KR20090011636A - Method for individualization and brand discrimination test in pig uising microsatellite marker - Google Patents

Method for individualization and brand discrimination test in pig uising microsatellite marker Download PDF

Info

Publication number
KR20090011636A
KR20090011636A KR1020070075426A KR20070075426A KR20090011636A KR 20090011636 A KR20090011636 A KR 20090011636A KR 1020070075426 A KR1020070075426 A KR 1020070075426A KR 20070075426 A KR20070075426 A KR 20070075426A KR 20090011636 A KR20090011636 A KR 20090011636A
Authority
KR
South Korea
Prior art keywords
seq
pig
dna
primer
microsatellite
Prior art date
Application number
KR1020070075426A
Other languages
Korean (ko)
Other versions
KR100925036B1 (en
Inventor
전진태
이정규
임현태
김재환
서보영
이상호
이재봉
김효선
Original Assignee
경상대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상대학교산학협력단 filed Critical 경상대학교산학협력단
Priority to KR1020070075426A priority Critical patent/KR100925036B1/en
Publication of KR20090011636A publication Critical patent/KR20090011636A/en
Application granted granted Critical
Publication of KR100925036B1 publication Critical patent/KR100925036B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis

Abstract

A method for identifying of pig entity using microsatellite marker is provided to distinguish quickly and effectively the pig entity by performing multiplex PCR using the microsatellite marker specific to the pig. A method for identifying of pig entity comprises steps of: (a) multiplex PCR-amplifying a nucleic acid sample for analysis to microsatellite markers selected from a group consisting of SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24,SW951, S0026, SW632, SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24,SW951, S0026, SW632, S0301, SW122, S0225, SW769 and SW787 by using specific primer; detecting product amplified in step (a) through electrophoresis system; (c) and detecting allele and determining genotype.

Description

마이크로새틀라이트 마커를 이용한 돼지의 개체식별 및 브랜드육 식별 방법{Method for individualization and brand discrimination test in pig uising microsatellite marker}Method for individualization and brand discrimination test in pig uising microsatellite markers using microsatellite markers

본 발명은 마이크로새틀라이트 마커를 이용한 돼지의 개체식별 및 브랜드육식별 방법에 관한 것이다. 보다 구체적으로, 본 발명은 효과적인 돼지의 개체식별 및 브랜드육 식별을 위해 선발된 마이크로새틀라이트 마커 조합에 특이적인 프라이머를 이용하여 멀티플렉스 PCR을 수행하는 것을 특징으로 하는 돼지의 개체식별 및 브랜드육 식별 방법에 관한 것이다.The present invention relates to a pig individual identification and brand meat identification method using a microsatellite marker. More specifically, the present invention is to identify the individual identification and brand meat of pigs, characterized in that to perform multiplex PCR using primers specific for the combination of the microsatellite markers selected for effective identification and brand meat identification of pigs It is about a method.

돼지는 세계적으로 사람이 필요로 하는 단백질 섭취를 위한 가장 기본적인 가축으로 각각의 시대와 상황 및 사람들의 기호에 따라 사육되어 왔으며, 우리나라의 경우 돼지고기 중 특정부위만을 선호하는 경향을 가지고 있다. Pigs are the most basic livestock for human consumption of protein, which has been raised according to each age, situation and people's preference. In Korea, there is a tendency to prefer only a certain portion of pork.

현재 돼지고기의 경우 특정부위를 포함해 수입이 되고 있는 상황이고 또한 국내에서 생산되는 돼지고기는 수많은 브랜드가 만들어져 브랜드육으로 판매되고 있다. 하지만 돼지고기는 육안적 식별이 불가능하다는 점을 악용하여 일부 부도덕한 유통업자들이 수입육(냉장 및 냉동육) 및 비 브랜드육 등을 브랜드육으로 둔갑 유통시키는 사례가 빈번히 발생하고 있으나 둔갑유통을 방지하기 위한 과학적인 감식기법이 전무한 상황으로 과학적 감식기법 개발을 통한 건전한 유통문화 정착이 절실히 요구되는 실정이다.Currently, pork is being imported including certain parts, and domestically produced pork is made of many brands and sold as branded meat. However, due to the fact that pork is not visually identifiable, some immoral distributors frequently distribute imported meat (chilled and frozen meat) and non-branded meat as branded meat. As there is no scientific recognition technique, it is urgently needed to establish a sound distribution culture by developing scientific recognition techniques.

쇠고기의 경우 2007년 생산이력제 시범사업의 일환으로 DNA 마커를 이용한 개체판별 사업이 진행될 예정이나 아직 돼지고기 생산이력에 관련된 연구 등이 국내에서 미비하여 산업에 직접 활용 가능한 기술이 개발되지 못하고 있어 브랜드육의 신뢰성을 높이고 정확한 부정육 식별을 위하여 돼지에 적합한 DNA 마커 개발이 필요하다.In the case of beef, the individual discrimination business using DNA marker is scheduled to proceed as part of the pilot project in 2007, but the research on pork production history is still insufficient in Korea. Development of DNA markers suitable for pigs is necessary to increase the reliability of the meat and to accurately identify the meat.

마이크로새틀라이트들은 1990년경부터 동물의 계통분류, 유전적 유연관계 분석 연구에 있어 가장 효율적인 분자 마커로 활용되고 있으며, 2000년 이후 개, 고양이등 애완동물과 연어등 어류에서는 마이크로새틀라이트를 이용하여 특정 개체의 품종식별에 사용하고 있다. 최근에는 특정 개체의 품종식별을 위하여 마이크로새틀라이트의 실험결과를 활용한 다양한 통계분석기법(Bayseian, Frequency, Dc genetic distance활용기법)들이 제안되었으며, 가축의 경우 국제동물유전학회(http://www.isag.org.uk/02_PVpanels_LPCGH.doc), Rosline 연구소(http://www. projects.roslin.ac.uk/cdiv/markers.html) 등에서 권장하는 40 여종의 마이크로새 틀라이트를 사용하여 대립유전자의 다형성이 과다하게 편귀되어 있지 않은 특성을 이용하여 생산이력제, 친자감별과 계통유전학등에 광범위하게 활용되고 있다.Microsatellites have been used as the most efficient molecular markers for animal phylogeny and genetic flexibility analysis since around 1990.Since 2000, microsatellites have been used in pets such as dogs and cats and fish such as salmon. Used to identify breeds of individuals. Recently, various statistical analysis techniques (Bayseian, Frequency, Dc genetic distance utilization techniques) using microsatellite experiments have been proposed for the identification of breeds of specific individuals. In the case of livestock, the International Society of Animal Genetics (http: // www) allele using over 40 microsatellites recommended by .isag.org.uk / 02_PVpanels_LPCGH.doc) and Rosline Institute (http://www.projects.roslin.ac.uk/cdiv/markers.html) It is widely used in production history system, paternity discrimination, and phylogenetics because it is not excessively biased.

이에 본 발명자들은 마아크로새틀라이트 마커를 이용한 돼지의 개체식별 및 브랜드육 식별 방법을 연구하던 중, 다형성지수가 높은 마이크로새틀라이트 마커를 선발하고 이에 특이적인 프라이머를 이용하여 멀티플렉스 PCR을 수행하면 신속하고 효과적으로 돼지 개체를 식별할 수 있을 뿐만 아니라 친자감별 및 브랜드육 식별에도 매우 유용함을 확인함으로써 본 발명을 완성하였다. Therefore, the inventors of the present invention, while studying a method for identifying individuals and brand meat of pigs using a macrosatellite marker, select a microsatellite marker with a high polymorphism index and perform multiplex PCR using specific primers. The present invention was completed by confirming that pigs can effectively identify pig individuals as well as very useful for paternity identification and brand meat identification.

따라서 본 발명의 목적은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머를 이용하여 멀티플렉스 PCR을 수행하는 것을 특징으로 하는 돼지 개체의 식별방법을 제공하는 것이다.Therefore, it is an object of the present invention to provide a pig individual identification method characterized by performing a multiplex PCR using a primer specific for a pig microsatellite marker.

또한, 본 발명의 목적은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머를 포함하는 돼지 개체 식별용 키트를 제공하는 것이다.It is also an object of the present invention to provide a pig individual identification kit comprising a primer specific for a pig microsatellite marker.

또한, 본 발명의 목적은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머 세트를 제공하는 것이다.It is also an object of the present invention to provide primer sets specific for pig microsatellite markers.

또한, 본 발명의 목적은 상기 키트를 이용한 브랜드육의 식별방법을 제공하는 것이다.It is also an object of the present invention to provide a method of identifying brand meat using the kit.

상기와 같은 목적을 달성하기 위하여, 본 발명은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머를 이용하여 멀티플렉스 PCR을 수행하는 것을 특징으로 하는 돼지 개체의 식별방법을 제공한다.In order to achieve the above object, the present invention provides a method for identifying a pig individual, characterized in that to perform multiplex PCR using a primer specific for a pig microsatellite marker.

또한, 본 발명은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머를 포함하는 돼지 개체 식별용 키트를 제공한다.The present invention also provides a kit for identifying a pig individual comprising a primer specific for a pig microsatellite marker.

또한, 본 발명은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머 세트를 제공한다.The present invention also provides primer sets specific for pig microsatellite markers.

또한, 본 발명은 상기 키트를 이용한 브랜드육의 식별방법을 제공한다.In addition, the present invention provides a method of identifying brand meat using the kit.

이하, 본 발명을 상세히 설명하기로 한다.Hereinafter, the present invention will be described in detail.

본 발명에서 사용된 용어 "마이크로새틀라이트(Microsatellites)"란 진핵세포(eukaryotes) 유전자 전역에 걸쳐 분포하는 모노-, 디-, 트리- 및 테트라뉴클레오타이드 형태의 짧은 반복 염기서열을 의미한다. 일반적으로 이러한 반복 서열은 염색체 내에서 10 내지 40 번 정도 단순반복 (tandem repeat)된 형태로 존재한다.As used herein, the term "microsatellites" refers to short repeat sequences in the form of mono-, di-, tri- and tetranucleotides distributed throughout the eukaryotes gene. In general, such repeat sequences are present in a tandem repeat of about 10 to 40 times in the chromosome.

본 발명에서 사용된 용어 "마이크로새틀라이트 마커"란 마이크로새틀라이트를 이용한 DNA 다형검출 마커를 말한다.As used herein, the term “microsatellite marker” refers to a DNA polymorphism detection marker using microsatellite.

본 발명에서 사용된 용어 "DNA 다형(Polymorphism)"이란 동일종간 생물개체 의 특이적 DNA 구조의 다양성을 말한다.As used herein, the term "DNA polymorphism" refers to the diversity of specific DNA structures of the same species of organism.

본 발명에서 사용된 용어 "프라이머"는 본 발명에서 선발한 마이크로새틀라이트의 핵산서열을 특이적으로 증폭할 수 있는 올리고뉴클레오타이드 (oligonucle tide)를 의미한다. 본 발명에서는 본 발명에서 선발한 마이크로새틀라이트 마커의 핵산서열을 증폭할 수 있는 것이라면 당업자가 디자인할 수 있는 모든 프라이머가 본 발명의 프라이머 범위에 포함된다. As used herein, the term “primer” refers to an oligonucleotide that can specifically amplify the nucleic acid sequence of the microsatellite selected in the present invention. In the present invention, all primers that can be designed by those skilled in the art are included in the primer range of the present invention as long as the nucleic acid sequence of the microsatellite marker selected in the present invention can be amplified.

본 발명에서 사용된 용어 "PCR 반응 혼합물"은 DNA 폴리머라제 및 완충용액을 포함하여 PCR를 수행하기 위해 사용되는 분자생물학적 시약(molecular biological reagent)을 의미한다.As used herein, the term "PCR reaction mixture" refers to a molecular biological reagent used to perform PCR, including DNA polymerase and buffer solution.

본 발명에서 사용된 용어 "브랜드육"이란 품질 및 위생·안전성을 보증할 수 있고, 사업주체가 명확하며, 상표등록이 되어 있는 돈육을 일컫는다.The term "branded meat" used in the present invention refers to pork that can guarantee quality and hygiene and safety, and that the business entity is clear and registered trademark.

본 발명의 돼지 개체의 식별방법은 돼지의 다형성 분석용 마이크로새틀라이트 마커에 특이적인 프라이머를 이용하여 멀티플렉스 PCR을 수행하는 것을 특징으로 한다. Identification method of the pig individual of the present invention is characterized in that the multiplex PCR is performed using a primer specific for the microsatellite marker for polymorphism analysis of the pig.

상기 돼지의 다형성 분석용 마커로는 SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 및 SW787로 이루어진 군 중에서 선택된 13개 이상을 사용할 수 있다The marker for the polymorphism analysis of the pig is SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 and SW787 13 or more can be used.

가장 바람직하게는, 돼지의 다형성 분석용 마커로는 S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 및 SW787로 이루 어진 13개의 마커를 사용할 수 있다.Most preferably, 13 markers consisting of S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 and SW787 may be used as markers for polymorphism analysis of swine.

또한, 돼지의 다형성 분석용 마커로는 성감별 마커 PIG_X 및 PIG_Y를 추가로 포함할 수 있다.In addition, the marker for analyzing the polymorphism of the pig may further include sex discrimination markers PIG_X and PIG_Y.

상기 마이크로새틀라이트 마커에 특이적인 프라이머로는 마이크로새틀라이트 DNA의 3' 및 5' 부위에 인접한 50 내지 300 bp 부위에 위치한 10 내지 50 bp의 연속된 각 폴리뉴클레오타이드를 포함할 수 있다.Primers specific for the microsatellite markers are adjacent to the 3 'and 5' regions of the microsatellite DNA. And 10 to 50 bp of each contiguous polynucleotide located at a 50 to 300 bp site.

바람직하게는, 특히 본 발명의 역방향 프라이머는 상기 마이크로새틀라이트 마커에 특이적이면서 5' 말단에 특정 서열이 추가된 것일 수 있다. 상기 역방향 프라이머의 5' 말단에 특정 서열의 추가는 스터터 밴드(stutter band)로 인한 증폭산물의 분석 오류를 제거함으로써 신속하고 효과적으로 돼지 개체를 식별할 수 있도록 해준다. 보다 바람직하게는, 본 발명의 역방향 프라이머는 5' 말단에 GTTTCT 염기가 추가된 것일 수 있다.Preferably, in particular, the reverse primer of the present invention may be specific to the microsatellite marker and have a specific sequence added at the 5 'end. The addition of a specific sequence at the 5 'end of the reverse primer allows for quick and effective identification of swine individuals by eliminating analysis errors of amplification products due to stutter bands. More preferably, the reverse primer of the present invention may be a GTTTCT base added to the 5 'end.

본 발명자들은 돼지를 신속하고 효과적으로 식별할 수 있도록 하기 위해 다형성지수가 높은 마이크로새틀라이트 마커를 선발하였다.We have selected a microsatellite marker with a high polymorphism index in order to identify pigs quickly and effectively.

즉, 본 발명의 일 실시예에서는 17개의 돼지의 다형성 분석용 마이크로새틀라이트에 특이적인 프라이머를 각각 제조하고(실시예 2 참조), 이를 이용하여 돼지로부터 유래된 DNA 시료(실시예 1 참조)를 멀티플렉스 PCR에 의해 증폭한 다음(실시예 3 참조), 이들의 다형성 지수를 계산하였다(실시예 4 참조). 그 다음 17개의 마이크로새틀라이트 중 He 추정치를 근거로 하여 다형성지수가 높은 13개의 마이크로새틀라이트를 선발하였으며, 상기에서 선발한 마이크로새틀라이트에 성감별 마이크로새틀라이트를 추가하여 15개의 마이크로새틀라이트 마커를 이용하여 PCR 증폭을 수행하고 이들의 동일개체 출현확률 및 친자감별확률을 계산하였다(실시예 6 참조). 그 결과, 다형성지수가 높은 13개의 마이크로새틀라이트를 이용하여도 개체식별 및 친자감정이 가능한 추정치를 나타내였으므로 경제적인 면을 고려한다면 13개의 마이크로새틀라이트를 이용하는 것이 유용함을 알 수 있었다(표 4 참조).That is, in one embodiment of the present invention, each of the primers specific for microsatellite analysis for the polymorphism analysis of 17 pigs was prepared (see Example 2), and DNA samples derived from pigs (see Example 1) were used therein. After amplification by multiplex PCR (see Example 3), their polymorphism indices were calculated (see Example 4). Of the 17 microsatellites, 13 microsatellites with high polymorphism were selected on the basis of the He estimate, and 15 microsatellite markers were added by adding sex-sensitive microsatellites to the microsatellites selected above. PCR amplification was performed and the probability of appearance of the same individuals and the probability of paternity were calculated (see Example 6). As a result, 13 microsatellites with high polymorphism indexes showed estimates of individual identification and paternity. Therefore, it is useful to use 13 microsatellites in consideration of economic considerations (see Table 4). ).

따라서, 본 발명은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머를 이용하여 멀티플렉스 PCR을 수행하는 것을 특징으로 하는 돼지 개체의 식별방법을 제공한다.Accordingly, the present invention provides a method for identifying a pig individual, characterized in that the multiplex PCR is performed using a primer specific for a pig microsatellite marker.

바람직하게는, 본 발명에 따른 돼지 개체의 식별방법은 (a) 분석하고자 하는 핵산 시료를 SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 및 SW787로 이루어진 군 중에서 선택된 13개 이상의 마이크로새틀라이트 마커에 특이적인 프라이머를 이용하여 멀티플렉스 PCR 증폭하는 단계; 및 Preferably, the identification method of the pig individual according to the present invention (a) the nucleic acid samples to be analyzed SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122 , Consisting of S0225, SW769 and SW787 13 or more selected from Multiplex PCR amplification using primers specific for microsatellite markers; And

(b) 상기 (a) 단계에서 증폭된 산물을 전기영동장치를 통해 검출하여 대립유전자를(allele) 검출하고 유전자형을 결정하는 단계를 포함한다.(b) detecting the allele and determining the genotype by detecting the product amplified in step (a) through an electrophoresis device.

상기 (a) 단계에서 분석하고자 하는 핵산 시료는 생물학적 시료로부터 분리 될 수 있다. 상기 생물학적 시료로는 혈액 및 생물학적 기원의 기타 액상 샘플, 생검 표본, 모근, 조직 배양과 같은 고형 조직 샘플 또는 이로부터 유래된 세포 및 그 자손이 포함된다. 또한, 상기 샘플들은 시약처리, 가용화된 샘플 또는 배양세포, 세포 상등액 및 세포 용해물도 포함한다. The nucleic acid sample to be analyzed in step (a) can be separated from the biological sample. Such biological samples include solid tissue samples such as blood and other liquid samples of biological origin, biopsy samples, hair roots, tissue cultures or cells derived therefrom and their progeny. The samples also include reagent treatment, solubilized samples or cultured cells, cell supernatants and cell lysates.

상술한 생물학적 시료로부터 핵산의 분리는 당업계에 공지된 방법에 따라 수행할 수 있다. 본 발명의 일 실시예에서는 돼지의 혈액으로부터 게놈 DNA 추출 키트(Promega, USA)를 사용하여 게놈 DNA를 분리하여 사용하였다(실시예 1 참조).Isolation of nucleic acids from the biological samples described above can be performed according to methods known in the art. In one embodiment of the present invention, genomic DNA was isolated from pig blood using a genomic DNA extraction kit (Promega, USA) (see Example 1).

상기 (a) 단계에서 마이크로새틀라이트 마커는 가장 바람직하게는, S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 및 SW787로 이루어진 13개의 마커를 사용할 수 있다. In the step (a), the microsatellite marker may be most preferably 13 markers consisting of S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 and SW787. .

또한, 상기 (a) 단계의 마이크로새틀라이트 마커는 성감별 마커 PIG_X 및 PIG_Y를 추가로 포함할 수 있다.In addition, the microsatellite marker of step (a) may further include sex identification markers PIG_X and PIG_Y.

한편, 멀티플렉스 PCR의 경우 PCR 증폭시 여러 개의 프라이머가 사용되므로 각각의 프라이머가 증폭될 때 서로 간에 간섭이 발생하여 각각의 프라이머가 완전하게 아데노신을 합성할 수 없게 하여 완전한 스터터 밴드를 제거한 증폭산물을 획득하기가 어렵다. 이는 개체식별을 위한 유전자형의 결정이 단계에서 오류가 발생할 수 있으며, 이 단계에서 오류는 개체식별의 의미를 퇴색시키는 결과를 가져오게 된다. 이에 본 발명자들은 이러한 오류를 최소화하기 위해 상기 마이크로새틀라이 트 마커에 특이적인 프라이머 중 역방향 프라이머의 5' 말단에 GTTTCT 염기를 추가하였다.On the other hand, in the case of multiplex PCR, multiple primers are used to amplify the PCR, and thus, when each primer is amplified, interference occurs with each other so that each primer cannot synthesize adenosine completely, thereby removing the complete stator band. Difficult to obtain. This can lead to errors at this stage of genotyping for identification, which at this stage results in fading the meaning of the identification. In order to minimize this error, the inventors added a GTTTCT base to the 5 'end of the reverse primer among the primers specific for the microsatellite marker.

따라서 바람직하게는 본 발명에서 사용되는 역방향 프라이머는 5' 말단에 GTTTCT 염기가 추가된 것일 수 있다. 바람직하게는, 본 발명의 프라이머로는 서열번호 1 내지 서열번호 34로 표시되는 염기서열을 가진 것일 수 있다.Therefore, preferably the reverse primer used in the present invention may be a GTTTCT base added to the 5 'end. Preferably, the primer of the present invention may have a nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 34.

가장 바람직하게는, 본 발명의 프라이머로는 서열번호 3 및 4, 서열번호 7 및 8, 서열번호 9 및 10, 서열번호 11 및 12, 서열번호 13 및 14, 서열번호 15 및 16, 서열번호 17 및 18, 서열번호 19 및 20, 서열번호 21 및 22, 서열번호 23 및 24, 서열번호 27 및 28, 서열번호 29 및 30, 서열번호 33 및 34로 표시되는 염기서열로 이루어진 것일 수 있다.Most preferably, the primers of the present invention include SEQ ID NO: 3 and 4, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, SEQ ID NO: 15 and 16, SEQ ID NO: 17 And 18, SEQ ID NOs: 19 and 20, SEQ ID NOs: 21 and 22, SEQ ID NOs: 23 and 24, SEQ ID NOs: 27 and 28, SEQ ID NOs: 29 and 30, and SEQ ID NOs: 33 and 34.

또한, 본 발명의 프라이머로는 서열번호 35 및 서열번호 36, 서열번호 37 및 서열번호 38로 표시되는 염기서열로 이루어진 프라이머를 추가로 포함할 수 있다.In addition, the primer of the present invention may further include a primer consisting of the nucleotide sequence represented by SEQ ID NO: 35 and SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38.

상기 프라이머의 염기서열의 일부를 다른 염기로 치환, 삭제하거나 일부 염기서열의 위치와 방향이 바뀐 염기서열도 본 발명에 따른 프라이머의 범위에 속한다.A base sequence in which a part of the base sequence of the primer is replaced with another base, deleted, or the position and orientation of some base sequence are also included in the scope of the primer according to the present invention.

또한, 본 발명의 프라이머는 형광물질로 표지될 수 있다. 형광물질로는 특별히 제한되지 않으나, 예를 들면, FAM, VIC, NED, PET 등이 있다.In addition, the primer of the present invention may be labeled with a fluorescent material. The fluorescent material is not particularly limited, and examples thereof include FAM, VIC, NED, PET, and the like.

상기 (a) 단계에서 멀티플렉스 PCR은 당업계에 공지된 방법에 따라 각 유전자를 증폭하기에 적합한 조건으로 수행될 수 있다. 바람직하게는 멀티플렉스 PCR 은 어닐링(Annealing) 온도, 증폭산물의 크기 등을 고려하여 수행할 수 있다. 본 발명의 일 실시예에서는 DNA 6.6㎍, 각각의 프라이머 쌍 8.25㎕, Hot starte Taq DNA 중합효소 1.8 unit((주)바이오니아), 10×완충용액 1.5㎕, dNTP 1.5㎕의 조성에 증류수를 첨가하여 최종 부피를 15㎕로 하였으며, PCR 조건은 95℃에서 15분간 처리한 후 94℃에서 60초, 55℃에서 75초, 72℃에서 60초를 1 사이클로 하여 4회 반복하고, 94℃에서 60초, 54℃에서 75초, 72℃에서 60초를 1 사이클로 하여 4회 반복 후 94℃에서 60초, 53℃에서 75초, 72℃에서 60초를 1 사이클로 하여 24회 반복하고 65℃에서 30분간 신장(extension) 후 4℃에서 종료하였다. In step (a), multiplex PCR may be performed under conditions suitable for amplifying each gene according to methods known in the art. Preferably, the multiplex PCR may be performed in consideration of annealing temperature, size of the amplification product, and the like. In one embodiment of the present invention, distilled water is added to a composition of 6.6 μg of DNA, 8.25 μl of each primer pair, 1.8 unit of Hot starte Taq DNA polymerase (Bionia), 1.5 μl of 10 × buffer solution, and 1.5 μl of dNTP. The final volume was 15 μl, and the PCR conditions were repeated 15 times at 95 ° C. for 15 minutes, followed by 60 cycles at 94 ° C., 75 seconds at 55 ° C., and 60 seconds at 72 ° C. for 1 cycle, and 60 seconds at 94 ° C. 4 cycles of 75 seconds at 54 ° C. and 60 seconds at 72 ° C., followed by 24 cycles of 60 seconds at 94 ° C., 75 seconds at 53 ° C., 60 seconds at 72 ° C., and 24 cycles at 65 ° C. for 30 minutes. After extension was terminated at 4 ° C.

(b) 단계에서 증폭된 PCR 산물의 크기 분석은 증폭된 산물을 자동 유전자 분석장비를 이용하여 분리하고, 각 좌위별 대립유전자(allele)의 크기를 분석함으로써 수행할 수 있다. 예를 들면, 증폭 산물의 크기는 통상의 방법, 예컨대 아가로즈 젤 또는 아크릴아마이드 젤을 이용한 전기영동으로 실시한 후, 전개된 DNA 단편을 형광 염색 등을 통하여 확인가능하다. 바람직하게는, 염기서열분석장치(Applied Biosystems사)에 대립유전자분석 모드를 이용하여 전기영동을 실시해 프라이머의 형광물질 및 PCR 산물의 크기별로 분류하는 방법을 통하여 확인할 수 있다. 상기 단계에서의 PCR 산물의 크기 분석 방법은 본 발명이 속하는 기술분야의 당업자라면 모두 실시가능하며, 상기 일예로 설명한 방법이외 통상의 모든 방법을 포함할 수 있다. Analysis of the size of the PCR product amplified in step (b) can be performed by separating the amplified product using an automatic genetic analysis equipment, and by analyzing the size of the alleles for each locus. For example, the size of the amplification products can be confirmed by conventional methods such as electrophoresis using agarose gels or acrylamide gels, and the developed DNA fragments can be identified through fluorescence staining and the like. Preferably, the sequencing device (Applied Biosystems, Inc.) may be identified by a method of classifying the fluorescent material and the PCR product by electrophoresis by using an allele analysis mode. The size analysis method of the PCR product in the above step can be carried out by those skilled in the art to which the present invention pertains, and can include all conventional methods other than the method described as an example.

다른 관점으로서, 본 발명은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머를 포함하는 돼지 개체 식별용 키트를 제공한다. 상기 본 발명에 따른 키트는 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머 및 PCR 반응 혼합물을 포함할 수 있다. 예를 들면, 본 발명의 키트는 프라이머, dNTP, Taq DNA 폴리머라아제 등으로 구성될 수 있다. 바람직하게는, 상기 마이크로새틀라이트 마커에 특이적인 프라이머는 역방향 프라이머의 5' 말단에 GTTTCT 염기가 추가된 것일 수 있다. In another aspect, the present invention provides a kit for identifying a pig individual comprising a primer specific for a pig microsatellite marker. The kit according to the present invention may include a primer and a PCR reaction mixture specific for a pig microsatellite marker. For example, the kit of the present invention may be composed of primers, dNTPs, Taq DNA polymerases, and the like. Preferably, the primer specific for the microsatellite marker may be a GTTTCT base added to the 5 'end of the reverse primer.

또한, 본 발명은 돼지의 마이크로새틀라이트 마커에 특이적인 프라이머 서열을 제공한다. 바람직하게는, 본 발명의 프라이머 서열은 상기 마이크로새틀라이트 마커에 특이적인 역방향 프라이머의 5' 말단에 GTTTCT 염기가 추가된 것이다. 보다 바람직하게는, 본 발명의 프라이머 서열은 SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 및 SW787로 이루어진 군 중에서 선택된 마이크로새틀라이트 마커에 특이적이며 5'말단에 GTTCT 염기가 추가된 것일 수 있다. 가장 바람직하게는 본 발명의 프라이머 서열은 서열번호 2, 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 10, 서열번호 12, 서열번호 14, 서열번호 16, 서열번호 18, 서열번호 20, 서열번호 22, 서열번호 24, 서열번호 26, 서열번호 28, 서열번호 30, 서열번호 32 및 서열번호 34로 이루어진 군 중에서 선택되는 염기서열로 이루어진 것일 수 있다.The present invention also provides primer sequences specific for pig microsatellite markers. Preferably, the primer sequence of the present invention is a GTTTCT base added to the 5 'end of the reverse primer specific for the microsatellite marker. More preferably, the primer sequence of the present invention is selected from the group consisting of SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 and SW787. The GTTCT base may be added at the 5 ′ end specific to the satellite marker. Most preferably, the primer sequence of the present invention is SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, It may be composed of a nucleotide sequence selected from the group consisting of SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, and SEQ ID NO: 34.

또한, 본 발명은 돼지의 성감별 마커 PIG_X 및 PIG_Y에 특이적인 프라이머 서열을 제공한다. 바람직하게는 상기 프라이머 서열은 서열번호 35 내지 서열번호 38로 이루어진 군 중에서 선택되는 염기서열로 이루어진 것일 수 있다.The present invention also provides primer sequences specific for pig sex discrimination markers PIG_X and PIG_Y. Preferably, the primer sequence may be made of a nucleotide sequence selected from the group consisting of SEQ ID NO: 35 to SEQ ID NO: 38.

한편, 본 발명에 따른 돼지 개체 식별 방법 및 키트는 브랜드육 유통 감시에 적용될 수 있다. 본 발명의 일 실시예에서 본 발명에서 선발한 13종의 마이크로새틀라이트 마커에 특이적인 프라이머쌍을 이용하여 실제로 출하되고 있는 브랜드육의 대립유전자형을 분석하고 친자감별을 실시한 결과, 100% 부모를 찾을 수 있는 결과를 나타었다(표 5 참조).On the other hand, pig individual identification method and kit according to the invention can be applied to brand meat distribution monitoring. In an embodiment of the present invention, allele types of the brand meats actually shipped by using primer pairs specific to 13 kinds of microsatellite markers selected in the present invention were analyzed and paternity was identified. As a result, 100% parents were found. Possible results were shown (see Table 5).

따라서, 본 발명은 (a) 부돈 및 모돈의 DNA의 대립유전자형을 분석하고 이를 데이터베이스로 구축하는 단계;Accordingly, the present invention comprises the steps of: (a) analyzing alleles of DNA of piglets and sows and constructing them into a database;

(b) 상기 (a) 단계의 부돈 및 모돈으로부터 계통출하된 자돈의 DNA를 소비단계에서 샘플링하는 단계;(b) sampling the DNA of piglets inherited from the piglets and sows of step (a) at the consumption stage;

(c) 상기 (b) 단계에서 수득한 자돈의 DNA 대립유전자형을 분석하는 단계;(c) analyzing the DNA allele type of the piglets obtained in step (b);

(d) 상기 (a) 단계의 부돈 및 모돈의 DNA 데이터베이스와 상기 (b) 단계의 자돈의 대립유전자형을 기초로 하여 친자감별을 수행하는 단계를 포함하는 브랜드육의 식별방법을 제공한다. 이에 대한 흐름도는 도 2에 나타낸 바와 같다.(d) provides a method of identifying brand meat, comprising performing paternity discrimination based on the DNA database of the piglets and sows of step (a) and the alleles of the piglets of step (b). The flowchart for this is as shown in FIG. 2.

상기 (a) 및 (c) 단계에서 대립유전자형의 분석은 본 발명에 따른 돼지 개체 식별용 키트를 이용하여 멀티플렉스 PCR을 수행하고 수득된 PCR 산물을 염기서열분 석장치(Applied Biosystems사)에서 대립유전자분석 모드를 이용하여 전기영동을 실시하여 프라이머의 형광물질 및 PCR 산물의 크기별로 분류하는 방법으로 수행할 수 있다. 측정된 대립유전자형에 대한 정보 및 부돈 및 모돈에 대한 정보는 데이터베이스화한다.The analysis of alleles in steps (a) and (c) is performed by multiplex PCR using a pig individual identification kit according to the present invention, and the PCR products obtained are alleles in a sequencing device (Applied Biosystems). Electrophoresis may be performed using a gene analysis mode to classify by fluorescent material and PCR product size of the primer. Information on allele types measured and information on piglets and sows are databased.

상기 (b) 단계에서 출하된 자돈의 DNA 샘플링은 유통업체를 통한 판매, 식당판매 및 정육점 판매 등의 유통망을 통한 소비 단계에서 소비자가 브랜드육 관리자에서 의뢰함으로써 수행될 수 있다. DNA 샘플링 방법은 식당이나 정육점에서 판매되는 고기를 구입한 소비자가 의뢰를 하거나 브랜드육 관리자가 판매점의 판매처에서 샘플링하여 분석기관 등에 샘플링한 조직을 의뢰하면 당업계에 공지된 방법을 사용하여 DNA를 추출 할 수 있다. 예를 들면 이에 한정되지는 않으나 SPK 버퍼(27% sucrose, 1x SSC, 1mM EDTA, 1% SDS, add ddH2O) 2ml에 조직 2g을 첨가한 후 균질화기(homogenizer)를 이용하여 조직을 잘게 분쇄하고 37℃ 배양기에 하룻밤(overnight) 동안 처리한다(최초 2시간동안 30분 간격으로 인버팅). 상기 용액에 RNase(10mg/ml) 2ul 첨가 후 37℃에서 2시간 동안 배양하고, 이후 ProteinaseK(25mg/ml) 5ul 첨가 후 37℃에서 2시간 동안 배양시킨다. 배양된 용액을 상온에 꺼내어 식힌 후 배양된 용액의 2배의 페놀(25 : 24: 1 = phenol : Chloroform: Isoamyl Alcohol)을 첨가하고, 두 층이 잘 섞이도록 교반시킨 후 13,000rpm에서 15분간 원심분리 한다. 원심분리 후 분리된 두 층에서 상층액 만을 취하여 새로운 용기로 옮기고, 새로운 용기로 옮긴 시료의 양과 동일한 양의 에탄올(100%)을 첨가한 후 13,000rpm에서 5분간 원심분리 한다. 원심분리 후 에탄 올(100%)을 제거하고, 새로운 에탄올(70%)을 첨가하여 침전된 DNA를 세척한 다음 에탄올(70%)을 조심스럽게 제거하고 상온에서 에탄올이 없어질 때까지 건조시킨 후 TE 버퍼(pH 8.0)에 DNA를 녹이는 방법으로 샘플링한 시료로부터 DNA시료를 채취할 수 있다. DNA sampling of piglets shipped in step (b) may be performed by a consumer requesting from a brand meat manager in a consumption phase through a distribution network such as sales through a distributor, restaurant sales, and butcher shop sales. The DNA sampling method is requested by a consumer who purchased meat sold in a restaurant or a butcher shop, or when a brand meat manager requests a tissue sampled from a retailer's sales office and an analytical institution, and extracts DNA using a method known in the art. can do. For example, but not limited to, 2 g of tissue is added to 2 ml of SPK buffer (27% sucrose, 1x SSC, 1 mM EDTA, 1% SDS, add ddH2O), and then finely crushed using a homogenizer and 37 The overnight incubator is incubated (inverted at 30 minute intervals for the first 2 hours). After adding 2ul of RNase (10mg / ml) to the solution, incubated for 2 hours at 37 ° C, and then adding 5ul of ProteinaseK (25mg / ml) for 2 hours at 37 ° C. After cultivating the incubated solution at room temperature and cooling, 2 times phenol (25: 24: 1 = phenol: Chloroform: Isoamyl Alcohol) of the incubated solution was added, and the mixture was stirred to mix well and centrifuged at 13,000 rpm for 15 minutes. Separate. After centrifugation, take only the supernatant from the two separated layers, transfer to a new container, add the same amount of ethanol (100%) as the amount of the sample transferred to a new container, and centrifuge at 13,000 rpm for 5 minutes. After centrifugation, ethanol (100%) was removed, fresh ethanol (70%) was added to wash the precipitated DNA, and ethanol (70%) was carefully removed and dried until the ethanol disappeared at room temperature. DNA samples can be collected from samples sampled by melting DNA in a TE buffer (pH 8.0).

상기 (d) 단계에서 친자감별은 당업계에 공지된 방법을 사용할 수 있으며, 예를 들면 이에 한정되지는 않으나 부모돈들의 대립유전자형의 정보가 저장되어 있는 데이터베이스의 자료와 친자감별 대상 샘플(자돈으로 생각되는 개체)의 대립유전자형을 일반적인 친자감별 프로그램(예, PAPA 2.0, GeneClass 2)에 적용하여 부모들의 대립유전자형 중 비교대상개체의 대립유전자형과 가장 높은 동일성을 가진 부모돈을 찾는 방법에 의해 수행될 수 있다.In step (d), paternity discrimination may use methods known in the art, for example, but not limited thereto, data of a database in which allele-type information of parental pigs is stored, and a sample for paternity discrimination (with piglets). The allele of the suspected individual) is applied to a general paternity discrimination program (e.g. PAPA 2.0, GeneClass 2) to find parental money that has the highest identity with the allele of the comparative entity among the alleles of the parents. It may be carried out by the method.

또한, 본 발명은 (a) 생산단계에서 계통출하돈의 DNA 대립유전자형을 분석하고 이를 데이터베이스로 구축하는 단계;In addition, the present invention comprises the steps of (a) analyzing the DNA alleles of the phylogenetic pig in the production step and constructing them into a database;

(b) 도축단계, 유통단계 및 소비단계로 이루어진 군 중에서 선택된 어느 단계에서 자돈의 DNA를 샘플링하여 대립유전자형을 분석하는 단계; 및(b) analyzing the allele type by sampling the DNA of the piglets at any stage selected from the group consisting of slaughter, distribution and consumption steps; And

(c) 상기 (a) 단계의 계통출하돈의 DNA 대립유전자형과 상기 (b) 단계의 자돈의 DNA 대립유전자형을 비교하여 동일성여부를 검증하는 단계를 포함하는 브랜드육의 식별방법을 제공한다. 이에 대한 흐름도는 도 3에 나타낸 바와 같다.(c) comparing the DNA allele of the phylogenetic pig of step (a) with the DNA allele of the piglet of step (b) to verify identity. The flowchart for this is as shown in FIG. 3.

상기 (a) 단계는 농가에서 출하전에 돼지의 모근 및 조직으로부터 DNA를 채 취하여 대립유전자형을 분석하는 단계이다. DNA의 채취는 당업계에 공지된 방법을 사용할 수 있다.Step (a) is a step of analyzing the alleles by collecting DNA from pig hair roots and tissues before shipment from the farm. DNA can be collected using methods known in the art.

상기 (a) 및 (b) 단계에서 대립유전자형의 분석은 본 발명에 따른 돼지 개체 식별용 키트를 이용하여 멀티플렉스 PCR을 수행하고 수득된 PCR 산물을 염기서열분석장치(Applied Biosystems사)에서 대립유전자분석 모드를 이용하여 전기영동을 실시해 프라이머의 형광물질 및 PCR 산물의 크기별로 분류하는 방법으로 수행할 수 있다. 측정된 대립유전자형에 대한 정보와 생산정보 등은 데이터베이스화한다.The analysis of alleles in steps (a) and (b) is performed by multiplex PCR using a pig individual identification kit according to the present invention, and the obtained PCR products are alleles in a sequencing device (Applied Biosystems). Electrophoresis may be performed using the assay mode to classify the fluorescent material and PCR product by size. The information on the measured allele types and production information are databased.

상기 (b) 단계는 도축장에서 출하된 돼지의 혈액 및 조직을 이용하여 DNA 검사를 수행하고 DNA 검사 결과 및 도축정보를 데이터베이스화한다.In the step (b), DNA testing is performed using blood and tissues from pigs shipped from the slaughterhouse, and the DNA test results and slaughter information are databased.

또한, 유통가공업체 및 매장을 통한 유통단계에서 돈육을 샘플링하여 DNA 검사를 수행하고 DNA 검사 결과 및 유통정보를 데이터베이스화한다.In addition, at the distribution stage through distribution processing companies and stores, pigs are sampled to perform DNA tests, and DNA test results and distribution information are databased.

또한, 식당 및 가정을 통한 소비단계에서 소비자 또는 유통단속기간 등의 의뢰를 통해 돈육을 샘플링하여 DNA 검사를 수행하고 DNA 검사 결과 및 소비정보를 데이터베이스화한다.In addition, during the consumption phases of restaurants and homes, pigs are sampled by requesting consumer or distribution control periods, DNA testing is performed, and DNA test results and consumption information are databased.

상기 (c) 단계는 상기 (a) 단계에서 수집한 DNA 정보 및 생산정보와 상기 (b) 단계에서 수집한 정보를 비교하고 동일성을 검증한다.Step (c) compares the DNA information and production information collected in step (a) with the information collected in step (b) and verifies the identity.

본 발명에 따른 돈육의 식별 방법은 부정육 유통을 근절시킬 수 있고 유통업자들의 부정행위를 사전에 방지할 수 있는 장점이 있다.The identification method of pork according to the present invention has the advantage of eliminating illegal distribution of meat and preventing illegal acts of distributors.

이상, 상기에서 살펴본 바와 같이 본 발명에 따른 방법은 돼지에 특이적인 마이크로새틀라이트 마커를 이용하여 멀티플렉스 PCR을 수행함으로써 신속하고 효과적으로 돼지 개체를 식별할 수 있을 뿐만 아니라 친자감별이 가능하다. 따라서, 이러한 방법을 브랜드육의 식별에 적용함으로써 유통상에 발생하는 부정행위를 제어할 수 있으며, 브랜드에 대한 소비자의 신뢰도를 상승시켜 생산농가의 소득 증대에 도움을 줄 수 있다. As described above, as described above, the method according to the present invention can identify pigs as well as quickly and effectively by performing multiplex PCR using a pig-specific microsatellite marker. Therefore, by applying this method to the identification of branded meat can control the cheating that occurs in the distribution, and can increase the consumer's confidence in the brand can help increase the income of the production farm.

이하, 본 발명의 구체적인 방법을 실시예를 들어 상세히 설명하고자 하지만 본 발명의 권리범위는 이들 실시예에 만 한정되는 것은 아니다.Hereinafter, the specific method of the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited only to these Examples.

<실시예 1><Example 1>

공시동물 및 DNA 시료Animal and DNA Samples

경상남도의 돼지농가에서 330두의 혈액을 채취하여 공시재료로 사용하였다. 돼지의 혈액으로부터 게놈 DNA 추출 키트(Promega, USA)를 이용하여 게놈 DNA의 분리하였다.330 heads of blood were collected from a pig farm in Gyeongsangnam-do and used as a test material. Genomic DNA was isolated from pig blood using a genomic DNA extraction kit (Promega, USA).

<실시예 2><Example 2>

프라이머의 제작Preparation of the primer

돼지 개체 식별 및 친자감별에 효과적으로 사용될 수 있는 마이크로새틀라이트 마커를 선발하기 위해, 국제동물유전학회에서 제안한 돼지의 다형성 분석용 마이크로새틀라이트(17개)에 특이적인 프라이머를 (주)진켐에 의뢰하여 주문 제작하였다. 또한, 성판별을 위해 성감별 프라이머를 X 염색체 및 Y 염색체 내의 특이 유전자를 기초로 하여 디자인하였다. 최종 멀티플렉스 PCR 세트의 제작은 ABI(Applied Biosystems, USA)에서 주문 제작하였으며, 한 쌍의 프라이머 중 정방향 프라이머 한쪽에 FAM, VIC, NED, PET으로 이루어진 형광물질로 표지(Label)하였다. 마이크로새틀라이트의 명칭, 표지 형광물질 및 프라이머 염기서열은 상기 표 1에 나타낸 바와 같다.In order to select microsatellite markers that can be effectively used for pig individual identification and paternity discrimination, Jinchem Co., Ltd. requested primers specific for microsatellite (17) for polymorphism analysis of pigs proposed by the International Institute of Animal Genetics. Made to order. In addition, sex discriminating primers were designed based on specific genes in the X and Y chromosomes for sex discrimination. Preparation of the final multiplex PCR set was made by ABI (Applied Biosystems, USA) and was labeled with a fluorescent material consisting of FAM, VIC, NED, and PET on one of the forward primers of the pair of primers. The name of the microsatellite, labeled fluorescent material and primer sequences are shown in Table 1 above.

돼지의 다형성 분석용 마이크로새틀라이트에 특이적인 프라이머Primer Specific for Microsatellite Analysis of Porcine Polymorphism 위치location 크로모좀Chromosome 표지sign 프라이머 서열Primer sequence 서열번호SEQ ID NO: SW240SW240 22 FAMFAM FF AGAAATTAGTGCCTCAAATTGGAGAAATTAGTGCCTCAAATTGG 1One RR GTTTCTAAACCATTAAGTCCCTAGCAAAGTTTCTAAACCATTAAGTCCCTAGCAAA 22 S0005S0005 55 VICVIC FF TCTTCCCTCCTGGTAACTATCTTCCCTCCTGGTAACTA 33 RR GTTTCTGCACTTCCTGATTCTGGGTAGTTTCTGCACTTCCTGATTCTGGGTA 44 SW911SW911 99 FAMFAM FF CTCAGTTCTTTGGGACTGAACCCTCAGTTCTTTGGGACTGAACC 55 RR GTTTCTCATCTGTGGAAAAAAAAAGCCGTTTCTCATCTGTGGAAAAAAAAAGCC 66 SW857SW857 1414 VICVIC FF TGAGAGGTCAGTTACAGAAGACCTGAGAGGTCAGTTACAGAAGACC 77 RR GTTTCTGATCCTCCTCCAAATCCCATGTTTCTGATCCTCCTCCAAATCCCAT 88 SW936SW936 1515 FAMFAM FF TCTGGAGCTAGCATAAGTGCCTCTGGAGCTAGCATAAGTGCC 99 RR GTTTCTGTGCAAGTACACATGCAGGGGTTTCTGTGCAAGTACACATGCAGGG 1010 S0090S0090 1212 FAMFAM FF CCAAGACTGCCTTGTAGGTGAATACCAAGACTGCCTTGTAGGTGAATA 1111 RR GTTTCTGCTATCAAGTATTGTACCATTAGGGTTTCTGCTATCAAGTATTGTACCATTAGG 1212 S0155S0155 1One NEDNED FF TGTTCTCTGTTTCTCCTCTGTTTGTGTTCTCTGTTTCTCCTCTGTTTG 1313 RR GTTTCTAAAGTGGAAAGAGTCAATGGCTATGTTTCTAAAGTGGAAAGAGTCAATGGCTAT 1414 SW72SW72 33 NEDNED FF ATCAGAACAGTGCGCCGTATCAGAACAGTGCGCCGT 1515 RR GTTTCTTTTGAAAATGGGGTGTTTCCGTTTCTTTTGAAAATGGGGTGTTTCC 1616 SW24SW24 1717 PETPET FF CTTTGGGTGGAGTGTGTGCCTTTGGGTGGAGTGTGTGC 1717 RR GTTTCTATCCAAATGCTGCAAGCGGTTTCTATCCAAATGCTGCAAGCG 1818 SW951SW951 1010 FAMFAM FF TTTCACAACTCTGGCACCAGTTTCACAACTCTGGCACCAG 1919 RR GTTTCTGATCGTGCCCAAATGGACGTTTCTGATCGTGCCCAAATGGAC 2020 S0026S0026 1616 VICVIC FF AACCTTCCCTTCCCAATCACAACCTTCCCTTCCCAATCAC 2121 RR GTTTCTCACAGACTGCTTTTTACTCCGTTTCTCACAGACTGCTTTTTACTCC 2222 SW632SW632 77 PETPET FF TGGGTTGAAAGATTTCCCAATGGGTTGAAAGATTTCCCAA 2323 RR GTTTCTGGAGTCAGTACTTTGGCTTGAGTTTCTGGAGTCAGTACTTTGGCTTGA 2424 S0301S0301 44 NEDNED FF CCGTCTTACTTAGGATGTTTCCGTCTTACTTAGGATGTTT 2525 RR GTTTCTTGATGTGTTTATGTGTTTGAGTTTCTTGATGTGTTTATGTGTTTGA 2626 SW122SW122 66 VICVIC FF TTGTCTTTTTATTTTGCTTTTGGTTGTCTTTTTATTTTGCTTTTGG 2727 RR GTTTCTCAAAAAAGGCAAAAGATTGACAGTTTCTCAAAAAAGGCAAAAGATTGACA 2828 S0225S0225 88 NEDNED FF GCTAATGCCAGAGAAATGCAGAGCTAATGCCAGAGAAATGCAGA 2929 RR GTTTCTCAGGTGGAAAGAATGGAATGAAGTTTCTCAGGTGGAAAGAATGGAATGAA 3030 SW769SW769 1313 NEDNED FF GGTATGACCAAAAGTCCTGGGGGTATGACCAAAAGTCCTGGG 3131 RR GTTTCTTCTGCTATGTGGGAAGAATGCGTTTCTTCTGCTATGTGGGAAGAATGC 3232 SW787SW787 1818 FAMFAM FF CTGGAGCAGGAGAAAGTAAGTTCCTGGAGCAGGAGAAAGTAAGTTC 3333 RR GTTTCTGGACAGTTACAGACAGAAGAAGGGTTTCTGGACAGTTACAGACAGAAGAAGG 3434 PIG_XPIG_X XX PETPET FF TACCAGTACACTGTAAGGGTTACCAGTACACTGTAAGGGT 3535 RR GTTTCTATGGATTCCCTTGCTGTCTCGTTTCTATGGATTCCCTTGCTGTCTC 3636 PIG_YPIG_Y YY PETPET FF GCCCACAACAAGTTCCTAAGGCCCACAACAAGTTCCTAAG 3737 RR GTTTCTGTTCCACCTAGCAAGGAAGAGTTTCTGTTCCACCTAGCAAGGAAGA 3838

<실시예 3><Example 3>

PCR 증폭PCR amplification

상기 실시예 1의 DNA 시료를 주형으로 하고, 실시예 2에서 제작한 각 프라이머를 사용하여 PCR을 다음의 조건으로 수행하였다.Using the DNA sample of Example 1 as a template, PCR was performed using the primers prepared in Example 2 under the following conditions.

주형 DNA 3.3㎍, 프라이머 2㎕, Taq DNA 중합효소 0.5 unit((주)솔젠트), 10×완충용액 1.5㎕, dNTP 1.2㎕의 조성에 증류수를 첨가하여 최종 부피를 15㎕로 하였다. PCR 조건은 94℃에서 15분간 처리한 후 95℃에서 50초, 55℃에서 70초, 72℃에서 70초를 1 사이클로 하여 32회 반복하였다. 그 후 65℃에서 1시간, 25℃에서 2시간 신장시킨 후 4℃에서 종료하였다. PCR 산물은 ABI-310 자동염기서열 분석장치(Applied Biosystems, USA)를 이용하여 크기별로 분류되도록 전기영동하고, GeneScan version 2.1(Applied Biosystems, USA)을 이용하여 크기와 표식자의 종류별로 분류한 후 마이크로소프트 엑셀(Microsoft Excel, Microsoft, USA)을 이용하여 자료를 취합하였다.Distilled water was added to the composition of 3.3 microgram of template DNA, 2 microliters of primers, 0.5 unit of Taq DNA polymerase (solgent), 1.5 microliters of 10 * buffer solutions, and 1.2 microliters of dNTP, and the final volume was set to 15 microliters. PCR conditions were repeated for 32 minutes with 1 cycle of 50 seconds at 95 ℃, 70 seconds at 55 ℃, 70 seconds at 72 ℃ after treatment for 15 minutes at 94 ℃. Then, it extended | stretched at 65 degreeC for 1 hour and 25 degreeC for 2 hours, and was complete | finished at 4 degreeC. PCR products were electrophoresed to size by ABI-310 automatic base sequence analysis device (Applied Biosystems, USA), and then classified by size and type of marker using GeneScan version 2.1 (Applied Biosystems, USA) Data was collected using Microsoft Excel, Microsoft, USA.

<실시예 4><Example 4>

마이크로새틀라이트의 다형성 지수 분석Polymorphism Index Analysis of Microsatellite

실시예 3의 결과로부터 각각의 마이크로새틀라이트 다형성지수인 이형접합률(He, Heterozygosity) 및 다형정보지수(PIC, polymorphic Infomation Content)를 Cervus version 2.0을 이용하여 계산하였다(Marshall et al(1998) Mol. Ecol. 7: 639-655).From the results of Example 3, each microsatellite polymorphism index (He, Heterozygosity) and polymorphic information index (PIC) were calculated using Cervus version 2.0 (Marshall et al (1998) Mol Ecol 7: 639-655).

그 결과, 각 마이크로새틀라이트의 다형성지수는 표 2에 나타낸 바와 같다. 본 발명자들은 각 마이크로새틀라이트 중 이형접합률이 높은 순서와 증폭산물의 크기, 분석시 발생하는 경제적 비용 등을 고려하여 17개 중 13개의 마이크로새틀라이트(S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225, SW787)를 선발하여 하나의 멀티플렉스 PCR 세트로 확립하였고, 예비 세트로서 나머지 4개의 마이크로새틀라이트를 하나의 멀티플렉스 PCR 세트로 확립하였다. As a result, the polymorphism index of each microsatellite is shown in Table 2. The present inventors consider 13 of 17 microsatellites (S0005, SW857, SW936, S00090, S0155, SW72) in consideration of the order of high heterojunction among the microsatellites, the size of the amplification products, and the economic cost of the analysis. , SW24, SW951, S0026, SW632, SW122, S0225, SW787) were selected to establish one multiplex PCR set, and the remaining four microsatellites were established as one multiplex PCR set as a preliminary set.

각 마이크로새틀라이트의 다형성지수Polymorphism Index of Each Microsatellite 위치location 대립 유전자 수Allele count NN 크기 범위(bp)Size range (bp) HeHe PICPIC S0005S0005 1717 321321 203 ~ 243203-243 0.8690.869 0.9080.908 SW24SW24 1111 324324 96 ~ 12196-121 0.7250.725 0.8220.822 SW787SW787 88 323323 150 ~ 165150-165 0.7240.724 0.7980.798 SW122SW122 99 320320 110 ~ 122110 to 122 0.7160.716 0.7850.785 SW240SW240 1010 316316 90 ~ 13090 to 130 0.7060.706 0.7460.746 SW857SW857 88 324324 144 ~ 160144 to 160 0.6670.667 0.8070.807 SW72SW72 66 326326 101 ~ 115101 to 115 0.6660.666 0.7140.714 SW632SW632 1010 325325 159 ~ 180159 to 180 0.6550.655 0.7740.774 S0026S0026 77 323323 92 ~ 10692-106 0.6500.650 0.7120.712 SW911SW911 77 315315 140 ~ 185140 to 185 0.6100.610 0.7100.710 S0155S0155 66 325325 150 ~ 166150 to 166 0.5850.585 0.7250.725 S00090S00090 77 301301 240 ~ 253240 to 253 0.5680.568 0.7030.703 S0301S0301 55 316316 240 ~ 280240 to 280 0.5350.535 0.6790.679 SW936SW936 88 326326 80 ~ 11780-117 0.5180.518 0.6650.665 S0225S0225 55 325325 170 ~ 196170-196 0.4770.477 0.5730.573 SW769SW769 55 316316 90 ~ 15090 to 150 0.370.37 0.4190.419 SW951SW951 66 323323 125 ~ 133125 to 133 0.3160.316 0.3650.365

<실시예 5>Example 5

통계분석Statistical analysis

실시예 3의 결과를 다음의 방법으로 통계분석하였다. Weir와 Hill(2002, Annu. Rev. Genet. 36:721-750) 추정법에 의한 F-통계량(F st , F it , F is 및 농장간 pairwise-F st )은 FSTAT version 2.9.3(Goudet (2001) Available from http://www.unil.ch/izea/softwere/fatat.html)과 GENEPOP version 3.4(Raymond와 Rousset (1995) J. Heredity 86:248-249)를 사용하여 계산하였다.The results of Example 3 were statistically analyzed in the following manner. The F- statistic ( F st , F it , F is and inter-farm pairwise- F st ) by Weir and Hill (2002, Annu. Rev. Genet. 36: 721-750) estimation method is shown in FSTAT version 2.9.3 (Goudet ( 2001) Available from http://www.unil.ch/izea/softwere/fatat.html) and GENEPOP version 3.4 (Raymond and Rousset (1995) J. Heredity 86: 248-249).

F-통계량 추정치에 대한 유의성 검정은 Goudet(2001)이 제안한 방법에 의하여 PT(permutation test)를 실시하여 얻었으며, 마터의 다형성지수인 이형접합률(He), 다형정보지수(PIC) 및 배재력(exclusion probability, PE)은 Cervus version 2.0(Marshall 등, 1998)을 이용하였다. 또한 추정된 F st F is 값에 근거하여 무작위 교배집단과 반형매 교배집단에서의 동일개체 출현가능확률은 API-CALC version 1.0(Ayres와 Overall (2004) Molecular Ecology Notes 4:315-318)을 사용하여 계산하였다. The significance test for the F- statistic estimates was obtained by performing a permutation test (PT) according to the method proposed by Goudet (2001). Heteromorphic index ( He ), polymorphic information index ( PIC ) and exclusion power (exclusion probability, PE ) was used for Cervus version 2.0 (Marshall et al., 1998). Also, based on the estimated values of F st and F is , the probability of occurrence of the same individual in random and half-bred cross populations is determined by API-CALC version 1.0 (Ayres and Overall (2004) Molecular Ecology Notes 4: 315-318). Calculated using.

추정된 F-통계량을 이용하여 무작위 교배집단과 반형매 교배집단을 가정하여 MS 유전자형의 동일한 개체 출현확률(probability of identity; PI와 probability of identity from half sibs; PI half - sibs )과 친자감정확률(probability of parent exclusion when both parents are unconfirmed; PEpu probability of paternity exclusion; PE)을 API-CALC version 1.0과 Cervus version 2.0을 이용하여 추정하였다. 또한 친자감별을 위해 PAPA 2.0 을 이용하여 친자를 감별하였다.Probability of identity ( PI and probability of identity from half sibs; PI half - sibs ) and paternity probability (assuming random and half-single hybrids using estimated F-statistics) probability of parent exclusion when both parents are unconfirmed; PEpu with probability of paternity exclusion; PE ) was estimated using API-CALC version 1.0 and Cervus version 2.0. Also, PAPA 2.0 was used to identify paternity.

그 결과, 전체의 MS를 사용할 경우 무작위 교배집단에서 1.04×10-17 반형매 교배집단에서는 1.09×10-13으로 나타났다(표 3). 이러한 추정치의 의미는 국내에서 하나의 돼지고기 브랜드육으로 개통 출하를 하는 농가들의 경우 일부 한정된 보증종모돈을 사용하기 때문에 이들의 절대적인 유전적 기여에 의한 거대한 반형매 교배집단으로 가정하고 하나의 브랜드를 만들어내기 위한 적정 사육두수를 감안하더라도 동일개체가 출현할 확률이 없는 것으로 보아도 무방할 것으로 사료된다. 또한 17개의 마이크로새틀라이트를 친자감정에 사용할 경우 부 또는 모의 교배기록과 유전자형이 파악된 경우에는 100% 친자감정이 가능함을 알 수 있었다.As a result, when the whole MS was used, it was found to be 1.09 × 10 −13 in the 1.04 × 10 −17 half-shaped cross population in the random cross group (Table 3). The meaning of these estimates is that farmers who open and sell a single pork brand in Korea use a limited number of guaranteed sows so that they make a brand assuming a huge half-breed breeding group by their absolute genetic contribution. Considering the proper number of breeding heads for the bet, it is considered that there is no possibility of the same individual appearing. In addition, when 17 microsatellites were used for paternity, it was found that 100% paternity was possible when parental or mock crosses and genotypes were identified.

17종의 마이크로새틀라이트 마커를 이용한 개체 출현확률 및 친자감별확률Probability of occurrence and paternity discrimination using 17 microsatellite markers Selected bySelected by PIPI PIPI half-sibshalf-sibs PIPI sibssibs PEPE pupu PEPE TotalTotal 1.09×10-17 1.09 × 10 -17 1.09×10-13 1.09 × 10 -13 1.09×10-7 1.09 × 10 -7 0.999740.99974 1.000001.00000

<실시예 6><Example 6>

멀티플렉스 PCRMultiplex PCR

상기 실시예 4에서 이형접합률(He)이 높은 순서와 증폭산물의 크기, 분석 시 발생하는 경제적 비용 등을 고려하여 선발된 13개의 마이크로새틀라이트(S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225, SW787)에 특이적인 프라이머 쌍(서열번호 3 및 4, 서열번호 7 및 8, 서열번호 9 및 10, 서열번호 11 및 12, 서열번호 13 및 14, 서열번호 15 및 16, 서열번호 17 및 18, 서열번호 19 및 20, 서열번호 21 및 22, 서열번호 23 및 24, 서열번호 27 및 28, 서열번호 29 및 30, 서열번호 33 및 34)에 성감별 프라이머 두쌍(PIG_X 및 PIG_Y, 서열번호 35 및 36, 서열번호 37 및 38)을 추가하여 멀티플렉스 PCR을 다음의 방법으로 수행하였다In Example 4, 13 microsatellites (S0005, SW857, SW936, S00090, S0155, SW72, selected in consideration of the order of high heterojunction ( He ), the size of the amplification product, and the economic cost incurred in the analysis) were selected. Primer pairs specific for SW24, SW951, S0026, SW632, SW122, S0225, SW787 (SEQ ID NOS: 3 and 4, SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 14, Sex with SEQ ID NO: 15 and 16, SEQ ID NO: 17 and 18, SEQ ID NO: 19 and 20, SEQ ID NO: 21 and 22, SEQ ID NO: 23 and 24, SEQ ID NO: 27 and 28, SEQ ID NO: 29 and 30, SEQ ID NO: 33 and 34) Multiplex PCR was performed by the following method by adding two pairs of star primers (PIG_X and PIG_Y, SEQ ID NOs: 35 and 36, SEQ ID NOs: 37 and 38).

실시예 1에서 준비한 주형 DNA 6.6㎍, 각각의 프라이머 쌍 8.25㎕, Hot starte Taq DNA 중합효소 1.8 unit((주)바이오니아), 10×완충용액 1.5㎕, dNTP 1.5㎕의 조성에 증류수를 첨가하여 최종 부피를 15㎕로 하였으며, PCR 조건은 95℃에서 15분간 처리한 후 94℃에서 60초, 55℃에서 75초, 72℃에서 60초를 1 사이클로 하여 4회 반복하고, 94℃에서 60초, 54℃에서 75초, 72℃에서 60초를 1 사이클로 하여 4회 반복 후 94℃에서 60초, 53℃에서 75초, 72℃에서 60초를 1 사이클로 하여 24회 반복하였다. 그리고 65℃에서 30분간 신장(extension) 후 4℃에서 종료하였다. 멀티플렉스 PCR 산물은 ABI-3130 자동염기서열 분석장치(Applied Biosystems, USA)를 이용하여 크기별로 분류되도록 전기영동하고, GeneMapper version 4.0(Applied Biosystems, USA)을 이용하여 크기와 표식자의 종류별로 분류한 후 마이크로소프트 엑셀(Microsoft Excel, Microsoft, USA)을 이용하여 자료를 취합하였다.Distilled water was added to the composition of 6.6 μg of template DNA prepared in Example 1, 8.25 μl of each primer pair, 1.8 unit of Hot starte Taq DNA polymerase (Bionia), 1.5 μl of 10 × buffer solution, and 1.5 μl of dNTP. The volume was 15 μl, and PCR conditions were repeated 15 times at 95 ° C. for 15 minutes, followed by 60 cycles at 94 ° C., 75 seconds at 55 ° C., 60 seconds at 72 ° C., and repeated 4 times, at 60 ° C. at 94 ° C., After 4 repetitions of 75 seconds at 54 ° C and 60 seconds at 72 ° C as one cycle, 24 cycles were repeated at 60 ° C at 94 ° C, 75 seconds at 53 ° C, and 60 seconds at 72 ° C. And it extended at 65 degreeC for 30 minutes, and finished it at 4 degreeC. Multiplex PCR products were electrophoresed to size by ABI-3130 automatic sequencing device (Applied Biosystems, USA), and size and type of markers using GeneMapper version 4.0 (Applied Biosystems, USA). The data was then collected using Microsoft Excel, Microsoft, USA.

상기에서 취합된 자료를 기초로 하여 무작위교배집단, 반형매교배집단, 전형매교배집단으로 각각 가정한 후 이들의 동일개체 출현확률 및 친자감별확률을 상기 실시예 5와 동일한 방법으로 계산하였다. On the basis of the data collected above, it was assumed that the random cross population, the half-cross hybrid group, and the typical single-cross hybrid group, respectively, and then the probability of appearance of the same individuals and the probability of paternity discrimination were calculated in the same manner as in Example 5.

그 결과, 13개의 마이크로새틀라이트 마커를 이용하여 무작위교배집단으로 가정하여 분석한 추정치의 경우 1.09×10-13, 반형매교배집단으로 가정하여 분석한 추정치의 경우 1.09×10-10, 전형매교배집단으로 가정하여 분석한 추정치의 경우 1.09×10-6으로 나타났으며 친자 감자감정 능력도 99.999%로 13개의 마이크로새틀라이트를 이용하여도 개체식별 및 친자감정이 가능한 추정치를 나타내었으므로 경제적인 면을 고려한다면 13개의 마이크로새틀라이트를 이용하는 것이 유용함을 알 수 있었다(표 4).As a result, 1.09 × 10 -13 for the estimates assuming a random cross population using 13 microsatellite markers, 1.09 × 10 -10 for the estimates assuming a half-cross breeding group, and a typical hawk cross In the case of the analysis estimated as a group, it was 1.09 × 10 -6 , and the parental potato emotion ability was 99.999%, and it was economical because it was able to identify individuals and paternity using 13 microsatellites. Considering this, it was found that it is useful to use 13 microsatellites (Table 4).

13종의 마이크로새틀라이트 마커를 이용한 개체 출현확률 및 친자감별확률Probability of occurrence and paternity discrimination using 13 microsatellite markers Selected bySelected by PIPI PIPI halfhalf -- sibssibs PIPI sibssibs PEPE pupu PEPE 13MS13MS 1.09×10-13 1.09 × 10 -13 1.09×10-10 1.09 × 10 -10 1.09×10-6 1.09 × 10 -6 0.998930.99893 0.999990.99999

<실시예 7><Example 7>

본 발명의 마이크로새틀라이트 마커를 이용한 브랜드육의 친자감별Paternity discrimination of branded meat using microsatellite marker of the present invention

본 발명에서 선발한 13종의 마이크로새틀라이트 마커의 친자감별 효과를 확인하기 위해 상기 마이크로새틀라이트 마커에 특이적인 프라이머쌍을 이용하여 실제 경남의 K시에서 생산되는 P 브랜드의 돼지 부돈 11두와 모돈 3두에서 출생한 자돈 2두를 대상으로 대립유전자형을 분석하였다. 보다 구체적으로, 자돈 2두로부터 혈액을 채취하여 혈액으로부터 게놈 DNA 추출 키트(Promega, USA)를 사용하여 게놈 DNA를 분리하는 방법으로 수득하고, 이를 주형으로 하여 실시예 6과 동일한 방법으로 멀티플렉스 PCR을 수행한 다음 멀티플렉스 PCR 산물은 ABI-3130 자동염기서열 분석장치(Applied Biosystems, USA)를 이용하여 크기별로 분류되도록 전기영동하고, GeneMapper version 4.0(Applied Biosystems, USA)을 이용하여 크기와 표식자의 종류별로 분류한 후 마이크로소프트 엑셀(Microsoft Excel, Microsoft, USA)을 이용하여 자료를 취합하였다. 취합된 자료를 기초로 하여 대립유전자형을 분석하고 PAPA 2.0 프로그램을 이용하여 친자감별을 실시하여 교배 조합표와 비교하였다.In order to confirm the paternity effect of the 13 kinds of microsatellite markers selected in the present invention, 11 pig pig pigs and sows of P brand produced in K city in Gyeongnam, Korea, using primer pairs specific to the microsatellite markers. Allelic types were analyzed in 2 piglets born from 3 heads. More specifically, blood was collected from two piglets and obtained by a method of separating genomic DNA from blood using a genomic DNA extraction kit (Promega, USA), which was used as a template for multiplex PCR in the same manner as in Example 6. The multiplex PCR product was then electrophoresed to size by ABI-3130 automatic sequencing device (Applied Biosystems, USA), and size and markers were analyzed using GeneMapper version 4.0 (Applied Biosystems, USA). After sorting by type, data was collected using Microsoft Excel (Microsoft Excel, Microsoft, USA). Based on the collected data, allele types were analyzed, and paternity identification was performed using the PAPA 2.0 program.

그 결과 100% 부모를 찾을 수 있는 결과를 나타었다(표 5).As a result, 100% parents were found (Table 5).

Figure 112007054713674-PAT00001
Figure 112007054713674-PAT00001

도 1은 13개의 마이크로새틀라이트 마커에 특이적인 프라이머와 2개의 성감별 프라이머를 이용하여 수득한 멀티플렉스 PCR 세트 산물의 전기영동 결과를 나타낸 것이다.1 shows the results of electrophoresis of multiplex PCR set products obtained using primers specific for 13 microsatellite markers and two sex discriminating primers.

도 2는 친자감별을 토대로 브랜드 유통 적용 시 생물학적 개체관리 시스템의 흐름도를 나타낸다.Figure 2 shows a flow chart of the biological individual management system when applying the brand distribution based on paternity discrimination.

도 3은 식육의 생산에서 소비까지 각 단계별 생물학적 개체식별 검사를 통한 개체관리 시스템의 흐름도를 나타낸다.3 shows a flow chart of an individual management system through biological identification of each stage from production to consumption of meat.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Method for individualization and brand discrimination test in pig uising microsatellite marker <160> 38 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SW240 forward primer <400> 1 agaaattagt gcctcaaatt gg 22 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SW240 reverse primer <400> 2 gtttctaaac cattaagtcc ctagcaaa 28 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> S0005 forward primer <400> 3 tcttccctcc tggtaacta 19 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S0005 reverse primer <400> 4 gtttctgcac ttcctgattc tgggta 26 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SW911 forward primer <400> 5 ctcagttctt tgggactgaa cc 22 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SW911 reverse primer <400> 6 gtttctcatc tgtggaaaaa aaaagcc 27 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SW857 forward primer <400> 7 tgagaggtca gttacagaag acc 23 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SW857 reverse primer <400> 8 gtttctgatc ctcctccaaa tcccat 26 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SW936 forward primer <400> 9 tctggagcta gcataagtgc c 21 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SW936 reverse primer <400> 10 gtttctgtgc aagtacacat gcaggg 26 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> S0090 forward primer <400> 11 ccaagactgc cttgtaggtg aata 24 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S0090 reverse primer <400> 12 gtttctgcta tcaagtattg taccattagg 30 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> S0155 forward primer <400> 13 tgttctctgt ttctcctctg tttg 24 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S0155 reverse primer <400> 14 gtttctaaag tggaaagagt caatggctat 30 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SW72 forward primer <400> 15 atcagaacag tgcgccgt 18 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SW72 reverse primer <400> 16 gtttcttttg aaaatggggt gtttcc 26 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SW24 forward primer <400> 17 ctttgggtgg agtgtgtgc 19 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SW24 reverse primer <400> 18 gtttctatcc aaatgctgca agcg 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SW951 forward primer <400> 19 tttcacaact ctggcaccag 20 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SW951 reverse primer <400> 20 gtttctgatc gtgcccaaat ggac 24 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S0026 forward primer <400> 21 aaccttccct tcccaatcac 20 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S0026 reverse primer <400> 22 gtttctcaca gactgctttt tactcc 26 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SW632 forward primer <400> 23 tgggttgaaa gatttcccaa 20 <210> 24 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SW632 reverse primer <400> 24 gtttctggag tcagtacttt ggcttga 27 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S0301 forward primer <400> 25 ccgtcttact taggatgttt 20 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S0301 reverse primer <400> 26 gtttcttgat gtgtttatgt gtttga 26 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SW122 forward primer <400> 27 ttgtcttttt attttgcttt tgg 23 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SW122 reverse primer <400> 28 gtttctcaaa aaaggcaaaa gattgaca 28 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> S0225 forward primer <400> 29 gctaatgcca gagaaatgca ga 22 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> S0225 reverse primer <400> 30 gtttctcagg tggaaagaat ggaatgaa 28 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SW769 forward primer <400> 31 ggtatgacca aaagtcctgg g 21 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SW769 reverse primer <400> 32 gtttcttctg ctatgtggga agaatgc 27 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SW787 forward primer <400> 33 ctggagcagg agaaagtaag ttc 23 <210> 34 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SW787 reverse primer <400> 34 gtttctggac agttacagac agaagaagg 29 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PIG_X forward primer <400> 35 taccagtaca ctgtaagggt 20 <210> 36 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PIG_X reverse primer <400> 36 gtttctatgg attcccttgc tgtctc 26 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PIG_Y forward primer <400> 37 gcccacaaca agttcctaag 20 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PIG_Y reverse primer <400> 38 gtttctgttc cacctagcaa ggaaga 26 <110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Method for individualization and brand discrimination test in pig          uising microsatellite marker <160> 38 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SW240 forward primer <400> 1 agaaattagt gcctcaaatt gg 22 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SW240 reverse primer <400> 2 gtttctaaac cattaagtcc ctagcaaa 28 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> S0005 forward primer <400> 3 tcttccctcc tggtaacta 19 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S0005 reverse primer <400> 4 gtttctgcac ttcctgattc tgggta 26 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SW911 forward primer <400> 5 ctcagttctt tgggactgaa cc 22 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SW911 reverse primer <400> 6 gtttctcatc tgtggaaaaa aaaagcc 27 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SW857 forward primer <400> 7 tgagaggtca gttacagaag acc 23 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SW857 reverse primer <400> 8 gtttctgatc ctcctccaaa tcccat 26 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SW936 forward primer <400> 9 tctggagcta gcataagtgc c 21 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SW936 reverse primer <400> 10 gtttctgtgc aagtacacat gcaggg 26 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> S0090 forward primer <400> 11 ccaagactgc cttgtaggtg aata 24 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S0090 reverse primer <400> 12 gtttctgcta tcaagtattg taccattagg 30 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> S0155 forward primer <400> 13 tgttctctgt ttctcctctg tttg 24 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> S0155 reverse primer <400> 14 gtttctaaag tggaaagagt caatggctat 30 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> SW72 forward primer <400> 15 atcagaacag tgcgccgt 18 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> SW72 reverse primer <400> 16 gtttcttttg aaaatggggt gtttcc 26 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> SW24 forward primer <400> 17 ctttgggtgg agtgtgtgc 19 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SW24 reverse primer <400> 18 gtttctatcc aaatgctgca agcg 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SW951 forward primer <400> 19 tttcacaact ctggcaccag 20 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SW951 reverse primer <400> 20 gtttctgatc gtgcccaaat ggac 24 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S0026 forward primer <400> 21 aaccttccct tcccaatcac 20 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S0026 reverse primer <400> 22 gtttctcaca gactgctttt tactcc 26 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SW632 forward primer <400> 23 tgggttgaaa gatttcccaa 20 <210> 24 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SW632 reverse primer <400> 24 gtttctggag tcagtacttt ggcttga 27 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S0301 forward primer <400> 25 ccgtcttact taggatgttt 20 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> S0301 reverse primer <400> 26 gtttcttgat gtgtttatgt gtttga 26 <210> 27 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SW122 forward primer <400> 27 ttgtcttttt attttgcttt tgg 23 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> SW122 reverse primer <400> 28 gtttctcaaa aaaggcaaaa gattgaca 28 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> S0225 forward primer <400> 29 gctaatgcca gagaaatgca ga 22 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> S0225 reverse primer <400> 30 gtttctcagg tggaaagaat ggaatgaa 28 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SW769 forward primer <400> 31 ggtatgacca aaagtcctgg g 21 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SW769 reverse primer <400> 32 gtttcttctg ctatgtggga agaatgc 27 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> SW787 forward primer <400> 33 ctggagcagg agaaagtaag ttc 23 <210> 34 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> SW787 reverse primer <400> 34 gtttctggac agttacagac agaagaagg 29 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PIG_X forward primer <400> 35 taccagtaca ctgtaagggt 20 <210> 36 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PIG_X reverse primer <400> 36 gtttctatgg attcccttgc tgtctc 26 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PIG_Y forward primer <400> 37 gcccacaaca agttcctaag 20 <210> 38 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PIG_Y reverse primer <400> 38 gtttctgttc cacctagcaa ggaaga 26  

Claims (21)

(a) 분석하고자 하는 핵산 시료를 SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 및 SW787로 이루어진 군 중에서 선택된 13개 이상의 마이크로새틀라이트 마커에 특이적인 프라이머를 이용하여 멀티플렉스 PCR 증폭하는 단계; 및(a) The nucleic acid sample to be analyzed is composed of SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 and SW787. 13 or more selected from Multiplex PCR amplification using primers specific for microsatellite markers; And (b) 상기 (a) 단계에서 증폭된 산물을 전기영동장치를 통해 검출하여 대립유전자를(allele) 검출하고 유전자형을 결정하는 단계를 포함하는 돼지 개체의 식별 방법. (b) detecting the allele and determining the genotype by detecting the product amplified in step (a) through an electrophoresis device. 제1항에 있어서, 상기 (a) 단계의 마이크로새틀라이트 마커가 S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 및 SW787임을 특징으로 하는 방법.The method of claim 1, wherein the microsatellite markers of step (a) are S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225, and SW787. 제1항에 있어서, 상기 (a) 단계의 마이크로새틀라이트 마커는 성감별 마커 PIG_X 및 PIG_Y가 추가되는 것을 특징으로 하는 방법.The method of claim 1, wherein the microsatellite marker of step (a) is characterized in that the sex discrimination markers PIG_X and PIG_Y are added. 제1항에 있어서, 상기 (a) 단계의 마이크로새틀라이트 마커에 특이적인 프라이머는 역방향 프라이머의 5' 말단에 GTTTCT 염기가 추가된 것을 특징으로 하는 방법.The method of claim 1, wherein the primer specific for the microsatellite marker of step (a) is characterized in that the GTTTCT base is added to the 5 'end of the reverse primer. 제1항에 있어서, 상기 (a) 단계의 마이크로새틀라이트 마커에 특이적인 프라이머가 서열번호 1 내지 서열번호 34로 표시되는 염기서열로 이루어진 것임을 특징으로 하는 방법.The method of claim 1, wherein the primer specific for the microsatellite marker of step (a) consists of a nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 34. 제1항에 있어서, 상기 (a) 단계의 마이크로새틀라이트 마커에 특이적인 프라이머가 서열번호 3 및 4, 서열번호 7 및 8, 서열번호 9 및 10, 서열번호 11 및 12, 서열번호 13 및 14, 서열번호 15 및 16, 서열번호 17 및 18, 서열번호 19 및 20, 서열번호 21 및 22, 서열번호 23 및 24, 서열번호 27 및 28, 서열번호 29 및 30, 서열번호 33 및 34로 표시되는 염기서열로 이루어진 군 중에서 선택되는 것임을 특징으로 하는 방법.According to claim 1, wherein the primers specific for the microsatellite marker of step (a) is SEQ ID NO: 3 and 4, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14 SEQ ID NO: 15 and 16, SEQ ID NO: 17 and 18, SEQ ID NO: 19 and 20, SEQ ID NO: 21 and 22, SEQ ID NO: 23 and 24, SEQ ID NO: 27 and 28, SEQ ID NO: 29 and 30, SEQ ID NO: 33 and 34 Method characterized in that it is selected from the group consisting of the base sequence. 제1항에 있어서, 서열번호 35 및 서열번호 36, 서열번호 37 및 서열번호 38로 표시되는 염기서열로 이루어진 프라이머를 추가로 포함하는 것을 특징으로 하는 방법.The method of claim 1, further comprising a primer consisting of a nucleotide sequence represented by SEQ ID NO: 35 and SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38. SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 및 SW787로 이루어진 군 중에서 선택된 13개 이상의 마이크로새틀라이트 마커에 특이적인 프라이머를 포함하는 돼지 개체식별용 키트.Group consisting of SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 and SW787 13 or more selected from Pig individual identification kit comprising a primer specific for the microsatellite marker. 제8항에 있어서, 상기 마이크로새틀라이트 마커가 S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 및 SW787임을 특징으로 키트.The kit of claim 8, wherein the microsatellite markers are S0005, SW857, SW936, S00090, S0155, SW72, SW24, SW951, S0026, SW632, SW122, S0225 and SW787. 제8항에 있어서, 2개의 성감별 마커 PIG_X와 PIG_Y가 추가되는 것을 특징으로 하는 키트.9. The kit of claim 8, wherein two sex discrimination markers PIG_X and PIG_Y are added. 제8항에 있어서, 상기 마이크로새틀라이트 마커에 특이적인 프라이머는 역방향 프라이머의 5' 말단에 GTTTCT 염기가 추가된 것을 특징으로 하는 방법.The method of claim 8, wherein the primer specific for the microsatellite marker is characterized in that the GTTTCT base is added to the 5 'end of the reverse primer. 제8항에 있어서, 상기 마이크로새틀라이트 마커에 특이적인 프라이머가 서열번호 1 내지 서열번호 34로 표시되는 염기서열로 이루어진 것을 특징으로 하는 키트.The kit according to claim 8, wherein the primer specific for the microsatellite marker consists of a nucleotide sequence represented by SEQ ID NO: 1 to SEQ ID NO: 34. 제8항에 있어서, 상기 마이크로새틀라이트 마커에 특이적인 프라이머가 서열번호 3 및 4, 서열번호 7 및 8, 서열번호 9 및 10, 서열번호 11 및 12, 서열번호 13 및 14, 서열번호 15 및 16, 서열번호 17 및 18, 서열번호 19 및 20, 서열번호 21 및 22, 서열번호 23 및 24, 서열번호 27 및 28, 서열번호 29 및 30, 서열번호 33 및 34로 표시되는 염기서열로 이루어진 것임을 특징으로 하는 키트.The method of claim 8, wherein the primers specific for the microsatellite marker are SEQ ID NOs: 3 and 4, SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, SEQ ID NOs: 13 and 14, SEQ ID NOs: 15 16, SEQ ID NO: 17 and 18, SEQ ID NO: 19 and 20, SEQ ID NO: 21 and 22, SEQ ID NO: 23 and 24, SEQ ID NO: 27 and 28, SEQ ID NO: 29 and 30, SEQ ID NO: 33 and 34 And characterized in that the kit. 제8항에 있어서, 서열번호 35 및 서열번호 36, 서열번호 37 및 서열번호 38로 표시되는 염기서열로 이루어진 프라이머를 추가로 포함하는 것을 특징으로 하는 키트.The kit according to claim 8, further comprising a primer consisting of the nucleotide sequences represented by SEQ ID NO: 35 and SEQ ID NO: 36, SEQ ID NO: 37, and SEQ ID NO: 38. SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 및 SW787로 이루어진 군 중에서 선택된 마이크로새틀라이트 마커에 특이적이며 5'말단에 GTTCT 염기가 추가된 역방향 프라이머 서열. Specific to microsatellite markers selected from the group consisting of SW240, S0005, SW911, SW857, SW936, S0090, S0155, SW72, SW24, SW951, S0026, SW632, S0301, SW122, S0225, SW769 and SW787 Reverse primer sequence with GTTCT base added. 제15항에 있어서, 서열번호 2, 서열번호 4, 서열번호 6, 서열번호 8, 서열번호 10, 서열번호 12, 서열번호 14, 서열번호 16, 서열번호 18, 서열번호 20, 서열번호 22, 서열번호 24, 서열번호 26, 서열번호 28, 서열번호 30, 서열번호 32 및 서열번호 34로 이루어진 군 중에서 선택되는 염기서열로 이루어진 것을 특징으로 하는 프라이머 서열.The method of claim 15, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, A primer sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, and SEQ ID NO: 34. 돼지의 성감별 마커 PIG_X 및 PIG_Y에 특이적인 프라이머 서열.Primer sequences specific for sex discriminator markers PIG_X and PIG_Y in pigs. 제17항에 있어서, 서열번호 35 내지 서열번호 38로 이루어진 군 중에서 선택되는 염기서열로 이루어진 것을 특징으로 하는 프라이머 서열.18. The primer sequence of claim 17, wherein the primer sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 35 to SEQ ID NO: 38. (a) 부돈 및 모돈의 DNA의 대립유전자형을 분석하고 이를 데이터베이스로 구축하는 단계;(a) analyzing the alleles of the DNA of the piglets and sows and constructing them into a database; (b) 상기 (a) 단계의 부돈 및 모돈으로부터 계통출하된 자돈의 DNA를 소비단계에서 샘플링하는 단계;(b) sampling the DNA of piglets inherited from the piglets and sows of step (a) at the consumption stage; (c) 상기 (b) 단계에서 수득한 자돈의 DNA 대립유전자형을 분석하는 단계; 및(c) analyzing the DNA allele type of the piglets obtained in step (b); And (d) 상기 (a) 단계의 부돈 및 모돈의 DNA 데이터베이스와 상기 (b) 단계의 자돈의 대립유전자형을 기초로 하여 친자감별을 수행하는 단계를 포함하는 돈육의 식별방법.and (d) performing paternity discrimination based on the DNA database of the piglets and sows of step (a) and the alleles of the piglets of step (b). (a) 생산단계에서 계통출하돈의 DNA 대립유전자형을 분석하고 이를 데이터베이스로 구축하는 단계;(a) analyzing the DNA allele of the phylogenetic donor at the production stage and constructing it into a database; (b) 도축단계, 유통단계 및 소비단계로 이루어진 군 중에서 선택된 어느 단계에서 자돈의 DNA를 샘플링하여 대립유전자형을 분석하는 단계; 및(b) analyzing the allele type by sampling the DNA of the piglets at any stage selected from the group consisting of slaughter, distribution and consumption steps; And (c) 상기 (a) 단계의 계통출하돈의 DNA 대립유전자형과 상기 (b) 단계의 자돈의 DNA 대립유전자형을 비교하여 동일성여부를 검증하는 단계를 포함하는 돈육의 식별방법.(c) comparing the DNA allele of the phylogenetic pig of step (a) with the DNA allele of the piglet of step (b) to verify identity. 제19항 또는 제20항에 있어서, 상기 대립유전자형의 분석은 제8항의 키트를 이용하여 멀티플렉스 PCR 방법으로 수행하는 것을 특징으로 하는 방법.21. The method of claim 19 or 20, wherein the analysis of the allele is performed by a multiplex PCR method using the kit of claim 8.
KR1020070075426A 2007-07-27 2007-07-27 Method for individualization and brand discrimination test in pig uising microsatellite marker KR100925036B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020070075426A KR100925036B1 (en) 2007-07-27 2007-07-27 Method for individualization and brand discrimination test in pig uising microsatellite marker

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020070075426A KR100925036B1 (en) 2007-07-27 2007-07-27 Method for individualization and brand discrimination test in pig uising microsatellite marker

Publications (2)

Publication Number Publication Date
KR20090011636A true KR20090011636A (en) 2009-02-02
KR100925036B1 KR100925036B1 (en) 2009-11-03

Family

ID=40682740

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020070075426A KR100925036B1 (en) 2007-07-27 2007-07-27 Method for individualization and brand discrimination test in pig uising microsatellite marker

Country Status (1)

Country Link
KR (1) KR100925036B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113373243A (en) * 2021-07-12 2021-09-10 安徽农业大学 Kit and method for family division and paternity test of domestic pigs

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR0142706B1 (en) * 1995-07-13 1998-08-17 문정환 Manual socket for the electrical character tester of semiconductor device

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113373243A (en) * 2021-07-12 2021-09-10 安徽农业大学 Kit and method for family division and paternity test of domestic pigs
CN113373243B (en) * 2021-07-12 2023-07-25 安徽农业大学 Kit and method for dividing family of domestic pigs and identifying paternity

Also Published As

Publication number Publication date
KR100925036B1 (en) 2009-11-03

Similar Documents

Publication Publication Date Title
Wood et al. Despite identifying some shared gene associations with human atopic dermatitis the use of multiple dog breeds from various locations limits detection of gene associations in canine atopic dermatitis
Fulton Genomic selection for poultry breeding
CN113046444B (en) SNP marker combination for tracing and identifying beef cattle individual and meat product and application thereof
Van Eenennaam et al. DNA-based paternity analysis and genetic evaluation in a large, commercial cattle ranch setting
Nicoloso et al. Recent advance in DNA-based traceability and authentication of livestock meat PDO and PGI products
JP2015526099A (en) Genetic markers for mastitis resistance
Chantry‐Darmon et al. A first‐generation microsatellite‐based integrated genetic and cytogenetic map for the European rabbit (Oryctolagus cuniculus) and localization of angora and albino
Harlizius et al. A single nucleotide polymorphism set for paternal identification to reduce the costs of trait recording in commercial pig breeding
KR101474284B1 (en) Microsatellite Marker for individualization in Korean native chicken and individualizing Method Using the Same
Dalvit et al. Breed assignment test in four Italian beef cattle breeds
Nuzhdin et al. Genome-enabled hitchhiking mapping identifies QTLs for stress resistance in natural Drosophila
KR102039309B1 (en) Microsatellite Marker For Identification of Korean Native Chicken And Method For Identification Using The Same
Gross et al. Development and characterization of novel tetranucleotide microsatellite markers in the noble crayfish (Astacus astacus) suitable for highly multiplexing and for detecting hybrids between the noble crayfish and narrow-clawed crayfish (A. leptodactylus)
Rikimaru et al. A method for discriminating a Japanese brand of chicken, the Hinai-jidori, using microsatellite markers
KR100925036B1 (en) Method for individualization and brand discrimination test in pig uising microsatellite marker
JP4982746B2 (en) Pig parent-child determination method using DNA marker
CN115341044A (en) Method for predicting daily gain of pigs by using microorganisms and related SNP sites thereof
KR101535925B1 (en) Microsatellite markers for identification of goats
WO2013079289A1 (en) Method for identifying cows with mastitis by bulk genotyping of tank milk
Mustafa et al. Comparative analysis of genome wide difference in Red Sindhi and Holstein cattle breeds using dense SNP marker
CN111154888B (en) Microsatellite marker for detecting beagle closed group and combination thereof
KR102382857B1 (en) Microsatellite marker for indentification and paternity verification of native black goat
CN114107520B (en) Pig intramuscular fat SNP molecular marker and application thereof
Hérault et al. Phenotypic and expression QTL integration allows the refinement of loci associated with pig carcass and meat quality traits
KR101754502B1 (en) Method for individualization and Parentage test in pig using microsatellite marker

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20121011

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20131001

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20140929

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20151026

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20160927

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20181016

Year of fee payment: 10

FPAY Annual fee payment

Payment date: 20191022

Year of fee payment: 11