KR20090058219A - Method for preparation of peptides by using deubiquitylating enzyme which is stable in presence of high concentration of urea - Google Patents

Abstract

A method for preparing a peptide using usp2-cc is provided to quickly and easily produce heterologous peptide without the removal process of urea. A gene construct comprises a fusion partner, ubiquitin, and polynucleotide coding a fusion protein of heterogous peptide. A method for producing water soluble heterogous peptide comprises: a step of inducing an expression vector containing the gene construct and transforming; a step of culturing the transformant to induce the expression of recombinant fusion protein; a step of suspending the recombinant fusion protein in solution containing 2-4M urea; and a step of treating Usp2-cc in the suspension solution and cutting the fusion protein to obtain the heterogous peptide.

Description

METHODS FOR PREPARATION OF PEPTIDES BY USING DEUBIQUITYLATING ENZYME WHICH IS STABLE IN PRESENCE OF HIGH CONCENTRATION OF UREA}

The present invention relates to a method for preparing agglutinated foreign peptides using a deubiquitylating enzyme having a stable activity in a high concentration of urea (hereinafter, Usp2-cc). An expression vector comprising a polynucleotide encoding a fusion protein of a foreign peptide is prepared, and a fusion protein expressed and aggregated from the expression vector is dissolved in a high concentration of urea, and the fusion protein is present in a state where urea is present without removing urea. The present invention relates to a method for preparing a water-soluble foreign peptide in its original form by cleaving using Usp2-cc.

Chemical biosynthesis of peptides susceptible to aggregation remains a major challenge. One of the major factors limiting the chemical synthesis of peptides is on-resin agglomeration which results in low yields, chemical and physical heterogeneity. Biological methods using fusion proteins consisting of protease cleavage recognition sites and target peptides have addressed these obstacles. However, there are still limitations such as low yield, aggregates of cleaved peptides, difficulty in purification, and the like. At this time, the recombinant fusion protein in the form of an inclusion body has an advantage that can be accumulated in high yield and high purity. Aggregated insoluble fusion proteins become soluble in strong denaturants such as urea. However, removal of urea is necessary to achieve the maximum activity of the protease selected for cleavage of the target peptide from the fusion protein, which removal results in deleterious effects such as aggregation of the peptide. Several strategies have already been implemented to address these harmful problems (Lopes DH et. al . , J Biol Chem 279: 42803-42810, 2004). One of them is on-column cutting (Dobeli H et al . , Biotechnology ( NY ) 13: 988-993, 1995; Lopes DH et al . , J Biol Chem 279: 42803-42810, 2004), which is time consuming, expensive and may require further purification.

After removal of the urea, removal of the fusion partner from the fusion protein can cause peptide aggregation, so removing the fusion partner in the presence of urea can inhibit the aggregation reaction. Therefore, if the cleavage reaction for removing the fusion partner can be performed in the presence of urea, the problem of aggregation may be solved. The specific and strong enzyme deubiquitylating enzyme (Usp2-cc) is an enzyme capable of cleaving ubiquitin and has been reported to maintain its intrinsic activity over a wide range of pH and NaCl concentrations (Baker RT). et al . , Methods Enzymol 398: 540-554, 2005; Baker RT et al . , Curr Opin Biotechnol 7: 541-546, 1996).

Accordingly, the present inventors expressed a fusion partner, a fusion protein comprising ubiquitin and foreign peptides that can be cleaved by Usp2-cc, which is active even if urea is present as a protein cleavage enzyme recognition site, and then the fusion protein As a result of treatment with the Usp2-cc under the present conditions, it was confirmed that not only aggregation phenomenon but also enzyme activity was maintained in the original peptide obtained by the above method, and the peptide which was easy to aggregate without any further step was purified. The present invention has been completed by confirming that it can be done.

The present invention provides a method for purifying agglomerated peptides that are difficult to chemically synthesize and biologically purify.

In order to achieve the above object, the present invention provides a gene construct comprising a polynucleotide encoding a fusion protein of a fusion partner, ubiquitin and foreign peptides.

In addition, the present invention provides an expression vector operably comprising the gene construct.

In addition, the present invention 1) preparing a transformant by introducing the expression vector into the host cell;

2) culturing the transformant of step 1) to induce expression of and obtain a recombinant fusion protein;

3) suspending the recombinant fusion protein of step 2) in a lysate comprising 2-4 M urea; And,

4) A method for preparing a water-soluble foreign peptide of its original form, comprising the step of treating the suspension of step 3) with a deubiquitylating enzyme (hereinafter referred to as Usp2-cc) to cleave the fusion protein and obtain the foreign peptide. To provide.

Also provided is a water soluble foreign peptide in its original form prepared by the process of the invention.

Hereinafter, the term used by this invention is demonstrated.

"Heterologous peptide" is a polypeptide that a person skilled in the art intends to produce in large quantities, and means any protein that can be expressed in a transformant by inserting a polynucleotide encoding the protein into a recombinant expression vector.

"Recombinant protein or fusion protein" refers to a protein in which another protein is linked to or added to the N-terminus or C-terminus of the sequence of the original foreign peptide. By recombinant fusion protein form or protein cleavage enzyme linked to the fusion partner of the present invention means a recombinant protein of the foreign peptide from which the fusion partner is removed from the recombinant fusion protein.

An "expression vector" is a linear or circular DNA molecule consisting of fragments encoding a target polypeptide operably linked to additional fragments provided for transcription of the expression vector. Such additional fragments include promoter and termination code sequences. Expression vectors also include one or more replication initiation points, one or more selection markers, polyadenylation signals, and the like. Expression vectors are generally derived from plasmid or viral DNA, or contain elements of both.

Hereinafter, the present invention will be described in detail.

 The present invention provides a gene construct comprising a polynucleotide encoding a fusion protein of a fusion partner, ubiquitin and a foreign peptide.

Ubiquitin (ubiquitin) is characterized in that cleaved by a deubiquitylating enzyme (hereinafter, Usp2-cc). The fusion partner is not limited thereto, but maltose binding protein (MBP), glutathione-S-transferase (GST), thioredoxin (Trx), NusA and GroES And the like, preferably GroES. GroES, the co-chaperone of E. coli , is suitable as a fusion partner due to its high expression and stability. In a preferred embodiment of the present invention, GroES was used in conjunction with a target peptide with ubiquitin in between (see FIG. 1A). The ubiquitin alone may be an effective fusion partner that can increase the expression of protein (Jonnalagadda S et al . , J Biol Chem 262: 17750-17756, 1987), not as efficient as using GroES as a fusion partner (no data). The foreign peptide can be any peptide desired by those skilled in the art, and the foreign peptide is preferably a protein that is easy to aggregate, and in a preferred embodiment of the present invention, Aβ _1-42 , Aβ _1-40 and Tat-humannin It was. Aβ _1-42 is known to form inclusion bodies in E. coli expression in previous studies (Dobeli H et al . , Biotechnology ( NY ) 13: 988-993, 1995; Lee EK et al . , Protein Expr Purif 40: 183-189, 2005), and chemical biosynthesis is also known to be difficult (Tickler AK et. al . , J Pept Sci 7: 488-494, 2001). In addition, Tat-Humanin, a 33 amino acid long cell permeable version of the apoptosis-inhibited humanin peptide, had a high tendency to aggregate, making its purification difficult.

In addition, the present invention provides an expression vector operably comprising the gene construct.

The gene construct of the present invention is cloned into a skeletal vector via a restriction enzyme site, and the skeletal vector that can be used in the method of the present invention is not particularly limited, but may be pET21a, pET28a, pET / Rb, pGEX, pET- Various vectors capable of transforming E. coli selected from the group consisting of 22b (+) and pGEX can be used. The expression vector of the present invention was able to express the recombinant fusion protein by operably including the gene construct in the pET28b backbone vector.

The present invention comprises the steps of 1) preparing a transformant by introducing the expression vector into a host cell;

2) culturing the transformant of step 1) to induce expression of and obtain a recombinant fusion protein;

3) suspending the recombinant fusion protein of step 2) in a lysate comprising 2-4 M urea; And,

4) A method for preparing a water-soluble foreign peptide of its original form, comprising the step of treating the suspension of step 3) with a deubiquitylating enzyme (hereinafter referred to as Usp2-cc) to cleave the fusion protein and obtain the foreign peptide. To provide.

The cleavage activity of the fusion protein in the presence of urea has two advantages. First, since no separate urea removal process is required, the aggregation of the fusion protein before the cleavage reaction can be suppressed. The second can prevent the aggregation of the cleaved peptide, which typically occurs in the case of peptides that are likely to aggregate. In a preferred embodiment of the present invention, at least 10 mg of pure (> 95%) peptide per liter of cell culture could be obtained without further dissolution and purification steps (FIG. 3B).

The urea of step 3) is included in the solution at a concentration of 2 to 4 M, preferably at a concentration of 2.5 to 3.5 M, most preferably 3 M. The recombinant fusion protein of step 2) can be cleaved by a deubiquitylating enzyme (hereinafter, Usp2-cc), which means that Usp2-cc contains ubiquitin which is included as a protein cleavage enzyme recognition site in the recombinant fusion protein. Because it can cut. The Usp2-cc has a wide pH range to maintain activity and has been reported to maintain activity even at high salt concentrations (Baker RT, Curr Opin Biotechnol 7: 541-546, 1996). In an embodiment of the present invention, the Usp2-cc is a fusion protein comprising GroES, ubiquitin and Aβ _1-42 having a structure as shown in FIG. 1A, and a molar ratio of Usp2-cc: substrate (fusion protein) = 1: 100. Peptides were effectively cleaved within 2 hours at 3 M urea at. At 4 M urea zone regeneration, more enzymes (four times or less) were required to have a similar effect to the above effect (see FIG. 2A), and cleavage reactions were not effective when urea was contained in high concentrations (no data). When cleavage reactions were performed in the presence of 3 M or 4 M urea based on visual observation or centrifugation methods, no aggregation of peptides was found. In contrast, when performed at <2 M urea, agglomerates of distinct cleavage products were found (no data). In addition, the cleavage effect of the Usp2-cc was hardly changed at pH 7-10 (see Figure 2b). Previous reports have reported the absence of urea maintains stable activity over a wide range of pH. For reference, the fusion protein was expressed in E. coli was a lot, but most of the inclusion body was confirmed (see Fig. 1b), after dissolving in 6 M urea serial dilution to confirm that the water solubility, Agglomerates were observed below 2 M urea (no data). An additional advantage of using Usp2-cc is that it can facilitate cleavage of the peptide from the intact fusion protein comprising ubiquitin without modification of the peptide's N-terminus. In comparison, TEV (tobaccos etch virus protease; CaErrington JC et al . , EMBO J 8: 365-370, 1989) and factor Xa (Jenny RJ et al . , Protein Expr Purif 31: 1-11, 2003), etc., have been reported to produce non-naturally occurring N-terminal amino acids and that errors may occur in cleavage.

The foreign peptide obtaining method of step 4) may be performed by column chromatography. The column chromatography method may specifically be an affinity chromatography or a liquid chromatography method.

By the method of the present invention the protein in its original form can be purified with only one step of chromatography (see FIG. 3B) and the yield reached 10 mg per liter of cell culture. This is due to other systems (Lee EK et al . , Protein Expr Purif 40: 183-189, 2005). Aβ _1-40 was much higher in yield when purified by the same method (15 mg per liter of cell culture). Tat-Humanin, a 33 amino acid long cell permeable version of the apoptosis-inhibited humanin peptide, had a high tendency to aggregate and was difficult to purify. However, this was also successfully purified by the method of the present invention (yield: 12 mg per liter of cell culture; FIG. 3A). Mass spectrometry of the purified peptides by MALDI-TOF MS revealed that Aβ _1-42 and Aβ _1-40 were 4514.6 Da (expected; 4513.8 Da) and 4330.8 Da (expected; 4329.86 Da), respectively, and Tat- Humanin was not mass analyzed for insolubility in buffer.

Also provided is a water soluble foreign peptide in its original form prepared by the process of the invention.

The Aβ _1-42 peptide prepared by the method of the present invention did not change biophysical and biological properties. Fibrillogenesis kinetics tested by ThT assay (FIG. 4A), formation of β-sheets measured by CD spectroscopy (FIG. 4B) and cytotoxicity against SH-SY5Y cells (FIG. 4C) Consistent with previous reports (Lee EK et al . , Protein Expr Purif 40: 183-189, 2005; Naiki H et al . , Lab Invest 74: 374- 38, 1996; Kirkitadze MD et al . , J Mol Biol 312: 1103-1119, 2001). Aβ _1-40 also showed biological activity, but the activity of Tat-humanine was not biologically tested (no data) because of the phenomenon of aggregation when added to cell culture.

Many human diseases, particularly Alzheimer's, Huntington and type 2 diabetes, are involved in the coagulation of peptides (Stefani M et. al . , J Mol Med 81: 678-699, 2003). The mechanism by which aggregation of peptides induces cytotoxicity is not well known. Aggregated peptides prepared in large quantities by the method of the present invention can be usefully used to elucidate the mechanism of the disease associated with the coagulation action of the peptides.

The method of the present invention can easily and quickly and effectively improve the production of agglomerate peptides and can be usefully used to elucidate the mechanisms related to the agglutination action of peptides.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1> Vector for Expression of Fusion Protein

<1-1> Vector containing a fusion partner

The gene encoding the co-chaperone GroES comprises a pair of primers described as SEQ ID NO: 1 (antisense primer; 5'-AAGTCCGCTCTATTCTTGATGCGGATCCCG-3 ') and SEQ ID NO: 2 (sense primer 5'-GGAATTCCATATGAATATTCGTCCATTGCA-3'). Using genomic DNA of E. coli DH5α as a template, with 200 μM of template DNA, 1.5 mM MgCl ₂ , Hepes buffer solution at 95 ° C. for 1 minute, 45 ° C. for 1 minute, 72 ° C. for 1 minute, and 30 repetition conditions. Obtained by performing PCR. After processing the PCR product using Nde I and BamH I restriction enzyme, it was inserted into the pET28b expression system (Novagen, USA) containing the restriction enzyme recognition site to obtain a pET28b-GroES vector.

<1-2> fusion partner, Ubiquitin  Recognition site and Aβ _1-42 Vector containing

Ubiquitin gene (Baker RT, using primer pairs set forth in SEQ ID NO: 3 (antisense primer; CCGCTCGAGTCACGCTATGACAACACCGCC) and SEQ ID NO: 4 (sense primer; CGCGGATCCCAGATCTTTGTGAAGA) Curr Opin Biotechnol 7: 541-546, 1996; Gene bank no .: AF073344) was used as a template, and PCR was performed under conditions of 95 ° C 1 minute, 45 ° C 1 minute, 72 ° C 1 minute, and 30 repetitions. After the PCR product was processed using Nde I and BamH I restriction enzymes, Nde I / BamH I restriction of the vector containing the restriction enzyme recognition site and containing amyloid β _1-42 (Aβ _1-42 ) Subcloning was performed at the enzyme recognition site. Thereafter, the BamH I restriction enzyme recognition site between ubiquitin and Aβ _1-42 was removed by site-directed mutagenesis to facilitate future cloning. Specifically, using a vector comprising the Aβ _1-42 as a template DNA, using a primer pair described as SEQ ID NO: 5 (sense primer; CTCCGCGGTGGAGATGCAGGATTC) and SEQ ID NO: 6 (antisense primer; GGATCCTGCATCTCCACCGCGGAG), 95 ° C, 1 minute, 45 ° C PCR was performed under conditions of 1 minute, 72 ° C., 1 minute, and 30 repetitions. The PCR product was digested with BamH I and XhoI restriction enzymes and reinserted into the vector. The ubiquitin-Aβ _1-42 gene is a primer pair described as SEQ ID NO: 7 (sense primer; 5'-CGCGGATCCCAGATCTTTGTGAAGAC-3 ') and SEQ ID NO: 8 (antisense primer; 5'-CCGCTCGAGTCACGCTATGACAACACCGCC-3') using the vector as a template DNA. Amplification was carried out under the conditions of 95 ° C. for 1 minute, 45 ° C. for 1 minute, 72 ° C. for 1 minute, and 30 repetitions. After processing the PCR product using BamH I and Xho I restriction enzyme, it was inserted into the pET28b-GroES vector containing the restriction enzyme recognition site to obtain a pET28b-GroES-ubiquitin-Aβ _1-42 vector (FIG. 1A). ).

<1-3> fusion partner, Ubiquitin  Recognition site and Aβ _1-40 Vector containing

Aβ _1-40 uses a pET28b-GroES-ubiquitin-Aβ _1-42 vector prepared by the method of Example 1-2 as a template DNA and stop codons before the last two amino acids of the Aβ _1-42 sequence through site mutations. Obtained by inserting. Specifically, using the PCR product as a template DNA using a primer pair described as SEQ ID NO: 9 (sense primer; GGGGGAGTATGAATCGCCCTC) and SEQ ID NO: 10 (antisense primer; GAGGCCGATTCATACTCCCCC), 95 ℃ 1 minute, 45 ℃ 1 minute, 72 ℃ 1 PCR was performed under conditions of 30 minutes of repetition. The ubiquitin-Aβ _1-40 gene was subjected to the same conditions as the PCR conditions of the ubiquitin-Aβ _1-42 gene described in Example 1-2 above using the primer pairs described in SEQ ID NO: 7 and SEQ ID NO: 8 using the vector as a template DNA. Was amplified. After processing the PCR product using BamH I and Xho I restriction enzyme, it was inserted into the pET28b-GroES vector containing the restriction enzyme recognition site to obtain a pET28b-GroES-ubiquitin-Aβ _1-40 vector.

<1-4> fusion partner, Ubiquitin  Recognition site and Tat - Humanin  Vector to include

Tat-humanin gene is a ubiquitin gene (Baker RT, Curr Opin Biotechnol 7: 541-546, 1996) the anti-sense template DNA primers that overlap to three (SEQ ID NO: 11 to 13; SEQ ID NO: 11: 5'-AAAACCACGCGGCGCCATACGACGACGCTGACGACGTTTTTTACGTCCACCGCGGAGGCGCAA-3 '; SEQ ID NO: 12: 5'-ATCAATTTCACCGGTCAGCAGCAGCAGGCAGCTAAAACCACGCGGCGCCAT-3 PCR amplified using the ubiquitin sense primers set forth in SEQ ID NO: 13: 5'-CCGCTCCAGTCACGCACGACGTTTCACCGGCAGATCAATTTCACCGGTCAG-3 ') and SEQ ID NO: 14 (5'-CGCGGATCCCAGATCTTTGTGAAGAC-3') and using BamH I and Xho I restriction enzymes. After processing the product, it was inserted into the pET28b-GroES vector containing the restriction enzyme recognition site to obtain a pET28b-GroES-ubiquitin-Tat-hummanin vector.

< Example  2> Fusion Protein Expression and Purification

<2-1> Transformation and Expression

Method described by Hanahan (Hanahan D, DNA Vectors obtained by the method of Example 1 by Cloning vol. 1 109-135, IRS press 1985) were transformed into E. coli BL21 (DE3) pLysS cells.

Specifically, the vectors of Example 1 were transformed into Escherichia coli BL21 (DE3) pLysS (Novagen, USA) treated with CaCl ₂ by a thermal shock method, and then cultured in a medium containing kanamycin (kanamycin) to transform the expression vector. Colonies exhibiting kanamycin resistance were selected. The colonies were inoculated in LB medium (30 μg / ml kanamycin; sigma, USA), incubated at 37 ° C. for 16 hours, and then inoculated in LB medium (30 μg / ml kanamycin; sigma, USA). When the OD ₆₀₀ of the culture reached 0.6, IPTG was added (0.4 mM) to further incubate for 6 hours to induce the expression of recombinant genes.

<2-2> Purification of Fusion Proteins

After incubation, the culture medium was centrifuged to separate the aggregated cells into 25 ml cell lysate (20 mM Tri-HCl, pH 8.0, 10 mM NaCl, 0.1 mM PMSF, 0.1 mM EDTA and 1 mM b-mercaptoethanol; Sigma, USA). Suspension was broken up into pieces). It was centrifuged at 13,000 rpm for 1 hour. Aggregates containing target peptides expressed by fusion to GroES forming inclusion bodies were prepared by resuspension buffer (50 mM Tris-Cl, pH 8.0, 150 mM NaCl, and 1) containing 6 M urea (USB chemicals, USA). resuspended in mM DTT; Sigma, USA). After resuspension, insoluble protein was removed by centrifugation at 18,000 rpm for 30 minutes. The supernatant was further purified by ultrafiltration.

The supernatant and inclusion body of the centrifuged sample before urea treatment were dissolved in urea, and 10 μl of each of the resuspended water-soluble proteins was mixed with 2 μl and boiled at 100 ° C. for 10 minutes. Boiled samples were loaded into wells of 10% SDS-PAGE gel and electrophoresed at 125 V for 2 hours to separate according to molecular weight.

As a result, as shown in FIG. 1B, the fusion protein containing Aβ _1-42 was highly expressed in E. coli , and most proteins were found to form inclusion bodies. The same was also true for Aβ _1-40 and Tat-humanin (FIG. 1C).

< Example  3> Fusion Protein Cleavage Reaction and Peptide Purification

<3-1> Fusion Protein Cleavage Reaction

<3-1-1> Fusion Protein Cleavage Reaction

Usp2-cc is Catanzariti AM et al . , Protein Purified according to the method of Sci 13: 1331-1339, 2004. Specifically, Usp2-cc ORF is mouse Usp2-45 cDNA (AY255637; Gousseva & Baker, Gene of IMAGE clone 1922050). Expr 11: 163-179, 2003) as template DNA was obtained by PCR using primer pairs set forth in SEQ ID NO: 15 (CGTGGATCCTCTGCTCACCAAAGCCAAGAATTC) and SEQ ID NO: 16 (TCCGGATCCTTACATACGGGAGGGTGGACTG). The PCR product was inserted into pET15b (Novagen, USA) after BamH I restriction enzyme treatment. After transforming the vector by the method of Example 2-1 to express the Usp2-cc, Catanzariti AM et al . , Protein Usp2-cc was purified according to the method of Sci 13: 1331-1339, 2004.

<3-1-2> cleavage reaction

After diluting the fusion protein obtained by the method of Examples 2-1 and 2-2 in twice the ratio of the resuspension buffer solution, Usp2-cc: fusion protein obtained by the method of Example 3-1-1 ( Substrates) were mixed at a ratio of 1:25, 1:50 and 1: 100 and incubated for 2 hours at pH 7-10 and 37 ° C. in the presence of 2 to 6 M of urea. 50 mM Tris-Cl was used to adjust pH 7-9 and 20 mM bicarbonate buffer (Sigma, USA) was used at pH 10. Unless otherwise indicated, cleavage reactions of all fusion proteins were performed at pH8.

<3-2> Purification of Peptides

Samples cut by the method of Example 3-1 were loaded onto a C18 column (25 mm × 250 mm, Grace Vydac, USA). Peptides were passed through solvent system buffer 1 (30 mM ammonium acetate, pH 10, 2% acetonitrile; Merck, USA) and buffer 2 (70% acetonitrile) at a flow rate of 10 ml / min at a rate of 10 ml / min. Purified by a 20-40% linear gradient method. Purified peptides were lyophilized and stored at −20 ° C., and dissolved by bath sonication for 10 minutes in a concentration of 1 mg / ml in 0.1% NH ₄ OH (Sigma, USA) immediately before use. The solution was mixed with the same dose of PBS (10 mM phosphate buffer, pH 7.4, 137 mM NaCl and 2 mM KCl; Ameresco, USA). In the case of Tat-humanine, it was dissolved in 10% glacial acetic acid and then diluted 5-fold in PBS.

As a result, as shown in FIG. 3B, the Aβ _1-42 peptide could be purified by only one step of chromatography.

<3-3> Peptide Analysis

<3-3-1> Mass Spectrometry

In Examples 3-1 and 3-2 purified peptides were subjected to mass spectrometry after cleavage under various enzyme: substrate ratios, urea concentrations and pH value conditions (Anigen, Korea).

As a result, Aβ _1-42 and Aβ _1-40 were found to be 4514.6 Da (expected value; 4513.8 Da) and 4330.8 Da (expected value; 4329.86 Da), respectively. However, Tat-humanin was not mass analyzed for insolubility in buffer.

<3-3-2> SDS - PAGE

In Examples 3-1 and 3-2, 10 μl of each of the purified peptides after cleavage at various enzyme: substrate ratios, urea concentrations, and pH value conditions was mixed with 2 μl and boiled at 100 ° C. for 10 minutes. Boiled samples were loaded into wells of 10% SDS-PAGE gel and electrophoresed at 125 V for 2 hours to separate according to molecular weight.

As a result, when serial inclusion of the inclusion body dissolved in 6 M urea was confirmed to maintain water solubility, agglomerates were observed at 2 M urea or less (no data). The peptide was also effectively cleaved within 2 hours at 3 M urea at a molar ratio of Usp2-cc: substrate = 1: 100. In the presence of 4 M urea, more enzymes (four times or less) were needed to have an effect similar to the above effect (FIG. 2A). When the urea was contained at high concentrations, the cleavage reaction did not perform effectively (no data). The effect of the cleavage reaction was little changed at pH 7-10 (FIG. 2B). Previous reports have reported the absence of urea maintains stable activity over a wide range of pH. When cleavage reactions were performed in the presence of 3 M or 4 M urea based on visual observation or centrifugation methods, no aggregation of peptides was found. In contrast, when performed at <2 M urea, agglomerates of distinct cleavage products were found (no data).

The Aβ _1-42 peptide could be purified by one step of chromatography by the method of the present invention (lane 3 in FIG. 3A) and the yield reached 10 mg per liter of cell culture. Aβ _1-40 was much higher in yield when purified by the same method (15 mg per liter of cell culture, lane 4 in FIG. 3A). Tat-Humanin was also successfully purified by the method of the present invention (yield: 12 mg per liter of cell culture; lane 5 in FIG. 3A).

< Example  4> Biophysical and Biological Properties of Purified Peptides

<4-1> cell culture

Human neuroblastoma SH-SY5Y cells (ECACC no. 94030304) were added to DMEM / F-12 (Gibco, USA) medium supplemented with 10% (v / v) FBS and 1% antibody (Jeil Biotechservices, Korea). Cultured at 37 ° C. and 5% CO ₂ . The cells were seeded in 96-well plates (Nunc, Denmark) at a density of 15,000 cells / well, followed by incubation for an additional 24 hours.

<4-2> Aβ _1-42 Fibril formation of Fibrillogenesis )

20 micromolar Aβ _1-42 was dissolved in PBS, incubated at 37 ° C. with a final dose of 300 μl, and 20 μl was removed and mixed with 80 μl of 5 μM ThT (Sigma, USA) prepared by dissolving freshly in PBS. Fluorescence was measured using a Microplate Spectrofluorometer (Molecular Devices, USA) at 445 nm (excitation) and 490 nm (emission).

<4-3> Aβ _1-42 Secondary structure

20 μl of Aβ _1-42 purified by the method of Example 2-2 was dissolved in PBS, followed by incubation at 37 ° C. for 24 hours, and the spectrum was immediately recorded.

Specifically, Far UV circular dichroism (CD) using a Jasco J-810 Spectropolarimeter (Jasco Co., Japan) with a 1 mm optical path length cuvette at 0.5 nm intervals between 190 and 250 nm at 25 ° C. Recorded. Five cumulative displayed powers were averaged to obtain 0.1 nm resolution, 0.5-s reaction time and 50 nm / min scan rate.

<4-4> MTT  inspection

Cells cultured by the method of Example 4-1 were treated with Aβ _1-42 and Aβ _1-40 purified by the method of Example 3-2 at a concentration of 0 to 10 μM, followed by MTT reduction assay. It was confirmed.

Specifically, 20 μl of a 5 mg / ml MTT solution (Sigma, USA) was added to 100 μl of cell culture in a 96-well plate, followed by incubation for 2 hours in a CO ₂ incubator. Then 100 μl of 20% SDS solution dissolved in 50% DMF (pH4.7; Sigma, USA) was added. After a further 16 hours of incubation, the absorbance was measured at 570 nm using a microplate reader (Molecular Devices, USA).

As a result, the purified Aβ _1-42 peptide as shown in Figure 4 did not change the biophysical and biological properties. Fibrillogenesis kinetics tested by ThT assay (FIG. 4A), formation of β-sheets measured by CD spectroscopy (FIG. 4B) and cytotoxicity against SH-SY5Y cells (FIG. 4C) Consistent with previous reports (Lee EK et al . , Protein Expr Purif 40: 183-189, 2005; Naiki H et al . , Lab Invest 74: 374-38, 1996; Kirkitadze MD et al . , J Mol Biol 312: 1103-1119, 2001). Aβ _1-40 also showed biological activity, but the activity of Tat-humanine was not biologically tested due to the phenomenon of aggregation when added to the cell culture (no data).

1 is a diagram showing a construct for overexpressing GroES-ubiquitin-Aβ _1-42 fusion protein and results of overexpression:

a: structure diagram around ubiquitin;

b: expression of GroES-ubiquitin-Aβ _1-42 (S: water soluble cell lysate, P: insoluble fraction); And,

c: Expression of GroES-ubiquitin-Aβ1-40 and GroES-ubiquitin-humanin (S: water soluble cell lysate, P: insoluble fraction).

Figure 2 shows the cleavage results of the GroES-ubiquitin-Aβ _1-42 fusion protein by Usp2-cc in urea conditions:

a: Cleavage results according to urea concentration and enzyme: substrate ratio (lanes 1 and 5 are free of Usp2-cc; lanes 2 and 6 are Usp2-cc: fusion protein = 1:25; lanes 3 and 7 are Usp2-cc: fusion Protein = 1: 50, lanes 4 and 8 are Usp2-cc: fusion protein = 1: 100); And,

b: cleavage effect according to pH control (Usp2-cc: fusion protein = 1:50).

3 shows the results of purification of Aβ _1-42 and several peptides:

a: SDS-PAGE (lane 1 is GroES-ubiquitin-Aβ _1-42 protein; lane 2 is a fusion protein cleaved by Usp2-cc; lane 3 is purified Aβ _1-42 ; lane 4 is purified Aβ _{1- 40} lane 5 is Tat-humanine); And,

b: RP-HPLC.

4 is a diagram showing fibrillogenesis, secondary structure and biological activity of Aβ _1-42 (three replicates):

a: increase in ThT-fluorescence of time-dependent Aβ _1-42 (RFU: relative amount of fluorescent unit);

b: CD spectra recordings of new Aβ _1-42 (solid line) and aggregated Aβ _1-42 (dashed line); And,

c: Cytotoxicity of Aβ _1-42 in SH-SY5Y cells.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION, ChoSun University <120> Method for preparation of peptides by using deubiquitylating          enzyme which is stable in presence of high concentration of urea <130> 7P-11-03 <160> 16 <170> KopatentIn 1.71 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GroES antisense primer <400> 1 aagtccgctc tattcttgat gcggatcccg 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GroES sense primer <400> 2 ggaattccat atgaatattc gtccattgca 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ubiquitin antisense primer <400> 3 ccgctcgagt cacgctatga caacaccgcc 30 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> ubiquitin sense primer <400> 4 cgcggatccc agatctttgt gaaga 25 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A beta 1-42 site-mutation sense primer <400> 5 ctccgcggtg gagatgcagg attc 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> A beta 1-42 site-mutation antisense primer <400> 6 ggatcctgca tctccaccgc ggag 24 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> A beta 1-42 sense primer <400> 7 cgcggatccc agatctttgt gaagac 26 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> A beta 1-42 antisense primer <400> 8 ccgctcgagt cacgctatga caacaccgcc 30 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A beta 1-40 sense primer <400> 9 gggggagtat gaatcgccct c 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> A beta 1-40 antisense primer <400> 10 gaggccgatt catactcccc c 21 <210> 11 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Tat-humanin overlap antisense primer 1 <400> 11 aaaaccacgc ggcgccatac gacgacgctg acgacgtttt ttacgtccac cgcggaggcg 60 caa 63 <210> 12 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Tat-humanin overlap antisense primer 2 <400> 12 atcaatttca ccggtcagca gcagcaggca gctaaaacca cgcggcgcca t 51 <210> 13 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> Tat-humanin overlap antisense primer 3 <400> 13 ccgctccagt cacgcacgac gtttcaccgg cagatcaatt tcaccggtca g 51 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Tat-humanin sense primer <400> 14 cgcggatccc agatctttgt gaagac 26 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Usp2-cc forward primer <400> 15 cgtggatcct ctgctcacca aagccaagaa ttc 33 <210> 16 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Usp2-cc reverse primer <400> 16 tccggatcct tacatacggg agggtggact g 31  

Claims (12)

A gene construct comprising a polynucleotide encoding a fusion protein of a fusion partner, ubiquitin and a foreign peptide. The fusion partner of claim 1 is a maltose binding protein (MBP), glutathione-S-transferase (GST), thioredoxin (Trx), NusA and GroES. Gene construct selected from the group consisting of. The gene construct according to claim 1, wherein ubiquitin is cleaved by a deubiquitylating enzyme (Usp2-cc). The gene construct of claim 1, wherein the foreign peptide has a biological activity selected from the group consisting of antigen, antibody, cell receptor, enzyme, structural protein, serum and cellular protein. The gene construct according to claim 1, wherein the foreign peptide is a prone protein. The gene construct of claim 5, wherein the prone protein is selected from Aβ _1-42 , Aβ _1-40, and Tat-humanin. An expression vector operably comprising the gene construct of claim 1. 1) preparing a transformant by introducing the expression vector of claim 7 into a host cell; 2) culturing the transformant of step 1) to induce expression of and obtain a recombinant fusion protein; 3) suspending the recombinant fusion protein of step 2) in a lysate comprising 2-4 M urea; And, 4) preparing a water-soluble foreign peptide in its original form, comprising the step of treating the suspension of step 3) with a deubiquitylating enzyme (hereinafter referred to as Usp2-cc) to cleave the fusion protein and obtain the foreign peptide. Way. The method according to claim 8, wherein the urea of step 3) is included at a concentration of 2.5 to 3.5 M. The method of claim 8, wherein the urea of step 3) is included at a concentration of 3 M. The method of claim 8, wherein the solution of step 3) is characterized in that the pH of 6.5 to 10.5. A water-soluble foreign peptide in its original form prepared by the method of claim 8.

Images