KR20070083754A - Bacteriophages displaying functional enzymes and uses thereof - Google Patents

Abstract

The present invention relates to the use of a virus, specifically a display bacteriophage, displaying a functional exogenous enzyme or functional fragments, variants or derivatives thereof, in industrial fermentation processes utilising the enzyme. The present invention also relates to viruses, specifically display bacteriophages, displaying two or more different exogenous enzymes or functional fragments, variants or derivatives thereof and their use in industrial fermentation processes utilising the enzymes. In a preferred embodiment the display phage displays functional copies of alpha-amylase and xylanase and is used to de-ink mixed office waste.

Description

Bacteriophages Displaying Functional Enzymes and Uses Thereof}

The present invention relates to enzymes. More specifically, the present invention relates to enzymes produced by viruses.

All citations cited herein, ie all patents or patent applications, are incorporated herein by reference. No citation constitutes the prior art. Although several prior art references are mentioned herein, it is clear that these citations do not form part of the common knowledge in the art in Australia or elsewhere.

Enzymes are large, complex molecules that are currently produced in bioreactors using native host cells or in appropriate expression vectors for nucleic acid molecules encoding enzymes. For example, alpha-amylase is produced in a batch fermenter of Bacillus sp., In which the bacterial cells grow for 10 to 20 hours and then begin to produce enzymes for 100 to 150 hours. Lasts for a while. The enzyme is removed from the cell culture by filtration and concentration using ultra-filtration or acetone precipitation. Batch fermentation conditions, long production and purification times dramatically increase the price of the final enzyme product. In particular, the hemolytic stage is the most frequently used step to separate enzymes from cells. This step is the most important step in the industrial production process and requires a large amount of enzyme. Once purified, enzymes must be added to the reaction to proceed.

Commercial examples use alpha-amylases of B. licheniformis in high temperature processes, such as the process of liquefying starch in the early stages of production of ethanol, maltose and glucose syrup, which are made of paper and fiber. Also used in industry. Three important steps in the process of converting starch into glucose or maltose syrup are gelatinization, liquefaction and saccharification. In the gelatinization process, starch slurry and the most resistant alpha-amylase are injected with steam through a pipe at 105 ° C. for 5 minutes. In the liquefaction process, the starch-amylase mixture is left at 95 ° C. for about 2 hours to lower the viscosity of the starch. In the glycosylation process, glucose or maltose units are produced by enzymes such as glucoamylase, flulanase and fungal alpha-amylase. Therefore, enzymes require several enzymes. And, each added additive enzyme increases the cost of the process.

Phage display allows direct expression of the desired peptide or protein genotype into a phenotype, allowing expression of the protein and peptide on the surface of the phage particle. This method allows the selection of various libraries of peptides and proteins, and at the same time allows the interaction of other molecules such as ligands and enzyme substrates through the activity of the selected peptides and proteins. Phage display has been used to select phage libraries for enzymes with specific activities. From this point of view, the enzyme-producing phage may be used for analytical screening assay to measure the activity of the enzyme. However, once phage expressing the appropriate enzyme is identified, the nucleic acid encoding the desired enzyme should be amplified and cloned into an expression vector such as E. coli . If the protein is not released in such an expression vector, a cell hemolysis process is required to separate the protein, and this may include adding another enzyme to proceed with the process. When a body is formed, a solubilization process may be required. Such a process is a time-consuming process involving costly and downstream process technology that requires expensive enzymes. In addition, each phage of the phage library contains nucleic acid encoding only one enzyme. Therefore, this process must be repeated for each appropriate enzyme identified.

Therefore, there is a need in the art for a more cost-saving and less time-consuming method to produce the required products from enzymatic reactions.

1 shows different methods of producing recombinant viruses. v is the viral genomic DNA / RNA (eg, T7); m is a transcript (mRNA); p is plasmid DNA; g is bacterial genomic DNA (eg, E. coli ); φ is a phage particle having a recombinant enzyme; ¡Æ the transcriptional promoter region; Silver ribosomal binding site (rbs); Open arrows / boxes include viral protein genes / proteins (eg, outer protein 10); Vertical arrows / boxes include enzyme 1 gene / protein (eg, alpha-amylase); Dotted arrows / boxes include enzyme 2 gene / protein (eg xylanase); Hashed arrows / boxes refer to alternate shell protein genes / proteins.

In Figure 1, A VII and Aii show the production of enzyme 1 (alpha-amylase) and enzyme 2 (xylanase) in tandem form. B to I represent possible methods of producing recombinant viruses with enzymes as separate translation products. I shows non-covalent binding between enzymes.

2 shows the expression of alpha-amylase expressed in T7 phage plaques cultured in top agarose including Red Starch (Megazyme). The white zone surrounding the red starch means the hydrolysis of the red starch due to the activity of alpha-amylase, and the absence of the clearing zone means the absence of activity of the alpha-amylase (black arrow). ).

FIG. 3 shows an enzyme (A) produced from phage in crude digest, alpha-amylase produced from phage in TB, using 1% starch (hydrolyzed potato starch for electrophoresis, Aldrich) at different temperatures. Sigma, A3404) (B), alpha-amylase (C) produced from phage in 0.05M glycine-NaOH (pH 9.0) and alpha-amylase (Sigma, A3403) produced from phage in 0.05M glycine-NaOH (pH 9.0) (D) is a graph comparing the production of reducing sugars.

FIG. 4 is a graph showing dextrose equivalent values (DE) obtained using phage digests capable of producing crude alpha-amylase and 15% wheat starch (Sigma) maintained at 93 ° C.

5 shows plaque production in 1% Red Starch (Megazyme) (A, C, E and G) and 1% Azo-xylan (Megazyme) (B, D and F). A: T7-xylanase, no clearing zone; B: T7-xylanase, with clearing zone; C: T7-alpha-amylase, with clearing zone; D: T7-alpha-amylase, no clearing zone; E: T7-xylanase-α-amylase, with clearing zone; F: T7-xylanase-α-amylase, clearing zone around very small plaque (arrow); G: T7-α-amylase-xylanase, with clearing zone.

6 shows the relative% brightness of handsheets made from pulped MOW after phage construct treatment. T7NE: T7 without enzyme (100%); T7 Amy: T7 with amylase; T7Xyn: T7 with xylanase; T7AX: T7 with both amylase and xylanase; T7NE + com Amy: A mixture of T7-NE digest and commercial amylase.

To describe a preferred embodiment of the present invention, the abbreviations used herein are as follows:

DE = dextrose equivalent

DNS = dinitrosalicylic acid

IPTG = isopropyl-beta-D-thiogalactopyranoside

MOI = multiplicity of infection

PCR = polymerase chain reaction

PEG = polyethylene glycol

PPM = parts per million

SEC = size exclusion chromatography

TA = Terrific agar

TB = Terrific broth

Unless otherwise indicated, the invention will employ conventional chemistry, proteochemistry, molecular biology and enzymatic techniques, within the capabilities of those skilled in the art. Such techniques are well known by those skilled in the art and can be fully explained by the respective documents. It is obvious that the present invention is not limited to the specific materials and methods described herein, as the materials and methods vary. It is obvious that the terminology used herein is for the purpose of describing particular embodiments only, and is not limited by the scope of the present invention but only by the appended claims.

In the description of the present invention, the term “comprise” or a variant such as “comprises” or “comprising”, except where necessary for context due to language or implications, It is used to characterize features of the described invention in a broad sense, that is, without limiting additional features or presence in various embodiments of the invention.

In this specification, the articles “a”, “an” and “the” include plural forms unless the context clearly dictates otherwise, for example, “an enzyme” thus enzyme. ) And “an amino acid” includes one or more amino acids.

"Plurality" means "plural" or "more than one."

When a range of values is expressed, it can be seen that these ranges include the upper and lower limits of the range, meaning all values within these limits.

According to a first aspect of the present invention, the present invention provides a method for producing a product of an enzymatic reaction. This method is aimed at the use of commercial production of enzyme (s).

As used herein, an "enzymatic reaction" means a reaction that is catalyzed by an enzyme in such a way that the reactant itself is consumed in the reaction to form a product.

This is different from the transcriptional response, which depends on the template. For example, polymerases synthesize RNA or DNA that is complementary to a template. To decode the template, the polymerase must complex with the template before the polymerase catalyzes RNA or DNA synthesis. Although this template is present during the reaction process, it is not a reactant of the reaction because it does not split or burn out during the production of one or more products.

As used herein, the term “catalyze” means that the rate of enzymatic reactions is accelerated by substances that remain without chemical change due to the reaction.

Enzymatic reactions can be part of a series of enzymatic reactions, such as metabolic pathways. A “metabolic pathway” is a series of enzymatic reactions that involve the synthesis (assimilation) of products derived from the reactants and the decomposition (catabolism) of the reactants that produce one or more products. It means making larger molecules into smaller molecules, or breaking large molecules to produce smaller ones.

"Enzyme" means a molecule or collection of molecules that promotes an enzymatic reaction. Enzymes are usually specific to the reaction they catalyze and specific to the reactants involved in the reaction. It is a large complex molecule that has an active site and a binding site, and the active site of the enzyme is the binding site where the catalyst takes place The structure and chemical properties of the active site are the recognition and binding of the reactants. The binding site is the part of the protein to which the specific ligand binds.

The present invention is suitably related to protein enzymes and functional fragments, variants and derivatives thereof. The functional fragment of an enzyme is a portion of the enzyme that has the expected catalytic activity of the enzyme. For example, when the enzyme is alpha-amylase or xylanase, functional fragments refer to all fragments having the activity of amylase or xylanase, respectively.

Functional variants of enzymes have one or more substitutions such that the secondary conformation does not change but the activity of the enzyme is maintained. Examples of such conservative substitutions include amino acids having the same hydrophobicity, size and charge as the original amino acid residues. Substitutions are often well known by those skilled in the art of protein or peptide chemistry. For example, conservative substitutions may be converse with substitution of glycine for proline; Substitution of a glycine for alanine or valine and vice versa; Substitution of leucine for isoleucine and vice versa; Substitution of lysine for histidine and vice versa; Substitution of cysteine with threonine and vice versa; Substitution of asparagine with glutamine and vice versa; And the substitution of glutamic acid with arginine and vice versa.

Functional derivatives include one or several amino acid residues, either naturally occurring or substituted by synthetic amino acid homologs of twenty standard amino acids, but the activity of the enzyme remains unchanged. Examples of such homologues include 4-hydroxyproline, 5-hydroxylysine, 3-methylhistidine, homoserine, ornithine, [beta] -alanine and 4-aminobutanoic acid, beta-alanine, norleucine, norvaline And hydroxyproline, thyroxine, gamma-aminobutyl acid, homoserine, citrulline and the like.

The term "enzyme" can also extend meaning to homologues of enzymes. Homologs of enzymes have protein sequences that are quite similar to enzymes. Homologs with more than 80% sequence similarity fall within the category of "enzymes", provided they maintain the catalytic function of the enzyme.

Suitable enzymes for use in the present invention include lipase, phytase, amylase, xylanase, cellulase, dehalogenase, lactinase, pectinase, formic acid dehydrogenation. Enzymes, aspartic acid transaminase, transketolase, lactase, alpha-galactosidase, alkaline phosphatase, pullulanase, isoamylase, alpha-1,6-glucosidase, beta-glucanase, glucoamylase, Hydrolytic dehydrogenase, subtilinin, fructose-bisphosphate aldolase and glucose isomerase. Table 1 shows examples of reactions catalyzed by these enzymes and the processes that are usefully used.

Examples of enzymes and reactions catalyzed by enzymes Kind of enzyme Catalyzed reaction enzyme fair Functional group / substrate product 1. Redox enzymes Oxidation-reduction; Hydrogenation at oxidation or C-H, C-C and C = C bonds  Formic acid dehydrogenase Cofactor Reproduction Formic acid + NAD (+) CO ₂ + NADH 2. Transferase Delivery of aldehydes, ketones, acyls, sugars, phosphoryls and methyl groups Aspartic Acid Transaminase L-aspartic acid + 2-oxoglutaric acid = oxaloacetic acid + L-glutamic acid L-aspartic acid + 2-oxoglutaric acid Oxaloacetic acid + L-glutamic acid       3. Hydrolase Hydrolysis and Formation of Esters, Amides, Lactones, Lactams, Epoxy, Nitriles, Anhydrides, Glycosides, and Organohalogen Compounds Alpha-amylase Alpha-amylase is used to hydrolyze α-1,4 bonds in both amylase and amylopectin and to liquefy starch to lower viscosity. Enzymatic reactions involve hydrolyzing the 1,4-alpha-D-glocoside bonds of polysaccharides comprising three or more 1,4-alpha bound D-glucose units. Α-1,4-linkage of polysaccharides Low Molecular Weight Polysaccharides 1,4 xylanase Depolymerization of xylanase is important in the bakery and agrowaste industries, as well as in pulp and paper and livestock feed. Hydrolysis of Xylan's 1,4-beta-D-Xyloside Bonds Xyloligopolysaccharides and xylose   4. Lyase Small molecule addition / removal of C = C, C = N and C = O bonds Fructose-bisphosphate aldolase D-fructose 1,6-bisphosphate = glycerone phosphate + D-glyceraldehyde 3-phosphate Glycerone Phosphate + D-Glyceraldehyde 3-Phosphate D-fructose 1,6-bisphosphate       5. Isomerase Racemization, epimerization, and rearrangement Glucose isomerase Fructose is sweeter than glucose, but since glucose is readily available and inexpensive, it is preferable to use glucose when producing fructose using glucose isomerase. D-glucose 6-phosphate = D-fructose 6-phosphate Intramolecular Redox and Isomerized Glucose 6-Phosphate Fructose 6-phosphate 6. Rigaze Formation / cutting triphosphate cleavage of C-O, C-S, C-N or C-C bonds DNA ligase (NAD +) NAD + + (deoxyribonucleotide) n + (deoxyribonucleotide) m = AMP + nicotinamide nucleotide + (deoxyribonucleotide) n + m NAD + + (deoxyribonucleotide) n + (deoxyribonucleotide) m AMP + Nicotinamide Nucleotide + (Deoxyribonucleotide) n + m

Examples of specific enzymes suitable for use in the present invention include alpha-amylase and xylanase. The "alpha-amylase", an endohydrolase, cleaves α-1,4-oligosaccharide bonds and produces α-dextrin, maltose, G3, G4 and G5 oligosaccharides. Preferred alpha-amylase of is 1,4-α-glucan glucan hydrolase (EC 3.2.1.1) of Bacillus licheniformis Commercially, alpha of amyloid of B. licheniformis Amylases are widely used in the paper and textile industry, as well as in processes requiring high temperatures such as liquefaction of starch in the early stages of ethanol, maltose and glucose syrup production.

“Xylanase” is an enzyme that catalyzes the internal hydrolysis of the main chain of xylan, the main component of hemi-cellulose. The preferred xylanase of the present invention is Bacillus halodurance. halodurans ) xylanase A (1,4-beta-D-xylan xylanase, EC 3.2.1.8) of C125. Xylanase A belongs to family 10 of xylanase and is commercially preferred because it can catalyze a reaction between pH 6-10. Xylanase is important for the bleaching and pulping of paper in the paper and pulp industry or for flour processing in the livestock feed industry and the bakery industry.

Enzymatic reactions produce products from the reactants. The "reactant" is the starting material for the enzymatic reaction and is consumed in the enzymatic reaction. The "product" of the enzymatic reaction may be the final product or an intermediate product. As mentioned above, the enzymatic reaction may produce one or more products. One, two, several or all of the products produced can be recovered in the recovery step, preferably the products are recovered.

In this specification, a "product" is a commercially preferred product. The object of the first aspect of the invention is to accumulate the product either directly or through the production of intermediate products. Thus, the method of the first aspect of the present invention is non-analytical and is completely different from the screening of enzymatic activity using phage display.

Depending on the needs of one or more reactants to produce the product, the enzymatic reaction requires suitable conditions and time for the enzyme to catalyze the reaction. Suitable conditions may include a specific temperature, pH, salt concentration, etc. or one or more co-factors. The conditions for each reaction must all be met and at least the enzyme and reactant must be contacted in order to trigger the enzymatic reaction.

The enzymes of the present invention are produced by recombinant viruses. A "virus" is an infectious agent that proliferates itself only within the cells of a living host, consisting of nucleic acids surrounded by a thin shell of protein. Viruses suitable for use in the present invention are shown in Table 2.

The term "recombinant" refers to a particle molecule in which two separate segments of the sequence are made by artificial combination, ie by techniques such as chemical synthesis or genetic engineering, etc. .

Thus, "recombinant virus" refers to a virus in which one or more proteins are present, but not of the viral origin.

Methods of producing recombinant viruses that produce a single enzyme are known in the art. For example, suitable nucleic acid molecules can be inserted into the virus through a variety of procedures known in the art, which include encoding an enzyme at a suitable restriction endonuclease site adjacent to the viral gene for production of the outer protein. And a process for recombinantly inserting nucleic acid molecules.

"Non-native enzyme" means an enzyme that is not expressed by the wild type of naturally occurring virus. For example, the enzyme may be expressed by a nucleic acid molecule made by artificial binding of two or more nucleic acid molecules which are not found in a combined form in nature.

As used herein, “contacting” or “contacting” means bringing the reactant and the recombinant virus that produces the enzyme into contact with each other. Reactants and recombinant viruses can bind to each other in any order. Recombinant viruses producing enzymes may be added to the reactants and vice versa.

As used herein, “recovered” means, for example, separating or purifying the product from the enzyme. The product of the enzymatic reaction is recovered by any means known in appropriate purity for the intended use of the product. The method of recovering the product of the enzymatic reaction is known in the art and will depend on the product being recovered Suitable methods include affinity chromatography, the use of one or more purification tags, extraction and precipitation And / or filtration The recovered product may be applied to other reactions, optionally via other treatments or reaction steps, the recovered product may be properly prepared for use in its intended use.

The term “encoded” or “encodes” refers to nucleic acid sequence information that generally exists in a translatable form. Antisense strands are also believed to be able to encode sequences, since the same content of information exists in a readily accessible form, particularly when linked to sequences that promote expression of the sense strands. It is true.

As used herein, “nucleic acid molecule” means DNA or RNA, antisense nucleic acid molecule, and may include functional fragments of nucleic acid molecules. When functional fragments of nucleic acid molecules are expressed as proteins, Means when the expressed protein is maintaining the activity of the original protein.

Nucleic acid molecules can be recombinantly inserted into the viral genome. As used herein, “recombinantly inserted” means that the nucleic acid molecule is artificially inserted or added to another nucleic acid molecule such as a viral genome.

As used herein, "genome" refers to the entirety of the genetic complement of an organism, including all genes of the organism. Thus, the viral genome includes all genes of the virus.

A "gene" refers to a nucleic acid molecule that contains information about a particular function. Thus, a viral gene refers to a nucleic acid molecule that encodes a particular viral protein (especially the outer envelope protein). Or more signal sequences, replication sources, enhancer factors, promoters and / or transcription termination sequences.

The signal sequence may be a constituent of the virus or may be part of a nucleic acid encoding an enzyme inserted into the virus. The signal sequence may be a signal sequence of a prokaryote, mammal or insect. For example, the signal sequence may be an alkaline phosphatase, penicillinase, LPP, heat resistant endotoxin II leader sequence.

Recombinant viruses include promoters operably linked to nucleic acid sequences encoding enzymes. Potential Promoters recognized by various host cells are well known. Suitable promoters for use with bacterial hosts include hybrid promoters such as p-lactamase and lactose promoter systems, alkaline phosphatase, tryptophan (trp) promoter systems, and tac promoters, all of which are available to those skilled in the art. Known.

When a sequence is "operably linked" to a promoter, it is meant when the functional promoter enhances the transcription or expression of that sequence.

Recombinant viruses also include cloned select genes, called selectable markers, which encode proteins that aid in the isolation of organisms carrying the virus. Conventional selection genes, such as genes encoding D-alanine racemase, confer resistance to antibiotics or other toxic substances, such as (a) ampicillin, neomycin, methotrexate or tetracycline. And (b) encodes a protein that compensates for auxotrophic deficiency or (c) supplies important nutrients for Bacillus that are not available from complex medium. Enzyme-encoding nucleic acid molecules and fragments thereof are nucleic acid molecules encoding viral envelope proteins and may be expressed as part of the same translation product. Coat proteins are proteins that form part of the shell that surrounds the nucleic acid core of a virus. Examples of shell proteins suitable for use in the present invention are shown in Table 2. Preferably, the present invention uses outer protein 10 of phage T7.

In the use of the method of the first aspect of the invention, the recombinant protein produces one or more enzyme (s) which are part of the same translation product as the protein of the virus. "Same translational product as a protein of the virus" means that the enzyme is produced as part of the same protein as the viral envelope protein. "Separate translational product as a protein of the virus" means that the enzyme is produced as a separate protein as a viral envelope protein.

According to one embodiment of the invention, the nucleic acid molecule encoding the enzyme is recombinantly inserted into a nucleic acid molecule encoding the outer protein of the virus, such as the outer protein 10 of recombinant T7.

Viruses and Shell Protein Mammalian Viruses Suitable for Use in the Present Invention and genus Bell Outer protein for fusion of enzymes Adenoviridae Mastadenovirus Human Adenovirus C Outer protein II: High expression Outer protein III, IIIa and 및: Low expression Parvobiiridae Defendovirus Adeno-associated virus 1 High expression in VP-1 to VP-3, V-3 Herpesviridae Simplexvirus Herpes virus 1 Intradermal Glycoprotein: Low Expression Foxviridae Orthopoxvirus Besonia virus Open reading frames F13L, A34R, A36R, B5R and A56R encode envelope related proteins for low expression. Retroviridae Betaretrovirus Mouse breast cancer virus MA protein associated with lipid membrane for low expression Picornaviridae Hepatovirus Hepatitis A Virus Key Capsid Protein vp1-3 for High Expression  Picornaby Rhino virus Human Renovirus A vP1, 2 and 3: high expression Hepadnaviridae Hepadnavirus Hepatitis B Virus S-protein for high expression. M and L Proteins for Low Expression Orthomyxoviridae Influenzavirus A Influenza virus Hemagglutinin: low expression Nodavirus Flockhouse virus

Insect virus

and genus Bell Outer protein for fusion of enzymes Baculoviridae Nucleopolyhedro -virus Autographa california nucleopolyhedro -virus Key outer protein GP64: low expression Baculo Riviera Granulovirus Codling moth granulovirus (Cydia pomonella Granulovirus) Togaviridae Alphavirus Sindbis virus Since it is a single capsid protein, high expression is possible. Low expression of the envelope glycoproteins E1 and E2 is also possible. Nodarviridae Nodavirus Flockhouse virus

Plant virus

and genus Bell Outer protein for fusion of enzymes Pottyviridae Potyvirus Turnip mosaic virus Unclassified Tobamovirus Tobacco Mosaic Virus High expression in a single outer protein Unclassified Tenuivirus Ogal disease virus Geminiviridae Mastrevirus Corn Stripes Virus Bunyaviridae Tospovirus Tomato Stain Wither Virus Low Level Cloning in Cortical Glycoproteins Caulimoviridae Cassava vein mosaic-like viruses Cassava Lobe Mosaic Virus Late cleavage of high expressing polypeptide precursors in the envelope protein encoded in the open reading frame IV causes expression problems. Gemini Begomovirus Tomato yellowing leaf virus

Fungal virus

and genus Bell Outer protein for fusion of enzymes Partitiviridae Partitivirus Wheat blight pathogen virus Totiviridae Totivirus Saccharomyces cerevisiae virus L-A Gag, a major outer protein, is highly expressed. Gag-pol is low expression

Bacteriophage

and genus Type Species / Yes Outer protein for fusion of enzymes Corticoviridae Corticovirus PM2 Major capsid protein P2 is highly expressed Innoviridae Inovirus Collifage fd Outer Protein III: Low Expression Outer Protein Ⅷ: High Expression Inobiri University Plectrovirus Acole Plasma Phage Leviviridae Levivirus Coli Phage MS2 Major outer protein: high expression possible Levi Allolevirus Coliphage Qbeta Major outer protein: high expression possible Myoviridae Coli Phage T4 Soc and Hoc: low expression gp23: high expression Grape Squash (Podoviridae) Coliphage T7 Outer protein 10: high to low depending on the promoter used Siphoviridae Lambda phage group Coli Phage Lambda Key outer protein E: outer proteins D, B, W, FII, B *, X1 and X2 for high expression and low expression Sypoviridae Bacteriophage SPBc2 Tectiviridae Tectivirus Phage PRD1 P2 is a major capsid protein for high expression and P1 is a spike protein that allows for low expression Grape band "φ29-like viruses" Bacillus Phage φ29 gp8 is the main capsid protein: high expression Gp8.5 is heat fiber protein: low expression

Regardless of whether the virus contains a enzyme as a viral protein and in the same or separate translation products, if the recombinant virus contains multiple enzymes, such enzymes can be produced as the same or separate translation products.

As shown in FIG. 1G, a nucleic acid molecule encoding one enzyme can be recombinantly inserted into a nucleic acid molecule encoding one recombinant viral protein, and a nucleic acid molecule encoding another enzyme is recombined with a nucleic acid molecule encoding another viral protein. Can be inserted.

Alternatively, nucleic acid molecules encoding both enzymes can be inserted into nucleic acid molecules encoding one viral protein, both of which can be expressed as part of the same translation product (FIGS. 1A ′ and ii). The viral protein may be different copies of the same protein or different proteins.

Various techniques for introducing a large number of non-natural enzymes into a virus will be recognized by those skilled in the art (see FIGS. 1 and Examples).

The enzyme and viral protein when produced as the same translation product may be separated or directly linked by linkers, cleavage sites and / or purification labels. “Linker” means a sequence that determines the conformation that allows the functional activity of the protein to which it is attached. Preferably, the linker is a peptide as 1, 2, 3, 4, 5, 6, 7 , Amino acids 8, 9, 10, 20, 30, or 50 or more. The length of all linkers used may vary depending on the nature of the enzyme, and in the absence of short or preferred linkers, It may vary depending on whether a rigid conformation is desired or whether a flexible structure is desired.

"Cleavage site" refers to an amino acid sequence that can act on proteolytic enzymes to cleave enzymes from outer proteins (TEV and Factor Xa) (TEV, Factor a). Means an amino acid sequence such as hexHis, Flag ^™ or I.SPY ^™ or a non-amino acid sequence such as biotin, which can be used to purify recombinant virus from an enzyme and / or solution or culture.

As shown in Table 2 above, viruses can infect host cells of the same category as mammalian, insect, plant, fungal or bacterial cells. The virus has a specific host type. Thus, those skilled in the art will be able to use any suitable host cell, provided that the appropriate virus is used. Examples of mammalian host cells are BSC-1, HeLa S3, CV-1, RK ₁₃ , Huh-T ₇ , BHK and EB ₉ .

Phage, also known as bacteriophage, refers to a virus that infects bacterial cells. Phage may be viral phage, temperate phage, filamentous phage, lytic, non-bacterial, enveloped, non-enveloped, DNA or RNA. For example, phages are Corticoviridae, Cystroviridae, Innoviridae, Leviviridae, Lipoviridae, Microviridae, Mio It may be Myoviridae, Plasmaviridae, Podoviridae, Siphoviridae, Sulpholobus shibatae virus or Tectiviridae. Examples of specific phages include PM2, Coliphage fd, Acholeplama phage, Coliphage MS2, Coliphage Qbeta, Coliphage T4, Coliphage T7, Coliphage Lambda, Bacteriophage SPBc2, Phage PRD1 and Bacillus (Bacillus) phage φ29. Preferably, in the present invention, T7 phage is used. T7 is a lytic phage of E. coli with an isometric head with six short fibers and a linear double stranded DNA.

The present invention will be described in detail with reference to the following embodiments and drawings which are not limited thereto.

Example 1 Design and Construction of Recombinant Virus

Bacillus licheniformis ( Bacillus) licheniformis (B2659) was isolated from rotten bread (from Food Science Australia, North Ryde, NSW, Australia). T7 phage and Escherichia coli coli ) And BLT5403 strain were supplied with a T7Select ^® 10-3 Cloning Kit (Novagen, 2000).

Bacillus Lee Kenny Po Ms (Bacillus licheniformis) are TY medium (to make a plate medium, 16gL ^-1 of tryptone (BD), 10gL ^-1 of yeast extract (Difco), a 5gL ^-1 sodium chloride (NaCl) and 20gL ^{- 1} Oxoid, see Martirani et. al ., 2002). The shake culture flask of BLT5403 was weighed into ¹² gL ^-1 tryptone (Oxide), 24 gL ^-1 yeast extract (Merck), 0.4% (v / v) glycerol and 20 gL ^-1 agar. ) Or Terrific Agar (TA). The medium was sterilized and then 10% (v / v) sterile phosphate solution (23.1 gL ⁻¹ KH ₂ PO ₄ and 125.4 gL ⁻¹ K ₂ HPO ₄ ) was added. Carbenicillin (Sigma) was sterilized with a filter (0.2 μm) and added at a concentration of 50 mgL ⁻¹ . Tower for plaques (plaque) to form (top) of the agarose is agarose 10gL ^-1 tryptone (Oxide), 5gL ^-1 yeast extract (Merck), 5gL ^-1 of sodium chloride (NaCl) and 6gL ^-1 ROOS LE (Promega).

Gene amplification

Bacillus licheniformis Alpha-amylase gene (Accession number X03236; X01386) was amplified in iCycler (Biorad) using primers 1 and 2 in Table 3 below. 20 ml TY medium culture in which Bacillus licheniformis was shaken overnight at 200 rpm and 30 ° C. in an orbital incubator-shaker (INFORS AG CH-4103, Bottmingen) DNA was extracted from. Cells were collected and pelleted, 200 μl of lysozyme buffer (50 mM glucose, 10 mM EDTA and 25 mM Tris-HCl (pH 8.0)) and 5 g / L lysozyme (Chicken eggwhite [muramidase], ICN biomedicals) (see : Resuspended using Sambrook and Russel, 2001, Molecular Cloning: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and incubated at 37 ° C. for 20 minutes. After lysozyme treatment, 500 µl of Trizol reagent (Invitrogen) was added, and DNA was extracted according to the producer's instructions.

Primers used for cloning and sequencing of alpha-amylase fused to T7 envelope protein 10 primer Sequence (5 '→ 3') Forward / Reverse Annealing Site SEQ ID NO: One TTACGCAAATCTTAATGGGACG Reverse 5 ’amyS One 2 GCTACTATCTTTGAACATAAATTGAAAC Reverse 3 ’amyS 2 3 CAACGGATGCTTGGAAACG Reverse amyS internal 3 4 GGTTTCCGTCTTGATGCTGT Forward direction amyS internal 4 5 GGAGCTGTCGTATTCCAGTC Forward direction T7SelectUP Primer 5 6 AACCCCTCAAGACCCGTTTA Forward direction T7SelectDOWN Primer 6

Amplification consists of 240 ng of template DNA, 1 μM of each primer, 1.25 U of polymerase (Taq DNA Polymerase (Promega), 1 pfu DNA polymerase (Promega), 0.2 mM of each dATP, dCTP, dTTP and dGTP (Promega). ), Mg ^{+ 2} is not 1 × buffer solution (Promega) and were used 2mM was carried out in a reaction volume of 50㎕ contains the MgCl ₂ to the cycle parameters, such as parameters: 2 minutes denaturation at 95 ℃ after one cycle 30 cycles consisting of 1 minute denaturation at 95 ° C., annealing at 47 ° C. for 30 seconds, extension at 75 ° C. for 3 minutes, and 1 cycle of extension at 72 ° C. for 1 minute agarose gel. After amplification, 1448 bp bands were purified using Wizard ^® PCR preps DNA Purification System (Promega).

Alpha-amylase-encoding nucleic acid T7Select  In vector Cloning

Alpha amylase amplification products can be obtained using the Trinucleotide Sticky End Cloning method (Dietmaier and Fabry, 1995, Protocol: Di / Trinucleotide Sticky End Clonin (DI / TRISEC) .In: Boehringer Mannheim PCR Applications Manual.Boehringer Mannheim GmbH, Biochemica, p. 136-140) and cloned into T7Select vector. Purified amplification products were phosphorylated using T4 polynucleotide kinase (Doyle, 1996, Protocols and Application Guide, 3rd Edition, USA: Promega Corporation, p.187), 0.5-fold of 7.5M ammonium acetate And precipitated using three times 100% ethanol. After mixing the material, DNA was precipitated at the highest rate for 15 minutes at 4 ° C. using a bench-top microcentrifuge (SIGMA 1-13, B. Braun Biotech International GmbH, Melsungen, Germany). DNA was washed with 70% (v / v) ethanol and then resuspended with 10 μl of nuclease-free water (Promega). Phosphorylated amplification products were reacted with T4 DNA polymerase (Roche) (64 ng / 35 μL of reaction mixture, ¹ gL- ¹ Bovine Serum Albumin (Sigma, Fraction V), 1 × Restriction Enzyme Buffer C (Promega), The reaction was carried out at 12 ° C. for 30 minutes in 1 mM dTTP (Promega) and 3 U / 35 μL of the reaction mixture), followed by heat treatment at 80 ° C. for 15 minutes, followed by ammonium acetate precipitation by the method described above. Purified DNA was resuspended in 1 μl of sterile water (dH ₂ O). The arm of the T7Select 10-3 vector (1 μg / 20 μL reaction volume) was transferred to 0.1 mM dATP (Promega), 1 × restriction enzyme treatment buffer A (Promega), and 4 U / 20 μL reaction volume Klenow enzyme (Roche). ) For 15 minutes at room temperature, and the enzyme was inactivated at 75 ℃. DNA was precipitated with ammonium acetate by the method described above and resuspended in 2 μl of sterile water. Ligation was performed according to the method of T7Select ^® System Manual (Novagen, 2000). Packaging the ligated DNA, and according to the process of the T7Select ^® System Manual (Novagen), were performed plaque assay.

Phage plaques displaying alpha-amylase were identified by incubation in top agarose containing Red Starch (Megazyme). Alpha-amylase depolymerized Red Starch into stained sections with small molecular weight. The small molecular weight fragments were metabolized or dispersed by BLT5403 host cells, exhibiting a clear zone around the plaques that could produce alpha-amylase, as shown in FIG. 2.

positivity( positive ) Cloning  Genetic confirmation

PCR amplification and sequencing were performed to confirm the presence of alpha-amylase gene in amylase-positive plaques. Amplification of the alpha-amylase gene confirmed the production of 1448 nucleotide amplification products using gene-specific primers (primers 1 and 2 in Table 3).

For DNA sequencing, phage lysates were obtained in 60 mL of BLT5403 incubated in TB medium containing 50 mgL- ¹ carbenicillin (Sigma) by the method described above (Novagen, 2000). The cloned alpha-amylase gene was amplified from boiled phage crushes for 10 minutes. For amplification were used ^® T7Select (Novagen) forward (forward) and backward (reverse) primer. The sequences of these primers are provided as Primer Nos. 5 and 6 in Table 3.

The reaction conditions for amplifying the gene from Bacillus licheniformis are as described above. T7Select ^® (Novagen) and purified by the ammonium acetate precipitation as described above for the amplification products using the methods forward and reverse primers. T7Select ^® additional primers designed from (Novagen) forward and inside (internal) regions of the gene and the reverse primer: using a (refer to primers 3 and 4 in Table 3) determining the sequence. Nucleotide sequence of the alpha-amylase gene present in the phage is Bacillus licheniformis ) and the amyS gene (Accession number M13256). The T7Select construct containing the amylase gene was named 'T7-amy'.

Xylanase ( xylanase ) -Coding of nucleic acid T7Select  In vector Cloning

Bacillus halodurans cultured overnight at 37 ° C. in Tryptone Soy Agar (Oxide)Bacillus halodurans) DNA was extracted from the culture of C-125 (JCM-9153-Japanese Collection of Microorganisms) using TRIZOL (Invitrogen) according to the supplier's instructions. Using primers 7 and 8 (see Table 4), the following reaction mixture (50 μl) was made and the xynA gene was amplified: 0.1 μg of DNA, μM of each primer, 1.25 U of polymerase (Taq Polymerase, Promega). ), 1 pfu of DNA Polymerase (Promega), 0.2 mM of each dATP, dCTP, dTTP and dGTP (Promega), Mg^{2 +}1 × buffer (Promega) and 2 mM MgCl without₂. The following cycle parameters were used: After 1 cycle of denaturation at 95 ° C., 1 cycle, 1 minute denaturation at 95 ° C., 30 seconds annealing at 53 ° C., 3 minutes extension at 75 ° C., and 5 minutes at 72 ° C. 1 cycle extension. Amplification products were analyzed using 1% agarose gel.

The amplification product was purified by ammonium acetate precipitation using 0.5 volumes of 7.5M ammonium acetate and 3 volumes of 100% ethanol. After mixing the materials, DNA was precipitated at 4 ° C. for 15 minutes using a bench-top microcentrifuge (SIGMA 1-13, B. Braun Biotech International GmbH, Melsungen, Germany). DNA was washed with 70% (v / v) ethanol and then resuspended with 10 μl nuclease free water (Promega).

According to the producer's instructions, the ends of the fragments were cut using EcoRI (Promega) and HindIII (Promega). The cleaved DNA was purified by the ammonium acetate precipitation method. The resulting fragments were ligation into T7Select vector arm (Novagen) using T4 DNA ligase (Roche). Ligation was carried out at 4 ° C. for one day. After ligation into the T7 vector, the cloned DNA was packaged into virions using reagents and experimental methods supplied from the T7Select System (Novagen). The integrity of the construct (T7-xyn) was confirmed through DNA sequencing.

Primer used for cloning a nucleic acid encoding xylanase to T7Select vector primer Sequence (5 '→ 3') Forward / Reverse Annealing Site Base addition Construct SEQ ID NO: 7 tcttcttgaattccgaaaacctgtacttccagggtgctcaaggaggaccaccaaaatc Forward direction 5′-xynA terminus 5 ′ EcoRⅠ in front of rTEV protease cleavage site T7 Xyn 7 8 tctcttcaagcttctaatcaataattctccagtaagcaggtttc Reverse 3′-xynA terminus 3'-HindⅢ T7 Xyn 8

Example 2 Kinetic Analysis of Alpha-amylase

Km  and kcat Measure

The activity of crude phage-expressed enzyme and PEG 6000-precipitated phage expressase (Novagen) resuspended in 0.05M glycine-NaOH (pH 9.0) were obtained from commercially available TB and 0.05M. The activity of alpha-amylase (Sigma, Cat. No. A3404) in glycine-NaOH (pH 9.0) was compared. For the measurement of Km and kcat, the range of the starch (hydrolyzed potato starch, Aldrich) concentration for electrophoresis was 0% [w / v] to 2.5% [w / v]. All measurements were repeated three times. Starch was boiled in TB or 0.05M glycine-NaOH (pH 9.0) for 15 minutes.

Equal amounts of starch and digest / enzyme preparations were equilibrated in separate tubes at a temperature of 70 ° C. for 10 minutes. The enzyme and starch test samples were mixed and reacted at 70 ° C. for 10 minutes. Starch and enzyme samples to be used as a blank (blank) was placed in a separate tube and left for 10 minutes at 70 ℃. To minimize maltose production, control starch and enzyme were mixed at the time of color development. Dinitrosalicyclic acid (DNS) color reaction assay was referred to Bernfeld's method (Amylases, alpha and beta.Method Enzymol., 1: 149-158, 1955). Starch-enzyme solution (1 mL) was added to 1 mL of color reagent and boiled in boiling water for 10 minutes. After boiling and rapidly cooling on ice, 10 mL of dH ₂ O was added thereto, and the OD ₅₄₀ value was measured using a UV-1601 spectrophotometer (Shimadzu Corporation, Kyoto, Japan). Maltose was used as the standard to determine the concentration of reducing sugars. Km and Vmax measurements were determined using a Lineweaver-Burk plot, and kcat measurements were calculated using the following equation:

kcat = Vmax / [E] _i

     Where

   Vmax represents the maximum velocity calculated from the Lineweaver-Burk plot,

[E] _i represents the initial enzyme concentration.

The enzyme concentration of the phage was calculated assuming an average of 10 molecules of enzyme per phage (T7Select ^® System Manual, Novagen), and the phage concentration of the digested product was determined using the plaque assay, and the concentration was determined using the following equation. :

Mass = (number of molecules × molecular weight) / constant of avogadro

The kinetics of phage-expressing alpha-amylase was investigated by Sigma ( Bacillus licheniformis ). A3404) is compared with the kinetic properties of alpha-amylase and the results are shown in Table 5 below.

Kinetic data of alpha-amylase produced by T7-amyphage and commercial alpha-amylase Crude phage digest (T7-amy) Sigma α-amylase of TB PEG 6000-precipitated T7-amy phage of 0.05M glycine-NaOH, pH 9.0 Sigma α-amylase of 0.05 M glycine-NaOH, pH 9.0 Km (%) 0.05 0.03 0.08 0.08 kcat (min-1) 581 315 426 180 kcat / Km (% -1, min-1) 11614 11819 5570 2268 Optimum temperature (℃) 70 70 70 70 Activation energy (J / mol) 12696 9934 17111 12944

The crude enzyme produced by T7-amyphage showed a high affinity for starch with a Km of 0.05%. The affinity of the crude enzyme for starch was compared to that of commercial alpha-amylase (Sigma) in TB. Both the crude enzyme produced by T7-amy phage and the commercially available enzymes in TB showed lower Km values compared to the same enzymes in 0.05M glycine-NaOH (pH 9.0) buffer. The kcat value of the crude enzyme produced by T7-amy phage was 581 min ^{- 1} , which was slightly higher than 315 min ^-1, the kcat value of commercial enzymes contained in TB. Both the enzyme produced by T7-amy phage and the commercially available enzyme showed lower kcat values in 0.05M glycine-NaOH than in TB. Compared with commercially available enzymes, the high kcat value of the T7-amy phage-expressing enzyme in glycine buffer is due to the residual media composition present after phage precipitation, thereby enhancing the activity of the enzyme. Crude enzyme has a kcat / Km value of 11614%

^-1 .min ^{- 1} in was very efficient. This efficiency is about the same as commercial enzymes in TB, and significantly higher than precipitating enzymes produced by commercial enzymes and T7-amy phage in 0.05M glycine-NaOH (pH 9.0).

As shown in FIG. 3, both the enzyme produced by T7-amyphage and the commercially available enzyme showed optimal activity at 70 ° C., but rapidly decreased at 80 ° C. and 90 ° C. As shown in FIG.

Activation energy measurement

For the measurement of activation energy, starch (hydrolyzed potato starch for electrophoresis, Aldrich) was used at a final concentration of 10 gL ⁻¹ . The enzyme assay was as described above except that the temperature range was 30 ° C (303.1K) to 90 ° C (363.1K). The activation energy was calculated using the Java Arrhenius calculator ( http://members.nuvox.net/~on.jwclymer/arr.html ) using the following equation:

Ea = -R * slope

     Where

R represents gas constant [8.314 J / mol K],

The slope was calculated as a function of 1 / T [K] relative to the Ln speed [mol / L / sec] using the temperature K and the speed value. If the substrate concentration is constant, the velocity is proportional to the velocity constant k, because velocity = k [substrate]. Only the measured value of the linear portion of 1 / T [K] with respect to the Ln rate [mol / L / sec] was used for the activation energy calculation.

As shown in Table 5, the activation energy of both the commercial enzyme and the enzyme produced by the T7-amy phage is low, which means that a small amount of energy is required for the hydrolysis of starch occurring in the presence of alpha-amylase. . Enzymes produced by T7-amy phage when crude digest and after resuspension in 0.05M glycine-NaOH (pH 9.0) after precipitation are commercially available amylase enzymes contained in TB and 0.05M glycine-NaOH (pH 9.0). In comparison, it had a slightly higher activation energy.

From these results, it can be seen that alpha-amylase expressed by T7 has a much better effect than commercial alpha-amylase in terms of efficiency (kcat / Km), temperature optimization and activation energy. In addition, the results indicate that the activity of alpha-amylase produced by T7 in the crude digest was determined by T7 in 0.05M glycine-NaOH (pH 9.0) (buffer, which is shown to impart optimized activity of purified alpha-amylase). It is shown to be superior to the activity of alpha-amylase produced. This shows that it may be possible to include the product of the enzyme into a liquefaction process without undergoing an expensive and time-consuming process of purifying the enzyme from phage before use.

Example 3 Mass Production of Phage

T7-amy phages were produced in 10 L fermenter of Biostat ^® C (B. Braun Biotech International GmbH, Melsungen, Germany). At this time, the fermentation broth was composed of 36 gL- ¹ tryptone (Oxide), 72 gL- ¹ enzyme extract (Merck), 0.4% (v / v) glycerol, 10% (v / v) after sterilization Phosphoric acid solution (23.1 gL- ¹ KH ₂ PO ₄ and 125.4 gL- ¹ KH ₂ PO ₄ ) was added. The sterilized phosphate solution was FE411 (B. Braun Biotech International GmbH, Melsungen, Germany) using a peristaltic pump (peristaltic pump), the solution in the fermenter through a 0.2 μm filter (Sartorius) before inoculation into the fermenter after sterilization of the medium Carbenicillin (50mgL- ¹ , Sigma) was added by injection. Antifoam (5 mL, Sigma) is added to the initial medium prior to sterilization, but no further addition is required afterwards. 50 mgL

BLT5403 ( E. coli ), which was spawned in a TB containing ^-1 carbenicillin, was incubated at 200 rpm for one day at 37 ° C, and then 6L having a measured value at OD ₆₀₀ between 0.3 and 0.4. Was used for inoculation of fermentation medium. The conditions at the time of culture were 37 degreeC and pH 7.4. The pH was measured using a Mettler Toledo 405-DPAS-SC-K8S / 120 equipped with a pH probe, 10% (v / v) ammonium hydroxide solution and 10% (v / v). PH was adjusted using ortho-phosphoric acid solution. Dissolved oxygen was adjusted to 20% and measured using a Mettler Toledo InPro 6310/100 / T / NO ₂ sensor. Aeration was maintained using alternating stirrers and airflow. The gas mixture was initially set to 40% oxygen and 60% air, with the oxygen concentration increased by the oxygen demand of the culture. Sartofluor Capsule (Sartorius) of 0.2 μm was used to filter the air entering the fermenter, and Sartofluor Mini Cartridge (Sartorius) of 0.1 μm was used as an exhaust filter. 2.5 hours after incubation, glycerol (Sigma, 99% +) diluted with 72% (v / v) deionized water was added to the fermenter using a FE411 (B. Braun Biotech International GmbH, Melsungen, Germany) peristaltic pump. Put it. The feed profile was as follows:

y = 1.88e ^{0 .11t}

Where

y represents the percentage of the pump maximum flow rate (100%),

1.88 represents the initial flow rate (as a percentage of the maximum flow rate),

0.11 is the slope of the log curve to determine the flow rate of the feed

Represents μ,

t represents time (h).

The flow rate of 72% (v / v) of glycerol supplied through a silicone rubber tube (Jehbsil ^® ) with an inner diameter of 1.6 mm × an outer diameter of 4.8 mm was according to the following formula:

y = 0.2773x + 0.4726

Where

y represents the flow rate (mL / min),

x represents the percentage of maximum flow rate.

     For control of the fermentor, the software MFCS / win IFB RS-422 (B. Braun Biotech International GmbH, Melsungen, Germany) was used.

Number in TB containing carbenicillin 50mgL ^-1 growth phase of E. coli to grow rapidly (exponential phase) (E. coli), the main BLT5403 host cells, OD ₆₀₀ value of 29.5 (4 h after inoculation) and a MOI value of 0.007 and When between 0.01 and inoculated with T7-amy phage. About 3 hours after the inoculation, lysis of the culture occurred, which can be seen by rapidly decreasing the oxygen demand. After dissolution, the phage concentration of the fermenter was 6.2 × 10 ¹⁰ pfu / mL, which was about the same as 4 × 10 ¹⁴ pfu / total fermenter volume. Estimating 10 enzyme molecules per phage (Novagen, 2000), 0.4 mg of enzyme was produced during the fermentation process (0.06 mg L ⁻¹ ).

The use of a phage titer as an indicator of enzyme concentration in a fermenter could have underestimated the enzyme concentration, which is the result of agitation and oxygenation, which led to increased shearing of the fermenter. This was because the rate of phage infection caused by degradation of the culture could be reduced. Phage production can be optimized by the addition of suspended substrates such as montmorillonite and colloidal clay particles of attapulgite, which will reduce virus inactivation as the phage adsorbs into the particles. Meant that it could. A small scale assay of alpha-amylase activity in digests using 2% starch (hydrolyzed potato starch) revealed 0.111 g reducing sugars / L digests / min at 70 ° C.

Example 4 Calculation of dextrose equivalent (DE) value of fermenter digest

Wheat starch (Sigma) was placed in deionized water containing 80 ppm calcium acetate at a concentration of 30% (w / v) and slurried to give a volume of 500 mL in a round bottom flask. Fermenter digests are poured to a final volume of 1 L, heated in an Electromantle MV (Electrothermal, UK) heating mantle, and then hand-held homogenizer to shear the starch. (Ultraturrax T25 Basic, IKA Works, Asia, Selanger, Malaysia) was used for further homogenization. When the temperature of the starch mixture reached the boiling point, an additional 5 minutes were boiled and placed in a water bath at 93 ° C. A 1 g aliquot was removed periodically and diluted with 9 mL of sterile water to test the reducing sugar concentration (see Bernfeld, 1955, supra) on the glucose standard curve. The solid starch in the solution is boiled in a DNS developing reagent before measuring the OD ₅₄₀ value, and then centrifuged for 30 seconds in a bench-top microcentrifuge (SIGMA 1-13, B. Braun Biotech International GmbH, Melsungen, Germany). Pelletized. DE values were calculated as% reduced sugars expressed in glucose liberated from total carbohydrates.

4 shows DE values obtained using 15% wheat starch containing 40 ppm of calcium ions and fermenter digest. DE values of 8 to 14 are values expected by the starch industry performing liquefaction under optimized conditions. These conditions are not possible at the laboratory level, but the DE values in the commercially expected range were obtained using enzymes much less than those currently used industrially. We would like to emphasize that this level of DE value was obtained using crude decomposition products. There is no need to purify the enzyme and after 2 hours of incubation at 93 ° C., no phage or bacteria will be present. Saccharified syrups obtained from starch are usually filtered or purified through activated charcoal and ion exchange resins to remove any large contaminants from the enzyme production process before the end product is used. Will be. When starch is used for the production of ethanol, liquefied starch can be further applied to batch yeast fermentation, so the purity of the original sample will not be a problem.

Example 5 Cloning of Nucleic Acids Encoding Alpha-amylase and Xylanase into T7 Select Vectors Encoding them to Be Expressed in the Same Translation Product

As shown in FIGS. 1A and 1Aii, the two enzymes used in the present invention were cloned into T7 phage to encode the nucleic acid molecules with the same translational product. Cloning two enzymes into the same phage is highly desirable because many industrial enzymatic reactions require the use of more than one enzyme. Examples include the use of fatty acid-oxidases for beer production, fiber decolorization, baking, production of laundry detergents, enzymatic bleaching of cotton, separation of lipid fractions from corn fiber and production of paper stock. This includes.

Bacillus Lee Kenny Po Ms (Bacillus licheniformis) alpha-amylase (α- 1,4-glucan hydrolase glucan (glucan glucanohydrolase), EC 3.2.1.1) and Bacillus halo Durance (Bacillus halodurans ) Xylanase A (1,4-beta-D-xylan hydrolase, EC 3.2.1.8) of C125 (JCM 9153) was cloned into T7Select vector (Novagen) to convert them into one translation product. Produced. Translation products also include T7 envelope protein 10 (CP10). Both alpha-amylase and xylanase were orientated, CP10-alpha-amylase-xylanase (T7-AX) and CP10-xylanase-alpha-amylase (T7-XA).

xynA the genes of Bacillus halo Durance (Bacillus halodurans ) amplified under the above reaction conditions using genomic DNA and primers 11 and 12 for T7-AX (see Table 6) or primers 13 and 14 for T7-XA (of which the Same as above conditions, except the time was reduced to 2 minutes). The amyS gene was amplified from 10 µl of boiled T7-amyS digest (described in Example 1), and the reaction conditions were almost the same except that the annealing temperature was changed to 49 ° C. Primers 9 and 10 (see Table 6) for T7-AX constructs and primers 15 and 16 for T7-XA. PCR products were analyzed, purified and digested with appropriate restriction enzymes (BamHI, EcoRI and HindIII), ligated into T7Select vector arms and packaged in virions by the methods described above. Plaques producing alpha-amylase and / or xylanase were identified by culturing in top agarose containing Red Starch (Megazyme) and Birchwood azo-xylan (Megazyme), respectively (see Figure 5). The total of the final constructs was confirmed by DNA sequencing using primers 1-17 (see Tables 3, 5 and 6).

Primers used for cloning alpha-amylase and xylanase to produce as identical translation products primer Sequence (5 '→ 3') Forward / Reverse Annealing Site Base addition Construct SEQ ID NO:  9 tcttcttgaattccgcaaatcttaatgggacgc Forward direction 5 'amyS terminus 5 ’EcoRⅠ T7 AX (amy) 9   10 tcttcttggattccaccctggaagtacaggttttctgaacctctttgaacataaattgaaaccga Reverse 3 'amyS terminus 5 ′ stop codon deletion, linker, rTEV site, BamHⅠ T7 AX (amy) 10  11 tcttcttggatccggcggctcatcagctcaaggaggaccaccaaaatc Forward direction 5 'xynA terminal 5′BamHⅠ, linker in frame T7 AX (xyn) 11  12 tctcttcaagcttctaatcaataattctccagtaagcaggtttc Reverse 3 'xynA terminal 3 ’HindⅢ T7 AX (xyn) 12  13 tcttcttgaattccgctcaaggaggaccaccaaaatc Forward direction 5 'xynA terminal 5 ’EcoRⅠ T7 XA (xyn) 13  14 tcttcttggatccaccctggaagtacaggttttctgaaccatcaataattctccagtaagcagg Reverse 3 'xynA terminal 5 ′ stop codon deletion, linker, rTEV site, BamHⅠ T7 XA (xyn) 14  15 tcttcttggatccggcggctcatcagcaaatcttaatgggacgctg Forward direction 5 'amyS terminus 5 'BamHⅠ, linker in frame T7 XA (amy) 15  16 tctcttcaagcttctatctttgaacataaattgaaaccgac Reverse 3 'amyS terminus 3 ’HindⅢ T7 XA (amy) 16  17 gggtctgtttcatccac Reverse xynA internal T7 XA (xyn) T7 AX (xyn) 17

Example 6 Kinetic Analysis of T7 Constructs and Xylanases Containing Alpha-amylase and Xylanase as Same Translation Product

The activity of the crude phage-expressing enzyme in the crude form was compared with commercially available alpha-amylase (Sigma, Cat. No. A3404). Alpha-amylase activity was measured by the above-described dinitrosalicyclic acid (DNS) color reaction.

Xylanase activity was measured using lyophilized oat spelt xylan (Sigma oat spelts, X-0627). Lyophilized xylan (3 g in 150 mL) was added to boiling water, twice the volume of absolute ethanol was added and filtered using 12.5% Whatman's # 4 filter paper. Then, 100 mL of ethanol was passed through the filter, followed by 100 mL of 95% ethanol and 99.9% ethanol, and then 100 mL of 99.9% acetone. Xylan was placed in a dryer and dried for one day. Lyophilized xylan was added to TB to make 1% xylan stock solution, which was boiled for 15 minutes and then cooled. Determination of xylanase activity was carried out using xylan as a substrate, 4 mL of water added at the end of the reaction, and 1 mL of sample was run on a bench-top centrifuge (SIGMA 1-13, B. Braun) before measuring the OD ₅₄₀ value. Biotech International GmbH, Melsungen, Germany) was the same as the measurement of alpha-amylase (DNS reaction) except for the one minute rotation at the maximum speed. Determination of the activity of xylanase was made at 70 ° C., which is the optimal temperature for the cloned enzyme of Bacillus halodurans . Reducing sugar concentrations were measured using xylose as a standard. Km and kcat measurements of all constructs are shown in Table 7. There are no direct comparisons in terms of the kinetics of any commercially available xylanase, phage-based and phage-free xylanase.

Enzyme Dynamics Measurements of T7Select Constructs and Commercial Enzymes Construct Km (%) kcat (min ^-1 ) kcat / Km (% ^-1 min ^-1 ) Starch Xylan Starch Xylan Starch Xylan T7-amy 0.05 0.21 581 1805 11614 8807 T7-xyn No act * 0.03 No act * 3188 No act * 127507 T7-AX 0.08 0.06 6321 4835 79012 87917 T7-XA 0.02 0.09 2052 1796 136818 19954 Sigma amy 0.03 0.14 315 233 11819 1685

No act *-T7-xyn phage showed no activity when starch was used as a substrate.

           It does not appear.

The apparent Km values for the T7-amy, T7-AX and T7-XA phage constructs using starch as substrates are similar to those under the same conditions using commercially available free alpha-amylase (Sigma) and all starches used. Was 0.02 to 0.08%. T7-xyn did not show any activity on starch. When using xylan as the substrate, all constructs expressing xylanase (T7-xyn, T7-AX and T7-XA) also showed similar Km values of 0.03 to 0.09%. Both alpha-amylase and commercial enzymes produced by T7-amyphage showed activity against xylan, but showed slightly higher Km values. This is presumed to be due to the low purity of the oat spell xylan used in the present invention. Very similar Km values were obtained for enzymes for corresponding substrates, but the highest Km values for starch (except for T7-Amy phage and commercially available enzymes) were found for T7-AX phage, and the most for xylan. High Km values were seen in T7-XA. The desired enzyme of both the T7-AX and T7-XA phage constructs (ie, alpha-amylase of starch or xylanase of xylan) is present between the phage outer protein and the second enzyme. This means that the affinity of the enzyme for the substrate is the same translation product, which is slightly affected by the production of the enzyme. The turnover rate, or apparent catalyst constant (kcat), is variable depending on the construct. However, constraining enzymes (i.e., connecting to outer proteins or other enzymes and / or fusing between two proteins) can affect kcat and possibly increase conversion. The fact is obvious. Higher kcat means faster response with higher conversion rate. This means that it can also affect specificity constants (kcat / Km). Ultimately, high kcats are cost effective.

Example 7 : Cloning of alpha-amylase encoding nucleic acid and xylanase encoding nucleic acid as different translation products in the same T7Select vector

The following constructs were constructed using standard molecular biology cloning techniques.

A single transcription unit that encodes two different translation products ( unit )

Nucleic acid molecules encoding two different enzymes (nucleic acid molecules 1 and 2) were inserted into phage vector DNA, respectively, by the method described above (T7Select kit instructions, Novagen). Nucleic acid molecule 1 carrying a 3 ′ flanking vector sequence comprising an enhancer sequence for translation of stop codons and downstream genes was amplified by PCR. Nucleic acid molecule 2, including a start codon with nucleic acid molecule 2 and a nucleic acid sequence encoding CP10 protein, was also amplified by PCR. Appropriate restriction enzyme sites incorporated at the 5 'and 3' ends of the PCR product were used to ligation the nucleic acid molecules 1 and 2 comprising the PCR fragment into phage vector cancer.

As shown in FIG. 1B, the vector sequence after ligation is in-frame by nucleic acid molecule 1 comprising the appropriate promoter, transcriptional initiation sequence and CP10 protein coding sequence originating from the vector cancer and comprising a translation stop codon . This leads to a short intervening sequence containing sequences involved in enhancing the translation, and also to the coding sequence of the CP10 gene with the coding sequence of the start codon and the nucleic acid molecule 2.

2 warriors (serial, tandem Unit and two translation products

As shown in FIG. 1C, the short intervening region between nucleic acid molecules 1 and 2 is a long (~ 100bp) double-stranded oligonucleotide, or a short PCR product that encodes a ribosome binding site for promoter, transcription start and nucleic acid molecule 2. Except for the substitution, a process as described above could be used. This strategy is similar to that found in the LIC Duet Minimal Adapter Strategy (Novagen). The termination sequence for nucleic acid molecule 1 may also be included in the intervening region.

2 transcriptions (branches, divergent Unit and two translation products

Two separate promoters were used to express the desired fusion nucleic acid molecule. The branching (head-to-head) nature of the promoter degrades expression due to translation from one translation unit to the next. This is shown in Figure 1D. Philips et al. Used this approach to develop a new baculovirus expression system (2004, BioTechniques 36: 80-83).

One or two enzyme-encoding nucleic acid molecule plasmids Construction

Nucleic acid molecules 1 and / or 2 fused to a nucleic acid molecule encoding the outer protein of the virus may be expressed from nucleic acid sequences present in the plasmid vector. After expression in the virus, the expressed product will be incorporated with other proteins expressed from the viral genome to form viral particles. This is shown in Figure 1E. Examples include complementary plasmids expressing the wild-type CP10A gene present in part of the helper phage / phagemid system or T7Select system (Novagen) described in detail in Willats, 2002, Plant Molecular Biology, 50: 837. have.

One or two enzyme-encoding nucleic acid molecules expressed in the genome

In this methodology, the relationship between phage phenotype and genotype is not important because there is no screening step. An important result in phage production is the expression of the desired enzyme. Thus, as long as the nucleic acid molecule encoding the fusion protein is incorporated into the phage particle, the construct encoding the fusion protein will be expressed in the genome (see FIG. 1F). Fusion constructs can be integrated by methods known in the art.

Two different outer proteins used for fusion products

Some phage systems (eg M13) express different proteins on the surface. This provides the opportunity for the expression of different genes of interest in several different envelope proteins (see FIG. 1G). For example, an Ff bacteriophage (eg, M13) may be used to determine the desired protein / peptide fused with a pVIII or pIII shell protein described in [Willats, 2002], depending on the size and number of fusion proteins required. Expression.

Mixed with separate phage particles From crushed  Expression of individual nucleic acid molecules

A simple approach to obtaining multiple enzymes is to produce each enzyme as a separate fusion construct. By mixing the mills produced from different fusion constructs, one can generate a pool of mills that exhibit a large number of enzymatic activities in an appropriate proportion (see FIG. 1H). Castillo et al. Use this method to express a library of target peptides and a library of target binders (sdFv) in two separate phage vectors, and a candidate binder. Was successfully isolated (2001, J. Immuno. Meth., 257: 117-122).

Nucleic acid molecule 1 expressed as a fusion product with an outer protein Non-covalent bonds  2nd gene product linked via

If the association between the subunits of the product in the form of a multimer is relatively strong, only one subunit needs to be attached to the phage particle through fusion with one outer protein. Assembly of other subunits occurs within the cell, resulting in the presence of multiplexed products on the phage surface (see FIG. 1I). This is the methodology commonly used when using various subunits of antibodies, as detailed in, eg, Hoogenboom et al ., 1998, Immunotechonology, 4: 1-20.

Example 8 De-Ink of Mixed Office Waste Using Phage-Expressing Enzymes

Mixed office waste (MOW) is a large resource for recycling waste, but because it is known as the most difficult raw material to de-ink, alternatives to conventional alkaline de-ink processes are needed. Various studies have shown that de-inking with enzymes is a viable alternative, involving lipases, esterases that break down inks made from oils, pectinase, hemicellase / xylanase, cellulase, amylase and ink particles. It has been shown that various enzymes, including other lignolytic enzymes that liberate ink particles by altering the bond or fiber surface, facilitate deinking. Xylanase and alpha-amylase are both shown to enhance deinking. A T7 construct comprising a nucleic acid molecule encoding alpha-amylase and xylanase and attached to a nucleic acid molecule encoding phage shell protein 10 is used in a deinking assay, which is a practical method for performing enzyme deinking of MOW. Could know.

Preparation of Pulp

MOW with about 22% ink coverage was crushed (600 g) and pulped with Technical Association of Paper and Pulp Industries (TAPPI) protocol T525 om-92. The pulp was partially dried to 75% (water): 25% (fiber) and stored at 4 ° C.

Preparation of the enzyme

Phage grinding was prepared as directed by the T7Select (Novagen) producer including PEG precipitation. Almost equal units of activity (eg 20 units) of free or phage enzyme activity were resuspended in 170 mL TB.

Enzyme reaction

170 ml of enzyme preparation (described above) was heated to 70 ° C. on a hotplate and 10 g of oven dried (OD) fiber (40 g of pulp) was added. The mixture was carefully stirred at reaction temperature for 30 minutes. The temperature was raised to 100 ° C. and the mixture was boiled for 10 minutes. After boiling, the mixture did not show any phage.

Of the handsheet  floating( flotation ) And manufacturing

After boiling for 10 minutes, the mixture was diluted with 2 L of water at room temperature and transferred to a flotation device (Pala et al ., 2004, J. Biotech., 108: 79-89). 3 mL of suspension aid (diluted to 1/50, Buckman BDR2331) was added. Suspension occurred at air flow of 0.5 L min < -1 > for 20 minutes. At the end of the suspension the remaining foam was removed, the pulp was concentrated through low speed centrifugal filtration and oven dried. 3 g of OD fibers were wetted with 300 ml of water and digested for 1 minute (Black and Decker FP15X, setting II). A handsheet was made (TAPPI protocol T272om-92) and brightness was measured using the TAPPI protocol T272om-92 (ColorTouch apparatus (Model ISO) light source D65).

De Ink  Output of the process

6 shows an increase in the brightness of the handsheets due to the deinking of amylases and xylanases. In the absence of nucleic acid sequences encoding these enzymes, T7 phage pulverized (T7-NE) without amylase and xylanase activity was used as a negative control. Phage containing nucleic acid molecules encoding one enzyme (T7-amy or T7-xyn phage) showed improved brightness compared to the negative control (both 3.8%). The combination of both enzymes in the same phage particle (T7-AX) showed a higher improvement with a 4.1% increase in brightness. This tendency can be observed through several independent experiments. Through optimization of the mill production, the degree of improvement seen in commercial amylases can be shown in the T7-NE mill (5.6% improvement).

Example 9 Production of Enzymes Using Mammalian Host Cells

Plasmids with a potent promoter synthesized were constructed using techniques known in the art, for example described in Charkrabarti et al ., 1997, Biotechniques, 23 (6): 1094-1097. Nucleic acid molecules encoding the enzymes of interest are produced that are present between flanking nucleic acids encoding a basinian sequence, a promoter or a selection marker (eg, TK kinase or antibiotic selection marker). Suitable promoters and screening markers are known in the art and are exemplified in the prior art by Chakrarabarti et al.

Recombinant Bessian viruses such as IHDJ strains are described, for example, in Earl PL and Moss B., 1991, Generation of Vaccinia viruses, pp. 16.17.1-16.17.16 in FM Ausbal et al ., (Ed) Current Protocols in Molecular Biology, vol 2., Greene Publishing Associates and Wiley International Sciences, New York, NY It was constructed. The virus consists of a nucleic acid produced by insertion into a viral genome fused with a nucleic acid encoding the cytoplasmic and transmembrane domains of the B5R protein of the extracellular envelope of the virus.

Host cells, such as CV-1 cells, were infected with the recombinant virus and the recombinant virus was described, for example, in methods known in the art described by Earl PL and Moss B (1991) above. By viable breeding, the resulting nucleic acid is translated and fused to a nucleic acid encoding a part of the B5R protein.

It will be apparent to those skilled in the art that the above embodiments have been described for the purpose of clarity and understanding of the present invention, and various changes may be made in the above-described embodiments and methods, which are described herein. It is obvious that the scope of the inventive concept does not depart.

<110> COMMONWEALTH SCIENTIFIC AND INDUSTRIAL RESEARCH ORGANISATION <120> Bacteriophages displaying functional enzymes and uses approximately <160> 17 <170> KopatentIn 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 1 ttacgcaaat cttaatggga cg 22 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 2 gctactatct ttgaacataa attgaaac 28 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 3 caacggatgc ttggaaacg 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 4 ggtttccgtc ttgatgctgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 5 ggagctgtcg tattccagtc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 6 aacccctcaa gacccgttta 20 <210> 7 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 7 tcttcttgaa ttccgaaaac ctgtacttcc agggtgctca aggaggacca ccaaaatc 58 <210> 8 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 8 tctcttcaag cttctaatca ataattctcc agtaagcagg tttc 44 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 9 tcttcttgaa ttccgcaaat cttaatggga cgc 33 <210> 10 <211> 65 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 10 tcttcttgga ttccaccctg gaagtacagg ttttctgaac ctctttgaac ataaattgaa 60 accga 65 <210> 11 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 11 tcttcttgga tccggcggct catcagctca aggaggacca ccaaaatc 48 <210> 12 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 12 tctcttcaag cttctaatca ataattctcc agtaagcagg tttc 44 <210> 13 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 13 tcttcttgaa ttccgctcaa ggaggaccac caaaatc 37 <210> 14 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 14 tcttcttgga tccaccctgg aagtacaggt tttctgaacc atcaataatt ctccagtaag 60 cagg 64 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 15 tcttcttgga tccggcggct catcagcaaa tcttaatggg acgctg 46 <210> 16 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 16 tctcttcaag cttctatctt tgaacataaa ttgaaaccga c 41 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 17 gggtctgttt catccac 17  

Claims (50)

(a) providing a recombinant virus or fragment of a recombinant virus comprising a non-native enzyme or functional fragment, variant or derivative thereof; And,       (b) contacting the reactant with the recombinant virus or fragment thereof for a time and under conditions suitable to catalyze the enzymatic reaction of the reactant to produce a product, A method of producing an enzymatic reaction product with a reactant. The method of claim 1, Further comprising recovering the product of the enzymatic reaction. A method of producing an enzymatic reaction product with a reactant. The method of claim 1, Non-natural enzymes are encoded by a nucleic acid molecule inserted into the virus A method of producing an enzymatic reaction product with a reactant. The method of claim 3, wherein The nucleic acid is recombinantly inserted into the viral genome A method of producing an enzymatic reaction product with a reactant. The method of claim 1, Non-natural enzymes are characterized by being incorporated into the virus as a protein. A method of producing an enzymatic reaction product with a reactant. The method of claim 1, Recombinant virus or fragment of a recombinant virus is characterized by producing a number of non-natural enzymes or fragments, variants or derivatives thereof A method of producing an enzymatic reaction product with a reactant. The method of claim 6, Wherein at least one of the non-natural enzymes or fragments, variants, or derivatives thereof is different A method of producing an enzymatic reaction product with a reactant. The method of claim 6, Non-natural enzymes are provided as the same translation product A method of producing an enzymatic reaction product with a reactant. The method of claim 6, The non-natural enzyme is provided as a separate translation product A method of producing an enzymatic reaction product with a reactant. The method according to any one of claims 1 to 9, Non-natural enzymes are characterized in that they act in the metabolic pathway A method of producing an enzymatic reaction product with a reactant. The method according to any one of claims 1 to 10, Non-natural enzymes are provided as part of the same translation product as the coat protein of the virus A method of producing an enzymatic reaction product with a reactant. The method according to any one of claims 1 to 11, The virus is characterized in that the phage (phage) A method of producing an enzymatic reaction product with a reactant. The method according to claim 1 or 2, The non-natural enzyme is characterized in that alpha-amylase or xylanase (xylanase) A method of producing an enzymatic reaction product with a reactant. The method of claim 6, One of the non-natural enzymes is characterized in that amylase or xylanase A method of producing an enzymatic reaction product with a reactant. The method according to any one of claims 1 to 14, The product of the enzymatic reaction is characterized in that the liquid starch (liquified starch) A method of producing an enzymatic reaction product with a reactant. The method of claim 10, Metabolic pathways are characterized by producing maltose or glucose A method of producing an enzymatic reaction product with a reactant. The method of claim 10, A number of enzymes are characterized in that they act on de-inked mixed office waste. A method of producing an enzymatic reaction product with a reactant. The method of claim 1, The product is liquefied starch, the reactant is starch and the enzyme is alpha-amylase A method of producing an enzymatic reaction product with a reactant. The method of claim 6, The product is a deink mixed office waste, the reactants are mixed office paper, and the enzyme is alpha-amylase or xylanase. A method of producing an enzymatic reaction product with a reactant. The method according to any one of claims 1 to 19, The enzymatic reaction is carried out in a reaction vessel, and the recombinant virus is provided in the same reactor. A method of producing an enzymatic reaction product with a reactant. A method of constructing a recombinant virus that produces a plurality of non-natural enzymes or functional fragments, variants or derivatives thereof, the method comprising manipulating the virus to include non-natural enzymes. The method of claim 21, Non-natural enzymes or functional fragments, variants or derivatives thereof are characterized by different characteristics How to construct a recombinant virus. The method of claim 21 or 22, The virus is engineered by inserting genomic nucleic acid molecules encoding recombinant enzymes or functional fragments, variants or derivatives thereof into the virus. How to construct a recombinant virus. The method of claim 23, wherein Nucleic acid molecules are inserted so that the enzyme is produced in the same translation product. How to construct a recombinant virus. The method of claim 23, wherein The nucleic acid molecules are inserted such that each enzyme is produced as a separate translation product. How to construct a recombinant virus. The method of claim 24, A plurality of enzymes are inserted into the virus inside the cassette containing each enzyme How to construct a recombinant virus. The method of claim 25, A number of enzymes are characterized by incorporation into the virus as discrete nucleic acid molecules. How to construct a recombinant virus. The method according to any one of claims 23 to 25, Nucleic acid molecules are recombinantly inserted into the viral genome How to construct a recombinant virus. The method of claim 21 or 22, Viruses have been engineered by incorporating non-natural enzymes into viral particles as separate proteins. How to construct a recombinant virus. The method of claim 21 or 22, Viruses have been engineered by incorporating non-natural enzymes into viral particles as fusion proteins. How to construct a recombinant virus. The method according to any one of claims 21 to 30, One or each non-natural enzyme or functional fragment, variant or derivative thereof is characterized in that it acts in the metabolic pathway How to construct a recombinant virus. The method of any one of claims 21 to 31, Wherein one or each non-natural enzyme or functional fragment, variant or derivative thereof is produced as part of the same translation product as the outer protein of the virus How to construct a recombinant virus. Use of the method of any one of claims 21 to 32 for mass production of enzymes. The method of claim 33, Characterized in that the bulk is the reaction volume of more than 1 liter For mass production of enzymes. The method of claim 34, Characterized in that the bulk is a reaction volume of more than 5 liters For mass production of enzymes. A recombinant virus or fragment of a recombinant virus comprising a plurality of non-natural enzymes or functional fragments, variants or derivatives thereof in the same translation product. A recombinant virus or fragment of a recombinant virus comprising a plurality of non-natural enzymes or functional fragments, variants or derivatives thereof as separate translation products. 38. The method of claim 36 or 37, Many non-natural enzymes or functional fragments, variants or derivatives thereof are characterized by different characteristics Recombinant virus or fragment of a recombinant virus. 39. The method of any of claims 36-38, One or each non-natural enzyme or functional fragment, variant or derivative thereof is characterized in that it acts in the metabolic pathway Recombinant virus or fragment of a recombinant virus. The method according to any one of claims 36 to 39, wherein Wherein one or each non-natural enzyme or functional fragment, variant or derivative thereof is produced as part of the same translation product as the outer protein of the virus Recombinant virus or fragment of a recombinant virus. The method according to any one of claims 36 to 39, wherein Produced by the method of any one of claims 21 to 32 Recombinant virus or fragment of a recombinant virus. 42. A host cell comprising the virus or fragment of any one of claims 36-41. The method of claim 42, wherein Characterized in that they are bacterial cells Host cell. The method of claim 42 or 43, E. coli ( Esherichia coli ) cells, characterized in that Host cell. 42. A method of producing a plurality of enzymes or functional fragments, variants or derivatives thereof, comprising the step of producing the recombinant virus of any one of claims 36-41. 42. An enzyme or functional fragment, variant or derivative thereof according to any one of claims 36 to 41 produced by a recombinant virus. The method of any one of claims 21-32 or 45, the recombinant virus of any one of claims 36-41, or a fragment thereof, or the enzyme or functional of claim 46, wherein the enzyme is an alpha-amylase or xylanase. Fragments, variants or derivatives thereof. The method of any one of claims 21-32 or 45, the recombinant virus of any one of claims 36-41, or a fragment thereof, or the enzyme or functional fragment, variant or of claim 46, wherein the enzyme is a liquefied starch. Its derivatives. The method of any of claims 21-32 or 45, the recombinant virus of any of claims 36-41, or a part thereof, which is part of a metabolic pathway producing maltose or glucose. Fragment, or enzyme or functional fragment, variant or derivative thereof of claim 46. The method of any one of claims 21 to 32 or 45, the recombinant virus of any one of claims 36 to 41, or fragments thereof, which enzymatically catalyzes an enzymatic reaction to aid in deinking mixed office waste. Or the enzyme or functional fragment, variant or derivative thereof of claim 46.

Images