ ID NO: 24) -

3. Transformation plasmid preparation

In order to transform the promoter isolated from the Arabidopsis to prepare a carrier for the analysis of promoter function using the gateway carrier pBGWFS7. The amplified PCR products were 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3 '(SEQ ID NO: 25) and B2 in 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3', the adapter primer B1 containing the entire bacterial side specific recombinant nucleic acid sequence site when the bacteria were infected with bacteriophage. (SEQ ID NO: 26), respectively, re-PCR was used. The reaction produced an intermediate cloning vector. This subcloned carrier was subjected to an LR recombination reaction again with the pBGWFS7 vector (FIG. 9) in which a reporter system in which Egfp and GUS genes were linked to produce a final plant transformation carrier was completed. At this time, pBGWFS7 used as a binary vector has a spectinomycin resistance gene for microbial selection, and includes a herbicide resistant Bar gene as a plant selection factor.

FIG. 8 is a genetic map of the pDONR221 vector recombined with a PCR product, and FIG. 9 is a genetic map of the pBGWFS7 vector, which is a gateway vehicle used for promoter analysis.

4. Arabidopsis transformation

After seeding, primary seedlings of Arabidopsis thaliana ecotype Columbia-0 plants grown for about 4 weeks in a 23 ° C incubator (16 hours day, 8 hours nights) were removed to induce at least 3-4 secondary branches. Agrobacteria are infected by spraying a bud of Agrobacteria cultures containing plant transformation carriers with a OD 0.8 diluted in a solution containing 5% sucrose and 0.05% silwet77. After overnight incubation with sufficient humidity and dark conditions, incubate for 4-5 days at 23 ℃ incubator (16 hours day / 8 hours night), and then culture and dilute Agrobacteria in the same manner as above. Incubated overnight with sufficient humidity and dark conditions, and then grown for 3 to 5 weeks in a 23 ° C. incubator (16 hours day / 8 hours night) until the mature silique matures to brown. And harvested. The seeded seeds were sown again, and T1 generation transformants were selected by spraying 0.3% batha on the second and third weeks of growth. T1 transgenic plants were grown for about 2 months in a 23 ° C. incubator (16 hours day / 8 hours night) until the pod silicate matured to brown, and then T2 seeds were seeded.

5. GUS Blue color  Reaction analysis

Transgenic T2 seeds were germinated to observe the expression of blue expression gene (GUS). As a control, a germ pole transformed with a pBI121 vector having a non-transformed Arabidopsis and 35S promoter was used. In order to observe the expression of blue color gene, seedlings and various tissues were treated with GUS-assay buffer [X-gluc (cyclohexyl ammonium salt) 20 mM, NaH ₂ PO ₄ H ₂ O 100 mM, NaEDTA 10 mM, Triton X-100 0.1%, pH 7 .5], overnight treatment at 37 ° C, discarded the buffer solution and wiped with water, then immersed in 70% by weight ethanol and repeatedly changed until chlorophyll (chlorophyll) is removed once every hour at 37 ℃. Plants were observed under a stereomicroscope and Figure 10 shows the expression of blue chromogenic genes.

Blue color was not observed in non-transgenic Arabidopsis, but blue color was observed in Arabidopsis transformed by SIR131-2682 line and SIR2682-131 line, indicating that GUS protein was expressed by SPLCV promoter. . (Figure 10)

Figure 1 shows the electrophoresis picture of the result of amplification of the partial gene sequence for SPLCV polymerase chain reaction assay and overall sequence determination. SP1 (1632 bp) and SP2 (2138 bp) fragments of expected sizes were amplified by DNA polymerase chain reaction.

Figure 2 shows the primer design for determining the overall sequence, a primer design schematic showing the location of the primer sequence on the SPLCV using the overlapping portion of the amplified region to secure the entire virus sequence.

3 shows the design of sequencing primers for SPLCV sequence identification

Figure 4 is the full nucleotide sequence corresponding to 2828 bp length of SPLCV [wavering marks: each corresponding restriction enzyme recognition sequence].

Figure 5 shows a genomic map of SPLCV purely isolated from domestic sweet potatoes (arrow indicates each gene (complementary gene strand; C1, C2, C3, C4, viral gene strand; V1, V2)).

6 is a conceptual diagram of a method for fusion between a deletion set of a promoter region and a reporter gene for confirming bidirectional promoter activity of an intergenic region of SPLCV.

FIG. 7 is an electrophoresis photograph showing amplification of a promoter deletion set having homologous recombination sites at both ends by first and second PCR.

8 is a genetic map of the pDONR221 vector recombined with a PCR product.

9 is a genetic map of the pBGWFS7 vector, which is a gateway vehicle used for promoter analysis.

10 is a photograph observing the expression of the blue color gene (GUS) in the transformed Arabidopsis. (A: untransformed Arabidopsis, B: GUS expression identified from SIR2682-262 line C: transformant of pBI121 vector with 35s promoter, D: GUS expression identified from SIR131-2682 line, E: SIR2682- GUS expression identified from 131 line)

<110> SUNGKYUNKWAN UNIVERSITY Foundation for Corporate Collaboration RURAL DEVELOPMENT ADMINISTRATION <120> The bidirectional promoter using Sweet potato leaf curl virus          Korean isolate <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 278 <212> DNA <213> Sweet Potato Leaf Curl Virus Korean isolate <400> 1 ttggagacac gcataagttc aaatgaattg gagactggag acaatatata gtatgtctcc 60 aaatggcatt ctggtaattt agaagatcct tttagcttta attcaaattc cgacaactct 120 gggtccacca aaaggcgggc accgtattaa tattaccggt gcccgccgcg ccctttaata 180 gtgggcccca caagggacca cgcgtctttt ccgtactgtc tttaatgatt actttgcttt 240 ataaggacca atcaggtttc cgtgcttggg cgccaaga 278 <210> 2 <211> 2828 <212> DNA <213> Sweet Potato Leaf Curl Virus Korean isolate <400> 2 taatattacc ggtgcccgcc gcgcccttta atagtgggcc ccacaaggga ccacgcgtct 60 tttccgtact gtctttaatg attactttgc tttataagga ccaatcaggt ttccgtgctt 120 gggcgccaag aatggagcag ttgtgggacc ctttgcagaa cccactcccg gatactttat 180 acggttttag gtgtatgcta tccgtaaaat acttgcagag tattttgaag aaatacgagc 240 caggaacctt agggttcgag ctctgttcgg agttaatccg tatattcagg gtcaggcagt 300 atgacagggc gaattcccgt ttcgcggaga tttcatccat atggggggag accggtaaga 360 cggaggctga acttcgagac agctatcgtg ccctacactg ggaatgctgt cccaattgct 420 gcccgaagct atgtcccggt ttcaagaggc gtccggatga agagaaagag gggtgaccgc 480 atcccgaagg gatgtgttgg tccctgtaag gtccaggact atgagttcaa gatggacgtt 540 ccccacacgg gaacgtttgt ctgtgtctcg gattttacta ggggaactgg gcttactcat 600 cgcctgggta agcgtgtttg tgtgaagtcc atgggtatag atgggaaggt ctggatggat 660 gacaatgtgg ccaagagaga tcacaccaat atcatcacgt attggttgat tcgtgacaga 720 aggcccaata aggatccgct gaactttggc caagtcttca ctatgtatga caatgagccc 780 actactgcta agatccgaat ggatctgagg gatagaatgc aggtattgaa gaagttctct 840 gttacagttt caggaggtcc atacagccac aaggagcagg ccttaattag gaagtttttt 900 aagggtttgt ataatcatgt tacttacaat cataaggaag aagctaagta tgagaatcag 960 ttagaaaatg ctttgatgtt gtatagtgct agcagtcatg cgagtaatcc tgtgtatcag 1020 accctgcgtt gcaggtctta tttctatgat tcgcacaata attaataaaa ttatatttta 1080 ttaatacagt aatatcttta catcatcatt acaatctaca gtatctactt catctatcca 1140 agaacatact cttggaagat atctaataac aaaaactaaa ttaactaaac taaaaaaccc 1200 taaatttgct aattcattac atatacgcca tttaaggcgt tccaaaatac cagtccaact 1260 gtgaatagca ccagttagac gggtcgtcaa gatccggaat tggaggaaga tcttgtggaa 1320 tcccagttgc ctcctttccc tgtagttgac ccacatctgg aatttgagga tggttctccc 1380 ctgtgtgctc tcgtgggcat acataattct gagatggaac ggtgcagtcc gacccacaga 1440 catggggttg gtgtcgaatt cgagtgctct cgtagtctga gcatgactta gtgattcccc 1500 tgtgcgtgaa tccatgctga tacttgcagt ttggggtgat gaaggctgaa cagccgcaac 1560 ccttccacac tatccttgtc ctctgttcag gaactttcct cttggccttc ttcgcctctg 1620 cgtgcagtgg ctcctgaatg ggacacttcc tcttgattcc agaagggaga ttggacatcg 1680 cagaatatag cgtttgctgt tgcccaattc ttgagtgctc cttgctctgg tttgtccaac 1740 cagagtttaa atgaggagcc ctctcctgga ttgcagagga agatagtggg aattccacct 1800 ttaatttgaa ctggctttcc gtatttacag ttggattgcc agtccttctg ggcccccatg 1860 aattccttaa agtgctttag gtattggggg ttgacgtcat caatgacgtt ataccaagca 1920 ctgttgctgt atacttttgg gcttagatct aaatgcccac acaaataatt gtgagggccc 1980 aaagacctgg cccatactgt tttgcctatt ctgcttgggc cttcaataac aatggatatg 2040 ggtctatccg gccgcgcagc ggcatccatg acattttcag cggcccagtc gctgataatg 2100 tcaggaactg cattgaaaga agaagatgaa aaaggagaag aatatacaga aggaggagga 2160 gaaaaaatcc tatctaaatt actaactaaa ttgtgaaatt gaaacaaata tttttcaggg 2220 agtttctccc taattatttg caacgcagct tctttagaac ctgcgtttag agcctctgcg 2280 gctgcgtcat tagcagtctg ctggcctcct ctagcagatc tgccgtcgac ctggaattca 2340 ccccaggtga tggtatcccc gtccttgtca acgtaggact tgacatcgga cgaggattta 2400 gctccctgaa tgttggggtg aaagtgattc gatctgttcg gtgagaccag atcgaagaat 2460 ctgctatttg tgcagacgaa tttgccttcg aactgcacca gcacatggag gtgaggttcc 2520 ccatcctcgt gcagttctct tgctacgtgt atgtattttt tgttggtggg tgtttggata 2580 tttaggagtt gggctaggca gtcctctttt gagagagaac agcgtggata agtaataaaa 2640 taatttttgg cctgaatttt aaaacgtttt ggaggagcca tttggagaca cgcataagtt 2700 caaatgaatt ggagactgga gacaatatat agtatgtctc caaatggcat tctggtaatt 2760 tagaagatcc ttttagcttt aattcaaatt ccgacaactc tgggtccacc aaaaggcggg 2820 caccgtat 2828 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPF1 (forward) <400> 3 ctcgtgcagt tctcttgcta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPR1 (reverse) <400> 4 gcaactggga ttccacaaga 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPF2 (forward) <400> 5 gtgtatcaga ccctgcgttg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SPR2 (reverse) <400> 6 atacggtgcc cgccttttgg 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SPR3 (reverse) <400> 7 ccttcaaaag tgggccccac a 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SPR4 (reverse) <400> 8 atgacagggc gaatgcgcgt t 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5SpLCV2ndSeq <400> 9 gatgtgtggg tccctgtaag 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5SpLCV2Seq_Rc <400> 10 cttacaggga cccacacatc 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5SpLCV3rdSeq <400> 11 agtaatcctg tgtatcagac 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5SpLCV4thSeq <400> 12 ctgtgcgtga atccatgctg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5SpLCV5thSeq <400> 13 cctattctgc ttgggccttc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5SpLCVlastSeq <400> 14 aaaggcgggc accgtattaa 20 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 5SP2682Vs <400> 15 aaaaagcagg ctttggagac acgcataagt tc 32 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 5SP2557Vs <400> 16 aaaaagcagg cttttttgtt ggtgggtgtt tg 32 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 3SP262Vs <400> 17 agaaagctgg gtagctcgaa ccctaaggtt cc 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 3SP131Vs <400> 18 agaaagctgg gttcttggcg cccaagcacg ga 32 <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 5SP262Cs <400> 19 aaaaagcagg ctagctcgaa ccctaaggtt cc 32 <210> 20 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 5SP131Cs <400> 20 aaaaagcagg cttcttggcg cccaagcacg ga 32 <210> 21 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 3SP2557Cs <400> 21 agaaagctgg gttttttgtt ggtgggtgtt tg 32 <210> 22 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 3SP2682Cs <400> 22 agaaagctgg gtttggagac acgcataagt tc 32 <210> 23 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> attB1adaptor <400> 23 ggggacaagt ttgtacaaaa aagcaggct 29 <210> 24 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> attB2adaptor <400> 24 ggggaccact ttgtacaaga aagctgggt 29  

Claims (1)

A bidirectional promoter of domestic sweet potato leaf disease infected DNA virus represented by the nucleotide sequence of SEQ ID NO: 1.

Images