KR20070053798A - Caev-based vector systems - Google Patents

Abstract

The present invention relates to goat arthritis encephalitis virus-based vectors and vector systems useful for delivering nucleic acids to non-dividing and dividing cells. Also disclosed are methods for delivering nucleic acids to non-dividing and dividing cells using the vector system.

Description

CAE-based vector system {CAEV-BASED VECTOR SYSTEMS}

The present invention relates to lentiviral vectors useful for polynucleotide delivery, and more specifically to caprine arthritis encephalitis virus, which is useful for delivering polynucleotides to non-dividing and dividing cells.

Lentiviruses are a subgroup of retroviruses that can infect non-dividing cells as well as dividing cells. Vectors derived from lentiviral are an ideal tool for delivering foreign genes to target cells because they can reliably integrate genes into the genomes of dividing and non-dividing cells to mediate long-term gene expression (Gilbert and Wong-Staal, 2001; Mitrophanous et al., 1999; Naldini et al., 1996; Sauter and Gasmi, 2001).

Lentiviruses are not only non-primates (e.g. feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), equine infection virus (EIAV), goat arthritis encephalitis virus (CAEV) and visna virus), but also primates (e.g. : Has been isolated from several vertebrate species, including human and monkey immunodeficiency viruses (HIV-1, HIV-2, SIV). Of these, HIV and SIV are currently best known. However, due to the possibility that the vector can be recombined into infectious and pathogenic forms, the use of such a system in humans poses serious safety problems. Therefore, it is desirable to use non-primate lentiviral in gene therapy.

Among the non-primate lentiviral vectors, vectors derived from FIV (Curran and Nolan, 2002) and EIAV [US 2001/0044149] have been best studied and little progress has been made on other non-primate vectors.

As with all lentiviruses, CAEV is capable of infection and replication in dividing cells as well as finally differentiated and non-dividing cells. Several biological features of CAEV show that the virus is an interesting candidate for development as a gene transfer / therapeutic vector. First, the common host of CAEV is goats, and no human infection by CAEV has been reported. Second, the CAEV genome is the most systematically separated from HIV-1 among lentiviruses. Third, the genome construction of CAEV is relatively simple compared to other lentiviruses. The CAEV genome contains three structural genes ( gag, pol, env ) and three regulatory / accessory genes ( vif, tat and rev ).

However, despite these advantages, efforts to develop a CAEV-based delivery system have not been successful, resulting in an insecure and inefficient recombinant viral vector production system that renders the use of a CAEV-based gene delivery system impractical. Got it.

In 1998, L. Mselli-Lakhal et al. Reported a first generation CAEV-based vector system, but the viral titer (ie 10-187 TU / ml) of the system was effective. It was below the level. The authors explained that this inefficiency was due to the lack of genomic RNA accumulation into the cytoplasm and the low packaging efficiency of the vector RNA. Another problem with this study is the use of infectious wild type virus ("helper virus") as a packaging system, which is of little practical value for human application.

Therefore, there is a need for a safe and effective CAEV-based lentiviral vector system that can mediate gene transfer to a wide range of dividing and non-dividing cells.

Summary of the Invention

The present invention broadly relates to the production of CAEV-based lentiviral vector particles useful for delivering foreign polynucleotides to target cells. Such vector particles can be used for anti-viral, anti-tumor and / or gene therapy.

The present invention provides a transition vector for use in the CAEV-based vector production system described above, wherein the transition vector is

(a) (i) an untranslated region between the CAEV 5 ′ LTR and the CAEV gag -coding sequence, and

(Ii) 1 to X nucleotides of the CAEV gag -coding sequence linked to the 3 'end of the untranslated region, where X is less than 613

Consisting essentially of a CAEV packaging sequence; And

(b) System which is associated operably with said packaging sequence, required for polyadenylation reaction, RNA can transport, reverse transcription, and integration (integration) - acting element (cis -acting elements)

It includes.

In one embodiment of the invention, X is 60, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575 and 600.

In another embodiment of the invention, X is

(a) X is greater than 25 but less than 600,

(b) X is greater than 25 but less than 500,

(c) X is greater than 25 but less than 400,

(d) X is greater than 25 but less than 300,

(e) X is greater than 25 but less than 200,

(f) X is greater than 50 but less than 600,

(g) X is greater than 50 and less than 500,

(h) X is greater than 50 and less than 400,

(i) X is greater than 50 and less than 300,

(j) X is greater than 50 and less than 200,

(k) X is greater than 75 and less than 600,

(l) X is greater than 75 and less than 500,

(m) X is greater than 75 and less than 400,

(n) X is greater than 75 and less than 300,

(o) X is greater than 75 and less than 200,

(p) X is greater than 100 but less than 600,

(q) X is greater than 100 and less than 500,

(r) X is greater than 100 but less than 400,

(s) X is greater than 100 and less than 300,

(t) X is greater than 100 and less than 200,

(u) X is greater than 125 and less than 600,

(v) X is greater than 125 and less than 500,

(w) X is greater than 125 and less than 400,

(x) X is greater than 125 and less than 300,

(y) X is greater than 125 and less than 200,

(z) X is greater than 150 and less than 600,

(aa) X is greater than 150 and less than 500,

(bb) X is greater than 150 and less than 400,

(cc) X is greater than 150 and less than 300,

(dd) X is greater than 150 and less than 200,

(ee) X is greater than 200 and less than 600,

(ff) X is greater than 200 and less than 500,

(gg) X is greater than 200 and less than 400,

(hh) X is greater than 200 and less than 300,

(ii) X is greater than 200 and less than 200,

(jj) X is greater than 250 and less than 600,

(kk) X is greater than 250 and less than 500,

(ll) X is greater than 250 and less than 400, and

(mm) X is greater than 250 and less than 300

It is selected from the group consisting of.

In other embodiments, X is greater than 40 but less than 613.

In other embodiments, X is greater than 57 and less than 613.

In another embodiment, X is about 327.

In one embodiment of the present invention, gag - start codon of the coding sequence is mutated to prevent translation of gag protein. In another embodiment, the start codon is mutated to TAG.

In another embodiment of the transition vectors of the invention, the ATG codon of the gag -coding sequence is located downstream of the start codon ATG, wherein the start codon is mutated to prevent translation of the gag protein, wherein X is Less than 30. In another embodiment X is about 21.

The transition vector of the present invention may further comprise an RRE region.

In another embodiment of the invention, the transition vector comprises a CAEV 3 'LTR with the U3 region deleted.

The transition vector of the present invention may further comprise a heterologous promoter. In one embodiment of the invention, the heterologous promoter is a human cytomegalovirus major immediate early promoter (HCMV MIEP). In another embodiment, the transition vector is pCAH / SINd1 (SEQ ID NO: 68).

The transfer vector of the present invention is a transcription cassette comprising a heterologous polynucleotide of interest operably linked to a heterologous promoter (e.g., human cytomegalovirus primary early promoter HCMV MIEP, or murine cytomegalovirus primary early promoter MCMV MIEP). It may further include. Such transfer vectors enable the polynucleotide of interest to bind into the virus particle, thereby providing a means for increasing the number of infected host cells comprising the polynucleotide therein.

The invention also provides a CAEV-based lentiviral vector system that produces CAEV-based, replication-defective vector particles useful for delivering foreign polynucleotides to mammalian cells. The vector particles can infect and transduce mammalian cells. The vector system includes a transition vector as described above; And a packaging vector system comprising a first polynucleotide comprising a GAEV gag-pol -coding sequence and an RRE, and a second polynucleotide comprising a viral envelope coding sequence.

In one embodiment, said second polynucleotide comprises a non-CAEV env -coding sequence. In one embodiment, said second polynucleotide comprises a VSV-G- or GaLV-coding sequence.

In other embodiments, the CAEV vector system comprises a third poly nucleotide sequence comprising a rev -coding sequence.

In other embodiments, the CAEV vector system comprises a fourth polynucleotide sequence comprising a vif -coding sequence.

In another embodiment, the first polynucleotide of each CAEV vector system described above further comprises a heterologous regulatory sequence operably linked to a CAEV gag-pol -coding sequence.

In another embodiment, the second polynucleotide of the CAEV vector system described above further comprises a heterologous regulatory sequence operably linked to said viral envelope-coding sequence.

In another embodiment, the third polynucleotide further comprises a heterologous regulatory sequence operably linked to a rev -coding sequence.

In another embodiment, the fourth polynucleotide further comprises a heterologous regulatory sequence operably linked to the vif -coding sequence.

In one embodiment of the invention, the CAEV vector system comprises a packaging vector system without a competent CAEV packaging sequence. In another embodiment, the packaging vector system lacks the 5 'terminal region between the splicing donor site of the CAEV genome and the gag start codon.

In one embodiment, the CAEV vector system comprises a first vector comprising a first polynucleotide and a second vector comprising a second polynucleotide. In other embodiments, the vector system comprises a first vector comprising a first polynucleotide, a second vector comprising a second polynucleotide, and a third vector comprising a third polynucleotide. In other embodiments, the vector system comprises a first vector comprising a first polynucleotide, a second vector comprising a second polynucleotide, a third vector comprising a third polynucleotide, and an agent comprising a fourth polynucleotide Contains 4 vectors. The third vector may be pHYK / rev (SEQ ID NO: 75), and the fourth vector may be pHYK / vif (SEQ ID NO: 76).

In another embodiment, the vector system comprises a first vector comprising a first polynucleotide, a third polynucleotide and a fourth polynucleotide, and a second vector comprising a second polynucleotide.

In one embodiment, the first vector of the CAEV vector system comprises a CAEV gag -coding sequence and an RRE operably linked to a heterologous promoter. The promoter may be MCMV MIEP. In another embodiment, the CAEV vector system comprises a first vector pMGP / RRE (SEQ ID NO: 77).

In one embodiment, the second vector of the CAEV vector system is a VSV-G-coding sequence operably linked to a heterologous promoter. The promoter may be HCMV MIEP. The second vector may further include a beta globin intron. In another embodiment, the CAEV vector system comprises a second vector pHGVSV-G (SEQ ID NO: 74).

In one embodiment, the second vector of the CAEV vector system is a GaLV env- coding sequence operably linked to a heterologous promoter. The promoter may be MCMV MIEP. The second vector may further include eukaryotic elongation factor-1 alpha intron. In another embodiment, the CAEV vector system comprises a second vector pMYKEF-1 / env (SEQ ID NO: 72).

Another aspect of the invention is a method of producing CAEV-based lentiviral vector particles useful for infecting mammalian cells. The method comprises the steps of (a) transfecting cells with the above-described vector system under conditions suitable for CAEV-based particle production, wherein the vector particles are infection- and transduction-competent and replication-defective, and ( b) recovering said vector particles.

The present invention also provides a composition comprising CAEV-based lentiviral vector particles and optionally a carrier, wherein said vector particles are produced by the method described above.

The present invention also provides a kit comprising the above-described transfer vector or CAEV-based lentiviral vector system.

The invention also provides a packaging cell comprising a CAEV gag-pol- coding sequence and RRE, and optionally a viral env- coding sequence. The packaging cell may further comprise a rev- coding and / or vif -coding sequence. The cells are useful for packaging the RNA form of the transfer vector into vector particles that are infection- and transduction-competent and replication-defective.

In one embodiment, the vector system comprises a cell comprising the first polynucleotide described above. The vector system may further comprise the third and / or fourth polynucleotide described above.

In other embodiments, the vector system comprises a cell comprising the first polynucleotide and the second polynucleotide described above. The vector system may further comprise the third and / or fourth polynucleotide described above.

In other embodiments, the vector system comprises a cell comprising a first vector comprising a CAEV gag-pol- coding sequence and an RRE. The first vector may further comprise a rev -coding and / or vif -coding sequence. On the other hand, the cell may comprise a first vector comprising a CAEV gag-pol- coding sequence and a RRE, a second vector comprising a rev -coding sequence, and / or a third vector comprising a vif -coding sequence. .

In some embodiments, the vector system comprises a cell comprising a first vector comprising a CAEV gag-pol- coding sequence and a RRE, and a second vector comprising a viral env -coding sequence. The first vector may further comprise a rev -coding and / or vif -coding sequence. On the other hand, the cell comprises a first vector comprising a CAEV gag-pol- coding sequence and a RRE, a second vector comprising a viral env -coding sequence, and a third vector comprising an optional rev -coding sequence and / Or a fourth vector comprising the vif -coding sequence.

Another aspect of the invention is a method of delivering a polynucleotide or polypeptide to a mammalian cell or replicating a polynucleotide encoding the polypeptide, wherein the method is selective and conditions capable of integrating the polynucleotide into the mammalian cell genome. And contacting said mammalian cell with the above-mentioned vector particle under conditions such that said polypeptide encoded by said polynucleotide can proliferate. The mammalian cell may be a dividing cell, a non-dividing cell or a CD34 + stem cell. The method of delivering a polynucleotide or polypeptide to a mammalian cell or replicating a polynucleotide molecule encoding the polypeptide may further comprise separating the cell from the mammal before contacting the cell with the vector particles. have. The method may further comprise propagating the cells in culture after contacting the cells with the vector particles. The method may further comprise reintroducing the cells into the mammal before or after propagating the contacted cells.

The invention also relates to a CAEV-based comprising heterologous polynucleotides of interest, such that the polypeptides encoded by the delivered polynucleotides are expressed in vertebrates in an amount sufficient to detect or elicit a biological response in vertebrates. A method of delivering a polypeptide to a vertebrate, comprising administering the lentiviral vector particles to the vertebrate, wherein the vector particles are produced by the method described above.

The invention also relates to (a) an untranslated region between the CAEV 5 'LTR and the CAEV gag -coding sequence, and (b) the 1st to Xth nucleotides of the CAEV gag -coding sequence linked to the 3' end of the untranslated region ( Wherein X is less than 613), thereby providing a vector comprising a CAEV packaging sequence.

The inventors have found that, as presented herein, the production of CAEV-based lentiviral vector particles exhibits improved efficiency and safety compared to existing CAEV-based vector particles in lentiviral vector design. This improved efficiency is achieved by finding the optimal length of the untranslated region and gag-coding region between the 5 'LTR and the gag start codon, which provides an efficient packaging sequence that enables efficient capsidization, which increases viral titer. Let's do it. Viral titers are also enhanced using a strong heterologous promoter in the design of the packaging plasmid. This improved safety is achieved through the construction of tat -independent transition vectors and plasmid-based packaging systems.

1 is a schematic of the CAEV provirus genome structure.

2A is a schematic of plasmid pMGP / RRE (SEQ ID NO: 77). pMGP / RRE (SEQ ID NO: 77) is the MCMV MIEP region (bp 1-660), RRE region (bp 5,426-5,627 or bp 5,368-5,669) located upstream of the CAEV gag-pol coding region (bp 709-5,243). , And a 9,446 bp plasmid containing bovine growth hormone (BGH) polyadenylation signal (bp 5,751-5,984). The vector also contains neomycin resistance gene coding region (bp 8,151-7,155), SV40 origin of replicaiton (bp 8,509-8,152), Col E1 origin of replication (bp 6,115-6,698), and ampicillin resistance gene region (bp 9,362-8,528).

2B is a schematic of plasmid pMGP / REV / RRE. pMGP / REV / RRE is the MCMV MIEP region (located at bp 1-660) upstream of the CAEV gag-pol coding region (bp 726-5,258) and the primary splicing provision location of CAEV (bp 688-704), first exon of the rev coding region (bp 5,383-5,494), RRE region (bp 5,540-5,841), second exon of the rev coding region (bp 5,888-6,177), and bovine growth hormone (BGH) polyade 9,924 bp plasmid containing a nilation signal (bp 6,229-6,462). The vector also contains neomycin resistance gene coding regions (bp 7,633-8,629), SV40 origin of replication (bp 8,987-8,630), Col E1 origin of replication (bp 6,593-7,176), and ampicillin resistance gene region (bp 9,840-9,006). Include.

3A is a schematic of plasmid pCAH / SINd (SEQ ID NO: 73). pCAH / SINd (SEQ ID NO: 73) shows HCMV MIEP (bp 1-588), R-U5 sequence region (bp 611-772), RRE region (bp 796-1,154), and U3-deletion at CAEV 5'LTR. 3,566 bp plasmid containing the CAEV 3'LTR region (bp 1,275-1,458). The vector also includes Col E1 origin of replication (bp 1,863-2,466), and kanamycin resistance gene coding region (bp 2,698-3,510).

3B is a schematic of plasmid pCAH / SINd0 (SEQ ID NO: 67). pCAH / SINd0 (SEQ ID NO: 67) is the remaining untranslated sequence including HCMV MIEP (bp 1-588), R-U5 sequence region (bp 611-772), primer binding site (PBS) at CAEV 5'LTR. (bp 773-789), a RRE region (bp 1,141-1,499), and a U3-deleted CAEV 3'LTR region (bp 1,620-1,803). The vector also includes Col E1 origin of replication (bp 2,208-2,791) and kanamycin resistance gene coding region (bp 3,043-3,855).

3C is a schematic of plasmid pCAH / SINd1 (SEQ ID NO: 68). pCAH / SINd1 (SEQ ID NO: 68) is the HCMV MIEP (bp 1-588) promoter; R-U5 sequence region in CAEV 5'LTR (bp 610-772); Residual untranslated region (bp 773-789) comprising the PBS position; ATG start codon (bp1121-1123) and a fragment of 327 bp of, gag gene has a point mutation (point mutation) to TAG from the ATG ATG co-Don (bp1142-1144) located downstream of the ATG start codon (bp 1,121 -1,448); RRE region (bp 1,468-1,826); And a U3-deleted CAEV 3′LTR region (bp 1,947-2,130). The vector also includes the Col E1 origin of replication (bp 2,535-3,118) and the kanamycin resistance gene region (bp 3,370-4,182).

3D is a schematic of plasmid pCAH / SINd2 (SEQ ID NO: 69). Plasmid pCAH / SINd2 (SEQ ID NO: 69) was HCMV MIEP (bp 1-588); R-U5 sequence region in CAEV 5'LTR (bp 610-772); Residual untranslated region (bp 773-789) comprising the PBS position; 612 bp fragment (bp 1,121-1,733) of the gag gene with point mutations in the starting ATG codon (bp1121-1123) and the ATG codon (bp1142-1144) located downstream of the starting ATG codon; RRE region (bp 1,753-2,111); And a 4,523 bp plasmid comprising the U3-deleted CAEV 3'LTR region (bp 2,232-2,415). The vector also includes Col E1 origin of replication (bp 2,820-3,403) and kanamycin resistance gene coding region (bp 3,655-4,467).

3E is a schematic of plasmid pCAH / SINd3 (SEQ ID NO: 70). pCAH / SINd3 (SEQ ID NO: 70) is HCMV MIEP (bp 1-588); R-U5 sequence region in CAEV 5'LTR (bp 610-772); Residual untranslated region (bp 773-789) comprising the PBS position; Start ATG codon (bp 1121-1123) and a fragment of 908 bp of, gag gene having a point mutation at the ATG codon (bp 1142-1144) located downstream of the start ATG codon (bp1,121-2,029); RRE region (bp 2,049-2,407); And a 4,819 bp plasmid comprising a U3-deleted CAEV 3'LTR region (bp 2,549-2,711). The vector also includes a Col E1 origin of replication (bp 3,116-3,699) and a kanamycin resistance gene coding region (bp 3,951-4,763).

Degree 3f is a schematic of plasmid pCAH / SINd4 (SEQ ID NO: 71). pCAH / SINd4 (SEQ ID NO: 71) is HCMV MIEP (bp 1-588); R-U5 sequence region in CAEV 5'LTR (bp 610-772); Residual untranslated region (bp 773-1,120) comprising the PBS position; A segment of 1198 bp of the gag gene (bp 1,121-2,319) with point mutations in the starting ATG codon (bp 1121-1123) and the ATG codon (bp 1142-1144) located downstream of the starting ATG codon; RRE region (bp 2,342-2,700); And a 5,112 bp plasmid comprising the U3-deleted CAEV 3'LTR region (bp 2,842-3,004). The vector also includes a Col E1 origin of replication (bp 3,409-3,992) and a kanamycin resistance gene coding region (bp 4,244-5,056).

3G is a schematic of the plasmid pCAH / SINd1 / hlacZ (SEQ ID NO: 79). pCAH / SINd1 / hlacZ (SEQ ID NO: 79) is an 8,127 bp plasmid derived from pCAH / SINd1 (SEQ ID NO: 68) that expresses a lacZ reporter gene (reporter gene). The vector comprises two HCMV MIEP promoter regions (located at bp 1-588 and bp 1,866-2,460, respectively); R-U5 sequence region in CAEV 5'LTR (bp 610-772); Residual untranslated region (bp 773-789) comprising the PBS position; Start ATG codon (bp 1121-1123) and a fragment of 325 bp of, gag gene having a point mutation at the ATG codon (bp 1142-1144) located downstream of the start ATG codon (bp 1,121-1,446); lacZ gene coding sequence (bp 2,541-5,711); And a U3-deleted CAEV 3'LTR region (bp 5,782-6,019). The vector also includes a Col E1 origin of replication (bp 6,424-7,007), and a kanamycin resistance gene coding region (bp 7,259-8,071).

3H is a schematic of the plasmid pCAH / SINd60 / hlacZ (SEQ ID NO: 78). Plasmid pCAH / SINd60 / hlacZ (SEQ ID NO: 78) shows two promoter regions HCMV MIEP (located at bp 1-588 and bp 1,595-2,189, respectively); R-U5 sequence region in CAEV 5'LTR (bp 610-772); Residual untranslated region (bp 773-789 bp) comprising the PBS position; Start ATG codon (bp 1121-1123) and a fragment of 60 bp of, gag gene having a point mutation at the ATG codon (bp 1142-1144) located downstream of the start ATG codon (bp 1,121-1,181); RRE region (bp 1,195-1,565); lacZ gene coding sequence (bp 2,270-5,440); And 7,856 bp comprising a U3-deleted CAEV 3 ′ LTR region (bp 5,511-5,748). The vector also includes the Col E1 origin of replication (bp 6,153-6,736), and the kanamycin resistance gene coding region (bp 6,988-7,800).

4 is a schematic of plasmid pHYK / vif (SEQ ID NO: 76). pHYK / vif (SEQ ID NO: 76) shows HCMV MIEP (bp 1-596), vif gene coding region (bp 691-1,380), BGH polyadenylation signal (bp 1,467-1,695), Col E1 origin of replication (bp 1,826- 2,409), a plasmid of 5,729 bp including neomycin resistance gene coding region (bp 3,862-2,866), and ampicillin resistance gene coding region (bp 5,270-4,239).

5 is a schematic of plasmid pHYK / rev (SEQ ID NO: 75). pHYK / rev (SEQ ID NO: 75) is HCMV MIEP (bp 1-596),revGene coding region (bp 672-1,073), BGH polyadenylation signal (bp 1,157-1,385), Col E1 origin of replication (bp 1,516-2,099), neomycin resistance gene coding region (bp 3,552-2,556), and ampicillin resistance gene 5,419 bp plasmid containing coding region (bp 4,960-3,929).

6A is a schematic of plasmid pHGVSV-G (SEQ ID NO: 74). pHGVSV-G (SEQ ID NO: 74) shows HCMV MIEP (bp 1-596), β-globin intron region (bp 714-1,599), VSV-G coding region (bp 1,632-3,312), BGH polyadenylation signal (bp 3,361-3,589), Col E1 origin of replication (bp 3,720-4,303), neomycin resistance gene coding region (bp 5,756-4,760), ampicillin resistance gene coding region (bp 7,164-6,133), and F1 origin of replication (bp 7,165-7,621 ) Is a 7,623 bp plasmid.

6B is a schematic of plasmid pMYKEF1 / env (SEQ ID NO: 72). pMYKEF1 / env (SEQ ID NO: 72) shows MCMV MIEP (bp 1-665), human EF1-α intron region (bp 668-1,618), GaLV env coding region (bp 1,699-3701), BGH polyadenylation signal (bp 3,885-4,118), Col E1 origin of replication (bp 4,349-4,832), neomycin resistance gene coding region (bp 6,290-5,284), and ampicillin resistance gene coding region (bp 7,496-6,666) plasmid of 7,579 bp.

7 is a photograph showing the relative amounts of transfer vector RNA transcribed from a gene transfer vector transfected with human 293T target cells.

8 is two photographs showing human 293T target cells transfected with CAEV (A) and MuLV (B) vectors.

FIG. 9 is a photograph showing the relative amounts of transfer vector RNA expressed in transfected 293T cells (lanes 1, 2 and 3) or capsidated and released (lanes 4, 5 and 6) in 293T packaging cells.

FIG. 10 is a photograph showing the phase mass of transferred vector RNA capsidized and released in human 293T packaging cells. FIG.

FIG. 11 is a photograph showing the relative amount of integrated retroviral cDNA after infection and reverse transcription of pseudolented lentiviral vectors with VSV-G or GaLV envelope proteins.

12 is a photograph showing the relative amount of viral vector cDNA integrated into an infected host cell chromosome.

FIG. 13 is two graphs showing the results of FACS analysis on (A) control cells and (B) G1-stabilized cells. FIG.

FIG. 14 is two graphs showing the relative transduction efficiency of HIV-1-, CAEV-, and MuLV-derived viral vectors for (A) the number of transduced cells and (B) dividing and non-dividing cells.

The present invention relates, in particular, to a CAEV-based lentiviral vector system and a method for delivering a polypeptide of interest to dividing and non-dividing cells using said vector.

CAEV dielectric

Wild-type CAEV virus has a dimeric RNA genome (single-stranded, positive polarity) that is replicated through a double-stranded DNA intermediate and packaged into a spherical envelope virion that contains a nucleoprotein core. ). The genome includes three genes encoding the structural and enzyme proteins Gag, Pol and Env, and a long terminal repeat (LTR) at each end of the integrated viral genome. The genome also encodes three regulatory proteins, vif , tat and rev .

The gag gene encodes an internal structural protein, the pol gene encodes a viral replication enzyme, and the env gene encodes an envelope glycoprotein that mediates the virus to attach to the cell surface. Vif protein is involved in viral infectivity and Tat protein is involved in transactivation of 5 'LTR. Rev protein and its target sequence RRE (Rev Response Element) are used to transport the stability of viral RNA, regulation of viral RNA splicing, and transport large RNA (non-spliced or single-spliced) from the nucleus to the cytoplasm. It is related. The proviral LTR sequence comprises U3 (unique sequence elements downstream of structural proteins), R (short repetitions at each genome end), and U5 (specific sequence elements immediately following the R sequence) regions . The U3 region of 5'LTR includes a viral promoter and an enhancer. The 3 'end of the genome contains a polyadenylation signal at 3'LTR.

The wild-type genome of CAEV also includes several cis -acting elements such as att (attachment site) at the LTR terminus for proviral integration; Promoter elements that regulate transcriptional initiation of integrated provirus at 5′LTR; PBS (primer binding position) located downstream of 5 ′ LTR; 5'-splicing provision position; Packaging sequence (herein interchangeably means packaging location or packaging signal); Ppt (polypurine track) position located near 3'LTR; And polyadenylation signals at 3'LTR.

As used herein, the term “ cis ” refers to genes present on the same chromosome or linear portion of a nucleic acid. Thus, the term “ cis -defect” means a defect found on the linear sequence of a nucleic acid. The term “ cis -action” means the control effect of a regulatory gene on a gene present on the same chromosome or linear portion of a nucleic acid. For example, promoters that affect the synthesis of downstream mRNAs are cis -acting regulatory elements.

Full-length genomic sequences for two isolates of CAEV are known, which are listed in the National Center for Biotechnology Information (NCBI) database NC_001463 (SEQ ID NO: 1) and AF322109 (SEQ ID NO: 2) (Saltarelli et al. al., 1990, and Gjerset, BJ et al., non-public). The nucleic acid of the claimed invention is not limited to a particular isolate of CAEV, but may be a sequence that retains the known function of its genomic sequence. For example, it is known in the art that natural variations in the gene sequence occur during viral replication, resulting in similar nucleic acid sequences encoding proteins with similar functions.

The sequence alignment of NC_001463 (SEQ ID NO: 1) and AF322109 (SEQ ID NO: 2) genomic sequences is shown in Table 1. As can be seen in Table 1, there is considerable nucleic acid homology between the sequences, but the difference at the nucleic acid level is evident. The variability of the CAEV gag regions described in Table 2 (SEQ ID NOS: 3-6) is particularly important. The sequence alignment of the NC_001463 5'LTR, pol , rev and vif genes, and the corresponding genes from AF322109, can be found in Table 3-6 (SEQ ID NOs: 7-14). In addition, many partial sequences of the CAEV genome are known and deposited. For example, accession numbers AY081139, AY101347, AY101348, AY047362, AF402668, AF402667, AF402666, AF402665, AF402664, AJ305042, AJ305041, and AJ305040 all provide gag gene sequences from Brazilian isolates of CAEV. Accession Nos. AF015181, L78453, L78451, L78450, L78447 and L78446 also include gag gene sequences from various CAEV isolates. Accession Nos. X64828 and M63106 include the rev gene sequence from various CAEV isolates. Accession Nos. AF015182, AJ305053, K03327, L78448, L78452 and U35814 include the pol gene from various CAEV isolates. Gag gene of NC_001463 (SEQ ID NOs: 15, 17), AF015181 (SEQ ID NOs: 16, 17), AF402664 (SEQ ID NOs: 20, 26), AF402665 (SEQ ID NOs: 21, 27), AF402666 (SEQ ID NOs: 22 , 28), sequence alignments between gag genes from AF402667 (SEQ ID NOs: 23, 29) and AF402668 (SEQ ID NOs: 24, 30) are identified in Table 8. Sequence between the gag gene from the gag gene of the NC_001463 (SEQ ID NO: 31, 35), AJ305040 (SEQ ID NO: 32, 36), AJ305041 (SEQ ID NO: 33, 37), and AJ305042 (34, 38 SEQ ID NO) The alignment is shown in Table 9. The sequence alignment between the gag gene (SEQ ID NO: 39, 41) of NC_001463 and the gag gene from AY047362 (SEQ ID NO: 40, 42) is shown in Table 10. The sequence alignment between the NC_001463 gag gene (SEQ ID NOs: 43, 45) and the gag gene from AY081139 (SEQ ID NOs: 44, 46) is shown in Table 11. The sequence alignment between the gag gene of NC_001463 (SEQ ID NO: 47, 50) and the gag genes from AY101347 (SEQ ID NO: 48, 51) and AY101348 (SEQ ID NO: 49, 52) is shown in Table 12. NC_001463 gag gene (SEQ ID NO: 53, 59), L78446 (SEQ ID NO: 54, 60), L78447 (SEQ ID NO: 55, 61), L78450 (SEQ ID NO: 56, 62), L78451 (SEQ ID NO: 57, 63) and the sequence alignment between the gag genes from L78453 (SEQ ID NOs: 58, 64) are shown in Table 13.

The alignments were performed using the following parameters using the vector NTI (VectorNTI, Informax, USA):

For pairwise alignment: gap start penalty: 15

                                     Blank Extension Penalty: 6.6

For multiple alignment: blank starting penalty: 15

                                     Blank Extension Penalty: 6.6

                                     Whitespace Separation Penalty Range: 8

Table 14 summarizes the percent homology to sequence alignment of the gag gene sequences presented above. Table 15 summarizes the percent homology of the overall genome alignments of NC_001463 (SEQ ID NO: 1) and AF322109 (SEQ ID NO: 2), and the alignments of the gag , 5 LTR, pol , rev and vif regions. Numerous partial sequences from various CAEV isolates as well as the genomic sequences of the two CAEV isolates are known and can easily identify matching sequences, thus over-exploiting experiments to implement the claimed invention using various CAEV sequences. This is not required.

CAEV Vector of the Invention

The vectors of the present invention provide a means for replicating and expressing polynucleotides or genes that are independent of the nucleus of a host cell in a broad phylogenetic range of host cells. Binding of such heterologous nucleic acid to a vector-mediated host cell refers to transfection or infection of the host cell, where infection refers to the use of viral particles and transfection refers to the use of the nucleic acid molecule as it is.

The term "gene" refers to a DNA sequence comprising control and coding sequences necessary for the production of a polypeptide or precursor. The terms "polynucleotide" or "nucleic acid molecule" as used interchangeably herein refer to nucleotide polymers of any length, such as two or more, and include both DNA and RNA. Nucleotides can be bound to the polymer by deoxyribonucleotides, ribonucleotides, nucleotide analogues (such as modified phosphates, bases or sugars), or suitable enzymes such as DNA polymerase or RNA polymerase. Can be. The polypeptide may be encoded by either the full length coding sequence or any portion of the coding sequence having a length such that the desired activity of the polypeptide is maintained.

The term "wild type" means a gene or gene product that is separated from a naturally occurring source and that is characterized by that gene or gene product. Wild-type genes are the most frequently observed among populations and are optionally designed as "general" or "wild" forms of the gene. On the other hand, the term “mutated” or “variant” refers to a gene or gene product that exhibits a change in sequence or functional feature (ie, a replaced feature) when compared to the wild type gene or gene product. Naturally-occurring variants can be isolated and identified by the fact that they have altered characteristics when compared to wild-type genes or gene products.

As used herein and in the claims, the singular forms "a", "an", "the", and the like include plural references unless the context clearly dictates otherwise. Thus, for example, the meaning of "polynucleotide" includes polynucleotides, and the meaning of "stem cell" also includes a plurality of cells.

As used herein, the term "retrovirus" refers to RNA viruses that utilize reverse transcriptase during their replication cycle. Retroviral genomic RNA is converted to double-stranded DNA by reverse transcriptase. This double-stranded DNA form of the virus can be integrated into the chromosome of infected cells; Once integrated, this is called a "provirus". Proviruses serve as templates for RNA polymerase II and govern the expression of RNA molecules encoding structural proteins and enzymes necessary to produce new viral particles.

As used herein, the term "lentiviral" refers to a group (or genus) of retroviruses that slowly progress the disease. Viruses included in this group include human immunodeficiency virus (HIV); Visna-Madi, Goat Arthritis Encephalitis Virus (CAEV), which causes encephalitis (bisna) or pneumonia (maddy) in sheep; Equine Infectious Anemia Virus (EIAV); Feline immunodeficiency virus (FIV); Bovine immunodeficiency virus (BIV); And monkey immunodeficiency virus (SIV). Diseases caused by these viruses are characterized by long incubation and prolonged pathways. In general, the viruses potentially infect monocytes and macrophages and spread from them to other cells.

As used herein, the term "vector" refers to a nucleic acid molecule that transfers fragments of a transition polynucleotide (eg, DNA) from one cell to another. The term "vehicle" is sometimes used interchangeably with "vector". Any form of carrier or vector is included within this definition. For example, the vector includes, but is not limited to, viral particles, plasmids, transposons, and the like.

Basic techniques for the construction of the vector of the present invention are already known to those skilled in the art, see Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor, N.Y., 1989). Various methods are available for joining DNA fragments, the selection of which is readily made by one skilled in the art depending on the terminal nature of the DNA fragment.

Suitable polyadenylation sequences of the invention include, but are not limited to, bovine growth hormone (BGH) polyadenylation signals (Pfarr et al., 1986), SV40 early region polyadenylation sites (Hall et al., 1983). ) And SV40 late region polyadenylation sites (Carswell and Alwine, 1989), β-globin polyA, and Herpes simplex virus thymidine kinase polyA, and the like.

Promoters of the invention may include promoters for mammalian or viral origin and will be sufficient to govern the transcription of a terminal located in a cell (ie, a sequence linked to the 5 'end of a promoter sequence). Promoter regions may also include regulatory elements for increasing or decreasing transcription. Suitable promoters for the present invention include, but are not limited to, human or murine cytomegalovirus early promoters (HCMV MIEP or MCMV MIEP), elongation factor 1 alpha (ef-1α), and Loose sarcoma virus long terminal repeat promoters ( pRSV) and the like. Intron sequences may also be associated with a promoter. Intron sequences include, but are not limited to, ef-1α introns and β-globin introns. Inducible expression systems can also be used. Examples of induction systems include, but are not limited to, ecdysone-induced mammalian expression systems (Invitrogen, CA, USA) and Tet-On and Tet-Off gene expression systems (Clontech, CA, USA). Cell or tissue specific promoters can be used for targeted expression of gene sequences in specific cell populations.

Enhancer sequences upstream of the promoter or terminator sequences, and downstream of the coding region, may optionally be included in the vector of the present invention to promote expression. Vectors of the invention may also include additional nucleic acid sequences, such as intron sequences, localization sequences, or signal sequences, such that cells efficiently and efficiently process proteins expressed by the nucleic acids of the vector. Examples of intron sequences include β-globin introns (Kim et al., 2002) and human EF-1α introns (Kim et al., 2002) and the like. Such additional sequences are inserted into the vector to be operably linked to the promoter sequence for transcriptional purposes or to the initiation and processing sequences for translational and processing purposes. Meanwhile, inserted sequences can be located anywhere in the vector.

The term “operably linked” is governed by a promoter sequence in which transcription of the gene sequence is operably linked, is governed by a translation control sequence in which translation of the gene sequence is operably linked, and also post-translational processing of the gene sequence. Means a linkage between a gene sequence and a promoter or other regulatory or processing sequence, governed by a processing sequence operably linked.

The term "SIN vector" refers to a self-inactivating vector having a truncated U3 region in 3'LTR. During the reverse transcription period, the cleaved U3 replicates at 5'LTR, resulting in a loss of transcriptional capacity and an inhibitory effect on the internal promoter.

The packaging sequence of the transfer vector comprises (i) an untranslated region between the CAEV 5 'LTR and the CAEV gag -coding sequence, and (ii) the 1 to X nucleotides of the CAEV gag -coding sequence linked to the 3' end of the untranslated region ( Where X is less than 613). In one embodiment, X is 60, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575 and 600 It is selected from the group consisting of.

In another embodiment of the invention, X is selected from the group consisting of:

(a) X is greater than 25 but less than 600,

(b) X is greater than 25 but less than 500,

(c) X is greater than 25 but less than 400,

(d) X is greater than 25 but less than 300,

(e) X is greater than 25 but less than 200,

(f) X is greater than 50 but less than 600,

(g) X is greater than 50 and less than 500,

(h) X is greater than 50 and less than 400,

(i) X is greater than 50 and less than 300,

(j) X is greater than 50 and less than 200,

(k) X is greater than 75 and less than 600,

(l) X is greater than 75 and less than 500,

(m) X is greater than 75 and less than 400,

(n) X is greater than 75 and less than 300,

(o) X is greater than 75 and less than 200,

(p) X is greater than 100 but less than 600,

(q) X is greater than 100 and less than 500,

(r) X is greater than 100 but less than 400,

(s) X is greater than 100 and less than 300,

(t) X is greater than 100 and less than 200,

(u) X is greater than 125 and less than 600,

(v) X is greater than 125 and less than 500,

(w) X is greater than 125 and less than 400,

(x) X is greater than 125 and less than 300,

(y) X is greater than 125 and less than 200,

(z) X is greater than 150 and less than 600,

(aa) X is greater than 150 and less than 500,

(bb) X is greater than 150 and less than 400,

(cc) X is greater than 150 and less than 300,

(dd) X is greater than 150 and less than 200,

(ee) X is greater than 200 and less than 600,

(ff) X is greater than 200 and less than 500,

(gg) X is greater than 200 and less than 400,

(hh) X is greater than 200 and less than 300,

(ii) X is greater than 200 and less than 200,

(jj) X is greater than 250 and less than 600,

(kk) X is greater than 250 and less than 500,

(ll) X is greater than 250 and less than 400, and

(mm) X is greater than 250 and less than 300.

In other embodiments, X is greater than 40 but less than 613. In another embodiment, X is about 327. In one embodiment of the transition vector, the codons that initiate gag translation are mutated (eg, ATG replaced with TAG, TTG, CTG, or ATT). The term "codon" refers to one sequence consisting of three nucleotides in a DNA or messenger RNA molecule, meaning an instruction for binding a specific amino acid to a growing polypeptide chain. The transition vector further comprises a heterologous promoter and one or more cis -acting sequences.

As used herein, the term "packaging signal" or "packaging sequence" refers to a sequence located adjacent to the 5 'LTR of the CAEV genome, where viral RNA is required to encapsulate into a viral capsid or particle. Many retroviral vectors use the minimal packaging signal (also called psi [psi] sequence) required for the encapsidation of the viral genome. Thus, as used herein, the terms "packaging sequence", "packaging signal", "cy", and the symbol "ψ" refer to a non-coding sequence required for the encapsidation of CAEV RNA strands during viral particle formation.

In another embodiment of the invention, the transition vector also comprises a transcription cassette. As used herein, the term “transcription cassette” refers to a nucleic acid comprising a polynucleotide that is operably linked to a specific group of genetic elements, generally a heterologous promoter, operably linked to a heterologous promoter, and that expresses the polypeptide of interest. It means a fragment or segment of. The cassette can be removed as a single unit or inserted into a vector or plasmid.

An example of a transition vector of the invention is shown in FIG. 3C. 3C shows plasmid pCAH / SINd1 (SEQ ID NO: 68). pCAH / SINd1 (SEQ ID NO: 68) is a 327 bp fragment of the gag gene with the HCMV MIEP promoter, R-U5 sequence region in CAEV 5'LTR, residual untranslated sequence comprising PBS position, ATG → TAG double point mutation 4,238 bp plasmid, comprising the RRE region and the U3-deleted CAEV 3'LTR region. The vector also includes a Col E1 origin of replication (bp 2535-3118) and a kanamycin resistance gene region (bp 3370-4182). Other examples of transition vectors are shown in FIGS. 3A-3H.

The present invention provides a CAEV vector system comprising the transition vector and packaging vector system described above. The packaging vector system includes first and second polynucleotide vector sequences. The first polynucleotide sequence comprises a CAEV gag-pol and RRE-coding sequence and the second polynucleotide comprises a viral envelope coding sequence. In one embodiment, the second polynucleotide encodes a non-CAEV envelope.

As used herein, the phrase “structural gene” refers to a polynucleotide sequence that encodes a protein required for capsidization (eg, packaging) of a viral genome, including gag , pol and env and the like.

An example of a first packaging vector of the invention is shown in FIG. 2A. 2A shows plasmid pMGP / RRE (SEQ ID NO: 77). The plasmid has 9,446 base pairs (bp) and includes an MCMV MIEP region, a CAEV gag-pol coding region, an RRE region, and bovine growth hormone (BGH) polyadenylation signal. The vector also includes a neomycin resistance gene coding region, an SV40 origin of replication, a Col E1 origin of replication, and an ampicillin resistance gene region.

The host range of cells that can be infected by the viral vectors of the invention can be replaced by using enveloped genes from other intimate viruses. That is, it is possible to extend the host range of the CAEV vector of the present invention by taking advantage of the ability to participate in the encapsidation of other viruses possessed by the envelope protein of a particular virus. Examples of retrovirus-derived env genes include, but are not limited to: G-protein of hydrophobic stomatitis virus (VSV-G), gibbon leukemia virus (GaLV), Raus sarcoma virus (RSV), molony rat Leukemia virus (MoMuLV), mouse breast tumor virus (MMTV), and human immunodeficiency virus (HIV). These viral envelope proteins all effectively form pseudo virions with the genome and matrix members of other viruses. As used herein, the term “pseudotype” refers to a viral particle comprising a nucleic acid of one virus and an envelope protein of another virus. In general, VSV-G or GaLV pseudo-type vectors have a very wide host range and still exhibit high levels of infectivity, while they can be pelleted at high concentrations by ultracentrifugation (Burns et al., 1993). ).

Another example of a second packaging vector of the present invention is shown in FIGS. 6A and 6B. 6A shows plasmid pHGVSV-G (SEQ ID NO: 74). pHGVSV-G (SEQ ID NO: 74) is HCMV MIEP, β-globin intron region, VSV-G coding region, BGH polyadenylation signal, Col E1 origin of replication, neomycin resistance gene coding region, ampicillin resistance gene coding region, and 7,623 bp plasmid containing the F1 replication origin. 6B shows plasmid pMYKEF1 / env (SEQ ID NO: 72). The plasmid comprises 7,579 bp comprising MCMV MIEP, human EF1-α intron region, GaLV env coding region, BGH polyadenylation signal, Col E1 origin of replication, neomycin resistance gene coding region, and ampicillin resistance gene coding region. .

In another embodiment of the invention, the packaging vector comprises a third polynucleotide encoding Rev. In infected cells, Rev binds to the Rev-response element (RRE) in viral transcripts, resulting in transcription of characteristic single-spliced or non-spliced transcripts of viral structural proteins later in replication. Thus, Rev mediates transient regulation of viral gene expression. Rev also affects the transport of viral transcripts, including RRE, because the splicing mechanism of mammalian cells is paired with the migration of mRNA from the synthetic site to the cytoplasm.

An example of a third packaging vector of the invention is shown in FIG. 5. 5 shows plasmid pHYK / rev (SEQ ID NO: 75). pHYK / rev (SEQ ID NO: 75) is a 5,419 bp plasmid comprising HCMV MIEP, rev gene coding region, BGH polyadenylation signal, Col E1 origin of replication, neomycin resistance gene coding region, and ampicillin resistance gene coding region .

In another embodiment of the invention, the packaging vector comprises a fourth polynucleotide encoding Vif. Binding of Vif may be essential for infection and packaging of virions depending on the packaging cell line chosen.

An example of a fourth packaging vector of the present invention is shown in FIG. 4. pHYK / vif (SEQ ID NO: 76) is a 5,729 bp plasmid comprising HCMV MIEP, vif gene coding region, BGH polyadenylation signal, Col E1 origin of replication, neomycin resistance gene coding region, and ampicillin resistance gene coding region .

When retroviral vector DNA is transfected into a cell, it may or may not be integrated into chromosomal DNA and then transcribed to produce full length retroviral vector RNA comprising the ψ sequence. Under these conditions, only vector RNA is packaged into the viral capsid construct. Such completed, but replication-defective, viral particles can be used to deliver retroviral vectors to target cells with relatively high efficiency.

As used herein, the term "replicating-defective" means a virus that is unable to replicate completely and effectively, such that infectious virions are not produced (eg, replication-defective lentiviral progeny). The term “replicating-competent” means a wild-type virus or a mutant virus that has the ability to replicate, such that infectious virions can be produced by viral replication (eg, replication-competent lentivirus progeny).

Packaging can also be inducible as well as non-inducible. In induced packaging cells and packaging cell lines, CAEV particles are produced in response to at least one or more inducers. In a preferred embodiment with an inducing cell line, the inducer is Tat. In non-induced packaging cell lines and packaging cells, no inducible material is required to cause lentiviral particle production.

CAEV vector sequence

Functionally equivalent sequences of the present invention also include various segments of the CAEV genome that maintain substantially the same function as each native sequence. These fragments may be at least about 10, 15 contiguous nucleotides, at least about 20 contiguous nucleotides, at least about 24, 50, 60, 80, 100, 120, 140, 160, 180, 200, 220 of elements of a particular gene of interest. , 240, 260, 280, 300, 340, 360, 380, or more. Such fragments are produced by the use of restriction enzymes that cut native viral genomes; By synthesizing nucleotide sequences from unique nucleotide sequences of the viral genome; Or through the use of PCR techniques (see in particular (Mullis and Faloona, 1987) and (Erlich, 1989)). In addition, variants of various vector members are included in the methods of the invention, as a result of site-directed mutagenesis. In more detail, methods are common in the art of determining functional equivalence.

"Variants" include substantially similar sequences. Thus, for nucleotide sequences or amino acid sequences, variants include sequences that are functionally equivalent to various members of the viral vector system. Variant nucleotide sequences also include synthetically derived nucleotide sequences generated, for example, by position induced mutations that still retain the function of the native sequence. In general, nucleotide sequence variants or amino acid sequence variants of the invention are at least 70%, generally 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 with respect to their respective unique nucleotide sequences Will have a sequence homology of%, 96%, 97%, 98%, or 99%.

Variants of the invention include sequences of the vectors disclosed herein (SEQ ID NOs: 67-79) and at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96 Polynucleotides (eg, vectors), including, consisting essentially of, or consisting of, sequences having homology of%, 97%, 98%, or 99%.

Those skilled in the art will appreciate that many conservative variations of the disclosed nucleic acid constructs produce functionally identical constructs. Conservative variation of a particular nucleic acid sequence means a nucleic acid that encodes the same or essentially the same amino acid sequence, or if the nucleic acid does not encode an amino acid sequence, it means essentially the same sequence. Due to the degeneracy of the genetic code, many functionally identical nucleic acids encode any given polypeptide. For example, due to the degeneracy of the genetic code, "silent substitutions" (ie substitutions of nucleic acid sequences that do not cause mutation of the encoded polypeptide) inherent in the characteristics of all nucleic acid sequences encoding amino acids. . Similarly, “conservative amino acid substitutions” in one or a few amino acids of the amino acid sequence of a packaged or packageable construct are substituted with other amino acids having very similar characteristics and are also very similar to the disclosed constructs and are readily identified. For example, codons CGU, CGC, CGA, CGG, AGA and AGG all encode the amino acid arginine. Thus, at all positions where arginine is specified by codons, the codons can be replaced with any corresponding codons shown without changing the encoded polypeptide. Such nucleic acid variation is a "silent variation", which is a type of "conservatively modified variation". Every nucleic acid sequence herein that encodes a polypeptide also presents all possible silent variations. Those skilled in the art will recognize that each codon in a nucleic acid (except AUG, which is typically the only codon for methionine) can be modified to produce functionally identical molecules by basic techniques. Thus, each "silent variation" of a nucleic acid encoding a polypeptide is inherent in any given sequence. In addition, one of ordinary skill in the art will appreciate that individual substitutions, deletions, or additions that replace, add, or delete a single amino acid or some amino acids (generally less than 5%, more generally less than 1%) in the encoded sequence chemically It will be appreciated that there are "conservertively modified variations" that are substituted with similar amino acids. Conservative substitution tables that provide functionally similar amino acids are already known in the art. Each of the following six groups contain amino acids that are conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T);

2) aspartic acid (D), glutamic acid (E);

3) asparagine (N), glutamine (Q);

4) arginine (R), lysine (K);

5) isoleucine (I), leucine (L), methionine (M), valine (V); And

6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

See also Creighton (1984) Proteins W. H. Freeman and Company. Finally, the addition of a sequence that does not change the activity of the nucleic acid molecule, such as a non-functional sequence, is a conservative modification of the underlying nucleic acid. Such conservative substitutions variations in each disclosed sequence are a feature of the invention.

With respect to amino acid sequences for various full-length or mature polypeptides used in the vector systems of the present invention, variants include deletion of one or more amino acids at the N-terminus and / or C-terminus in the native polypeptide ( Also called cleavage) or addition; Deletion or addition of one or more amino acids at one or more positions in the native polypeptide; Or by substitution of one or more amino acids at one or more positions in the native polypeptide, polypeptides derived from the native polypeptide. Such variants can result, for example, from polymorphism or human manipulation. Such methods of operation are generally known in the art.

Those skilled in the art will recognize several ways of causing substitution within a given nucleic acid construct. Such known methods include site-directed mutations, PCR amplification using degenerate oligonucleotides, exposure of cells, including nucleic acids, to mutation reagents or radiation (eg, ligation and / or making large nucleic acids). Chemical synthesis of the desired oligonucleotides and other known techniques (related to cloning) (Gillam and Smith, 1979), (Roberts, Cheetham, and Rees, 1987), and Sambrook, Innis, Ausbel, Berger, Needham VanDevanter and See Mullis (all supra).

Variants of native nucleic acids or native polypeptides have substantial homology with native sequences or native polypeptides. Variants may vary by as few as 4, 3, 2 or 1 amino acid residues, as low as 5, such as 6-10, as low as 1-10 amino acid residues. Variants of the nucleic acid sequence may vary by as few as 4, 3, 2 or 1 nucleic acid residues, as low as 5, such as 6 to 20, as low as 1 to 30 nucleic acids.

“Sequence homology” refers to the identification of identical nucleotide or amino acid residues within a variant sequence and a cited sequence when the alignment and comparison of certain consecutive segments of the nucleotide sequence or amino acid sequence of the variant with respect to the nucleotide sequence or amino acid sequence of the cited sequence. it means. Sequence alignment and homology determination methods between sequences are known in the art. With regard to the optimal alignment of two nucleotide sequences, consecutive segments of variant nucleotide sequences may have additional nucleotides or deleted nucleotides relative to the cited nucleotide sequence. Likewise, for optimal alignment of two amino acid sequences, successive segments of variant amino acid sequences may have additional or deleted amino acid residues relative to the cited amino acid sequence. Consecutive segments used for comparison with a cited nucleotide sequence or cited amino acid sequence will include at least 20 contiguous nucleotide or amino acid residues, and may include 30, 40, 50, 100, or more nucleotide or amino acid residues. Can be. Regarding the inclusion of a void in the nucleotide sequence or amino acid sequence of the variant, correction for increased sequence homology can be made by imposing a blank penalty.

Determination of percent homology between two sequences can be performed using a mathematical algorithm. For example, the percent homology of the amino acid sequence is Smith-Waterman using BLOSUM matrix 62, an affine 6 gap search with 12 blank starting penalty and 2 blank extending penalty. It can be determined using the Smith-Waterman homology search algorithm. Meanwhile, the percent homology of the nucleotide sequence can be determined using the Smith-Waterman homology search algorithm using a blank starting penalty of 25 and a blank extending penalty of 5. Such sequence homology determination can be performed using, for example, a DeCypher Hardware Accelerator from TimeLogic Version G. The Smith-Waterman homology search algorithm is taught by Smith and Waterman and is cited herein. Meanwhile, an alignment program GCG gap using default parameters (GCG Gap, Wisconsin Genetic Computing Group, Suite Version 10.1) may be used. The GCG Gap program applies the Needleman and Wunch algorithm and can be used for nucleotide sequence alignment with a blank start penalty of 3 and a blank extension penalty of 1. Examples of mathematical algorithms used to compare two sequences, which are preferred but not limited thereto, include, but are not limited to, Karlin and Altschul's (Karlin and Altschul, 1990) modifications made by Karlin and Altschul (1993). There is this. This algorithm has been reflected in the Nblast (NBLAST) and XBLAST programs of Altschul et al. (1990). BLAST nucleotide search can be performed under conditions of N blast program, score = 100, wordlength = 12 to obtain nucleotide sequences with sufficient sequence homology. Blast protein search can be performed under conditions of Xblast program, score = 50, wordlength = 3 to obtain amino acids with sufficient sequence homology. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as set forth in Altschul et al. (1997). On the other hand, PSI-Blast can be used to perform an iterated search for searching for the discrete relationships between molecules (see Altschul et al., 1997, above). ). When using blast, blank flask and PSI-blast programs, the default parameters of each program (eg Xblast and Nblast) can be used (see http://www.ncbi.nlm.nih.gov). Another non-limiting example of a mathematical algorithm used for sequence comparison is the algorithm of Myers and Miller (1988) CABIOS 4: 11-17. This algorithm is reflected in the ALIGN program, version 2.0, which is part of the GCG sequence alignment software package. When using an alignment program for amino acid sequence comparison, it can be used for the PAM120 weight residue table, 12 blank length penalty, and 4 blank penalty. Percent homology of amino acid sequences can also be determined using VectorNTI (VectorNTI, Informax, USA).

One skilled in the art can screen for nucleic acids of interest based on the sequences provided and generally known in the art with respect to CAEV. Lentivirus life cycle, genome structure, developmental control and related molecular biology have been the focus of intensive research over the last decade. The specific effects of several variations on many retivirus genomes are known. In addition, nucleic acid sequence diversity of some CAEV strains is known. In addition, conventional knowledge related to the properties of conventional proteins and nucleic acids allows those skilled in the art to select appropriate sequences that have similar or equivalent activity to the nucleic acids and polypeptides disclosed in the Sequence Listing herein.

Finally, modifications to most nucleic acids are identified by a series of screening techniques in suitable assays for the desired properties. For example, modifications in the immunological properties of the encoded polypeptide can be detected by appropriate immunological analysis. Modifications to other properties such as nucleic acid hybridization to complementary nucleic acids, redox reactions or thermostability of the encoded protein, hydrophobicity, susceptibility to proteolysis, or tendency to aggregate, are all analyzed according to basic techniques.

Polynucleotide of interest

As will be appreciated by those skilled in the art, the nucleotide sequence of the inserted polypeptide of interest can be any nucleotide sequence. For example, the polynucleotide sequence can be a reporter gene or a selectable marker gene sequence. As used herein, a reporter gene sequence is any gene sequence that, upon expression, produces a protein whose presence or activity can be detected. Representative examples of suitable reporter genes include galactokinase, β-galactosidase, chloramphenicol acetyltransferase, β-lactamase, and green fluorescent protein. fluorescent protein), enhanced green fluorescent protein, and the like. The reporter gene, on the other hand, can be any gene sequence whose expression produces a gene product that affects cell physiology. Polynucleotide sequences of the invention may comprise one or more gene sequences that already have one or more promoters, initiation sequences, or processing sequences.

The selectable marker gene sequence is any gene sequence capable of expressing a protein that, due to its presence, selectively proliferates a cell comprising the same. Examples of selectable marker genes include conferring host resistance to antibiotics (e.g., puromycin, hygromycin, neomycin, theosin, etc.), conferring host resistance to amino acid analogs, or under other severemissible culture conditions. Gene sequences that may enable the growth of bacteria on additional carbon sources are included.

The reporter or selection marker gene sequence is sufficient to enable recognition or selection of the vector in normal cells. In one embodiment of the invention, the reporter gene sequence is generally absent in mammalian cells and, therefore, may encode enzymes or other proteins that can clearly demonstrate the presence of the vector in these cells.

The transfer vectors of the present invention may additionally provide a means for binding heterologous nucleic acids or polynucleotides into viral particles, thereby increasing the number of infected host cells comprising heterologous nucleic acids therein. Binding of heterologous polynucleotides promotes replication of heterologous nucleic acid in viral particles and subsequent production of heterologous proteins. Heterologous proteins are defined herein as proteins or fragments in which all or part of the protein is not expressed by the host cell. Nucleic acids or gene sequences are referred to as heterologous unless they are inherently present in the wild type of the viral vector used to deliver the gene into the cell. The term heterologous nucleic acid sequence or polynucleotide sequence as used herein refers to a nucleic acid molecule (preferably DNA). The polynucleotide sequence or heterologous polynucleotide sequence may also comprise coding sequences of the desired product, such as a suitable biologically active protein or polypeptide, an immunogenic or antigenic protein or polypeptide, or a therapeutically active protein or polypeptide. Polypeptides can compensate for the lack or nonexistent expression of endogenous proteins in host cells. Such gene sequences can be derived from a variety of sources including DNA, cDNA, synthetic DNA, RNA or combinations thereof. Such gene sequences may also include genomic DNA, which may or may not include naturally occurring introns. In addition, such genomic DNA can be obtained in connection with a promoter sequence or a polyadenylation sequence. The gene sequence of the present invention is preferably cDNA. Genomes or cDNAs can be obtained by several methods. Genomic DNA can be extracted and isolated from appropriate cells by methods known in the art. On the other hand, mRNA can be isolated from cells and used to prepare cDNA via reverse transcription or other methods. Meanwhile, the polynucleotide sequence may include a sequence complementary to the RNA sequence, such as an antisense RNA sequence, and the antisense sequence may be administered in the individual to inhibit the expression of the complementary polynucleotide in the individual cell.

Expression of the heterologous gene may provide an immune or antigenic protein or polypeptide that achieves an antibody response. The antibodies thus generated can be recovered from body fluids such as blood, serum or ascites of the animal.

The heterologous gene can also be any nucleic acid of interest that can be transcribed. Generally, foreign genes encode polypeptides. Preferably the polypeptide has certain therapeutic advantages. The polypeptide may compensate for the lack or absence of endogenous protein in the host cell. Polypeptides can impart new properties to host cells such as chimeric signaling receptors (see US Pat. No. 5,359,046). Those skilled in the art can determine the suitability of foreign gene enforcement techniques taught herein and known in the art. For example, the skilled person will recognize that the foreign gene is of an appropriate size for capsidation and that the foreign gene product is properly expressed.

Certain heterologous proteins that may be used in the present invention are not essential to the present invention.

Specific examples of such heterologous proteins that can be used in the present invention include dystrophin (Hoffman, Brown, and Kunkel, 1987), coagulation factor VIII (Wion et al., 1985), cystic fibrosis transmembrane regulator protein; CFTR) (Anderson et al., 1991; Crawford, 1991), Ornithine Transcarbamylase (OTC) (Murakami et al., 1988), and α1-antitrypsin (α1-antitrypsin) Fagerhol and Cox, 1981).

Genes encoding several heterologous proteins are known in the art and can be cloned from genomic or cDNA libraries (Sambrook et al, supra). Examples of such genes include dystrophin gene (Lee et al., 1991), coagulation factor VIII gene (Toole et al., 1984), CFTR gene (Rommens et al., 1989; Riordan, 1989), OTC gene (Horwich et al. , 1984), and the α1-antitrypsin gene (Lemarchand et al., 1992).

In addition, treatment of Rb (Chang et al., 1995) and cancer (Wills et al., 1994; Clayman, 1995) and HIV disease (Bridges and Sarver, 1995) for the treatment of vascular proliferative diseases such as atherosclerosis Genes encoding heterologous proteins such as p53 can be used in the present invention.

Vectors do not always have to encode functional heterologous gene products, ie they can also encode partial gene products that act as inhibitors of eukaryotic enzymes (Warne, Viciana, and Downward, 1993; Wang, 1991). .

It is preferred to modulate the expression of intracellular gene regulatory molecules by molecular introduction by the methods of the invention. The term "modulate" means inhibiting the expression of a gene when it is overexpressed or augmenting its expression when it is underexpressed. When cell proliferative diseases are involved in the expression of genes, nucleic acid sequences that inhibit gene expression at the translational level can be used. For example, antisense nucleic acids, ribozymes or triple antigens and the like can be used to block transcription or translation of a particular mRNA by masking the mRNA with an antisense nucleic acid or triplex agent or cleaving it with ribozymes. .

Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of a particular mRNA molecule. In cells, antisense nucleic acids hybridize to the corresponding mRNAs to form double-stranded molecules. Since cells do not translate double-stranded mRNA, antisense nucleic acids inhibit the translation of mRNA. Antisense oligomers having about 15 or more nucleotides are preferred because they are easily synthesized but produce less problems than larger molecules when introduced into target cells. The use of antisense methods to inhibit ex vivo translation of genes is known in the art (Marcus-Sekura, 1988).

Antisense nucleic acids can be used to block the expression of mutant proteins or excessively active gene products, such as amyloid precursor proteins that accumulate in Alzheimer's disease. These methods are also useful for the treatment of Huntington's disease, hereditary Parkinson's disease and other diseases. Antisense nucleic acids are also useful for inhibiting the expression of proteins associated with toxicity.

Oligonucleotides can be used to delay transcription through a mechanism known as the triplex strategy, in which oligomers are bound around double-helical DNA. Thus, triple compounds can be designed to recognize specific positions of selected genes (Maher, Wold, and Dervan, 1991; Helene, 1991).

Ribozymes are RNA molecules that have the ability to specifically cleave other single-stranded RNA in a manner similar to DNA restriction endonuclease. Modification of nucleic acid sequences encoding such RNA makes it possible to process molecules that recognize and cleave specific nucleic acid sequences in RNA molecules (Cech, 1988). The main advantage of this approach is that it inactivates only mRNAs with specific sequences.

It may be desirable to transfer nucleic acids encoding biological response modifiers. This category includes, for example, immunopotentiators, such as nucleic acids encoding various cytokines classified as "interleukins" of interleukin 1-12. This category also includes, but does not necessarily work according to the same mechanism, interferons, in particular gamma interferon (γ-IFN), tumor necrosis factor (TNF) and granulocyte-macrophage colony stimulating factor (GM-CSF), etc. Included. It is desirable to deliver these nucleic acids to bone marrow cells or macrophages to treat innate enzyme deficiency or immune deficiency. Nucleic acids encoding growth factors, toxic peptides, ligands, receptors or other physiologically important proteins can also be introduced into certain non-dividing cells.

Thus, the recombinant CAEV vector system of the present invention can be used to treat HIV-infected cells (eg T-cells or macrophages) with anti-HIV molecules. In addition, for example, for the treatment of cystic fibrosis, respiratory epithelial cells may be infected with the recombinant lentivirus of the present invention having a gene for cystic fibrosis metastatic membrane conduction modulator (CFTR).

Thus, the recombinant CAEV vector system of the present invention can be used to treat various human diseases. Representative examples of human diseases to which the CAEV vector system is applicable include, but are not limited to, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis disease, Huntington's disease, beta-thalassemia, Retinitis pigmentosa, mucopolysaccharide disease, leukodystrophy diseases, X-linked SCID, phenylketonuria, tyrosinemia, A and Hemophilia A and B, Wilsons disease, LDL receptor deficiency, Human Immunodeficiency, and Ducens dystrophy.

CAEV Vector Particles

In the methods of the invention, infectious and replication-deficient CAEV vector particles can be prepared according to the methods disclosed herein in combination with techniques known in the art. The method comprises transfecting lentiviral-allowed cells with the vector expression system of the present invention; Producing CAEV-derived particles in the transfected cells; And recovering viral particles from the cell.

The term "transfection" refers to the introduction of foreign DNA into eukaryotic cells. Transfections include, but are not limited to, calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroshock, microinjection, liposome fusion, lipofectamine and protoplasts It can be performed by various methods known in the art, such as a fusion method.

As used herein, the term "transduction" refers to gene transfer using viral or retroviral vector particles by means of infection rather than by transfection. In some embodiments, the retroviral vector is transduced. Thus, "transduced genes" are genes introduced into cells through lentiviral or vector infection and proviral integration. In certain embodiments, CAEV viral vector particles transduce genes into "target cells" or host cells.

Promoting the production of intracellular infectious viral particles can also be carried out using conventional techniques such as basic cell culture growth techniques.

Recovering infectious virus particles can be carried out using conventional techniques. For example, infectious particles can be recovered by recovering the supernatant of the cell culture, as is known. Optionally, the recovered virus particles can be purified as needed. Appropriate purification techniques are known to those skilled in the art.

As required by those skilled in the art, CAEV stock solutions can be prepared using the vectors and methods of the present invention. Methods of preparing viral mother liquors are known in the art and are described, for example, in (Soneoka et al., 1995) and (Landau and Littman, 1992). In the method of producing the mother liquor of the present invention, the lentiviral-allowing cells are transfected with the vector system of the present invention. The cells are cultured under appropriate cell culture conditions and recover CAEV particles from the cell culture described above. Suitable acceptable cell lines include, but are not limited to, human cell lines 293, 293T, and HeLa monkey cell lines Vero, and goat cell lines GSM and Ch1Es. The vectors of the present invention are also used to prepare stable packaging cells (ie, cells that stably express CAEV structural proteins without producing infectious viral particles on their own) and virus producing cells (VPCs). useful. Methods for preparing packaging cells expressing retroviral proteins are known in the art and are described, for example, in US Pat. No. 4,650,764 to Temin et al., Which is incorporated herein as such. . Within the scope of the present invention, the packaging cell will comprise a lentiviral-allowed host cell comprising a CAEV nucleic acid sequence from at least one CAEV packaging vector set forth herein, wherein the nucleic acid sequence is a packaging-signal defect so that the cell is It is not possible to produce a replication-qualified infectious virus, but it is possible to produce at least one CAEV structural protein.

Packaging cells can be made by transfecting CAEV-allowed host cells (eg, human embryonic kidney 293 or 293T cells) with appropriate CAEV nucleic acid sequences according to known methods as set out above. Thus, the resulting packaging cells can express and produce at least one CAEV structural protein. However, the packaging cells still cannot produce recombinant CAEV virus. The packaging cell may then be transfected with another nucleic acid sequence, a transfer vector comprising the heterologous gene of interest and the appropriate packaging signal. Once transfected with additional sequences or sequences, the packaging cells can be used to provide CAEV virus stocks containing heterologous genes, where the virus is itself replication-ineligible. Thus, the resulting virus producing cells (VPCs) can produce infectious viral particles comprising heterologous genes of interest.

Gene transfer and treatment

Many human genetic diseases resulting from alterations in a single gene are major candidates for gene therapy. As used herein, the term "gene therapy" or "gene transfer" is defined as the insertion of a gene into a cell for the purpose of clinical treatment. Many applications of gene therapy, particularly through stem cell gene insertion, are known and extensively reviewed. Target cells for ex vivo or in vivo therapeutic gene transfer include, but are not limited to, hematopoietic stem cells, lymphocytes, vascular endothelial cells, respiratory epithelial cells, keratinocytes. , Skeletal and muscle cells, liver cells (liver cells), neurons (neuron cells), cancer cells (cancer cells) and the like.

The gene transfer technology of the present invention can also be used to identify peptide processing processes and to identify functional domains of various proteins. To study cell-specific differences in processing and cell fate, cloned cDNA or genomic sequences for proteins can be introduced into different target cells in vitro or in vivo. By placing the coding sequence under the control of a strong promoter, a significant amount of the desired protein can be made. In addition, specific residues involved in protein processing, intracellular storage, or biological activity can be determined by mutated changes in the distinct residues of the coding sequence.

The gene transfer technology of the present invention can also be applied to provide a means of regulating the expression of proteins and the ability to regulate their cellular level. Certain functions of proteins, such as their role in differentiation, can be studied in tissue culture, while others will need to be reintroduced into the in vivo system at different stages of development to observe changes in relevant properties.

Gene transfer provides a means for studying nucleic acid sequences and cellular factors that regulate expression of a particular gene. An example of such research is the study of analyzing reporter gene expression by fusing regulatory elements to the reporter gene.

Gene transfer also has practically important uses in understanding disease states and providing treatment. There are several genetic diseases in which defective genes are known and cloned. In some cases, the function of these cloned genes is known. In general, the condition of the disease can be divided into two classes: an imbalanced state, generally inherited recessively, generally in enzymes, deficient, and at least occasionally related to regulatory or structural proteins. In the case of a disease of deficiency, gene transfer can be used to deliver normal genes to the diseased tissue for replacement therapy, as well as to create animal models for the disease using antisense mutations. In the case of an imbalanced disease state, gene transfer can be used to create a disease state in a model system, which can be used in studies to reverse the disease state. Thus, the methods of the present invention allow for the treatment of genetic diseases. As used herein, a disease state is treated by partially or wholly treating a deficiency or imbalance that causes and gradually worsens the disease. Location-specific integration of nucleic acid sequences that cause mutations or correct defects can also be used.

The method of the present invention can be used for transplantation of nerve cells, glial cells, fibroblasts or mesenchymal cells, or ex vivo transplantation of cells infected with the recombinant lentivirus of the present invention, central nervous system. Or "grafting" associated with in vivo infection with ventricular cavities, or subdurally infection of the host brain surface. Such grafting methods are known to those of skill in the art and described in Neural Grafting in the Mammalian CNS, Bjorklund & Stenevi, eds. (1985).

In the case of diseases due to lack of protein products, gene transfer can be used to introduce normal genes into the affected tissue for replacement therapy, as well as to create animal models for the disease using antisense mutations. For example, factor VIII or VIII coding nucleic acids can be introduced into CAEV particles for infection of muscle, spleen or liver cells.

Many applications of gene therapy, in particular gene therapy via stem cell gene insertion, are known and extensively studied. The term "stem cells" as used herein includes, but is not limited to, hematopoietic stem cells, neural stem cells, mesenchymal (particularly muscular) stem cells, liver stem cells, and the like. Stem cells can repopulate tissues in vivo. Hematopoietic stem cells are progenitor cells derived from human hematopoietic cells early in development.

Gene therapy with hematopoietic stem cells is also useful for treating gene abnormalities in lymphoid or myeloid cells that generally result in the production of defective proteins or abnormal levels of gene expression. Do.

For many of these diseases, the introduction of normal copies or functional homologs of defective genes and the production of missing genes, even in small amounts, have a beneficial effect. At the same time, it is not expected that overexpression of gene products will have a detrimental effect. Non-limiting examples of diseases in which gene transfer to hematopoietic stem cells are very useful are as follows. Such diseases generally include bone marrow diseases, red blood cell defects, metabolic diseases, and the like. Hematopoietic stem cell gene therapy includes α- and β-thalassemia anemia, sickle cell anemia, and type A and B defects in the globin gene or coagulation factor genes (eg, factor VII and factor VII genes). It is beneficial for the treatment of genetic diseases of blood cells such as hemophilia A and B. Another preferred example is a severe complication of immunodeficiency, in which the patient lacks adenosine deaminase (ADA) enzymes that help to remove certain by-products that are toxic to T and B lymphocytes. combined immunodeficiency disease (SCIDS). These patients are ideal candidates for gene therapy by introducing the ADA gene into their hematopoietic stem cells instead of the lymphatic cells of patients previously done. Other diseases include neutrophils, chronic granulomatosis, in which defective cytochrome b is expressed, and Gaucher disease due to abnormal glucocerebrosidase gene production in macrophages. Etc.

Neurodegenerative diseases such as Parkinson's disease are also good targets for gene therapy that introduces GDNF (glial cell line-derived neurotrophic factor) genes into striatum and substantia (Kordower et al., 2000).

Methods of treating various forms of cancer are also included in gene therapy. The CAEV vector may include, for example, a gene encoding a toxin or apoptosis inducing substance effective for killing cancer cells specifically. Tumor cell specific killing can be performed by introducing a suicide gene into cancer hematopoietic cells under the condition that only tumor cells express a suicide gene. Suicide gene products generally confer lethal sensitivity to cells by converting non-toxic agents into toxic derivatives. For example, the enzyme cytosine deaminase converts the non-toxic substance 5'-fluorocytosine into 5-fluorouracil, a toxic derivative (Mullen, Kilstrup, and Blaese, 1992). Tumor-specific lymphoid cells can be genetically modified to, for example, deliver site-specific gene products with anti-tumor activity to tumor locations to avoid toxicity associated with systemic delivery of such gene products. The approach of gene therapy can also be applied to bone marrow cells that are resistant to the toxic effects of chemotherapy.

Gene therapy can also be used to prevent or treat viral infections such as HIV and HTLV-1 infections. For example, hematopoietic stem cells can be genetically modified to confer resistance to HIV infection. One approach specifically inhibits viral gene expression by using antisense RNA or by disrupting existing viral regulatory pathways. Antisense RNA complementary to retroviral RNA has been shown to inhibit the replication of several retroviruses, including HIV (Rhodes and James, 1991) and HTLV-1 (von Ruden and Gilboa, 1989) (To, Booth, and Neiman, 1986).

Another area where gene therapy in hematopoietic stem cells can be used is the alleviation of autoimmune disease. The therapeutic gene may encode a B or T cell signal molecule, for example, capable of reconstituting normal apoptosis signals resulting in the killing and elimination of autoreactive cells.

In vitro cell transformation methods (eg, through re-fusion of transformed cells into host cells) for diagnosis, research or gene therapy are known to those skilled in the art. In one embodiment of the invention, the cells are isolated from the subject organism, transfected with the vector of the invention comprising the polypeptide of interest and refused back to the subject organism (eg, patient).

Various cell types suitable for ex vivo transformation are known to those skilled in the art. Particularly preferred cells are stem cells described above (eg Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition Wiley-Liss, New York, and methods of isolating and culturing cells from patients cited herein). See the discussion. Transformed cells are known in the art (Kuchler (1977) Biochemical Methods in Cell Culture and Virology, Kuchler, RJ, Dowden, Hutchinson and Ross, Inc., and Atlas (1993) CRC Handbook of Microbiological Media (Parks ed). ) CRC press, Boca Raton, Fl. Mammalian cell systems will often be formed into cell monolayers, but mammalian cell suspensions may also be used. On the other hand, the cells may be derived from those stored in cell banks (eg blood banks). Preferred examples of mammalian cell lines include HEC-1-B cell lines, VERO and Hela cells, Chinese hamster ovary (CHO) cell lines, W138, BHK, Cos-7 or MDCK cell lines (see, eg, Freshney, supra). Included.

T cells or B cells may also be used in some ex vivo gene transfer processes. Several techniques for isolating T and B cells are known. Expression of surface markers facilitates the isolation and purification of these cells.

In summary, the viral vectors of the present invention can be used to stably transduce dividing or non-dividing cells and to stably express heterologous genes. Using such a vector system, it is possible to introduce protein coding genes into dividing or non-dividing cells which can affect the physiology of the cells. Thus, the vector of the present invention can be usefully used for gene therapy for experimental modification of disease or cellular physiology.

Kits

It is another object of the present invention to provide a kit or drug delivery system comprising a vector for use in the methods described herein. Essential materials and reagents required for the administration of all target retroviral particles can be included in the kit (eg, packaging cell constructs or cell lines). The components of the kits are provided in various formulations. One or more CAEV particles may be formulated in a single pharmaceutically acceptable composition or in separate pharmaceutically acceptable compositions with one or more agents (eg, chemotherapeutic agents).

Members of such kits or drug delivery systems may also be provided in a dry or reduced pressure lyophilized form. When the reagents or members are provided in dry form, they are generally reconstituted due to the addition of a suitable solvent which may be provided to other container means. Kits of the invention also include instructions relating to dose and / or administration information for the target CAEV particles. Kits or medicament delivery systems of the present invention will also include means such as commercially available dense vials, such as injection or blow-molded plastic containers, generally to maintain a vial. Regardless of the number and shape of the containers, the kit may also include or be packaged with an instrument to assist injecting / administering or locating the final construct composition into the subject. Such instruments may be applicators, inhalers, syringes, pipettes, forceps, measured spoons, eye-droppers or any such medically approved delivery. It may be a substance.

The following examples illustrate the invention in various aspects, but do not limit the method of the invention.

Example

The following examples set forth specific embodiments and aspects of the invention and do not limit the scope of the invention.

The following examples demonstrate the discovery that the recombinant CAEV-based lentiviral vector system of the present invention is as effective in expression as in the known HIV-1 based lentiviral system. The above examples are HIV-1-based lentiviral vectors whose genomic RNA transcription, capsidization, translation, reverse transcription, and integration levels of the CAEV-based vector particle production system of the present invention have long been recognized as highly effective gene transfer systems. Comparable to the system (Naldini et al., 1996).

The present invention is based on at least three plasmid co-transfection methods and is the first report on the structure of a high titer CAEV-based vector system that requires expression of the gag - pol and env genes, and optionally the rev gene. to be.

Substances and Methods

Plasmid structure

Parent plasmids. The parental plasmid from which the CAEV vector of the present invention is derived is the plasmid pWTE-BM and plasmid pCAEV-LTR provided by Dr. Marie Suzan, Institut National de la Sante et de la Recherche Medicale INSERM, France. The pWTE-BM plasmid contains non-essential stuffer fragments of full length genomic CAEV cDNA and 1337 base pairs, except for the 0.4 kb Hind III fragments comprising the env , rev, and U3 regions. Plasmid pCAEV-LTR contains 0.4 kb Hind III fragments excluded from pWTE-BM (Saltarelli et al., 1990; Saltarelli, 1993). Neither vector can produce wild type viruses.

CAEV gag-pol expression vector (pMGP / RRE (SEQ ID NO: 77) and pMGP / REV / RRE) . pMGP / RRE (SEQ ID NO: 77) plasmid pWTE BM-derived gag - (noted in Fig. 2a) a pol expression plasmid. The pMGP / RRE (SEQ ID NO: 77) plasmid contains the strong and heterologous MCMV main early promoter (MCMV MIEP), the gag-pol gene, and the rev response element (RRE). The pMGP / RRE (SEQ ID NO: 77) plasmid also encodes a neomycin resistance gene as an antibiotic selection marker. In this plasmid structure, the pWTE-BM derived gag-pol gene segment (the 512-5046 nucleotides of the CAEV genome) was cloned into the pGL2-Basic (Promega, WI, USA) cloning vector using standard methods for several PCR and subcloning steps. Subcloned. The MCMV MIEP fragment was cut from plasmid pMYK (Kim et al., 2002) and inserted upstream of the gag gene, and the RRE region (7824-8183 nucleotides or 7849-8150 nucleotides of the CAEV genome) was inserted downstream of the pol gene. It became. pMGP / REV / RRE is another gag-pol expression plasmid containing the CAEV rev gene (shown in FIG. 2B). In addition, the main splicing donation site of the CAEV (330-346 nucleotides of the CAEV genome) was inserted downstream of the MCMV promoter.

Transition vector (pCAH / SINd series). Plasmids belonging to the pCAH / SINd series (shown in FIGS. 3A-3H) (SEQ ID NOs: 67-71, 73, 78, and 79) were constructed to identify optimal packaging sequences for the design of transition vectors of the present invention. . Each plasmid in the series was designed to include 5 'untranslated regions and gag -encoding regions of different lengths to allow side-by-side comparison of the effects of various lengths in these regions. In particular, to address safety issues, these plasmids were designed as self-inactivation (SIN) vectors with a U3 region with 3'LTR deleted. The U3 region of 5'LTR was replaced with HCMV MIEP so that vector RNA was expressed at high levels from the transvector without the trans -acting factor tat . In addition, all known cis -acting sequence elements required for polyadenylation, RNA transport, reverse transcription, and integration were included in this series of transition vectors.

Plasmids of the pCAH / SINd series (SEQ ID NOs: 67-71, 73, 78, 79) were prepared in the following manner. pCAH / SINd (PBS-deficient negative control vector) (SEQ ID NO: 73) (FIG. 3A) contains only 5 ′ untranslated sequences (R and U5 regions) (1 th to 163 nucleotides of the CAEV genome) in 5 ′ LTR It is designed to be. pCAH / SINd0 (SEQ ID NO: 67) (FIG. 3C) was designed to include all of the 5 ′ untranslated region (1 th to 511 nucleotides of the CAEV genome). pCAH / SINd1 (SEQ ID NO: 68) (Fig. 3c) is designed to contain a 5 '327 bp fragment of the gag gene having the untranslated region and all point mutations (1 to 839th nucleotides of the CAEV genome). pCAH / SINd2 (SEQ ID NO: 69) (FIG. 3D) was designed to contain a 612 bp fragment (1st to 1124th nucleotide of the CAEV genome) of the gag gene with all 5 ′ untranslated regions and point mutations. Plasmid pCAH / SINd3 (SEQ ID NO: 70) (FIG. 3E) was designed to contain the 908 bp fragment (1st to 1420th nucleotide of the CAEV genome) of the gag gene with all 5 ′ untranslated regions and point mutations. Was designed to contain: (SEQ ID NO: 71) (Fig. 3f) is the 5 'untranslated region all 1,198 bp fragment of the gag gene, and has a point mutation (1 to 1710th nucleotides of the CAEV genome) plasmid pCAH / SINd4. pCAH / SINd1 / hlacZ (SEQ ID NO: 78) (FIG. 3G) was prepared by inserting an expression cassette consisting of HCMV MIEP and lacZ genes into pCAH / SINd1 (SEQ ID NO: 68). Plasmid pCAH / SINd60 / hlacZ (SEQ ID NO: 78) (FIG. 3H) is for the length of the gag gene (1-569 nucleotides of CAEV) including the first 60 bp fragment of the gag gene with point mutation. , pCAH / SINd1 (SEQ ID NO: 68).

CAEV vif expression vector (pHYK / vif) (SEQ ID NO: 76) . The vif gene (5006-5695 nucleotides of the CAEV genome), known to be required for rapid and efficient viral replication, was cloned into the eukaryotic expression vector pHYK (Kim et al., 2002) (FIG. 4).

CAEV rev Expression Vector (pHYK / rev) (SEQ ID NO: 75). The rev gene, which regulates viral gene expression at the post-transcriptional level by interaction with RRE, has two exons (the first exon is 6,012-6,123 nucleotides of the CAEV genome and the second exon is 8514-8803 nucleotides of the CAEV genome). Is done. The Rev / RRE system promotes nuclear release of non-spliced RNA and is known to be essential for lentiviral replication. Full length cDNA of the rev gene was synthesized by RT-PCR and subcloned into the pHYK vector (FIG. 5).

Virus envelope gene expression vector. Envelope gene expression vector systems as used herein are plasmid pHGVSV-G (SEQ ID NO: 74) and plasmid pMYKEF1 / env (SEQ ID NO: 72) (FIGS. 6A and 6B). Plasmid pHGVSV-G (SEQ ID NO: 74) is designed to express hydrophobic stomatitis virus-G (VSV-G) glycoprotein and includes HCMV MIEP with β-globin intron as promoter. pMYKEF-1 / env (SEQ ID NO: 72) is designed to express Gibbons leukemia virus (GaLV) envelope protein and includes an MCMV MIEP with eukaryotic elongation factor-1α as a promoter.

MuLV- and HIV-1-based plasmids. As a control vector system, pMFG / lac / Zpuro and pHR / lacZ vectors were used in the present invention, which were murine leukemia virus (MuLV) (Kim et al., 1997) and human type 1 immunodeficiency virus (HIV-1), respectively. (Naldini et al., 1996), a lacZ-containing retroviral vector. As packaging plasmids of the MuLV and HIV-1 vector systems, pEQPAM3 (Persons et al., 1998) and pCMVΔR8-2 were used, respectively. The HIV-1 packaging plasmid pCMVΔR8-2 is identical to pCMVΔR9 (Naldini et al., 1996) except that the HIV-1 vpu gene was encoded and the 1.3-kb BglII fragment was deleted from the env gene.

Vector particle production

Pseudo-CAEV-based lentiviral vector particles undergo liposome mediated transient transformation of three or more plasmids to 293T cells dispensed at a concentration of 5 × 10 ⁵ cells per 6-well culture dish one day before transfection. To produce. Three plasmid cotransfections were performed in a 1: 1: 1 molar ratio of gag - pol expression plasmid, transition vector plasmid, and env -encoding plasmid. Four plasmid cotransfections were performed at a 3: 3: 3: 1 molar ratio of gag - pol expression plasmid, transition vector plasmid, env -encoding plasmid, and rev -expressing plasmid. Five plasmid cotransfections were performed in a 3: 3: 3: 1: 1 molar ratio of gag - pol expressing plasmid, transition vector plasmid, env -encoding plasmid, rev -expressing plasmid and vif -expressing plasmid. Culture supernatants containing viral vector particles were recovered after 48 hours, filtered by 0.45 μM membrane filtration (Nalgene, NY, USA), immediately used or stored in a -70 ° C. deep-freezer.

In vivo Transduction

Transduction was performed by adding viral vector particles to 293T cells for 4 hours in the presence of 8 μg / ml polybrene and then adding fresh medium. After 48 hours, the cells were fixed with a solution consisting of 1% formaldehyde and 0.2% glutaaldehyde and 300 μg of 5-bromo-4-chloro-3-indolyl β-D-galactoside (X-Gal, Promega, WI, USA), 4 mM potassium ferrocyanide, 4 mM potassium ferricyanide and 2 mM MgCl ₂ for 12 hours at 37 ° C., followed by beta- The gal expression (Beta-Gal expression) was analyzed. Titer can be determined by measuring the number of blue foci as LacZ-forming units (LFU / ml) per ml.

RT-PCR Analysis

Total RNA was extracted from the cultured cells or cell supernatants by the method using Trizol LS Reagent (TRIzol LS Reagent, GIBCO BRL, CA, USA). The total RNA was removed by DNA lyase-free DNAase I (RNase free-DNase I, 1 unit / mg of DNA treatment for 20 minutes at 37 ℃, Promega, WI, USA) to remove DNA contaminants. The reaction of DNAase I was stopped by adding the RQ1 DNase stop solution provided with the DNAase, and RNA was used by using RNeasy mini kit (Qiagen, Germany). It was purified through the method. Purified RNA was reverse transcribed into cDNA via reverse transcription (RT) reaction (90 minutes at 37 ° C.). Specifically, the RT reaction was performed in the presence of MuLV reverse transcriptase, oligo-dT primers or C-terminal specific primers, and a mixture of dNTPs. PCR amplification was performed with specific primers for semi-quantitative analysis of template DNA. Specifically, PCR product DNA was synthesized from cDNA or chromosomal DNA in the presence of thermostable Ex Taq polymerase, sequence specific DNA primers, and a mixture of dNTPs.

Southern Blot Analysis

Genomic DNA was transduced with one of the pseudo-HIV-1 or CAEV vector particles using the DNeasy Tissue Kit (Qiagen, Germany), and mock-transduced control cells. Prepared from. 10 μg of genomic DNA from cells transduced with the HIV-1 vector were digested with Bam H I and Kpn I. Each 10 μg of genomic DNA from CAEV vector transduced cells was digested with Eco R I and Ssp I. The cleaved genomic DNAs were separated by electrophoresis on a 0.7% agarose gel and transferred to a cationic charged nylon membrane (Roche, Germany). Dig-labeled probes were prepared by PCR using lac Z gene specific primers (forward primer: CTGGCGTAATAGCGAAGAGG (SEQ ID NO: 65), reverse primer: AACTCGCCGCACATCTGAAC (SEQ ID NO: 66)), and Southern hybridization was performed using the Dig Application Manual. (Dig application manual, Roche, Germany).

Growth Arrest of Cells and FACS Analysis of Growth Stagnant Cells

293T cells were grown in aphidicolin (Sigma, USA) treatment (25 μg / ml) and then transduced with CAEV virus vector particles. As a positive or negative control, cells were transduced side by side with either an HIV-1 vector or a MuLV retroviral vector. Two days after transduction, cells were stained with X-gal to determine the beta-gal activity. In apidicholine treated cells, apidine choline was present before or after infection.

Growth retention of cells was confirmed by FACS analysis. Apidicholine treated or untreated control cells were washed with PBS and fixed overnight at −20 ° C. with 70% ethanol, propidium iodide (100 μg / ml) (Sigma, USA) and RNAse A ( 100 μg / ml) (Qiagen, Germany) for 1 hour at room temperature. Cells were analyzed by FACS analysis and calculated the percentage of total live cells at the G1, S and G2 / M stages of the cell cycle (Becton Dickinson, Sanjose, CA).

Example 1 Production of CAEV-Based Lentiviral Vector Particles

Replication defective lentiviral vector particles were produced by transient co-transfection of human 293T cells using a minimal 3-plasmid system of CAEV gag - pol expression plasmids, CAEV env -expressing plasmids and transition vector plasmids. In a 4-plasmid system, a CAEV rev expression plasmid is added, and in a 5-plasmid system, a CAEV vif expression plasmid is added. For efficient packaging, the transfer vectors were designed to include the first part of the gag -coding sequence, with mutations (ATG to TAG) introduced into the starting ATG codon and downstream ATG codons to prevent expression of the gag protein. RRE was included to enhance packaging efficiency and rev in 4- and 5-plasmid systems was expressed from the vector for CAEV mRNA release. The β-galactosidase gene, which acts as an internal HCMV-MIEP promoter in the transition vector plasmid, was inserted as a reporter gene. The U3 region of 5'LTR was replaced by HCMV-MIEP, a powerful viral promoter, to make the vector genome tat independent.

Transcription Vector RNA Transcription Levels. The level of transcription of genomic RNA from the transfer vectors is one of the important factors mediating the high titer production of recombinant viral vectors from packaging cells. In the present invention, the HCMV enhancer / promoter element was used to construct an HCMV / CAEV hybrid LTR promoter system for safe and efficient transcription of transfer vector RNA. To test the level of transcription of the transition vector plasmids of the pCAH / SINd (SEQ ID NOs: 67-71, 73, 78, and 79) series containing the hybrid LTR promoter, each transition vector plasmid was subjected to a packaging plasmid (pMGP / RRE (SEQ ID NO: 6). Number: 77), liposome- with pHYK / rev (SEQ ID NO: 75), pHYK / vif (SEQ ID NO: 76), pHGVSV-G (SEQ ID NO: 74) or pMYKEF1 / env (SEQ ID NO: 72)) It was introduced into human T cells by mediated transfection. After 48 hours of incubation, total RNA was purified from the transfected cells and subjected to reverse transcriptase polymerase chain reaction (RT-PCR) analysis to determine vector RNA transcripts. The PCR primer set for the CAEV transfer vector was designed to synthesize 348-bp PCR products encoding the RRE region portion. HIV-1 transfer vector of pHRlacZ (Naldini et al., 1996 ) another PCR primer set (primer set lac Z) of the is designed to synthesize a 645 bp PCR product encoding the lac Z gene. As shown in FIG. 7, the CAEV transfer vectors of the present invention produced RNA transcripts comparable to HIV-1-based lentiviral transfer vectors.

Formation and release of vector particles. To test the formation and release of mature and infectious viral vector particles, pMGP / RRE (SEQ ID NO: 77) gag-pol expression plasmid, pHGVSV-G (SEQ ID NO: 74) env expression plasmid, pHYK / rev (SEQ ID NO: 75) Liposome-mediated rev expression plasmid, pHYK / vif (SEQ ID NO: 76) vif expression plasmid, and pCAH / SINd60 / hlacZ (SEQ ID NO: 78) transition vector plasmid into human 293T cells (DuBridge et al., 1987). Co-transfection produced CAEV vector particles. 48 hours post transfection, culture supernatants were recovered from the transfected cells for infection and applied to fresh human 293T cells in the presence of 8 μg / ml polybrene. The results show that the five plasmid systems of the present invention are MuLV-based lentiviral vector systems (pEQPAM3, pMFG / lacZ / puro, pHGVSV-G (SEQ ID NO: 74)) (Ory, Neugeboren, and Mulligan, 1996; Persons et al , 1998) which can produce viral vector particle titers comparable to that of (see FIG. 8).

Example 2: Effect of Rev and Vif Expression on Vector Particle Production

To determine the effect of CAEV rev and vif control gene expression for vector particle production, (1) rev - and vif - not having the coding sequence, 3-plasmid system (pCAH / SIN, pMGP / RRE ( SEQ ID NO: 77 ), pHGVSV-G (SEQ ID nO: 74) or pMYKEF1 / env (SEQ ID nO: 72)), (2) vif - not having the coding sequence, 4-plasmid system (pCAH / SIN, pMGP / RR ( SEQ ID nO: 77), pHGVSV-G (SEQ ID NO: 74) or pMYKEF1 / env (SEQ ID NO: 72), pHYK / rev (SEQ ID NO: 75)), and (3) rev - and vif - including all of the coding sequence, 5-plasmid system (pCAH / SIN, pMGP / RRE (SEQ ID NO: 77), pHGVSV-G (SEQ ID NO: 74) or pMYKEF1 / env (SEQ ID NO: 72), pHYK / rev (SEQ ID NO: 75), pHYK) / vif (SEQ ID NO: 76)) was tested side by side for its efficiency in vector particle production. Plasmids of each system were transfected with 293T cells. Two days after transfection, the transfer vector RNA and virion RNA were extracted from the transfected cells and the medium of the transfected cells, respectively, and used as RT-PCR templates with a set of lac Z primers to detect the transition vector RNA genome. .

As shown in FIG. 9, although the expression level of transfer vector RNA in packaging cells is independent of rev or vif gene expression (lanes 1, 2 and 3 in FIG. 9), without rev The amount of encapsidated transfer vector RNA (lane 4 in FIG. 9) was much lower than the amount in the presence of rev (lane 5 in FIG. 9). Surprisingly, however, the titer of vector particles measured by RT-PCR with RNA encapsidated in the presence of vif (lane 6 in FIG. 9) was lower than the amount without CAEV vif (lane 5 in FIG. 9). This result means that CAEV rev and vif are not required for vector particle production, but rev is desirable for efficient vector particle production.

The results of the present invention related to vif expression indicate that the vif gene is essential for efficient replication of CAEV in goat synovial cells and affects the end of the viral replication cycle (eg RNA encapsidation, viral particle release from host cells). Inconsistent with the results reported by Harmache et al., 1995; Harmache et al., 1996. A suitable explanation for this discrepancy may be that human 293T cells were used instead of goat cells in the production of recombinant CAEV vector particles. This interpretation supports the hypothesis presented by Serde et al. (2002) that vif and virus-producing cells can modulate vif action on viral infectivity.

Example 3: Identification of Optimal Packaging Signal Sequences

To identify the optimal packaging signal sequence for capsidation of CAEV transfer vector RNA, a series of plasmids containing different portions of the CAEV gag -coding region and the untranslated region between the 5'LTR and the gag start codons are shown below. In the same way, their vector particle production efficiency was compared. Human 293T cells were expressed in pMGP / RRE (SEQ ID NO: 77) gag-pol expression plasmid, pHGVSV-G (SEQ ID NO: 74) env expression plasmid, pHYK / rev (SEQ ID NO: 75) rev expression plasmid, pHYK / vif (SEQ ID NO: No. 76) co-transfected with vif expression plasmid and pCAH / SINd (SEQ ID NOs: 67-71, 73, 78, and 79) transition vector series plasmids. As a negative control, the CAEV transition vector pCAM / lacZ (L) was transfected without the packaging plasmid. Two days after transfection, virion RNA was extracted from the culture of the transfected cells with either a set of RRE primers for detecting CAEV transfer vector series RNA genomes or a set of lac Z primers for detecting HIV-1 transfer vector RNA genomes. Used as RT-PCR template. As shown in FIG. 10, viral particles comprising viral RNA in culture recovered from virus producing 293T cells transfected with pCAH / SINd1 (SEQ ID NO: 68) containing the full length 5′LTR as well as the first 327 bp of the gag region. A strong PCR product signal was identified, indicating efficient release of (lane 3 in FIG. 10). These signals are comparable to those obtained using the HIV-1 vector, a positive control, in which the amount of capsidized CAEV transfer vector RNA of the present invention is comparable to that of the HIV-1-based transfer vector (lane 8 in FIG. 10). It means deserved. The packaging efficiency of the CAEV transition vector with the first 612 bp or more of the gag -coding region was significantly reduced (lanes 4, 5 and 6). PCR product signals were not detected when the transition vectors were used without gag -coding sequences (lanes 1 and 2 in FIG. 10). The negative control group was transfected with only the transition vectors, and the positive control HIV-1 vector was transfected with pCMVΔR8-2, pHR / lacZ and pHGVSV-G (SEQ ID NO: 74) (lanes 7 and 8 of FIG. 10).

In conclusion, when the transition vector comprises less than about 600 bp of the N-terminal gag -coding sequence as well as all of the untranslated region between the 5'LTR and the gag start codon, the transition vector RNA was efficiently encapsidated in the packaging cell. These results indicate that the role of the secondary structure of RNA in the packaging sequence is more important than the primary structure in RNA encapsidation.

Example 4 Pseudotypes of CAEV Vector Virions

To determine whether recombinant CAEV vector virions can be pseudotyped with GaLV glycoproteins as well as GaV glycoproteins, GaLV expression vectors and pMYKEF1 / env (SEQ ID NO: 72), or VSV-G expression vectors and pHGVSV- Human 293T cells were cotransfected with the G (SEQ ID NO: 74) transition vector plasmid and packaging plasmid. At 42 hours post transfection, the culture supernatant containing pseudo virion particles released from the transfected cells was recovered, clarified by 0.45 μm membrane filtration and used to infect 293T human target cells. One day after infection, genomic DNA was purified using a genomic DNA isolation kit (Genomic DNA Isolation kit, Qiagen, HL, Germany), followed by PCR experiments to detect integrated proviral cDNA. As expected, CAEV vectors (lane 1 in FIG. 11) are more efficiently pseudotyped by VSV-G proteins compared to MuLV- (lane 3 in FIG. 11) and HIV-1-based vectors (lane 4 in FIG. 11). It became. In addition, unlike the HIV-1 lentiviral vector system, the CAEV vectors of the present invention were successfully pseudotyped into GaLV envelopes (lane 2 in FIG. 11). Pseudotyping ability of the CAEV vector using GaLV envelope can provide a great advantage in the development of lentiviral vector systems at the clinical level. Transfected with MuLV (pEQPAM3, pMFG / lacZ / puro and pHGVSV-G (SEQ ID NO: 74)) and HIV-1 (pCMVΔR8-2, pHR / lacZ and pHGVSV-G (SEQ ID NO: 74) ) Vector controls are shown in lanes 3 and 4, respectively.

Example 5: Production of CAEV Packaging Cell Lines

pMGP / RRE (SEQ ID NO: 77) and pHYK / rev (SEQ ID NO: 75) vectors encode the neo ^r gene for selection in eukaryotic cells. For efficient screening after cotransfection with gag-pol and rev expression vectors, other CAEV gag-pol expression vectors can be constructed by substituting neo ^r genes with other antibiotic resistance genes such as bacterial gpt genes. On the other hand, a packaging plasmid system encoding the gag , pol and rev genes can be used. Antibiotic resistant colonies are selected under selection medium to determine if stable 293T cells expressing the CAEV packaging protein can be made. Production of recombinant CAEV vectors from stable 293T cells shows the ease of producing stable packaging cell lines for CAEV vector production.

Example 6 Integration of CAEV-Based Vector cDNA into a Host Chromosome

To test the integration of CAEV vector cDNA after transduction, pMGP / REV / RRE gag-pol expression plasmid, pHGVSV-G (SEQ ID NO: 74) env expression plasmid, and pCAH / SINd1 / hlacZ (SEQ ID NO: 79) transfer Vector plasmids were liposome-mediated co-transfected with human 293T cells to produce CAEV vector particles. As a positive control, HIV-1 vector particles were produced by cotransfecting the pCMVΔR8.2 gag-pol expression plasmid, the pHGVSV-G (SEQ ID NO: 74) env expression plasmid, and the pHR / lacZ transition vector with 293T cells. As a negative control, only the pCAH / SINd1 / hlacZ (SEQ ID NO: 79) transition vector plasmid was transfected. 48 hours after transfection, culture supernatants were recovered from each transfected cell for infection and applied to fresh 293T cells in the presence of 8 μg / ml polybrene. After 48 hours, genomic DNA was prepared from each transduced cell, followed by Southern blot analysis by digestion with restriction enzymes. Dig-labeled lac Z probe detected 3.15 kb Bam H I-Kpn I fragments for HIV-1-based transition vectors and 1.35 kb Hin d III- Ssp I fragments for CAEV-based transition vectors and negative controls . For the positive control, 0.3 ng and 3 ng of Hind III- Ssp I DNA fragment of the pCAH / SINd1 / hlacZ (SEQ ID NO: 79) transition vector plasmid were used. As shown in Figure 12, the CAEV-based transfer vectors of the present invention were integrated at a level comparable to that of HIV-1-based lentiviral transfer vectors.

Example 7: Gene Transfer to Non-Dividing Cells

293T cells were treated with aphidicolin, a DNA synthesis inhibitor, and dispensed into 6-well culture plates, followed by transduction with CAEV vector particles encoding the lac Z marker gene. As a control, cells were infected side by side with lac Z expressing MuLV retroviral vector and HIV-1 lentivirus vector. 48 hours after infection, to test transduction efficiency, the expression of the transfected lac Z gene was measured by X-gal staining. As shown in FIG. 14, MuLV-derived vectors efficiently infected cells that were not treated with DNA synthesis inhibitors. However, when cells were stagnated in the cell cycle by the treatment of DNA synthesis inhibitors, the transduction efficiency dropped significantly. In contrast, CAEV-based vectors were able to efficiently transduce dividing cells as well as non-dividing human cells to levels comparable to those of HIV-1-based vectors.

Example 8: In vivo Transduction of Muscle Cells

In this example, the pCAH / SINd1 / hlacZ (SEQ ID NO: 79) CAEV vector is used to transduce myocytes in vivo. The hind limbs of mice (Beige strain) were injected intramuscularly with 100 μl of the CAEV vector in the presence of 4 μg / ml polybrene. Two days later the mice were sacrificed and infected tissues were prepared for frozen section and β-galaccosidase analysis. As expected, the pCAH / SINd1lacZ (SEQ ID NO: 79) CAEV vector is effectively transduced into muscle cells in vivo.

The detailed description, including the specific embodiments and examples above, is intended to illustrate, but not limit, the invention. Many other variations and modifications may be made within the spirit and scope of the invention. The sequences, patents and patent applications deposited in the NCBI database cited herein are hereby incorporated by reference in their entirety.

Cited References

Altschul, SF, Gish, W., Miller, W., Myers, EW, and Lipman, DJ (1990). Basic local alignment search tool. J Mol Biol 215 (3) , 403-10.

Altschul, SF, Madden, TL, Schaffer, AA, Zhang, J., Zhang, Z., Miller, W., and Lipman, DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25 (17) , 3389-402.

Anderson, MP, Rich, DP, Gregory, RJ, Smith, AE, and Welsh, MJ (1991). Generation of cAMP-activated chloride currents by expression of CFTR. Science 251 (4994) , 679-82.

Bridges, SH, and Sarver, N. (1995). Gene therapy and immune restoration for HIV disease. Lancet 345 (8947) , 427-32.

Burns, JC, Friedmann, T., Driever, W., Burrascano, M., and Yee, JK (1993). Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci USA 90 (17) , 8033-7.

Carswell, S., and Alwine, JC (1989). Efficiency of utilization of the simian virus 40 late polyadenylation site: effects of upstream sequences. Mol Cell Biol 9 (10) , 4248-58.

Cech, TR (1988). Ribozymes and their medical implications. Jama 260 (20) , 3030-4.

Chang, MW, Barr, E., Seltzer, J., Jiang, YQ, Nabel, GJ, Nabel, EG, Parmacek, MS, and Leiden, JM (1995). Cytostatic gene therapy for vascular proliferative disorders with a constitutively active form of the retinoblastoma gene product. Science 267 (5197) , 518-22.

Curran, MA, and Nolan, GP (2002). Nonprimate lentiviral vectors. Curr Top Microbiol Immunol 261, 75-105.

Crawford, I., Maloney, PC, Zeitlin, PL, Guggino, WB, Hyde, SC, Turley, H., Gatter, KC, Harris, A., and Higgins, CF (1991). Immunocytochemical localization of the cystic fibrosis gene product CFTR. Proc Natl Acad Sci USA 88 (20) , 9262-6.

DuBridge, RB, Tang, P., Hsia, HC, Leong, PM, Miller, JH, and Calos, MP (1987). Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system. Mol Cell Biol 7 (1) , 379-87.

Erlich, HA (1989). Polymerase chain reaction. J Clin Immunol 9 (6) , 437-47.

Fagerhol, MK, and Cox, DW (1981). The Pi polymorphism: genetic, biochemical, and clinical aspects of human alpha 1-antitrypsin. Adv Hum Genet 11 , 1-62, 371-2.

Gilbert, JR, and Wong-Staal, F. (2001). HIV-2 and SIV vector systems. Somat Cell Mol Genet 26 (1-6) , 83-98.

Gillam, S., and Smith, M. (1979). Site-specific mutagenesis using synthetic oligodeoxyribonucleotide primers: I. Optimum conditions and minimum ologodeoxyribonucleotide length. Gene 8 (1) , 81-97.

Hall, CV, Jacob, PE, Ringold, GM, and Lee, F. (1983). Expression and regulation of Escherichia coli lacZ gene fusions in mammalian cells. J Mol Appl Genet 2 (1) , 101-9.

Harmache, A., Bouyac, M., Audoly, G., Hieblot, C., Peveri, P., Vigne, R., and Suzan, M. (1995). The vif gene is essential for efficient replication of caprine arthritis encephalitis virus in goat synovial membrane cells and affects the late steps of the virus replication cycle. J Virol 69 (6) , 3247-57.

Harmache, A., Russo, P., Guiguen, F., Vitu, C., Vignoni, M., Bouyac, M., Hieblot, C., Pepin, M., Vigne, R., and Suzan, M. (1996). Requirement of caprine arthritis encephalitis virus vif gene for in vivo replication. Virology 224 (1) , 246-55.

Helene, C. (1991). The anti-gene strategy: control of gene expression by triplex-forming-oligonucleotides. Anticancer Drug Des 6 (6) , 569-84.

Hoffman, EP, Brown, RH, Jr., and Kunkel, LM (1987). Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51 (6) , 919-28.

Horwich, AL, Fenton, WA, Williams, KR, Kalousek, F., Kraus, JP, Doolittle, RF, Konigsberg, W., and Rosenberg, LE (1984). Structure and expression of a complementary DNA for the nuclear coded precursor of human mitochondrial ornithine transcarbamylase. Science 224 (4653) , 1068-74.

Karlin, S., and Altschul, SF (1990). Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc Natl Acad Sci USA 87 (6) , 2264-8.

Karlin, S., and Altschul, SF (1993). Applications and statistics for multiple high-scoring segments in molecular sequences. Proc Natl Acad Sci USA 90 (12) , 5873-7.

Kim, SJ, Sadelain, M., Choi, KH, Kim, HK, Lee, JS, and Chung, HY (1997). Tetracycline-mediated suppression of gene expression with a new dicistronic retroviral vector. Mol Cells 7 (4) , 514-20.

Kim, SY, Lee, JH, Shin, HS, Kang, HJ, and Kim, YS (2002). The human elongation factor 1 alpha (EF-1 alpha) first intron highly enhances expression of foreign genes from the murine cytomegalovirus promoter. J Biotechnol 93 (2) , 183-7.

Kordower, JH, Emborg, ME, Bloch, J., Ma, SY, Chu, Y., Leventhal, L., McBride, J., Chen, EY, Palfi, S., Roitberg, BZ, Brown, WD, Holden , JE, Pyzalski, R., Taylor, MD, Carvey, P., Ling, Z., Trono, D., Hantraye, P., Deglon, N., and Aebischer, P. (2000). Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease. Science 290 (5492) , 767-73.

Landau, NR, and Littman, DR (1992). Packaging system for rapid production of murine leukemia virus vectors with variable tropism. J Virol 66 (8) , 5110-3.

Lee, CC, Pearlman, JA, Chamberlain, JS, and Caskey, CT (1991). Expression of recombinant dystrophin and its localization to the cell membrane. Nature 349 (6307) , 334-6.

Lemarchand, P., Jaffe, HA, Danel, C., Cid, MC, Kleinman, HK, Stratford-Perricaudet, LD, Perricaudet, M., Pavirani, A., Lecocq, JP, and Crystal, RG (1992). Adenovirus-mediated transfer of a recombinant human alpha 1-antitrypsin cDNA to human endothelial cells. Proc Natl Acad Sci USA 89 (14) , 6482-6.

Maher, LJ, 3rd, Wold, B., and Dervan, PB (1991). Oligonucleotide-directed DNA triple-helix formation: an approach to artificial repressors. Antisense res Dev 1 (3) , 277-81.

Marcus-Sekura, CJ (1988). Techniques for using antisense oligodeoxyribonucleotides to study gene expression. Anal Biochem 172 (2) , 289-95.

Miller, AD (1992). Human gene therapy comes of age. Nature 357 (6378) , 455-60.

Mitrophanous, K., Yoon, S., Rohll, J., Patil, D., Wilkes, F., Kim, V., Kingsman, S., Kingsman, A., and Mazarakis, N. (1999). Stable gene transfer to the nervous system using a non-primate lentiviral vector. Gene Ther 6 (11) , 1808-18.

Mselli-Lakhal, L., Favier, C., Da Silva Teixeira, MF, Chettab, K., Legras, C., Ronfort, C., Verdier, G., Mornex, JF, and Chebloune, Y. (1998) . Defective RNA packaging is responsible for low transduction efficiency of CAEV-based vectors. Arch Virol 143 (4) , 681-95.

Mullen, CA, Kilstrup, M., and Blaese, RM (1992). Transfer of the bacterial gene for cytosine deaminase to mammalian cells confers lethal sensitivity to 5-fluorocytosine: a negative selection system. Proc Natl Acad Sci USA 89 (1) , 33-7.

Mulligan, RC (1993). The basic science of gene therapy. Science 260 (5110) , 926-32.

Mullis, KB, and Faloona, FA (1987). Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155, 335-50.

Murakami, K., Amaya, Y., Takiguchi, M., Ebina, Y., and Mori, M. (1988). Reconstitution of mitochondrial protein transport with purified ornithine carbamoyltransferase precursor expressed in Escherichia coli. J Biol Chem 263 (34) , 18437-42.

Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, FH, Verma, IM, and Trono, D. (1996). In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272 (5259) , 263-7.

Ory, DS, Neugeboren, BA, and Mulligan, RC (1996). A stable human-derived packaging cell line for production of high titer retrovirus / vesicular stomatitis virus G pseudotypes. Proc Natl Acad Sci USA 93 (21) , 11400-6.

Persons, DA, Mehaffey, MG, Kaleko, M., Nienhuis, AW, and Vanin, EF (1998). An improved method for generating retroviral producer clones for vectors lacking a selectable marker gene. Blood Cells Mol Dis 24 (2) , 167-82.

Pfarr, DS, Rieser, LA, Woychik, RP, Rottman, FM, Rosenberg, M., and Reff, ME (1986). Differential effects of polyadenylation regions on gene expression in mammalian cells. DNA 5 (2) , 115-22.

Rhodes, A., and James, W. (1991). Inhibition of heterologous strains of HIV by antisense RNA. Aids 5 (2) , 145-51.

Riordan, JR, Rommens, JM, Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielenski, J., Lok, S., Plavsic, N., Chou, JL, and et al . (1989). Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 245 (4922) , 1066-73.

Roberts, S., Cheetham, JC, and Rees, AR (1987). Generation of an antibody with enhanced affinity and specificity for its antigen by protein engineering. Nature 328 (6132) , 731-4.

Rommens, JM, Iannuzzi, MC, Kerem, B., Drumm, ML, Melmer, G., Dean, M., Rozmahel, R., Cole, JL, Kennedy, D., Hidaka, N., and et al. (1989). Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245 (4922) , 1059-65.

Saltarelli, M., Querat, G., Konings, DA, Vigne, R., and Clements, JE (1990). Nucleotide sequence and transcriptional analysis of molecular clones of CAEV which generate infectious virus. Virology 179 (1) , 347-64.

Saltarelli, MJ, Schoborg, R., Gdovin, SL, and Clements, JE (1993). The CAEV tat gene trans-activates the viral LTR and is necessary for efficient viral replication. Virology 197 (1) , 35-44.

Saltarelli, MJ, Schoborg, R., Pavlakis, GN, and Clements, JE (1994). Identification of the caprine arthritis encephalitis virus Rev protein and its cis-acting Rev-responsive element. Virology 199 (1) , 47-55.

Sauter, SL, and Gasmi, M. (2001). FIV vector systems. Somat Cell Mol Genet 26 (1-6) , 99-129.

Seroude, V., Audoly, G., Gluschankof, P., and Suzan, M. (2002). Viral and cellular specificities of caprine arthritis encephalitis virus Vif protein. Virology 292 (1) , 156-61.

Smith, TF, Waterman, MS, and Fitch, WM (1981). Comparative biosequence metrics. J Mol Evol 18 (1) , 38-46.

Soneoka, Y., Cannon, PM, Ramsdale, EE, Griffiths, JC, Romano, G., Kingsman, SM, and Kingsman, AJ (1995). A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res 23 (4) , 628-33.

To, RY, Booth, SC, and Neiman, PE (1986). Inhibition of retroviral replication by anti-sense RNA. Mol Cell Biol 6 (12) , 4758-62.

Toole, JJ, Knopf, JL, Wozney, JM, Sultzman, LA, Buecker, JL, Pittman, DD, Kaufman, RJ, Brown, E., Shoemaker, C., Orr, EC, and et al. (1984). Molecular cloning of a cDNA encoding human antihaemophilic factor. Nature 312 (5992) , 342-7.

von Ruden, T., and Gilboa, E. (1989). Inhibition of human T-cell leukemia virus type I replication in primary human T cells that express antisense RNA. J Virol 63 (2) , 677-82.

Wang, CC (1991). A novel suicide inhibitor strategy for antiparasitic drug development. J Cell Biochem 45 (1) , 49-53.

Warne, PH, Viciana, PR, and Downward, J. (1993). Direct interaction of Ras and the amino-terminal region of Raf-1 in vitro. Nature 364 (6435) , 352-5.

Weintraub, HM (1990). Antisense RNA and DNA. Sci Am 262 (1) , 40-6.

Wills, KN, Maneval, DC, Menzel, P., Harris, MP, Sutjipto, S., Vaillancourt, MT, Huang, WM, Johnson, DE, Anderson, SC, Wen, SF, and et al. (1994). Development and characterization of recombinant adenoviruses encoding human p53 for gene therapy of cancer. Hum Gene Ther 5 (9) , 1079-88.

Wion, KL, Kelly, D., Summerfield, JA, Tuddenham, EG, and Lawn, RM (1985). Distribution of factor VIII mRNA and antigen in human liver and other tissues. Nature 317 (6039) , 726-9.

                          SEQUENCE LISTING <110> MACROGEN CO., LTD   <120> CAEV-BASED VECTOR SYSTEMS <160> 79 <170> KopatentIn 1.71 <210> 1 <211> 9189 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 1 gagttctagg agagtccctc ctagtctctc ctctccgagg aggtaccgag acctcaaaat 60 aaaggagtga ttgccttact gccgagtgga gagtgattac tgagcggccg gtgtatcggg 120 agtcgtccct taatctgtgc aataccagag cggctctcgc agctggcgcc caacgtgggg 180 cccgaggaga agaaaagaaa gcggccctga gaactcggct tctgaaaaag aggaagagga 240 caagttgcta tagcaacaag agagaagaag tagagcaaag gtccagtggc tcggaaaaag 300 aggaactgaa acttcgggga cgcctgaagg agtaaggtaa gtgactctgc tgtacgcggg 360 gcgaggcaga ggtttccttc taaattgaaa gagaagtgtt gctgcgagag gtcttggtgg 420 tcgagaatcc tgtacaaaaa aaaggaggga tctcggtcag gaccaggacc cctgggagta 480 atacaacagc aacaccgtaa gaaaatccgc catggtgagt ctagatagag acatggcgag 540 gcaagtctcc ggggggaaaa gagattatcc tgagctcgaa aaatgtatca agcatgcatg 600 caagataaaa gttcgactca gaggggagca cttgacagaa ggaaattgtt tatggtgcct 660 taaaacatta gattacatgt ttgaggacca taaagaggaa ccttggacaa aagtaaaatt 720 taggacaata tggcagaagg tgaagaatct aactcctgag gagagtaaca aaaaagactt 780 tatgtctttg caggccacat tagcgggtct aatgtgttgc caaatgggga tgagacctga 840 gacattgcaa gatgcaatgg ctacagtaat catgaaagat gggttactgg aacaagagga 900 aaagaaggaa gacaaaagag aaaaggaaga gagtgtcttc ccaatagtag tgcaagcagc 960 aggagggaga agctggaaag cagtagattc tgtaatgttc cagcaactgc aaacagtagc 1020 aatgcagcat ggcctcgtgt ctgaggactt tgaaaggcag ttggcatatt atgctactac 1080 ctggacaagt aaagacatac tagaagtatt ggccatgatg cctggaaata gagctcaaaa 1140 ggagttaatt caagggaaat taaatgaaga agcagaaagg tggagaagga ataatccacc 1200 acctccagca ggaggaggat taacagtgga tcaaattatg ggggtaggac aaacaaatca 1260 agcagcagca caagctaaca tggatcaggc aaggcaaata tgcctgcaat gggtaataaa 1320 tgcattaaga gcagtaagac atatggcgca caggccaggg aatccaatgc tagtaaagca 1380 aaaaacgaat gagccatatg aagattttgc agcaagactg ctagaagcaa tagatgcaga 1440 gccagttaca cagcctataa aagattatct aaagctaaca ctatcttata caaatgcatc 1500 agcagattgt cagaagcaaa tggatagaac actaggacaa agagtacaac aagctagtgt 1560 agaagaaaaa atgcaagcat gtagagatgt gggatcagaa gggttcaaaa tgcaattgtt 1620 agcacaagca ttaaggccag gaaaaggaaa agggaatgga cagccacaaa ggtgttacaa 1680 ctgtggaaaa ccgggacatc aagcaaggca atgtagacaa ggaatcatat gtcacaactg 1740 tggaaagaga ggacatatgc aaaaagaatg cagaggaaag agagacataa ggggaaaaca 1800 gcagggaaac gggaggaggg ggatacgtgt ggtgccgtcc gctcctccta tggaataact 1860 tcagcaccac ctatggttca ggtccgcata ggttcccagc agaggaactt gttatttgat 1920 accggggcgg accgaactat agttagatgg catgagggct cgggaaaccc agccggaagg 1980 ataaaactgc aaggaatagg aggaatagta gaaggagaaa aatggaataa tgtagaatta 2040 gaatataaag gagaaacaag aaagggaaca atagtagtgt taccacaaag tccagtagaa 2100 gtattaggac gagataacat ggcccgattt ggaataaaga taataatggc aaatttagag 2160 gaaaaaagaa tcccaattac aaaagtaaaa ttgaaagagg gatgtacggg tccacatgtc 2220 ccacaatggc cattaacaga agagaaatta aaaggtctaa cagaaatcat agataaatta 2280 gtggaagaag gaaaactagg aaaggcaccc ccacattgga catgtaatac tccaatcttt 2340 tgcataaaaa agaaatcagg gaagtggaga atgttaatag atttcagaga attgaacaaa 2400 cagacagaag atttaacaga agcgcagtta ggactcccgc atccgggagg actacaaaag 2460 aaaaaacatg ttacaatatt ggacatagga gatgcatatt ttactatacc cctatatgaa 2520 ccatatcgag agtacacatg ttttactcta ttaagtccta ataatctagg accatgtaaa 2580 agatactatt ggaaagtgct gccacaaggt tggaaattga gtccatctgt atatcaattt 2640 actatgcagg agatcttaga ggattggata cagcagcatc cagaaattca atttggcata 2700 tatatggatg atatttacat aggaagtgat ttagaaatta aaaagcatag agaaatagtg 2760 aaagatttag ccaattatat tgcccaatat ggattcactc tgccagaaga gaagagacaa 2820 aagggatatc cagcaaaatg gctaggattt gaactacacc cgcagacctg gaaatttcag 2880 aagcatacat tacctgaatt aacaaaggga acaataacat taaataaatt acagaaatta 2940 gtaggagaat tagtatggag acaatccata attgggaaaa gcattcctaa cattctgaaa 3000 ttaatggaag gagatagaga attacaaagt gaaagaaaaa ttgaagaagt acatgtgaaa 3060 gaatgggaag catgtaggaa aaaattagaa gaaatggaag gaaattatta taataaagac 3120 aaagatgtct atggacaatt ggcttgggga gacaaagcta tagaatatat agtgtatcag 3180 gagaaaggga aaccattatg ggtaaatgtg gttcacaata taaagaacct aagcatcccg 3240 caacaggtta ttaaagcagc gcaaaaatta acccaagaag tcatcattag gacaggaaaa 3300 ataccatgga tattgttgcc agggaaagaa gaagattgga gactagaatt gcaattaggg 3360 aacatcacat ggatgccaaa attttggtcc tgttatcgag gacatacaag atggagaaaa 3420 agaaatataa tagaagaagt agtagaaggg cctacatatt atacagatgg aggaaaaaag 3480 aataaagtag gaagtctagg gttcatagta tcaacagggg aaaaatttag aaagcatgaa 3540 gagggcacaa accagcaact agaattaaga gccatagagg aagctctaaa acaagggcct 3600 caaacaatga atttagtaac agatagtaga tatgcatttg aatttttatt aagaaattgg 3660 gatgaagaag taataaagaa tccaattcaa gcaagaatta tggaaattgc ccacaagaaa 3720 gataggatag gagtgcattg ggtgccagga cataaaggga ttccccaaaa tgaagaaata 3780 gacaaatata tttcggaaat atttcttgca aaagaaggag aaggaattct cccaaaaaga 3840 gaagaggatg cagggtatga tttaatatgc ccagaagagg ttaccataga gccaggacaa 3900 gtgaaatgca tccccataga gctaagatta aatttaaaga aatcacaatg ggctatgatt 3960 gctacaaaaa gcagcatggc tgccaaagga gtgttcacac aaggaggaat catagactca 4020 ggatatcagg gacaaataca ggtaataatg tataatagca ataaaatagc agtagtcata 4080 ccccaaggga gaaaatttgc acaattaata ttaatggata aaaagcatgg aaaattggaa 4140 ccctgggggg aaagcagaaa aacagaaagg ggagaaaaag gatttgggtc tacaggaatg 4200 tattggatag aaaatattcc tctggcagag gaagaccaca caaaatggca tcaagatgcc 4260 cgatcattgc atctagaatt tgaaattcca agaacagcag cagaagacat agtaaatcaa 4320 tgtgaaatat gcaaagaagc gaggacacct gcagtaatta gaggcggaaa caaaaggggg 4380 gtaaatcatt ggcaagtgga ttatacccat tatgaaaata tcatactatt agtatgggta 4440 gaaacaaatt caggactaat atatgcagaa aaagtaaaag gagaatcagg gcaagaattc 4500 agaataaaag tgatgcattg gtatgcatta tttggtccag agtcattgca gtcagacaat 4560 ggacctgcat ttgcagcaga gcccacacag ctgttaatgc aatacctagg agtaaaacac 4620 acaacaggca taccttggaa tccacagtct caggctatag tagaaagggc acatcaacta 4680 ttgaaaagca ctttaaagaa gttccagcca caatttgtcg ctgtagaatc agccatagca 4740 gcagccctag tcgccataaa tataaaaaga aagggtgggc tggggacaag ccctatggat 4800 atttttatat ataataaaga acagaaaaga ataaataata aatataataa aaattctcaa 4860 aaaattcaat tctgttatta cagaataagg aaaagaggac atcaggagag tggaaaggac 4920 caacccaggt actgtggaaa ggggaaggag ccaattgtgg taaaggatat agaaagtgaa 4980 aagtatttag taatacctta caaagatgca aaattcatcc cgccaccaac aaaagaaaag 5040 gaataaaaaa cctggaccag aattaccctt agcactatgg atacatatag cagaaagcat 5100 taatggggat agctcatggt acataacaat gagactgcaa cagatgatgt ggggaaaaag 5160 aggaaataag ttacaatata agaatgaaga cagggaatat gaaaattggg aaattacatc 5220 atggggatgg aaaatgcacc taaggagagt gaaacaatgg atacaagaca acaggagagg 5280 aagcccatgg cagtacaaag taggaggaac atggaaaagt ataggagtgt ggttcctgca 5340 agcaggagat tacagaaagg tagacaggca cttctggtgg gcatggagga tactgatatg 5400 ttcctgcagg aaagaaaagt ttgatataag agaatttatg agaggaagac atagatggga 5460 tttgtgcaaa tcctgtgctc aaggagaagt agtaaagcat actagaacaa aaagtctgga 5520 aagactagta ctgctacaga tggtagaaca gcatgtgttt caagtattgc cattgtggag 5580 agccaggaga agtagtacaa cagatttccc atggtgcagg gacacaacgg gatacacgca 5640 tgcgtggtct gtccaggagt gctggttgat ggaatatctc ttagaggatg agtgaagaac 5700 tgcctcaaag aagggagaca catccagaag aacttgtaag gaacgtacgg gaaagagaaa 5760 gggatacatg gcaatggaca agcatcagag tacctgcgga aatactgcaa agatggcttg 5820 ctatgcttag gtcaggcaga aatagaaaga aagtgtatag agaaatgcaa aaatggatgt 5880 ggatacatcc caaggcgcct gtgattaggg cctgtggatg cagactatgt aacccggggt 5940 ggggaacata atcaagggaa taataaatgc aaataaatgt aactaacaag tagcaaaagt 6000 gtctgtgtta gatggatgct ggggccagat acatgcgctt aactgggaag gaaaactggg 6060 ttgaagtaac catggacgga gagaaggaaa ggaaaagaga aggtttcact gcgggacagc 6120 aaggtaagta tcaaccccag gtaagtaagc aaatagggaa cagaaatact aacccatgct 6180 ttgcctataa agggatattc ctatggagga tatcactaac aatgtggata ttgctaggga 6240 taaatatgtg tgtcagtgca gaggattaca taacactaat atcagatccc tatgggttct 6300 cacccataaa aaatgtgtct ggggtaccag tgacttgtgt aacaaaagaa ttcgcaaaat 6360 ggggatgtca accactagga gcgtaccctg atccagaaat agaatacaga aatgtgagtc 6420 aggaagtagt gaaagaagta tatcaagaga attggccatg gaatacatat cattggcctc 6480 tctggcaaat ggagaatgtt aggtactggt taaaagaaaa tatgcaagaa aatcaacaga 6540 gaaaaaataa tacaaaagag ggtatagagg aattattagc aggaactata aggggaagat 6600 tctgtgtacc atacccattt gccttgttaa aatgcacaaa gtggtgctgg tatacagcgg 6660 ccataaacaa cgagtcagga aaagcaggaa aaataaaaat aaattgcaca gaagcaagag 6720 cagtctcctg tacagaggac atgccattag cctcaataca aagagcatat tgggatgaga 6780 aagacagaga gagcatggcc tttatgaata tcaaagcatg tgatagcaac ctaaggtgtc 6840 agaaaagacc tggagggtgt atggaaggat accctatccc agtaggagca gaaataatcc 6900 ctgaaagtat gaaataccta aggggagcaa agagtcagta tgggggaata aaagataaga 6960 atggagaatt aaaattacca ttaacattaa gagtgtgggt aaaattagca aatgtgtcag 7020 aatgggtaaa tgggacaccc ccggattggc aagacagaat taacggatcc aaaggaataa 7080 atgggacgct ctggggagag cttaacagta tgcatcacct aggatttgcc cttagccaga 7140 acggcaaatg gtgtaactac accggggaaa taaaattagg gcaagaaaca ttccaatatc 7200 attacaagcc aaactggaac tgtaccggga attggacgca atatccggtg tggcaagtga 7260 ttagaaacct ggatatggtg gaacatatga caggagaatg tgtgcagaga ccacaaaggc 7320 acaatataac agtaggaaat ggaaccataa cagggaattg cagtacaaca aactgggatg 7380 gatgtaattg ctcacgatca ggaaactacc tatataacag ctctgaggga ggattgttat 7440 taattctgtg cagacaaaac agcaccctaa caaggatcct gggaacaaat acaaattgga 7500 caactatgtg gggaatatac aaaaattgtt caggatgcga gaatgcaaca ttagacaaca 7560 caggagaagg aaccttagga ggtgtagcta ataagaactg tagcttgcct cataaaaatg 7620 agagcaacaa gtggacttgt gccccaagac aaagagatgg aaaaacagat tcgctataca 7680 tagcaggagg aaaaaagttt tggacacgaa ttaaggccca attcagctgt gaaagtaaca 7740 taggacaatt agatggaatg ttgcatcagc aaatactatt gcaaaaatat caagtaatta 7800 aggtaagagc ttatacatat ggggtgatag aaatgccaga aaactatgca aaaacaagaa 7860 tcataaacag gaaaaaaaga gaactcagcc acaagaggaa gaagagaggc gttggcttgg 7920 tcattatgct agttatcatg gcaatagtag ctgccgcagg ggcttctctg ggagtcgcaa 7980 acgcgattca gcagtcttac actaaggcag ctgtccagac ccttgctaat gcaactgctg 8040 cacagcagga tgtgttagag gcaacctatg ccatggtaca gcatgtggct aaaggcgtac 8100 gaatcttgga agctcgagtg gctcgagtgg aagctatcac agatagaata atgctatacc 8160 aagaattgga ttgttggcac tatcatcaat actgtataac ctctacaaaa acagaagtag 8220 caaaatatat caattggacg aggtttaagg ataattgcac atggcagcag tgggagagag 8280 gattacaggg gtatgataca aacttaacaa tactgttaaa ggaatcagca gcaatgacac 8340 aactagcaga agagcaagca aggaggatac cagaagtatg ggaaagttta aaagacgtct 8400 ttgattggtc aggatggttc tcatggctaa agtatattcc tattatagta gtaggattat 8460 taggatgcat tctgataaga gctgtgatat gtgtatgtca acctcttgtg cagatataca 8520 gaactctaag taccccgaca taccaacggg tcacagtcat catggaaaca agagcagacg 8580 tcgcaggaga aaatcaggat tttggcgatg gcttagagga atcagacaac agcgaaacaa 8640 gcgaaagagt gacagtacag aaagcttgga gccgtgcctg ggagctttgg cagaactcac 8700 cctggaagga gccatggaaa aggggcctgc tgaggctgct cgtccttccg ctgacgatgg 8760 gaatctggat aaatggatgg cttggagaac accacaaaaa taaaaaaaga aagggtgact 8820 gtgagacatg ggctaaagag gactaataac aagctaggcc aaattcctgt aaatcacttg 8880 gggggttata agaaaagcaa gttcactatg acaaagcaaa atgtaaaggc caaattcctg 8940 taaatcactt ggggggttat aagaaaagca agttcactat gacaaagcaa aatgtaaccg 9000 caagtgctga cagatgtaac agctgacata tcagctgatg cttgctcatg ctgacactgt 9060 agctctgagc tgtatataag gagaagcttg ctgcttgcac ttcagagttc taggagagtc 9120 cctcctagtc tctcctctcc gaggaggtac cgagacctca aaataaagga gtgattgcct 9180 tactgccga 9189 <210> 2 <211> 8919 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 2 gtgagtgctc tgaggagctc gaaggaaaga gtcctcagcc tctcctctcc gaggagcttc 60 ggctcataat aaaggagtgc ttgcttcaac agaactgagc tggtcgtggt tattatcggg 120 gaccgaagtc ccgtgcaaca ccggggcggt tctcgcagct ggcgcccaac gtggggctcg 180 agtagcttga gaagctcgac tgagatctga atccaagagc gacatcagac agcaagaaat 240 gagagtaatg agaccgcgag ctctgctgct gtaaaaaaga ggaagtagcg ggttgccgag 300 gcaactgctc agaagaacca ggggaaaggg cttccagcaa cctcaaaaga ggaaccgaga 360 cttcggggac gcctgaagta aggtaagtga ctctgctgta cgcggggcga ggcataggag 420 atccttctat tctaggaaga gaagcgctgt tctgggaggt cttggcgacc gagaatcttg 480 ttaaataagc caggatctcg atcaggacca agacccctca ggagagggta tagacagcgt 540 ggtaagaaat ccgccgtggt gagtctagat agagacatgg tgaggcaggc ctccggaagg 600 ggaaaggagt accccgagct aaaagaatgt ctgaaaaagg catgcaaaat aaaagtaagg 660 gctggggggg agcgcctgac agaaggaaat tgtctctggt gtataaaaac actagagtgt 720 atgtatgagg attgtaggga ggaaccttgg accccagaaa aatgtaaaca attatggaaa 780 aagttgaagc aggtagagcc tgaggagagt agcaaagcag actataactc gttaaaagca 840 accttggcgg ggatagtctg tgtgcaaatg ggaatgcagc ccgagacact gcaggatgcg 900 atagcaacct taaacatgag agatgaagta aaaggaaagg aaaagccatc agaagaaaag 960 aagggaatat atcccatatt agtgcaggca ggaggaggaa gagcatggag agcggtagag 1020 cctgctacct ttcagcagct ccaaacagtg gcaatgcagc atggactagt atcagaagaa 1080 tttgaaaggc agctagcata ctatgccacc acatggacaa gcaaggatat cttagaagta 1140 ttagccatga tgccaggaaa tagagcgcaa aaagaactaa tacaaggaaa gttaaatgag 1200 gaagcagaga gatggagaag gcagaatcca caacctgcgg gcgggttaac cgtggatcag 1260 ataatggggg taggacaaac gaatcaggca gcggcacagg ctaatatgga tcaagcaaga 1320 caaatatgcc tacaatgggt tataacagca ataagaggag ttaggcatat ggcccataga 1380 ccaggaaatc ccatgctggt aagacaaaaa ccaaatgaga actatgaaga gtttgccgca 1440 aggttgttag aagcagtgga tgcagaaccc gttacccaac ctataaaaga atatttaaag 1500 gtaactctgt cttacacaaa tgcaaattcg gaatgtcaaa aacatatgga cagagtgttg 1560 gggcaaagag tacagcaggc ctcaatagaa gaaaaaatgc aggcatgcag ggacatcggg 1620 ggaacagcat atcagatgca gttgcttgca caagccctcc gtggcggaaa agaagatggg 1680 aaaaaatctg tagggaagtg ttataactgt ggaaggcccg gacacagagc aaaagaatgc 1740 agacaaggca ttatatgtca caactgtgga aaaagagggc atatacagaa aaactgcaaa 1800 cagaaaagaa gaaaggagca gggaaacatg aggagggggc tacgtgtggt gccgtccgca 1860 ccccctatgg agtaacgcaa gcaccactaa tagttagggt acaaataggg aatcaggaga 1920 aacaattatt atttgacaca ggggcagata aaacgatagt aagaatgcat gatggaacag 1980 ggattccaaa cggaagaata aaattacaag ggataggagg aatagtagaa ggagaaaaat 2040 ggaataaagt acccatgaca tataagggag aaacatcctg cccaagcttg gttgtgctaa 2100 gagatagccc agtagaagta ttgggaagag ataacatgga agcattcggc gtaaccctaa 2160 taatggcaaa tttagaagat aagaaaattc ccacaatacc agtagaattg aaagaaggat 2220 gtaaagggcc acatgtgccc cagtggccat taacagcaga gaaattacaa ggactaacag 2280 gaatagtaga aaaattacta caggaaggaa aattggcaga ggccccagag ggatggacgt 2340 ggaacacgcc catcttctgc ataaaaaaga agtcaggaaa atggagaatg ttaatagatt 2400 ttagggaatt aaataagcaa acagcagatt tagcagaagc gcagctagga ctgccacacc 2460 caggagggtt gcaaaggaaa aagaatgtaa caattctgga cataggagat gcatatttca 2520 caattccctt atacgagccc tatcagaaat atacatgctt cacactccta agtcctaaca 2580 atttgggacc atgtaaaagg tattattgga aagtattacc ccagggatgg aaattgagcc 2640 cagctgtata tcaattcacc atgcaaaggt tgttaaaagg atggatacaa cagcataaaa 2700 acatacaatt tggaatatat atggatgata tctatattgg aagtgatcta acgatagccc 2760 aacataggaa gataatagaa gaattagcct catttataga acaatttggg tttacattac 2820 cagaagataa gagacaagag ggctatccag caaaatggct aggattcgag ctacatccag 2880 aaaaatggaa atatcaaaag cataaattgc cggaattaca agagggggta ataaccctga 2940 acaaattaca gaagatagta ggggaattag tgtggagaca atccttgata ggaaagagca 3000 tccccaatat cataaaatta atggaaggag atcgcgcatt acaaagtgaa aggaaaatag 3060 aaagaataca tgtacaagaa tgggaagcat gtcaaaagaa attagatgaa atggtaggaa 3120 attattacag agaagaagaa gatatctatg gacaaataac ttggggggat aaggcaataa 3180 aatacatagt attccaaagg aaaggggaac ccctatgggt aaatgtagta catgacataa 3240 aaaatttgag tctcccacag caagtgataa aagcagcaca gaaattaacc caggaagtaa 3300 tcataagaac aggaaaaatc ccatggctgc tactaccagg aagagaagaa gactggagat 3360 tagaactgca ggtagggaac atcacgtgga tgccatcatt ttggtcatgt tatcgaggag 3420 cacccaagtg gaaaagaagg aacatagtgg cagcagtggt agatggaccg acatattata 3480 cagatggggg aaagaaaaac gcacagggaa gctttggctt catctcccca acaggagaaa 3540 agttcagaag gcatgaagat ggaactaatc aggtattaga attaagggca atagaagatc 3600 catgtaaaca aggacctgaa agcatgaaca ttgtaactga cagcaggtat gcttatgaat 3660 tcatgctccg aaactgggat gaacaggtca taagaaaccc cattcaggca agaatcatgg 3720 cagaagtgca caagaaaaag caggtaggaa tacactgggt gccagggcat aaaggaatac 3780 ctcagaatga agagatagac cagtacatat cagaagtatt cttagcacga gaaggaacag 3840 ggatatgtga aaaaaggaag gaagatgctg gatatgattt attatgcccg catgaggtaa 3900 tacttaaacc ccaagaagta aaacggatcc caatagacct aaaattaaaa ttgaaagaaa 3960 agcaatgggc catgataagt gggaaaagta gcgttgcagc aaaaggaata tttgtacaag 4020 gaggcataat agattcaggg tatcagggac aagtacaagt catcctatat aatagtaata 4080 agatagaggt caaaatacca caaggcagga aatttgccca attaatatta atgaacttac 4140 aacatgaaga attagaagaa tggggaaagg aaagaaaaac agaaagagga acaaaaggat 4200 ttgggtctac aggagcattt tggatagaga atattcccca agcagaggaa gaacattaca 4260 aatggcatca agatgctaga tctctgcagc tagaattcaa gatacctaga gcagcagcag 4320 aagacattat acagcactgt gaggtatgtc aagaaggcaa acccgcagcg atcacgagag 4380 ggggaaataa aagaggaata gatcattggc aggtagacta tacacattac aaagaacaca 4440 taatattagt atgggtagag actaattcag gattaatatt tgcagagaaa gtaaaaggag 4500 aatcaggaca agaatttagg atgcagacat tgaaatggta tgctttgttt caaccaaaat 4560 cagtgcaatc agataatggg acagccttca cagctgaggc tacgcagcat ctaatgaagt 4620 atttagggat tcagcacact acgggtattc cgtggaaccc ccagtcacaa agtttagtag 4680 aaagagctca tcaaacatta aaacacatgt tagaaaaatt agaaccacaa tttgtggccc 4740 tacagtctgc catcgcagcc actctagttg cgctcaatat aaaaagaaag ggtggactag 4800 gggcaagccc tatggatatt tacatatata ataaggagca acaaagacaa caagataata 4860 gtaataaatt aattcagaaa aaattttgtt attacaggat cagaaaaaga ggccatccag 4920 gagagtggaa cggcccaact gaggtactgt gggaagggga aggagccata gtagttaaag 4980 acaaagaaag tgatagatat ctagtcatcc catataaaga tgcaaaattt attccgccac 5040 cgtcggaaca gaagggatag aagaataggt ccagaattgc ctttatcttt atggacttat 5100 acagcataca gcataaataa agatcccgca tggtatacaa ccctaagact gcagcaaatg 5160 atgtggcata ggaggggaaa taaattgaca tatgtcaggg aaaatgcaca gtacgaggag 5220 tgggaaatga cctcgtatga gtggaggata agaatgagaa gggacaaaac aaaaagtcat 5280 ccaagagggc atacttcgcc atggcaatat cggagacagg atggatggaa ggatgtggga 5340 acgtggttcc tacagccagg ggactataga aaggcggatc agcagttctg gttcgcttgg 5400 agaatagtgt cgtgttcatg taaaaaggaa ggatttaaca taagagaatt tatgctaggt 5460 acccatagat gggatttgtg taagtcgtgt tgccagggtg aagtagtaaa gagaacacaa 5520 ccctacacct tgcaaaggct cacgtggctt aaattaacag aagaccatgt atttcaagta 5580 atgcccttgt ggagagctcg caaagggatt accatagact ttccctggtg cagggacaca 5640 aaaggattcc tggagccgtg gacaacgcaa gagtgttggc aaatagagta tcccttggag 5700 gatgagtgag gaaaccccag caggaagaga accgactgca gaggaaatat ttgagcaaga 5760 agcagaaagt tggaagagaa caagcgtgcg agtcccaaat gacatattac aaagatggct 5820 agcaatgctt aggcaaagag gaaatagaaa gaaagtgctt agggaaatgc aaaaatgggc 5880 atggaggaat cccacggcgc gggtgattcg gccgtgtgga tgtcggctat gtaaccccgg 5940 ctgggggagt aattaatcat aataaagcaa attgtaacat gctgtgtcag gtgtcttgca 6000 ggaatggcgg agataagaaa agaagcaaag gagccactaa tccagggtaa gtataaaaaa 6060 caggtaagta gaataactat agttatatta ctaacagtaa gagcagcact aggagcagaa 6120 tacataacca taatatcaga cccatatggg ttctctcccg tgagaaatgt gtcaggagta 6180 cctgtaactt gtgtgacaaa agaatttagt aagtggggat gtcagccaat aggagcctac 6240 ccagacccag acttagaata cagaaatata agtaaagaaa tattagagga agtatatcaa 6300 caagactggc cgtggaatac ttatcattgg ccattatggc aaatggataa tgtagtacaa 6360 tgggcaaggc aaaatttaca ggataaccgc aaggaaaaaa gggacctggc agacctatta 6420 gcaggaaaaa taaggggaag attctgtgta ccctacccat ttgcgctcct ggagtgcatg 6480 gaatggtgct ggtgggttaa gaacactaat gcaggggggt atggagaagc agacataaga 6540 ataaattgct caagggcaag agcagtgagc tgcacaagtg aaatgccctt agcatcccta 6600 cagagggtat attgggaaaa ggaggaacga aaaaacatgg agaaaatgac catcaaacct 6660 tgcaataaaa atttggaatg caagaacaga aggggatgcg cagaagggta tccagtacct 6720 cccaaggcag agttattccc tccagcgttt caggatttac agccaaaagg gtacgcatat 6780 ggggcactta gagggaacag caaatttcca caaagagtgt cgctaagaac atgggtgaaa 6840 atagctaacc tgacaggatg ggaaaaagga aagccagcag aatggtggaa taccagccaa 6900 caggttcatt ggtttgatac cacgccacaa tatcatttag gatatgtatt atcccgagcg 6960 cctgagaaca ggagttgtaa tttcacaggg gaaatacgaa tagggcaaca tcagtttgag 7020 tataattaca ccctgacaaa gaattgcaca aaggagaagt ggaaagagta ccccatgtgg 7080 catgtctgga ggcatttaga tcaaaatgag cacttatcta gcatatgttt caaaagaccg 7140 agaagaaatg caacacaaat agggaacagt acactgcaag ggcaatgtaa tagaagtaat 7200 tggacaggat gccactgcaa tgagacaggg ataaacacaa catggagaat aaatggcaca 7260 aagggagctt atctcttaaa tagcactaat ggaaacatca tggtcttgtt atgctggaac 7320 acaacagtgg caggggtata tgagagtcag ctaaagtgga atgagagtct taaagacgga 7380 gactatgggc tctgttttaa ttcaacaaac aggaattgta ctagaaatgg agctcggcac 7440 tatgtaaaca agagagtgat aaaaaacgac acagcagatc ataattgtga tagcagcata 7500 tcagcaatag atggaatggt acatcaacaa atattactgc aaaggtatca agtaattaga 7560 gtaagagctt acacatacgg agtgattgat atgccagaca attatgagac cctaccagga 7620 aggagaagga gagatctcgc aaaggccagg aaaaagaggg gcgtgggcct ggtcatcatg 7680 ttagctatca tggccatagt ggctgctgca ggagcatctc tgggagtcgc gaacgcgatt 7740 cagcagtcct acaccaggga cgctgtccag actcttgcta acgcgactgc tgtgcaacag 7800 caggtgttag aggcgtccta tgccatgata cagcatgtgg ctaagggaat acgcatcctt 7860 gaagcacgcg tggcgagaat ggaagttatg atggatagaa tgatgttata tcaggaagta 7920 gactgctggc attatcacca atattgtgta acctctacaa gagcagacat agtgaattac 7980 attaattgga caaggtttaa agataattgc acatggcaag agtgggaaag ggagataagt 8040 gcgcatgaag gaaacatcac tatattactc aaagaatcag caaggataac acaattagca 8100 caacaaaagg tacaaagaat accagatgtg tggacagcac taagggagtc actaggatgg 8160 acacaatggc tggcttggat aaaatacctt cccataatag tagtagggat attaggatgc 8220 ataatcataa gaataatgtt gtgtgtagta caaccagttc ttcagattta cagaaccttg 8280 actcagacca ggtatcaaca agtcaacttg gtgatggaga cccgggtgca actagaagaa 8340 gaagaagaag aagacggaag ggatggtgga gatggctcag agagatgcag cgatcccgac 8400 aacaaaggaa ttatgaacgc ctggaggaga gcttgggtga cttggagaaa ctcaccttgg 8460 cagaacacat ggaagaatgt ggtggtggcg ccgttggtga ttccgctgac aatcagaatt 8520 tggctccttg gagagaatgg agagaacccc taaaagaaaa ataaaaaggg tggactgtga 8580 ggactgtgag gcctaggagc gagatagaaa cttataggcc tctcttcccg gaaagctaac 8640 tcactgtgag aggaatagca agtcacagtg acactgctaa ttgtacccgc aaccctgaga 8700 tcatgcaaac cacaatcctg agattatgct gacatgtgta acagctgatg cctcagctga 8760 tgcttgctca tgctgacaat gtaactagga gctctatata aacagagccc tagagcttgc 8820 tacttcagag tgctctgagg agctcgaagg aaagagtcct cagcctctcc tctccgagga 8880 gcttcggctc ataataaagg agtgcttgct tcaacagaa 8919 <210> 3 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 3 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 4 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 4 atggtgaggc aggcctccgg aaggggaaag gagtaccccg agctaaaaga atgtctgaaa 60 aaggcatgca aaataaaagt aagggctggg ggggagcgcc tgacagaagg aaattgtctc 120 tggtgtataa aaacactaga gtgtatgtat gaggattgta gggaggaacc ttggacccca 180 gaaaaatgta aacaattatg gaaaaagttg aagcaggtag agcctgagga gagtagcaaa 240 gcagactata actcgttaaa agcaaccttg gcggggatag tctgtgtgca aatgggaatg 300 cagcccgaga cactgcagga tgcgatagca accttaaaca tgagagatga agtaaaagga 360 aaggaaaagc catcagaaga aaagaaggga atatatccca tattagtgca ggcaggagga 420 ggaagagcat ggagagcggt agagcctgct acctttcagc agctccaaac agtggcaatg 480 cagcatggac tagtatcaga agaatttgaa aggcagctag catactatgc caccacatgg 540 acaagcaagg atatcttaga agtattagcc atgatgccag gaaatagagc gcaaaaagaa 600 ctaatacaag gaaagttaaa tgaggaagca gagagatgga gaaggcagaa tccacaacct 660 gcgggcgggt taaccgtgga tcagataatg ggggtaggac aaacgaatca ggcagcggca 720 <210> 5 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 5 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 6 <211> 1299 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 6 atggtgaggc aggcctccgg aaggggaaag gagtaccccg agctaaaaga atgtctgaaa 60 aaggcatgca aaataaaagt aagggctggg ggggagcgcc tgacagaagg aaattgtctc 120 tggtgtataa aaacactaga gtgtatgtat gaggattgta gggaggaacc ttggacccca 180 gaaaaatgta aacaattatg gaaaaagttg aagcaggtag agcctgagga gagtagcaaa 240 gcagactata actcgttaaa agcaaccttg gcggggatag tctgtgtgca aatgggaatg 300 cagcccgaga cactgcagga tgcgatagca accttaaaca tgagagatga agtaaaagga 360 aaggaaaagc catcagaaga aaagaaggga atatatccca tattagtgca ggcaggagga 420 ggaagagcat ggagagcggt agagcctgct acctttcagc agctccaaac agtggcaatg 480 cagcatggac tagtatcaga agaatttgaa aggcagctag catactatgc caccacatgg 540 acaagcaagg atatcttaga agtattagcc atgatgccag gaaatagagc gcaaaaagaa 600 ctaatacaag gaaagttaaa tgaggaagca gagagatgga gaaggcagaa tccacaacct 660 gcgggcgggt taaccgtgga tcagataatg ggggtaggac aaacgaatca ggcagcggca 720 caggctaata tggatcaagc aagacaaata tgcctacaat gggttataac agcaataaga 780 ggagttaggc atatggccca tagaccagga aatcccatgc tggtaagaca aaaaccaaat 840 gagaactatg aagagtttgc cgcaaggttg ttagaagcag tggatgcaga acccgttacc 900 caacctataa aagaatattt aaaggtaact ctgtcttaca caaatgcaaa ttcggaatgt 960 caaaaacata tggacagagt gttggggcaa agagtacagc aggcctcaat agaagaaaaa 1020 atgcaggcat gcagggacat cgggggaaca gcatatcaga tgcagttgct tgcacaagcc 1080 ctccgtggcg gaaaagaaga tgggaaaaaa tctgtaggga agtgttataa ctgtggaagg 1140 cccggacaca gagcaaaaga atgcagacaa ggcattatat gtcacaactg tggaaaaaga 1200 gggcatatac agaaaaactg caaacagaaa agaagaaagg agcagggaaa catgaggagg 1260 gggctacgtg tggtgccgtc cgcaccccct atggagtaa 1299 <210> 7 <211> 511 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 7 gagttctagg agagtccctc ctagtctctc ctctccgagg aggtaccgag acctcaaaat 60 aaaggagtga ttgccttact gccgagtgga gagtgattac tgagcggccg gtgtatcggg 120 agtcgtccct taatctgtgc aataccagag cggctctcgc agctggcgcc caacgtgggg 180 cccgaggaga agaaaagaaa gcggccctga gaactcggct tctgaaaaag aggaagagga 240 caagttgcta tagcaacaag agagaagaag tagagcaaag gtccagtggc tcggaaaaag 300 aggaactgaa acttcgggga cgcctgaagg agtaaggtaa gtgactctgc tgtacgcggg 360 gcgaggcaga ggtttccttc taaattgaaa gagaagtgtt gctgcgagag gtcttggtgg 420 tcgagaatcc tgtacaaaaa aaaggaggga tctcggtcag gaccaggacc cctgggagta 480 atacaacagc aacaccgtaa gaaaatccgc c 511 <210> 8 <211> 576 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 8 gtgagtgctc tgaggagctc gaaggaaaga gtcctcagcc tctcctctcc gaggagcttc 60 ggctcataat aaaggagtgc ttgcttcaac agaactgagc tggtcgtggt tattatcggg 120 gaccgaagtc ccgtgcaaca ccggggcggt tctcgcagct ggcgcccaac gtggggctcg 180 agtagcttga gaagctcgac tgagatctga atccaagagc gacatcagac agcaagaaat 240 gagagtaatg agaccgcgag ctctgctgct gtaaaaaaga ggaagtagcg ggttgccgag 300 gcaactgctc agaagaacca ggggaaaggg cttccagcaa cctcaaaaga ggaaccgaga 360 cttcggggac gcctgaagta aggtaagtga ctctgctgta cgcggggcga ggcataggag 420 atccttctat tctaggaaga gaagcgctgt tctgggaggt cttggcgacc gagaatcttg 480 ttaaataagc caggatctcg atcaggacca agacccctca ggagagggta tagacagcgt 540 ggtaagaaat ccgccgtggt gagtctagat agagac 576 <210> 9 <211> 3318 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 9 atgtcacaac tgtggaaaga gaggacatat gcaaaaagaa tgcagaggaa agagagacat 60 aaggggaaaa cagcagggaa acgggaggag ggggatacgt gtggtgccgt ccgctcctcc 120 tatggaataa cttcagcacc acctatggtt caggtccgca taggttccca gcagaggaac 180 ttgttatttg ataccggggc ggaccgaact atagttagat ggcatgaggg ctcgggaaac 240 ccagccggaa ggataaaact gcaaggaata ggaggaatag tagaaggaga aaaatggaat 300 aatgtagaat tagaatataa aggagaaaca agaaagggaa caatagtagt gttaccacaa 360 agtccagtag aagtattagg acgagataac atggcccgat ttggaataaa gataataatg 420 gcaaatttag aggaaaaaag aatcccaatt acaaaagtaa aattgaaaga gggatgtacg 480 ggtccacatg tcccacaatg gccattaaca gaagagaaat taaaaggtct aacagaaatc 540 atagataaat tagtggaaga aggaaaacta ggaaaggcac ccccacattg gacatgtaat 600 actccaatct tttgcataaa aaagaaatca gggaagtgga gaatgttaat agatttcaga 660 gaattgaaca aacagacaga agatttaaca gaagcgcagt taggactccc gcatccggga 720 ggactacaaa agaaaaaaca tgttacaata ttggacatag gagatgcata ttttactata 780 cccctatatg aaccatatcg agagtacaca tgttttactc tattaagtcc taataatcta 840 ggaccatgta aaagatacta ttggaaagtg ctgccacaag gttggaaatt gagtccatct 900 gtatatcaat ttactatgca ggagatctta gaggattgga tacagcagca tccagaaatt 960 caatttggca tatatatgga tgatatttac ataggaagtg atttagaaat taaaaagcat 1020 agagaaatag tgaaagattt agccaattat attgcccaat atggattcac tctgccagaa 1080 gagaagagac aaaagggata tccagcaaaa tggctaggat ttgaactaca cccgcagacc 1140 tggaaatttc agaagcatac attacctgaa ttaacaaagg gaacaataac attaaataaa 1200 ttacagaaat tagtaggaga attagtatgg agacaatcca taattgggaa aagcattcct 1260 aacattctga aattaatgga aggagataga gaattacaaa gtgaaagaaa aattgaagaa 1320 gtacatgtga aagaatggga agcatgtagg aaaaaattag aagaaatgga aggaaattat 1380 tataataaag acaaagatgt ctatggacaa ttggcttggg gagacaaagc tatagaatat 1440 atagtgtatc aggagaaagg gaaaccatta tgggtaaatg tggttcacaa tataaagaac 1500 ctaagcatcc cgcaacaggt tattaaagca gcgcaaaaat taacccaaga agtcatcatt 1560 aggacaggaa aaataccatg gatattgttg ccagggaaag aagaagattg gagactagaa 1620 ttgcaattag ggaacatcac atggatgcca aaattttggt cctgttatcg aggacataca 1680 agatggagaa aaagaaatat aatagaagaa gtagtagaag ggcctacata ttatacagat 1740 ggaggaaaaa agaataaagt aggaagtcta gggttcatag tatcaacagg ggaaaaattt 1800 agaaagcatg aagagggcac aaaccagcaa ctagaattaa gagccataga ggaagctcta 1860 aaacaagggc ctcaaacaat gaatttagta acagatagta gatatgcatt tgaattttta 1920 ttaagaaatt gggatgaaga agtaataaag aatccaattc aagcaagaat tatggaaatt 1980 gcccacaaga aagataggat aggagtgcat tgggtgccag gacataaagg gattccccaa 2040 aatgaagaaa tagacaaata tatttcggaa atatttcttg caaaagaagg agaaggaatt 2100 ctcccaaaaa gagaagagga tgcagggtat gatttaatat gcccagaaga ggttaccata 2160 gagccaggac aagtgaaatg catccccata gagctaagat taaatttaaa gaaatcacaa 2220 tgggctatga ttgctacaaa aagcagcatg gctgccaaag gagtgttcac acaaggagga 2280 atcatagact caggatatca gggacaaata caggtaataa tgtataatag caataaaata 2340 gcagtagtca taccccaagg gagaaaattt gcacaattaa tattaatgga taaaaagcat 2400 ggaaaattgg aaccctgggg ggaaagcaga aaaacagaaa ggggagaaaa aggatttggg 2460 tctacaggaa tgtattggat agaaaatatt cctctggcag aggaagacca cacaaaatgg 2520 catcaagatg cccgatcatt gcatctagaa tttgaaattc caagaacagc agcagaagac 2580 atagtaaatc aatgtgaaat atgcaaagaa gcgaggacac ctgcagtaat tagaggcgga 2640 aacaaaaggg gggtaaatca ttggcaagtg gattataccc attatgaaaa tatcatacta 2700 ttagtatggg tagaaacaaa ttcaggacta atatatgcag aaaaagtaaa aggagaatca 2760 gggcaagaat tcagaataaa agtgatgcat tggtatgcat tatttggtcc agagtcattg 2820 cagtcagaca atggacctgc atttgcagca gagcccacac agctgttaat gcaataccta 2880 ggagtaaaac acacaacagg cataccttgg aatccacagt ctcaggctat agtagaaagg 2940 gcacatcaac tattgaaaag cactttaaag aagttccagc cacaatttgt cgctgtagaa 3000 tcagccatag cagcagccct agtcgccata aatataaaaa gaaagggtgg gctggggaca 3060 agccctatgg atatttttat atataataaa gaacagaaaa gaataaataa taaatataat 3120 aaaaattctc aaaaaattca attctgttat tacagaataa ggaaaagagg acatcaggag 3180 agtggaaagg accaacccag gtactgtgga aaggggaagg agccaattgt ggtaaaggat 3240 atagaaagtg aaaagtattt agtaatacct tacaaagatg caaaattcat cccgccacca 3300 acaaaagaaa aggaataa 3318 <210> 10 <211> 3324 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 10 atgcagacaa ggcattatat gtcacaactg tggaaaaaga gggcatatac agaaaaactg 60 caaacagaaa agaagaaagg agcagggaaa catgaggagg gggctacgtg tggtgccgtc 120 cgcaccccct atggagtaac gcaagcacca ctaatagtta gggtacaaat agggaatcag 180 gagaaacaat tattatttga cacaggggca gataaaacga tagtaagaat gcatgatgga 240 acagggattc caaacggaag aataaaatta caagggatag gaggaatagt agaaggagaa 300 aaatggaata aagtacccat gacatataag ggagaaacat cctgcccaag cttggttgtg 360 ctaagagata gcccagtaga agtattggga agagataaca tggaagcatt cggcgtaacc 420 ctaataatgg caaatttaga agataagaaa attcccacaa taccagtaga attgaaagaa 480 ggatgtaaag ggccacatgt gccccagtgg ccattaacag cagagaaatt acaaggacta 540 acaggaatag tagaaaaatt actacaggaa ggaaaattgg cagaggcccc agagggatgg 600 acgtggaaca cgcccatctt ctgcataaaa aagaagtcag gaaaatggag aatgttaata 660 gattttaggg aattaaataa gcaaacagca gatttagcag aagcgcagct aggactgcca 720 cacccaggag ggttgcaaag gaaaaagaat gtaacaattc tggacatagg agatgcatat 780 ttcacaattc ccttatacga gccctatcag aaatatacat gcttcacact cctaagtcct 840 aacaatttgg gaccatgtaa aaggtattat tggaaagtat taccccaggg atggaaattg 900 agcccagctg tatatcaatt caccatgcaa aggttgttaa aaggatggat acaacagcat 960 aaaaacatac aatttggaat atatatggat gatatctata ttggaagtga tctaacgata 1020 gcccaacata ggaagataat agaagaatta gcctcattta tagaacaatt tgggtttaca 1080 ttaccagaag ataagagaca agagggctat ccagcaaaat ggctaggatt cgagctacat 1140 ccagaaaaat ggaaatatca aaagcataaa ttgccggaat tacaagaggg ggtaataacc 1200 ctgaacaaat tacagaagat agtaggggaa ttagtgtgga gacaatcctt gataggaaag 1260 agcatcccca atatcataaa attaatggaa ggagatcgcg cattacaaag tgaaaggaaa 1320 atagaaagaa tacatgtaca agaatgggaa gcatgtcaaa agaaattaga tgaaatggta 1380 ggaaattatt acagagaaga agaagatatc tatggacaaa taacttgggg ggataaggca 1440 ataaaataca tagtattcca aaggaaaggg gaacccctat gggtaaatgt agtacatgac 1500 ataaaaaatt tgagtctccc acagcaagtg ataaaagcag cacagaaatt aacccaggaa 1560 gtaatcataa gaacaggaaa aatcccatgg ctgctactac caggaagaga agaagactgg 1620 agattagaac tgcaggtagg gaacatcacg tggatgccat cattttggtc atgttatcga 1680 ggagcaccca agtggaaaag aaggaacata gtggcagcag tggtagatgg accgacatat 1740 tatacagatg ggggaaagaa aaacgcacag ggaagctttg gcttcatctc cccaacagga 1800 gaaaagttca gaaggcatga agatggaact aatcaggtat tagaattaag ggcaatagaa 1860 gatccatgta aacaaggacc tgaaagcatg aacattgtaa ctgacagcag gtatgcttat 1920 gaattcatgc tccgaaactg ggatgaacag gtcataagaa accccattca ggcaagaatc 1980 atggcagaag tgcacaagaa aaagcaggta ggaatacact gggtgccagg gcataaagga 2040 atacctcaga atgaagagat agaccagtac atatcagaag tattcttagc acgagaagga 2100 acagggatat gtgaaaaaag gaaggaagat gctggatatg atttattatg cccgcatgag 2160 gtaatactta aaccccaaga agtaaaacgg atcccaatag acctaaaatt aaaattgaaa 2220 gaaaagcaat gggccatgat aagtgggaaa agtagcgttg cagcaaaagg aatatttgta 2280 caaggaggca taatagattc agggtatcag ggacaagtac aagtcatcct atataatagt 2340 aataagatag aggtcaaaat accacaaggc aggaaatttg cccaattaat attaatgaac 2400 ttacaacatg aagaattaga agaatgggga aaggaaagaa aaacagaaag aggaacaaaa 2460 ggatttgggt ctacaggagc attttggata gagaatattc cccaagcaga ggaagaacat 2520 tacaaatggc atcaagatgc tagatctctg cagctagaat tcaagatacc tagagcagca 2580 gcagaagaca ttatacagca ctgtgaggta tgtcaagaag gcaaacccgc agcgatcacg 2640 agagggggaa ataaaagagg aatagatcat tggcaggtag actatacaca ttacaaagaa 2700 cacataatat tagtatgggt agagactaat tcaggattaa tatttgcaga gaaagtaaaa 2760 ggagaatcag gacaagaatt taggatgcag acattgaaat ggtatgcttt gtttcaacca 2820 aaatcagtgc aatcagataa tgggacagcc ttcacagctg aggctacgca gcatctaatg 2880 aagtatttag ggattcagca cactacgggt attccgtgga acccccagtc acaaagttta 2940 gtagaaagag ctcatcaaac attaaaacac atgttagaaa aattagaacc acaatttgtg 3000 gccctacagt ctgccatcgc agccactcta gttgcgctca atataaaaag aaagggtgga 3060 ctaggggcaa gccctatgga tatttacata tataataagg agcaacaaag acaacaagat 3120 aatagtaata aattaattca gaaaaaattt tgttattaca ggatcagaaa aagaggccat 3180 ccaggagagt ggaacggccc aactgaggta ctgtgggaag gggaaggagc catagtagtt 3240 aaagacaaag aaagtgatag atatctagtc atcccatata aagatgcaaa atttattccg 3300 ccaccgtcgg aacagaaggg atag 3324 <210> 11 <211> 402 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 11 atggatgctg gggccagata catgcgctta actgggaagg aaaactgggt tgaagtaacc 60 atggacggag agaaggaaag gaaaagagaa ggtttcactg cgggacagca agatatacag 120 aactctaagt accccgacat accaacgggt cacagtcatc atggaaacaa gagcagacgt 180 cgcaggagaa aatcaggatt ttggcgatgg cttagaggaa tcagacaaca gcgaaacaag 240 cgaaagagtg acagtacaga aagcttggag ccgtgcctgg gagctttggc agaactcacc 300 ctggaaggag ccatggaaaa ggggcctgct gaggctgctc gtccttccgc tgacgatggg 360 aatctggata aatggatggc ttggagaaca ccacaaaaat aa 402 <210> 12 <211> 321 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 12 atggcggaga taagaaaaga agcaaaggag ccactaatcc aggaccaggt atcaacaagt 60 caacttggtg atggagaccc gggtgcaact agaagaagaa gaagaagaag acggaaggga 120 tggtggagat ggctcagaga gatgcagcga tcccgacaac aaaggaatta tgaacgcctg 180 gaggagagct tgggtgactt ggagaaactc accttggcag aacacatgga agaatgtggt 240 ggtggcgccg ttggtgattc cgctgacaat cagaatttgg ctccttggag agaatggaga 300 gaacccctaa aagaaaaata a 321 <210> 13 <211> 690 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 13 atgcaaaatt catcccgcca ccaacaaaag aaaaggaata aaaaacctgg accagaatta 60 cccttagcac tatggataca tatagcagaa agcattaatg gggatagctc atggtacata 120 acaatgagac tgcaacagat gatgtgggga aaaagaggaa ataagttaca atataagaat 180 gaagacaggg aatatgaaaa ttgggaaatt acatcatggg gatggaaaat gcacctaagg 240 agagtgaaac aatggataca agacaacagg agaggaagcc catggcagta caaagtagga 300 ggaacatgga aaagtatagg agtgtggttc ctgcaagcag gagattacag aaaggtagac 360 aggcacttct ggtgggcatg gaggatactg atatgttcct gcaggaaaga aaagtttgat 420 ataagagaat ttatgagagg aagacataga tgggatttgt gcaaatcctg tgctcaagga 480 gaagtagtaa agcatactag aacaaaaagt ctggaaagac tagtactgct acagatggta 540 gaacagcatg tgtttcaagt attgccattg tggagagcca ggagaagtag tacaacagat 600 ttcccatggt gcagggacac aacgggatac acgcatgcgt ggtctgtcca ggagtgctgg 660 ttgatggaat atctcttaga ggatgagtga 690 <210> 14 <211> 490 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 14 atgcaaaatt tattccgcca ccgtcggaac agaagggata gaagaatagg caaaaagtca 60 tccaagaggg catacttcgc catggcaata tcggagacag gatggatgga aggatgtggg 120 aacgtggttc ctacagccag gggactatag aaaggcggat cagcagttct ggttcgcttg 180 gagaatagtg tcgtgttcat gtaaaaagga aggatttaac ataagagaat ttatgctagg 240 tacccataga tgggatttgt gtaagtcgtg ttgccagggt gaagtagtaa agagaacaca 300 accctacacc ttgcaaaggc tcacgtggct taaattaaca gaagaccatg tatttcaagt 360 aatgcccttg tggagagctc gcaaagggat taccatagac tttccctggt gcagggacac 420 aaaaggattc ctggagccgt ggacaacgca agagtgttgg caaatagagt atcccttgga 480 ggatgagtga 490 <210> 15 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 15 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 16 <211> 591 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 16 gctgtagact ctgtaatgtt ccaacaaatg caaacagtag caatgcagca tggcctcgtg 60 tccgaggatt ttgaaagaca gttagcatat tatgctacta cctggacaag taaagacata 120 ctagaagtat tggccatgat gcctgggaat agggctcaga aagaacttat tcaagggaaa 180 ttgaatgaag aagcagacag gtggagaagg aacaatccac caggaggatt aacagtggat 240 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 300 agacaaatat gcctacaatg ggtaataaac gccttaagag cagtaaggca tatggctcat 360 aggccaggga atccaatgct agtaaagcaa aaaacaaatg agccatatga agaatttgca 420 gcaagactgc tagaagcaat agatgcagaa gcggttacac agcccataaa agagtatcta 480 aagctaacat tatcctatac aaatgcagcc tcagattgtc aaaagcaaat ggagagagtg 540 ctaggacaaa gagtacaaca ggctagtgta gaaaaaaaaa tgcaagcatg t 591 <210> 17 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 17 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 18 <211> 591 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 18 gctgtagact ctgtaatgtt ccaacaaatg caaacagtag caatgcagca tggcctcgtg 60 tccgaggatt ttgaaagaca gttagcatat tatgctacta cctggacaag taaagacata 120 ctagaagtat tggccatgat gcctgggaat agggctcaga aagaacttat tcaagggaaa 180 ttgaatgaag aagcagacag gtggagaagg aacaatccac caggaggatt aacagtggat 240 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 300 agacaaatat gcctacaatg ggtaataaac gccttaagag cagtaaggca tatggctcat 360 aggccaggga atccaatgct agtaaagcaa aaaacaaatg agccatatga agaatttgca 420 gcaagactgc tagaagcaat agatgcagaa gcggttacac agcccataaa agagtatcta 480 aagctaacat tatcctatac aaatgcagcc tcagattgtc aaaagcaaat ggagagagtg 540 ctaggacaaa gagtacaaca ggctagtgta gaaaaaaaaa tgcaagcatg t 591 <210> 19 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 19 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 20 <211> 662 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 20 tcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagtatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaagaaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gtctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aaaacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc agaaacagat ggatagagta ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag gattcagaat 660 gc 662 <210> 21 <211> 662 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 21 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc aaaaacaaat ggatagaata ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag ggttcagaat 660 gc 662 <210> 22 <211> 651 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 22 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tggcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaacag 180 agctcaaaaa gagttaattc aggggaaatt gaataaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcac aaggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcag gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc agaaacaaat ggatagagta ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag g 651 <210> 23 <211> 520 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 23 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa gaatatttaa 520 <210> 24 <211> 663 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 24 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcgactaaga gcagtgagac atatggctca caaaccaggg aatccaatgc 420 tagtaaagca aaagacaaat gagtcatatg aaaaattttc agcaagactc ctagaagcaa 480 tagatgcaga accagttaca cagcctataa aagaatattt aaagttaaca ttatcttaca 540 caaatgcatc ctcagactgt caaaaacaaa tggatagagt actaggacag agagtgcaac 600 aagctagtgt ggaagaaaaa atgcaagcat gcagagatgt gggatcagaa ggattcagaa 660 tgc 663 <210> 25 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 25 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 26 <211> 662 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 26 tcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagtatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaagaaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gtctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aaaacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc agaaacagat ggatagagta ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag gattcagaat 660 gc 662 <210> 27 <211> 662 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 27 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc aaaaacaaat ggatagaata ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag ggttcagaat 660 gc 662 <210> 28 <211> 651 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 28 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tggcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaacag 180 agctcaaaaa gagttaattc aggggaaatt gaataaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcac aaggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcag gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc agaaacaaat ggatagagta ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag g 651 <210> 29 <211> 520 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 29 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga agattttgcc gcaagactgc tagaagcaat 480 agatgcagaa ccagttacac agcaaataaa gaatatttaa 520 <210> 30 <211> 662 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 30 gcaagcagca ggagggagaa gctggaaagc agtagactca gtgatgttcc agcaactgca 60 aaatgtagca atgcagcatg gcctcgtgtc cgaggatttt gaaaggcagt tagcatatta 120 tgctactacc tggacaagta aagatatatt agaagtattg gccatgatgc ctggaaatag 180 agctcaaaaa gagttaattc aagggaaatt gaatgaggaa gcagaaaggt ggagaaggaa 240 taatccacca cctcaagcag gcggaggatt aacagtggat caaattatgg gggtaggaca 300 aacaaatcaa gcagcggcac aggctaacat ggatcaggca agacaaatat gcctgcaatg 360 ggtaataaca gcactaagag cagtgagaca tatggctcac aaaccaggga atccaatgct 420 agtaaagcaa aagacaaatg agtcatatga aaaattttca gcaagactcc tagaagcaat 480 agatgcagaa ccagttacac agcctataaa agaatattta aagttaacat tatcttacac 540 aaatgcatcc tcagactgtc aaaaacaaat ggatagagta ctaggacaga gagtgcaaca 600 agctagtgtg gaagaaaaaa tgcaagcatg cagagatgtg ggatcagaag gattcagaat 660 gc 662 <210> 31 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 31 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 32 <211> 597 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 32 gcagtcgatg ctgtaatgtt ccagcaaatg caaacagtag ccatgcagca tggtcttgtg 60 tctgaggact ttgaaaggca gttagcatat tgtgctacta cctggacaag taaagatata 120 ttagaagtat tggccatgat gcctggaaat agagctcaaa aagagttaat tcaaggaaaa 180 ttaaacgagg aagcagaaag gtggagaagg aataatccac cgcctccaca aggaggggga 240 ttaacagtgg atcaaattat ggggatagga caaacaaatc aagcagcagc acaagctaac 300 atggatcagg caagacacat atgcctgcaa tgggtaataa cagcattaag agcagtaaga 360 catatggctc acagaccagg gaatccaatg ctcgtaaaac aaaaaacaaa tgagccatat 420 gaagagtttg cagcaaaact attagaagca atagatgcag aaccagtaac acagcccata 480 aaagactatc taaagttaac attatcttat acaaatgcgt cctcagactg tcaaaagcaa 540 atggatagag tgctgggaca aagagtgcaa caagctagtg tagacgagaa aatgcaa 597 <210> 33 <211> 597 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 33 gcagtagact cagtaatgtt ccagcaactg caaacagtag caatgcagca tggcctcgtg 60 tccgaggatt ttgaaaggca gttggcatat tatgctacta cctggacgag taaagacata 120 ctagaagtat tggccatgat gcctggaaac agagctcaaa aggagttaat tcaagggaaa 180 ttaaatgaag aggcagaaag gtggagaaga cataatccac cccctccggc gggaggagga 240 ttaacagtgg atcaaattat gggggtagga caaacaaatc aagcagcagc acaagctaac 300 atggatcagg caagacaaat atgcctgcaa tgggtaataa cagcattaag agcagtgagg 360 tatatgactc acaaaccagg gaatccaatg ctagtaaaac aaaaaacaaa tgaagcatat 420 gaagagttta cagcgagact gctagaagca atagatgcag agccagtaac acagcccaca 480 aaagaatatc taaaactaac attatcttat acaaatgcat cctcagactg tcaaaagcaa 540 atggatagag tactaggaca aagagtgcaa caagctagtg tagaagaaaa aatgcaa 597 <210> 34 <211> 597 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 34 gcagtcgatg ctgtaatgtt ccagcaaatg caaacagtag ccatgcagca tggtcttgtg 60 tctgaggact ttgaaaggca gttagcatat tatgctacta cctggacaag taaagatata 120 ttagaagtat tggccatgat gcctggaaat agagctcaaa aagagttaat tcaaggaaaa 180 ttaaatgagg aagcagaaag gtggagaagg aataatccac cgcctccaca gggaggggga 240 ttaacagtgg atcaaattat ggggatagga caaacaaatc aagcagcagc acaagctaac 300 atggatcagg caagacacat atgcctgcaa tgggtaataa cagcattaag agcagtaaga 360 catatggctc acagaccagg gaatccaatg ctcgtaaaac aaaaaacaaa tgagccatat 420 gaagagtttg cagcaaaact attagaagca atagatgcag aaccagtaac acagctcata 480 aaagactatc taaagttaac attatcttat acaaatgcgt cctcagactg tcaaaagcaa 540 atggatagag tgctgggaca aagagtgcaa caagctagtg tagacgagaa gatgcaa 597 <210> 35 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 35 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 36 <211> 597 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 36 gcagtcgatg ctgtaatgtt ccagcaaatg caaacagtag ccatgcagca tggtcttgtg 60 tctgaggact ttgaaaggca gttagcatat tgtgctacta cctggacaag taaagatata 120 ttagaagtat tggccatgat gcctggaaat agagctcaaa aagagttaat tcaaggaaaa 180 ttaaacgagg aagcagaaag gtggagaagg aataatccac cgcctccaca aggaggggga 240 ttaacagtgg atcaaattat ggggatagga caaacaaatc aagcagcagc acaagctaac 300 atggatcagg caagacacat atgcctgcaa tgggtaataa cagcattaag agcagtaaga 360 catatggctc acagaccagg gaatccaatg ctcgtaaaac aaaaaacaaa tgagccatat 420 gaagagtttg cagcaaaact attagaagca atagatgcag aaccagtaac acagcccata 480 aaagactatc taaagttaac attatcttat acaaatgcgt cctcagactg tcaaaagcaa 540 atggatagag tgctgggaca aagagtgcaa caagctagtg tagacgagaa aatgcaa 597 <210> 37 <211> 597 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 37 gcagtagact cagtaatgtt ccagcaactg caaacagtag caatgcagca tggcctcgtg 60 tccgaggatt ttgaaaggca gttggcatat tatgctacta cctggacgag taaagacata 120 ctagaagtat tggccatgat gcctggaaac agagctcaaa aggagttaat tcaagggaaa 180 ttaaatgaag aggcagaaag gtggagaaga cataatccac cccctccggc gggaggagga 240 ttaacagtgg atcaaattat gggggtagga caaacaaatc aagcagcagc acaagctaac 300 atggatcagg caagacaaat atgcctgcaa tgggtaataa cagcattaag agcagtgagg 360 tatatgactc acaaaccagg gaatccaatg ctagtaaaac aaaaaacaaa tgaagcatat 420 gaagagttta cagcgagact gctagaagca atagatgcag agccagtaac acagcccaca 480 aaagaatatc taaaactaac attatcttat acaaatgcat cctcagactg tcaaaagcaa 540 atggatagag tactaggaca aagagtgcaa caagctagtg tagaagaaaa aatgcaa 597 <210> 38 <211> 597 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 38 gcagtcgatg ctgtaatgtt ccagcaaatg caaacagtag ccatgcagca tggtcttgtg 60 tctgaggact ttgaaaggca gttagcatat tatgctacta cctggacaag taaagatata 120 ttagaagtat tggccatgat gcctggaaat agagctcaaa aagagttaat tcaaggaaaa 180 ttaaatgagg aagcagaaag gtggagaagg aataatccac cgcctccaca gggaggggga 240 ttaacagtgg atcaaattat ggggatagga caaacaaatc aagcagcagc acaagctaac 300 atggatcagg caagacacat atgcctgcaa tgggtaataa cagcattaag agcagtaaga 360 catatggctc acagaccagg gaatccaatg ctcgtaaaac aaaaaacaaa tgagccatat 420 gaagagtttg cagcaaaact attagaagca atagatgcag aaccagtaac acagctcata 480 aaagactatc taaagttaac attatcttat acaaatgcgt cctcagactg tcaaaagcaa 540 atggatagag tgctgggaca aagagtgcaa caagctagtg tagacgagaa gatgcaa 597 <210> 39 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 39 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 40 <211> 524 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 40 taaagatata ttagaagtat tggccatgat gcctggaaat agagctcaaa aagagttaat 60 tcaagggaaa ttgaatgaag aagcagaaag gtggagaagg aataatccac cacctcaagc 120 aggcggagga ttaacagtgg atcaaattat gggggtagga caaacaaatc aagcagcggc 180 acaggctaac atggatcagg caagacaaat atgcctgcaa tgggtaataa cagcactaag 240 agcagtgaga catatggctc acaaaccagg gaatccgatg ctagtaaagc aaaaaacaaa 300 tgagtcatat gaagattttg ccgcaagact gctagaagca atagatgcag aaccagttac 360 aaagcaaata aaagaatatt taaagttaac attatcttac acaaatgcat cctcagactg 420 taagaaacag atggatagag tactaggaca gagagtgcaa caagctagtg tggaagaaaa 480 aatgcaagca tgcagagatg tgggatcaga aggattcaga atgc 524 <210> 41 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 41 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 42 <211> 524 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 42 taaagatata ttagaagtat tggccatgat gcctggaaat agagctcaaa aagagttaat 60 tcaagggaaa ttgaatgaag aagcagaaag gtggagaagg aataatccac cacctcaagc 120 aggcggagga ttaacagtgg atcaaattat gggggtagga caaacaaatc aagcagcggc 180 acaggctaac atggatcagg caagacaaat atgcctgcaa tgggtaataa cagcactaag 240 agcagtgaga catatggctc acaaaccagg gaatccgatg ctagtaaagc aaaaaacaaa 300 tgagtcatat gaagattttg ccgcaagact gctagaagca atagatgcag aaccagttac 360 aaagcaaata aaagaatatt taaagttaac attatcttac acaaatgcat cctcagactg 420 taagaaacag atggatagag tactaggaca gagagtgcaa caagctagtg tggaagaaaa 480 aatgcaagca tgcagagatg tgggatcaga aggattcaga atgc 524 <210> 43 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 43 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 44 <211> 593 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 44 tgccgtagac tctgtgatgt tccaccagct gcatacagta gcaatgccgc atggcctcgt 60 gtctgaggac tttgaaaggc agttggcata ttatgctact acctggacaa gtaaagatat 120 actggaagta ttggccatga tgcctgggaa tagagctcaa aaagaattaa ttcaaggaaa 180 attaaatgaa gaagcagaaa ggtggagaag gaataatcca ccacctcaag caggcggagg 240 attaacagtg gatcaaatta tgggggtagg acaaacaaat caagcagctg cacaagctaa 300 catggatcag gcaagacaaa tatgcctgca atgggtaata tcagccttaa gagcagtgag 360 acatatgtct cataaaccag ggaatccgct gctagtaaag caaaaaacaa atgagtcata 420 tgaagatttt gcagctagac tgctagaagc aatagatcca gccccagtag cacatcctat 480 aaaagattat ttaaagttaa cactatctta tacgaatgca tcatcagatt gtcaaaagca 540 aatgggtaga atgctaggat cgagagtcca tcaagccagt gtgggccaaa aaa 593 <210> 45 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 45 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 46 <211> 593 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 46 tgccgtagac tctgtgatgt tccaccagct gcatacagta gcaatgccgc atggcctcgt 60 gtctgaggac tttgaaaggc agttggcata ttatgctact acctggacaa gtaaagatat 120 actggaagta ttggccatga tgcctgggaa tagagctcaa aaagaattaa ttcaaggaaa 180 attaaatgaa gaagcagaaa ggtggagaag gaataatcca ccacctcaag caggcggagg 240 attaacagtg gatcaaatta tgggggtagg acaaacaaat caagcagctg cacaagctaa 300 catggatcag gcaagacaaa tatgcctgca atgggtaata tcagccttaa gagcagtgag 360 acatatgtct cataaaccag ggaatccgct gctagtaaag caaaaaacaa atgagtcata 420 tgaagatttt gcagctagac tgctagaagc aatagatcca gccccagtag cacatcctat 480 aaaagattat ttaaagttaa cactatctta tacgaatgca tcatcagatt gtcaaaagca 540 aatgggtaga atgctaggat cgagagtcca tcaagccagt gtgggccaaa aaa 593 <210> 47 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 47 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 48 <211> 593 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 48 agcagtagat tctgtaatgt tccagcaact gcaaacagta gcaatgcagc atggactcgt 60 gtatgaagac tttgaaaggc tgtcggcata ttatgctact acctggacaa gtaaagatat 120 actggaagta ttggccatga tgcctgggaa tagagctcaa aaagaattaa ttcaaggaaa 180 attaaatgaa gaagcagaaa ggtggagaag gaataatcca ccacctcaag caggcggagg 240 attaacagtg gatcaaatta tgggggtagg acaaacaaat caagcagctg cacaagctaa 300 catggatcag gcaagacaaa tatgcctgca atgggtaata tcagccttaa gagcagtgag 360 acatatgtct cataaaccag ggaatccgct gctagtaaag caaaaaacaa atgagtcata 420 tgaagatttt gcagcaagac tgctagaagc aatagatgca gagccagtag cacatcctat 480 aaaagaatac ttaaagttaa cactatctta tacgaatgca tcatcagatt gtcaaaagca 540 aatggataga atgctggaat caagagtaca acaagctagt gtagaacaaa aaa 593 <210> 49 <211> 593 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 49 agccgtagat tctgtaatgt tccagcagct gcaaacagta gcaatgcagc atggcctcgt 60 gtcagaggac tttgaaaggc ttccagcata tcatgctact acctgggcaa gtaaagatat 120 cttagaagta ctggccatga tgcctggaaa tagagctcaa aaagagttaa ttcaagggaa 180 attaaatgaa gaagcagaga ggtggagaag gaataatcca ccacctccag caggaggagg 240 gttaacagtg gatcaaatta tgggagtagg acaaacaaat caggcagcgg cacaagcaaa 300 catggatcag gcaagacaaa tatgcctaca atgggtgata tcagcactaa gagcagtaag 360 gcatatggct cacaagccag ggaatccaat gttagtaaag caaaaagcaa atgagccata 420 tgaagaattt gcagcaaggc tgctggaagc aatagatgcc gagccagtta atcagcccat 480 aaaagaatat ctaaaactaa cgttgtctta tacgaatgca tcctcagatt gtcagaagca 540 aatggataga acactaggac aaagagtcaa acaagctagt gtagaacaaa aaa 593 <210> 50 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 50 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 51 <211> 593 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 51 agcagtagat tctgtaatgt tccagcaact gcaaacagta gcaatgcagc atggactcgt 60 gtatgaagac tttgaaaggc tgtcggcata ttatgctact acctggacaa gtaaagatat 120 actggaagta ttggccatga tgcctgggaa tagagctcaa aaagaattaa ttcaaggaaa 180 attaaatgaa gaagcagaaa ggtggagaag gaataatcca ccacctcaag caggcggagg 240 attaacagtg gatcaaatta tgggggtagg acaaacaaat caagcagctg cacaagctaa 300 catggatcag gcaagacaaa tatgcctgca atgggtaata tcagccttaa gagcagtgag 360 acatatgtct cataaaccag ggaatccgct gctagtaaag caaaaaacaa atgagtcata 420 tgaagatttt gcagcaagac tgctagaagc aatagatgca gagccagtag cacatcctat 480 aaaagaatat ctaaaactaa cgttgtctta tacgaatgca tcctcagatt gtcagaagca 540 aatggataga acactaggac aaagagtcaa acaagctagt gtagaacaaa aaa 593 <210> 52 <211> 593 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 52 agccgtagat tctgtaatgt tccagcagct gcaaacagta gcaatgcagc atggcctcgt 60 gtcagaggac tttgaaaggc ttccagcata tcatgctact acctgggcaa gtaaagatat 120 cttagaagta ctggccatga tgcctggaaa tagagctcaa aaagagttaa ttcaagggaa 180 attaaatgaa gaagcagaga ggtggagaag gaataatcca ccacctccag caggaggagg 240 gttaacagtg gatcaaatta tgggagtagg acaaacaaat caggcagcgg cacaagcaaa 300 catggatcag gcaagacaaa tatgcctaca atgggtgata tcagcactaa gagcagtaag 360 gcatatggct cacaagccag ggaatccaat gttagtaaag caaaaagcaa atgagccata 420 tgaagaattt gcagcaaggc tgctggaagc aatagatgcc gagccagtta atcagcccat 480 aaaagaatat ctaaaactaa cgttgtctta tacgaatgca tcctcagatt gtcagaagca 540 aatggataga acactaggac aaagagtcaa acaagctagt gtagaacaaa aaa 593 <210> 53 <211> 720 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 53 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt attacatgtt tgaggaccat aaagaggaac 180 cttggacaaa aaaacattag agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 <210> 54 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 54 cagcatggcc tcgtgtccga ggactttgaa aggcagttgg catattatgc tactacctgg 60 acaagtaagg acatattaga agtattggcc atgatgccag gaaatagagc tcaaaaggag 120 ctaattcaa 129 <210> 55 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 55 cagcatggaa tagtatcaga agagtttgag aggcaactgt cttattatgc taccacttgg 60 acaagcaagg atatcttaga ggtactagcc atgatgcctg gcaatagagc attaaaagag 120 ctaatacaa 129 <210> 56 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 56 caacatggga tagtatcaga ggaatttgag agacaaatgt cttattatgc taccacatgg 60 acaagtaagg atattttaga agtactagca atgatgcccg ggaacagagc attaaaggag 120 ctgatacaa 129 <210> 57 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 57 cagcatggac tagtatcaga agaatttgaa aggcagctag catactatgc cacaacgtgg 60 acaagcaaag acatactaga ggtgttagcc atgatgccag ggaatagagc acaaaaagaa 120 ctaatacaa 129 <210> 58 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 58 cagcatggac ttgtgtccga agattttgag aggcaattgg catattatgc tacaacctgg 60 actagtgaag atatattaga agtattggct atgatgcctg ggaatagagc acagaaagaa 120 ttaatacaa 129 <210> 59 <211> 1347 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 59 atggtgagtc tagatagaga catggcgagg caagtctccg gggggaaaag agattatcct 60 gagctcgaaa aatgtatcaa gcatgcatgc aagataaaag ttcgactcag aggggagcac 120 ttgacagaag gaaattgttt atggtgcctt aaaacattag attacatgtt tgaggaccat 180 aaagaggaac cttggacaaa agtaaaattt aggacaatat ggcagaaggt gaagaatcta 240 actcctgagg agagtaacaa aaaagacttt atgtctttgc aggccacatt agcgggtcta 300 atgtgttgcc aaatggggat gagacctgag acattgcaag atgcaatggc tacagtaatc 360 atgaaagatg ggttactgga acaagaggaa aagaaggaag acaaaagaga aaaggaagag 420 agtgtcttcc caatagtagt gcaagcagca ggagggagaa gctggaaagc agtagattct 480 gtaatgttcc agcaactgca aacagtagca atgcagcatg gcctcgtgtc tgaggacttt 540 gaaaggcagt tggcatatta tgctactacc tggacaagta aagacatact agaagtattg 600 gccatgatgc ctggaaatag agctcaaaag gagttaattc aagggaaatt aaatgaagaa 660 gcagaaaggt ggagaaggaa taatccacca cctccagcag gaggaggatt aacagtggat 720 caaattatgg gggtaggaca aacaaatcaa gcagcagcac aagctaacat ggatcaggca 780 aggcaaatat gcctgcaatg ggtaataaat gcattaagag cagtaagaca tatggcgcac 840 aggccaggga atccaatgct agtaaagcaa aaaacgaatg agccatatga agattttgca 900 gcaagactgc tagaagcaat agatgcagag ccagttacac agcctataaa agattatcta 960 aagctaacac tatcttatac aaatgcatca gcagattgtc agaagcaaat ggatagaaca 1020 ctaggacaaa gagtacaaca agctagtgta gaagaaaaaa tgcaagcatg tagagatgtg 1080 ggatcagaag ggttcaaaat gcaattgtta gcacaagcat taaggccagg aaaaggaaaa 1140 gggaatggac agccacaaag gtgttacaac tgtggaaaac cgggacatca agcaaggcaa 1200 tgtagacaag gaatcatatg tcacaactgt ggaaagagag gacatatgca aaaagaatgc 1260 agaggaaaga gagacataag gggaaaacag cagggaaacg ggaggagggg gatacgtgtg 1320 gtgccgtccg ctcctcctat ggaataa 1347 <210> 60 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 60 cagcatggcc tcgtgtccga ggactttgaa aggcagttgg catattatgc tactacctgg 60 acaagtaagg acatattaga agtattggcc atgatgccag gaaatagagc tcaaaaggag 120 ctaattcaa 129 <210> 61 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 61 cagcatggaa tagtatcaga agagtttgag aggcaactgt cttattatgc taccacttgg 60 acaagcaagg atatcttaga ggtactagcc atgatgcctg gcaatagagc attaaaagag 120 ctaatacaa 129 <210> 62 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 62 caacatggga tagtatcaga ggaatttgag agacaaatgt cttattatgc taccacatgg 60 acaagtaagg atattttaga agtactagca atgatgcccg ggaacagagc attaaaggag 120 ctgatacaa 129 <210> 63 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 63 cagcatggac tagtatcaga agaatttgaa aggcagctag catactatgc cacaacgtgg 60 acaagcaaag acatactaga ggtgttagcc atgatgccag ggaatagagc acaaaaagaa 120 ctaatacaa 129 <210> 64 <211> 129 <212> DNA <213> Caprine arthritis-encephalitis virus <400> 64 cagcatggac ttgtgtccga agattttgag aggcaattgg catattatgc tacaacctgg 60 actagtgaag atatattaga agtattggct atgatgcctg ggaatagagc acagaaagaa 120 ttaatacaa 129 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer used to construct dig-labeled probe <400> 65 ctggcgtaat agcgaagagg 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer used to construct dig-labeled probe <400> 66 aactcgccgc acatctgaac 20 <210> 67 <211> 3911 <212> DNA <213> Artificial <220> <223> pCAH / SINd0 <400> 67 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtgg actgtgagac 60 atgggctaaa gaggagcggc cgctcgagtc tagaactagt ggatcagctt tgctgcttgc 120 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 180 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 240 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagcc gacctcgagg 300 gggggcccta ttctatagtg tcacctaaat gctagagctc gctgatcagc ctcgactgtg 360 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 420 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 480 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 540 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 600 agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 660 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 720 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 780 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 840 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 900 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 960 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 1020 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 1080 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 1140 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 1200 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 1260 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 1320 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1380 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1440 aagtatatat gagtaacctg atcaggactc ttccttttca tgaacaataa aactgtctgc 1500 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 1560 taggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 1620 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 1680 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 1740 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 1800 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 1860 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 1920 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 1980 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 2040 tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat tctcaccgga 2100 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 2160 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 2220 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 2280 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 2340 ctaagaattc gcgcaattaa ccctcactaa agggaacaaa agctgggtac cgggcccgtt 2400 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 2460 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 2520 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 2580 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 2640 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 2700 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 2760 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 2820 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 2880 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 2940 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcaagct tgctgcttgc 3000 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 3060 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 3120 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagct ggcgcccaac 3180 gtggggcccg aggagaagaa aagaaagcgg ccctgagaac tcggcttctg aaaaagagga 3240 agaggacaag ttgctatagc aacaagagag aagaagtaga gcaaaggtcc agtggctcgg 3300 aaaaagagga actgaaactt cggggacgcc tgaaggagta aggtaagtga ctctgctgta 3360 cgcggggcga ggcagaggtt tccttctaaa ttgaaagaga agtgttgctg cgagaggtct 3420 tggtggtcga gaatcctgta caaaaaaaag gagggatctc ggtcaggacc aggacccctg 3480 ggagtaatac aacagcaaca ccgtaagaaa atccgcctag ggaattcgat tctagaggtg 3540 atagaaatgc cagaaaacta tgcaaaaaca agaatcataa acaggaaaaa aagagaactc 3600 agccacaaga ggaagaagag aggcgttggc ttggtcatta tgctagttat catggcaata 3660 gtagctgccg caggggcttc tctgggagtc gcaaacgcga ttcagcagtc ttacactaag 3720 gcagctgtcc agacccttgc taatgcaact gctgcacagc aggatgtgtt agaggcaacc 3780 tatgccatgg tacagcatgt ggctaaaggc gtacgaatct tggaagctcg agtggctcga 3840 gtggaagcta tcacagatag aataatgcta taccaagaat tggattgttg gcactaggat 3900 ccatcgccac c 3911 <210> 68 <211> 4238 <212> DNA <213> Artificial <220> <223> pCAH / SINd1 <400> 68 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtgg actgtgagac 60 atgggctaaa gaggagcggc cgctcgagtc tagaactagt ggatcagctt tgctgcttgc 120 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 180 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 240 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagcc gacctcgagg 300 gggggcccta ttctatagtg tcacctaaat gctagagctc gctgatcagc ctcgactgtg 360 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 420 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 480 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 540 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 600 agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 660 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 720 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 780 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 840 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 900 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 960 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 1020 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 1080 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 1140 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 1200 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 1260 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 1320 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1380 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1440 aagtatatat gagtaacctg atcaggactc ttccttttca tgaacaataa aactgtctgc 1500 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 1560 taggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 1620 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 1680 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 1740 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 1800 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 1860 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 1920 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 1980 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 2040 tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat tctcaccgga 2100 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 2160 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 2220 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 2280 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 2340 ctaagaattc gcgcaattaa ccctcactaa agggaacaaa agctgggtac cgggcccgtt 2400 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 2460 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 2520 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 2580 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 2640 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 2700 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 2760 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 2820 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 2880 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 2940 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcaagct tgctgcttgc 3000 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 3060 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 3120 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagct ggcgcccaac 3180 gtggggcccg aggagaagaa aagaaagcgg ccctgagaac tcggcttctg aaaaagagga 3240 agaggacaag ttgctatagc aacaagagag aagaagtaga gcaaaggtcc agtggctcgg 3300 aaaaagagga actgaaactt cggggacgcc tgaaggagta aggtaagtga ctctgctgta 3360 cgcggggcga ggcagaggtt tccttctaaa ttgaaagaga agtgttgctg cgagaggtct 3420 tggtggtcga gaatcctgta caaaaaaaag gagggatctc ggtcaggacc aggacccctg 3480 ggagtaatac aacagcaaca ccgtaagaaa atccgcctag gtgagtctag atagagacta 3540 ggcgaggcaa gtctccgggg ggaaaagaga ttatcctgag ctcgaaaaat gtatcaagca 3600 tgcatgcaag ataaaagttc gactcagagg ggagcacttg acagaaggaa attgtttatg 3660 gtgccttaaa acattagatt acatgtttga ggaccataaa gaggaacctt ggacaaaagt 3720 aaaatttagg acaatatggc agaaggtgaa gaatctaact cctgaggaga gtaacaaaaa 3780 agactttatg tctttgcagg ccacattagc gggtctaatg tgttgccaaa tggggatgag 3840 acctgcagga attcgattct agaggtgata gaaatgccag aaaactatgc aaaaacaaga 3900 atcataaaca ggaaaaaaag agaactcagc cacaagagga agaagagagg cgttggcttg 3960 gtcattatgc tagttatcat ggcaatagta gctgccgcag gggcttctct gggagtcgca 4020 aacgcgattc agcagtctta cactaaggca gctgtccaga cccttgctaa tgcaactgct 4080 gcacagcagg atgtgttaga ggcaacctat gccatggtac agcatgtggc taaaggcgta 4140 cgaatcttgg aagctcgagt ggctcgagtg gaagctatca cagatagaat aatgctatac 4200 caagaattgg attgttggca ctaggatcca tcgccacc 4238 <210> 69 <211> 4523 <212> DNA <213> Artificial <220> <223> pCAH / SINd2 <400> 69 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtgg actgtgagac 60 atgggctaaa gaggagcggc cgctcgagtc tagaactagt ggatcagctt tgctgcttgc 120 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 180 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 240 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagcc gacctcgagg 300 gggggcccta ttctatagtg tcacctaaat gctagagctc gctgatcagc ctcgactgtg 360 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 420 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 480 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 540 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 600 agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 660 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 720 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 780 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 840 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 900 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 960 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 1020 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 1080 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 1140 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 1200 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 1260 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 1320 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1380 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1440 aagtatatat gagtaacctg atcaggactc ttccttttca tgaacaataa aactgtctgc 1500 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 1560 taggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 1620 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 1680 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 1740 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 1800 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 1860 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 1920 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 1980 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 2040 tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat tctcaccgga 2100 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 2160 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 2220 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 2280 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 2340 ctaagaattc gcgcaattaa ccctcactaa agggaacaaa agctgggtac cgggcccgtt 2400 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 2460 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 2520 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 2580 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 2640 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 2700 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 2760 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 2820 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 2880 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 2940 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcaagct tgctgcttgc 3000 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 3060 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 3120 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagct ggcgcccaac 3180 gtggggcccg aggagaagaa aagaaagcgg ccctgagaac tcggcttctg aaaaagagga 3240 agaggacaag ttgctatagc aacaagagag aagaagtaga gcaaaggtcc agtggctcgg 3300 aaaaagagga actgaaactt cggggacgcc tgaaggagta aggtaagtga ctctgctgta 3360 cgcggggcga ggcagaggtt tccttctaaa ttgaaagaga agtgttgctg cgagaggtct 3420 tggtggtcga gaatcctgta caaaaaaaag gagggatctc ggtcaggacc aggacccctg 3480 ggagtaatac aacagcaaca ccgtaagaaa atccgcctag gtgagtctag atagagacta 3540 ggcgaggcaa gtctccgggg ggaaaagaga ttatcctgag ctcgaaaaat gtatcaagca 3600 tgcatgcaag ataaaagttc gactcagagg ggagcacttg acagaaggaa attgtttatg 3660 gtgccttaaa acattagatt acatgtttga ggaccataaa gaggaacctt ggacaaaagt 3720 aaaatttagg acaatatggc agaaggtgaa gaatctaact cctgaggaga gtaacaaaaa 3780 agactttatg tctttgcagg ccacattagc gggtctaatg tgttgccaaa tggggatgag 3840 acctgagaca ttgcaagatg caatggctac agtaatcatg aaagatgggt tactggaaca 3900 agaggaaaag aaggaagaca aaagagaaaa ggaagagagt gtcttcccaa tagtagtgca 3960 agcagcagga gggagaagct ggaaagcagt agattctgta atgttccagc aactgcaaac 4020 agtagcaatg cagcatggcc tcgtgtctga ggactttgaa aggcagttgg catattatgc 4080 tactacctgg acaagtaaag acatactaga agtattggcc atgatgcctg caggaattcg 4140 attctagagg tgatagaaat gccagaaaac tatgcaaaaa caagaatcat aaacaggaaa 4200 aaaagagaac tcagccacaa gaggaagaag agaggcgttg gcttggtcat tatgctagtt 4260 atcatggcaa tagtagctgc cgcaggggct tctctgggag tcgcaaacgc gattcagcag 4320 tcttacacta aggcagctgt ccagaccctt gctaatgcaa ctgctgcaca gcaggatgtg 4380 ttagaggcaa cctatgccat ggtacagcat gtggctaaag gcgtacgaat cttggaagct 4440 cgagtggctc gagtggaagc tatcacagat agaataatgc tataccaaga attggattgt 4500 tggcactagg atccatcgcc acc 4523 <210> 70 <211> 4819 <212> DNA <213> Artificial <220> <223> pCAH / SINd3 <400> 70 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtgg actgtgagac 60 atgggctaaa gaggagcggc cgctcgagtc tagaactagt ggatcagctt tgctgcttgc 120 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 180 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 240 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagcc gacctcgagg 300 gggggcccta ttctatagtg tcacctaaat gctagagctc gctgatcagc ctcgactgtg 360 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 420 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 480 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 540 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 600 agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 660 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 720 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 780 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 840 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 900 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 960 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 1020 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 1080 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 1140 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 1200 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 1260 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 1320 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1380 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1440 aagtatatat gagtaacctg atcaggactc ttccttttca tgaacaataa aactgtctgc 1500 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 1560 taggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 1620 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 1680 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 1740 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 1800 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 1860 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 1920 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 1980 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 2040 tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat tctcaccgga 2100 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 2160 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 2220 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 2280 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 2340 ctaagaattc gcgcaattaa ccctcactaa agggaacaaa agctgggtac cgggcccgtt 2400 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 2460 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 2520 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 2580 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 2640 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 2700 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 2760 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 2820 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 2880 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 2940 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcaagct tgctgcttgc 3000 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 3060 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 3120 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagct ggcgcccaac 3180 gtggggcccg aggagaagaa aagaaagcgg ccctgagaac tcggcttctg aaaaagagga 3240 agaggacaag ttgctatagc aacaagagag aagaagtaga gcaaaggtcc agtggctcgg 3300 aaaaagagga actgaaactt cggggacgcc tgaaggagta aggtaagtga ctctgctgta 3360 cgcggggcga ggcagaggtt tccttctaaa ttgaaagaga agtgttgctg cgagaggtct 3420 tggtggtcga gaatcctgta caaaaaaaag gagggatctc ggtcaggacc aggacccctg 3480 ggagtaatac aacagcaaca ccgtaagaaa atccgcctag gtgagtctag atagagacta 3540 ggcgaggcaa gtctccgggg ggaaaagaga ttatcctgag ctcgaaaaat gtatcaagca 3600 tgcatgcaag ataaaagttc gactcagagg ggagcacttg acagaaggaa attgtttatg 3660 gtgccttaaa acattagatt acatgtttga ggaccataaa gaggaacctt ggacaaaagt 3720 aaaatttagg acaatatggc agaaggtgaa gaatctaact cctgaggaga gtaacaaaaa 3780 agactttatg tctttgcagg ccacattagc gggtctaatg tgttgccaaa tggggatgag 3840 acctgagaca ttgcaagatg caatggctac agtaatcatg aaagatgggt tactggaaca 3900 agaggaaaag aaggaagaca aaagagaaaa ggaagagagt gtcttcccaa tagtagtgca 3960 agcagcagga gggagaagct ggaaagcagt agattctgta atgttccagc aactgcaaac 4020 agtagcaatg cagcatggcc tcgtgtctga ggactttgaa aggcagttgg catattatgc 4080 tactacctgg acaagtaaag acatactaga agtattggcc atgatgcctg gaaatagagc 4140 tcaaaaggag ttaattcaag ggaaattaaa tgaagaagca gaaaggtgga gaaggaataa 4200 tccaccacct ccagcaggag gaggattaac agtggatcaa attatggggg taggacaaac 4260 aaatcaagca gcagcacaag ctaacatgga tcaggcaagg caaatatgcc tgcaatgggt 4320 aataaatgca ttaagagcag taagacatat ggcgcacagg ccagggaatc caatgctagt 4380 aaagcaaaaa acgaatgagc catatgaaga ttttgcagca agactgcagg aattcgattc 4440 tagaggtgat agaaatgcca gaaaactatg caaaaacaag aatcataaac aggaaaaaaa 4500 gagaactcag ccacaagagg aagaagagag gcgttggctt ggtcattatg ctagttatca 4560 tggcaatagt agctgccgca ggggcttctc tgggagtcgc aaacgcgatt cagcagtctt 4620 acactaaggc agctgtccag acccttgcta atgcaactgc tgcacagcag gatgtgttag 4680 aggcaaccta tgccatggta cagcatgtgg ctaaaggcgt acgaatcttg gaagctcgag 4740 tggctcgagt ggaagctatc acagatagaa taatgctata ccaagaattg gattgttggc 4800 actaggatcc atcgccacc 4819 <210> 71 <211> 5112 <212> DNA <213> Artificial <220> <223> pCAH / SINd4 <400> 71 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtgg actgtgagac 60 atgggctaaa gaggagcggc cgctcgagtc tagaactagt ggatcagctt tgctgcttgc 120 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 180 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 240 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagcc gacctcgagg 300 gggggcccta ttctatagtg tcacctaaat gctagagctc gctgatcagc ctcgactgtg 360 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 420 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 480 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 540 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 600 agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 660 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 720 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 780 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 840 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 900 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 960 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 1020 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 1080 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 1140 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 1200 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 1260 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 1320 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1380 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1440 aagtatatat gagtaacctg atcaggactc ttccttttca tgaacaataa aactgtctgc 1500 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 1560 taggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 1620 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 1680 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 1740 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 1800 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 1860 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 1920 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 1980 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 2040 tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat tctcaccgga 2100 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 2160 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 2220 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 2280 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 2340 ctaagaattc gcgcaattaa ccctcactaa agggaacaaa agctgggtac cgggcccgtt 2400 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 2460 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 2520 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 2580 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 2640 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 2700 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 2760 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 2820 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 2880 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 2940 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcaagct tgctgcttgc 3000 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 3060 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 3120 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagct ggcgcccaac 3180 gtggggcccg aggagaagaa aagaaagcgg ccctgagaac tcggcttctg aaaaagagga 3240 agaggacaag ttgctatagc aacaagagag aagaagtaga gcaaaggtcc agtggctcgg 3300 aaaaagagga actgaaactt cggggacgcc tgaaggagta aggtaagtga ctctgctgta 3360 cgcggggcga ggcagaggtt tccttctaaa ttgaaagaga agtgttgctg cgagaggtct 3420 tggtggtcga gaatcctgta caaaaaaaag gagggatctc ggtcaggacc aggacccctg 3480 ggagtaatac aacagcaaca ccgtaagaaa atccgcctag gtgagtctag atagagacta 3540 ggcgaggcaa gtctccgggg ggaaaagaga ttatcctgag ctcgaaaaat gtatcaagca 3600 tgcatgcaag ataaaagttc gactcagagg ggagcacttg acagaaggaa attgtttatg 3660 gtgccttaaa acattagatt acatgtttga ggaccataaa gaggaacctt ggacaaaagt 3720 aaaatttagg acaatatggc agaaggtgaa gaatctaact cctgaggaga gtaacaaaaa 3780 agactttatg tctttgcagg ccacattagc gggtctaatg tgttgccaaa tggggatgag 3840 acctgagaca ttgcaagatg caatggctac agtaatcatg aaagatgggt tactggaaca 3900 agaggaaaag aaggaagaca aaagagaaaa ggaagagagt gtcttcccaa tagtagtgca 3960 agcagcagga gggagaagct ggaaagcagt agattctgta atgttccagc aactgcaaac 4020 agtagcaatg cagcatggcc tcgtgtctga ggactttgaa aggcagttgg catattatgc 4080 tactacctgg acaagtaaag acatactaga agtattggcc atgatgcctg gaaatagagc 4140 tcaaaaggag ttaattcaag ggaaattaaa tgaagaagca gaaaggtgga gaaggaataa 4200 tccaccacct ccagcaggag gaggattaac agtggatcaa attatggggg taggacaaac 4260 aaatcaagca gcagcacaag ctaacatgga tcaggcaagg caaatatgcc tgcaatgggt 4320 aataaatgca ttaagagcag taagacatat ggcgcacagg ccagggaatc caatgctagt 4380 aaagcaaaaa acgaatgagc catatgaaga ttttgcagca agactgctag aagcaataga 4440 tgcagagcca gttacacagc ctataaaaga ttatctaaag ctaacactat cttatacaaa 4500 tgcatcagca gattgtcaga agcaaatgga tagaacacta ggacaaagag tacaacaagc 4560 tagtgtagaa gaaaaaatgc aagcatgtag agatgtggga tcagaagggt tcaaaatgca 4620 attgttagca caagcattaa ggccaggaaa aggaaaaggg aatggacagc cacaaaggtg 4680 ttacaactgt ggaaaaccgg gacatcaagc aaggcactgc aggaattcga ttctagaggt 4740 gatagaaatg ccagaaaact atgcaaaaac aagaatcata aacaggaaaa aaagagaact 4800 cagccacaag aggaagaaga gaggcgttgg cttggtcatt atgctagtta tcatggcaat 4860 agtagctgcc gcaggggctt ctctgggagt cgcaaacgcg attcagcagt cttacactaa 4920 ggcagctgtc cagacccttg ctaatgcaac tgctgcacag caggatgtgt tagaggcaac 4980 ctatgccatg gtacagcatg tggctaaagg cgtacgaatc ttggaagctc gagtggctcg 5040 agtggaagct atcacagata gaataatgct ataccaagaa ttggattgtt ggcactagga 5100 tccatcgcca cc 5112 <210> 72 <211> 7579 <212> DNA <213> Artificial <220> <223> pMYKEF1 / env <220> <221> misc_feature (994). (994) N is a, c, g, or t <400> 72 aacaggaaag ttccattgga gccaagtaca ttgagtcaat agggactttc caatgggttt 60 tgcccagtac ataaggtcaa tgggaggtaa gccaatgggt ttttcccatt actggcacgt 120 atactgagtc attagggact ttccaatggg ttttgcccag tacataaggt caataggggt 180 gaatcaacag gaaagtccca ttggagccaa gtacactgag tcaataggga ctttccattg 240 ggttttgccc agtacaaaag gtcaataggg ggtgagtcaa tgggtttttc ccattattgg 300 cacgtacata aggtcaatag gggtgagtca ttgggttttt ccagccaatt taattaaaac 360 gccatgtact ttcccaccat tgacgtcaat gggctattga aactaatgca acgtgacctt 420 taaacggtac tttcccatag ctgattaatg ggaaagtacc gttctcgagc caatacacgt 480 caatgggaag tgaaagggca gccaaaacgt aacaccgccc cggttttccc tggaaattcc 540 atattggcac gcattctatt ggctgagctg cgttcacgtg ggtataagag gcgcgaccag 600 cgtcggtacc gtcgcagtct tcggtctgac caccgtagaa cgcagagctc ctcgctgcag 660 gcatgcaagc ttggtaagtg ccgtgtgtgg ttcccgcggg cctggcctct ttacgggtta 720 tggcccttgc gtgccttgaa ttacttccac gcccctggct gcagtacgtg attcttgatc 780 ccgagcttcg ggttggaagt gggtgggaga gttcaaggcc ttgcgcttaa ggagcccctt 840 cgccttttgc ttgagttgag gcctggcctg ggcgctgggg ccgccgcgtg caaatctggt 900 ggcaccttcg cgcctgtctc gctgctttcg ataagtctct agccatttaa aatttttgat 960 gacctgctgc gacgcttttt ttctggcaag atantcttgt aaatgcgggc caagatctgc 1020 acactggtat ttcggttttt ggggccgcgg gcggctacgg ggcccgtgcg tcccagcgca 1080 catgttcggc gaggaggggc ctgcgagcgc ggccaccgag aatcggacgg gggtagtctc 1140 aagctggccg gcctgctctg gtgcctggcc tcgcgccgcc gtgtatcgcc ccgccctggg 1200 cggcaaggct ggcccggtcg gcaccagttg cgtgagcgga aagatggccg cttcccggcc 1260 ctgctgcagg gagctcaaaa tggaggacgc ggcgctcggg agagcgggcg ggtgagtcac 1320 ccacacaaag gaaaagggcc tttccgtcct cagccgtcgc ttcatgtgac tccacggagt 1380 accgggcgcc gtccaggcac ctcgattagt tctcgagctt ttggagtacg tcgtctttag 1440 gttgggggga ggggttttat gcgatggagt ttccccacac tgagtgggtg gagactgaag 1500 ttaggccagc ttggcacttg atgtaattct ccttggaatt tgcccttttt gagtttggat 1560 cttggttcat tctcaagcct cagacagtgg ttcaaagttt ttttcttcca tttcagggat 1620 ccactagtaa cggccgccag tgtgctggaa ttcgatcata cctggtgttg ctgactaccc 1680 cgaccgcggt aaaagtcgat ggtattgctg cctgggtcca tgcttctcac ctcaaacctg 1740 caccaccttc ggcaccagat gagtcctggg agctggaaaa gactgatcat cctcttaagc 1800 tgcgtattcg gcggcggcgg gacgagtctg caaaataaga acccccacca gcccatgacc 1860 ctcacttggc aggtactgtc ccaaactgga gacgttgtct gggatacaaa ggcagtccag 1920 cccccttgga cttggtggcc cacacttaaa cctgatgtat gtgccttggc ggctagtctt 1980 gagtcctggg atatcccggg aaccgatgtc tcgtcctcta aacgagtcag acctccggac 2040 tcagactata ctgccgctta taagcaaatc acctggggag ccatagggtg cagctaccct 2100 cgggctagga ctagaatggc aagctctacc ttctacgtat gtccccggga tggccggacc 2160 ctttcagaag ctagaaggtg cggggggcta gaatccctat actgtaaaga atgggattgt 2220 gagaccacgg ggaccggtta ttggctatct aaatcctcaa aagacctcat aactgtaaaa 2280 tgggaccaaa atagcgaatg gactcaaaaa tttcaacagt gtcaccagac cggctggtgt 2340 aaccccctta aaatagattt cacagacaaa ggaaaattat ccaaggactg gataacggga 2400 aaaacctggg gattaagatt ctatgtgtct ggacatccag gcgtacagtt caccattcgc 2460 ttaaaaatca ccaacatgcc agctgtggca gtaggtcctg acctcgtcct tgtggaacaa 2520 ggacctccta gaacgtccct cgctctccca cctcctcttc ccccaaggga agcgccaccg 2580 ccatctctcc ccgactctaa ctccacagcc ctggcgacta gtgcacaaa tcccacggtg 2640 agaaaaacaa ttgttaccct aaacactccg cctcccacca caggcgacag actttttgat 2700 cttgtgcagg gggccttcct aaccttaaat gctaccaacc caggggccac tgagtcttgc 2760 tggctttgtt tggccatggg ccccccttat tatgaagcaa tagcctcatc aggagaggtc 2820 gcctactcca ccgaccttga ccggtgccgc tgggggaccc aaggaaagct caccctcact 2880 gaggtctcag gacacgggtt gtgcatagga aaggtgccct ttacccatca gcatctctgc 2940 aatcagaccc tatccatcaa ttcctccgga gaccatcagt atctgctccc ctccaaccat 3000 agctggtggg cttgcagcac tggcctcacc ccttgcctct ccacctcagt ttttaatcag 3060 actagagatt tctgtatcca ggtccagctg attcctcgca tctattacta tcctgaagaa 3120 gttttgttac aggcctatga caattctcac cccaggacta aaagagaggc tgtctcactt 3180 accctagctg ttttactggg gttgggaatc acggcgggaa taggtactgg ttcaactgcc 3240 ttaattaaag gacctataga cctccagcaa ggcctgacaa gcctccagat cgccatagat 3300 gctgacctcc gggccctcca agactcagtc agcaagttag aggactcact gacttccctg 3360 tccgaggtag tgctccaaaa taggagaggc cttgacttgc tgtttctaaa agaaggtggc 3420 ctctgtgcgg ccctaaagga agagtgctgt ttttacatag accactcagg tgcagtacgg 3480 gactccatga aaaaactcaa agaaaaactg gataaaagac agttagagcg ccagaaaagc 3540 caaaactggt atgaaggatg gttcaataac tccccttggt tcactaccct gctatcaacc 3600 atcgctgggc ccctattact cctccttctg ttgctcatcc tcgggccatg catcatcaat 3660 aagttagttc aattcatcaa tgataggata agtgcagtta aaattctggt ccttagacaa 3720 aaatatcagg ccctagagaa cgaaggtaac ctttaatttt gctctaagat tagagctatt 3780 cacaagagaa atggggatca ctagtgaatt ctgcagatat ccatcacact ggcggccgct 3840 cgagcatgca tctagagggc cctattctat agtgtcacct aaatgctaga gctcgctgat 3900 cagcctcgac tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt 3960 ccttgaccct ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat 4020 cgcattgtct gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg 4080 gggaggattg ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggcttctg 4140 aggcggaaag aaccagtggc ggtaatacgg ttatccacag aatcagggga taacgcagga 4200 aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 4260 gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 4320 aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 4380 gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 4440 ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 4500 cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 4560 ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 4620 actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 4680 tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 4740 gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 4800 ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 4860 cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 4920 ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 4980 tttaaatcaa tctaaagtat atatgagtaa cctgaggcta tggcagggcc tgccgccccg 5040 acgttggctg cgagccctgg gccttcaccc gaacttgggg ggtggggtgg ggaaaaggaa 5100 gaaacgcggg cgtattggcc ccaatggggt ctcggtgggg tatcgacaga gtgccagccc 5160 tgggaccgaa ccccgcgttt atgaacaaac gacccaacac cgtgcgtttt attctgtctt 5220 tttattgccg tcatagcgcg ggttccttcc ggtattgtct ccttccgtgt ttcagttagc 5280 ctccccctag ggtgggcgaa gaactccagc atgagatccc cgcgctggag gatcatccag 5340 ccggcgtccc ggaaaacgat tccgaagccc aacctttcat agaaggcggc ggtggaatcg 5400 aaatctcgtg atggcaggtt gggcgtcgct tggtcggtca tttcgaaccc cagagtcccg 5460 ctcagaagaa ctcgtcaaga aggcgataga aggcgatgcg ctgcgaatcg ggagcggcga 5520 taccgtaaag cacgaggaag cggtcagccc attcgccgcc aagctcttca gcaatatcac 5580 gggtagccaa cgctatgtcc tgatagcggt ccgccacacc cagccggcca cagtcgatga 5640 atccagaaaa gcggccattt tccaccatga tattcggcaa gcaggcatcg ccatgggtca 5700 cgacgagatc ctcgccgtcg ggcatgctcg ccttgagcct ggcgaacagt tcggctggcg 5760 cgagcccctg atgctcttga tcatcctgat cgacaagacc ggcttccatc cgagtacgtg 5820 ctcgctcgat gcgatgtttc gcttggtggt cgaatgggca ggtagccgga tcaagcgtat 5880 gcagccgccg cattgcatca gccatgatgg atactttctc ggcaggagca aggtgagatg 5940 acaggagatc ctgccccggc acttcgccca atagcagcca gtcccttccc gcttcagtga 6000 caacgtcgag cacagctgcg caaggaacgc ccgtcgtggc cagccacgat agccgcgctg 6060 cctcgtcttg cagttcattc agggcaccgg acaggtcggt cttgacaaaa agaaccgggc 6120 gcccctgcgc tgacagccgg aacacggcgg catcagagca gccgattgtc tgttgtgccc 6180 agtcatagcc gaatagcctc tccacccaag cggccggaga acctgcgtgc aatccatctt 6240 gttcaatcat gcgaaacgat cctcatcctg tctcttgatc gatctttgca aaagcctagg 6300 cctccaaaaa agcctcctca ctacttctgg aatagctcag aggccgaggc ggcctcggcc 6360 tctgcataaa taaaaaaaat tagtcagcca tggggcggag aatgggcgga actgggcgga 6420 gttaggggcg ggatgggcgg agttaggggc gggactatgg ttgctgacta attgagatgc 6480 atgctttgca tacttctgcc tgctggggag cctggggact ttccacacct ggttgctgac 6540 taattgagat gcatgctttg catacttctg cctgctgggg agcctgggga ctttccacac 6600 cctaactgac acacattcca cagctggttc tttccgcctc aggactcttc ctttttcaat 6660 aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt 6720 gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc 6780 gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg 6840 cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc 6900 gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg 6960 gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca 7020 ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga 7080 tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct 7140 ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg 7200 cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca 7260 accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata 7320 cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct 7380 tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact 7440 cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa 7500 acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc 7560 atactcttcc tttttcaat 7579 <210> 73 <211> 3566 <212> DNA <213> Artificial <220> <223> pCAH / SINd <400> 73 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtgg actgtgagac 60 atgggctaaa gaggagcggc cgctcgagtc tagaactagt ggatcagctt tgctgcttgc 120 acttcagagt tctaggagag tccctcctag tctctcctct ccgaggaggt accgagacct 180 caaaataaag gagtgattgc cttactgccg agtggagagt gattactgag cggccggtgt 240 atcgggagtc gtcccttaat ctgtgcaata ccagagcggc tctcgcagcc gacctcgagg 300 gggggcccta ttctatagtg tcacctaaat gctagagctc gctgatcagc ctcgactgtg 360 ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 420 ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 480 aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 540 gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 600 agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 660 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 720 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 780 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 840 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 900 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 960 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 1020 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 1080 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 1140 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 1200 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 1260 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 1320 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 1380 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 1440 aagtatatat gagtaacctg atcaggactc ttccttttca tgaacaataa aactgtctgc 1500 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 1560 taggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 1620 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 1680 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 1740 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 1800 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 1860 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 1920 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 1980 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 2040 tggctggcct gttgaacaag tctggaaaga aatgcataaa cttttgccat tctcaccgga 2100 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 2160 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 2220 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 2280 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 2340 ctaagaattc gcgcaattaa ccctcactaa agggaacaaa agctgggtac cgggcccgtt 2400 gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta gttcatagcc 2460 catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca 2520 acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga 2580 ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 2640 aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 2700 ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 2760 tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc 2820 ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt 2880 ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa 2940 tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcaagct ttgctgcttg 3000 cacttcagag ttctaggaga gtccctccta gtctctcctc tccgaggagg taccgagacc 3060 tcaaaataaa ggagtgattg ccttactgcc gagtggagag tgattactga gcggccggtg 3120 tatcgggagt cgtcccttaa tctgtgcaat accagagcgg ctctcgcagc tggcgggaat 3180 tcgattctag aggtgataga aatgccagaa aactatgcaa aaacaagaat cataaacagg 3240 aaaaaaagag aactcagcca caagaggaag aagagaggcg ttggcttggt cattatgcta 3300 gttatcatgg caatagtagc tgccgcaggg gcttctctgg gagtcgcaaa cgcgattcag 3360 cagtcttaca ctaaggcagc tgtccagacc cttgctaatg caactgctgc acagcaggat 3420 gtgttagagg caacctatgc catggtacag catgtggcta aaggcgtacg aatcttggaa 3480 gctcgagtgg ctcgagtgga agctatcaca gatagaataa tgctatacca agaattggat 3540 tgttggcact aggatccatc gccacc 3566 <210> 74 <211> 7623 <212> DNA <213> Artificial <220> <223> pHGVSV-G <400> 74 gcgcgcgttg acattgatta ttgactagtt attaatagta atcaattacg gggtcattag 60 ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 120 gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc 180 caatagggac tttccattga cgtcaatggg tggactattt acggtaaact gcccacttgg 240 cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 300 ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 360 tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 420 gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 480 gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 540 tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctctggc 600 taactagaga acccactgct tactggctta tcgaaattaa tacgactcac tatagggaga 660 cccaagcttg gtaccgagct cggatccact agtaacggcc gccagtgtgc tggaattcga 720 tgatcctgag aacttcaggg tgagtctatg ggacccttga tgttttcttt ccccttcttt 780 tctatggtta agttcatgtc ataggaaggg gagaagtaac agggtacagt ttagaatggg 840 aaacagacga atgattgcat cagtgtggaa gtctcaggat cgttttagtt tcttttattt 900 gctgttcata acaattgttt tcttttgttt aattcttgct ttcttttttt ttcttctccg 960 caatttttac tattatactt aatgccttaa cattgtgtat aacaaaagga aatatctctg 1020 agatacatta agtaacttaa aaaaaaactt tacacagtct gcctagtaca ttactatttg 1080 gaatatatgt gtgcttattt gcatattcat aatctcccta ctttattttc ttttattttt 1140 aattgataca taatcattat acatatttat gggttaaagt gtaatgtttt aatatgtgta 1200 cacatattga ccaaatcagg gtaattttgc atttgtaatt ttaaaaaatg ctttcttctt 1260 ttaatatact tttttgttta tcttatttct aatactttcc ctaatctctt tctttcaggg 1320 caataatgat acaatgtatc atgcctcttt gcaccattct aaagaataac agtgataatt 1380 tctgggttaa ggcaatagca atatttctgc atataaatat ttctgcatat aaattgtaac 1440 tgatgtaaga ggtttcatat tgctaatagc agctacaatc cagctaccat taggcccttt 1500 tgctaatcat gttcatacct cttatcttcc tcccacagct cctgggcaac gtgctggtct 1560 gtgtgctggc ccatcacttt ggcaaagaat cactagtgaa ttctgcagat atccatcaca 1620 ctggcggccg ctcgaggaat tctgacacta tgaagtgcct tttgtactta gcctttttat 1680 tcattggggt gaattgcaag ttcaccatag tttttccaca caaccaaaaa ggaaactgga 1740 aaaatgttcc ttctaattac cattattgcc cgtcaagctc agatttaaat tggcataatg 1800 acttaatagg cacagcctta caagtcaaaa tgcccaagag tcacaaggct attcaagcag 1860 acggttggat gtgtcatgct tccaaatggg tcactacttg tgatttccgc tggtatggac 1920 cgaagtatat aacacattcc atccgatcct tcactccatc tgtagaacaa tgcaaggaaa 1980 gcattgaaca aacgaaacaa ggaacttggc tgaatccagg cttccctcct caaagttgtg 2040 gatatgcaac tgtgacggat gccgaagcag tgattgtcca ggtgactcct caccatgtgc 2100 tggttgatga atacacagga gaatgggttg attcacagtt catcaacgga aaatgcagca 2160 attacatatg ccccactgtc cataactcta caacctggca ttctgactat aaggtcaaag 2220 ggctatgtga ttctaacctc atttccatgg acatcacctt cttctcagag gacggagagc 2280 tatcatccct gggaaaggag ggcacagggt tcagaagtaa ctactttgct tatgaaactg 2340 gaggcaaggc ctgcaaaatg caatactgca agcattgggg agtcagactc ccatcaggtg 2400 tctggttcga gatggctgat aaggatctct ttgctgcagc cagattccct gaatgcccag 2460 aagggtcaag tatctctgct ccatctcaga cctcagtgga tgtaagtcta attcaggacg 2520 ttgagaggat cttggattat tccctctgcc aagaaacctg gagcaaaatc agagcgggtc 2580 ttccaatctc tccagtggat ctcagctatc ttgctcctaa aaacccagga accggtcctg 2640 ctttcaccat aatcaatggt accctaaaat actttgagac cagatacatc agagtcgata 2700 ttgctgctcc aatcctctca agaatggtcg gaatgatcag tggaactacc acagaaaggg 2760 aactgtggga tgactgggca ccatatgaag acgtggaaat tggacccaat ggagttctga 2820 ggaccagttc aggatataag tttcctttat acatgattgg acatggtatg ttggactccg 2880 atcttcatct tagctcaaag gctcaggtgt tcgaacatcc tcacattcaa gacgctgctt 2940 cgcaacttcc tgatgatgag agtttatttt ttggtgatac tgggctatcc aaaaatccaa 3000 tcgagcttgt agaaggttgg ttcagtagtt ggaaaagctc tattgcctct tttttcttta 3060 tcatagggtt aatcattgga ctattcttgg ttctccgagt tggtatccat ctttgcatta 3120 aattaaagca caccaagaaa agacagattt atacagacat agagatgaac cgacttggaa 3180 agtaactcaa atcctgcaca acagattctt catgtttgga ccaaatcaac ttgtgatacc 3240 atgctcaaag aggcctcaat tatatttgag tttttaattt ttatgaaaaa aaaaaaaaaa 3300 aacggaattc ctcgagcatg catctagagg gccctattct atagtgtcac ctaaatgcta 3360 gagctcgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt gtttgcccct 3420 cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg 3480 aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt ggggtggggc 3540 aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct 3600 ctatggcttc tgaggcggaa agaaccagtg gcggtaatac ggttatccac agaatcaggg 3660 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 3720 gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 3780 cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 3840 ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 3900 tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 3960 gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 4020 tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 4080 ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 4140 ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg tatctgcgct 4200 ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 4260 accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 4320 tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 4380 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 4440 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aacctgaggc tatggcaggg 4500 cctgccgccc cgacgttggc tgcgagccct gggccttcac ccgaacttgg ggggtggggt 4560 ggggaaaagg aagaaacgcg ggcgtattgg ccccaatggg gtctcggtgg ggtatcgaca 4620 gagtgccagc cctgggaccg aaccccgcgt ttatgaacaa acgacccaac accgtgcgtt 4680 ttattctgtc tttttattgc cgtcatagcg cgggttcctt ccggtattgt ctccttccgt 4740 gtttcagtta gcctccccct agggtgggcg aagaactcca gcatgagatc cccgcgctgg 4800 aggatcatcc agccggcgtc ccggaaaacg attccgaagc ccaacctttc atagaaggcg 4860 gcggtggaat cgaaatctcg tgatggcagg ttgggcgtcg cttggtcggt catttcgaac 4920 cccagagtcc cgctcagaag aactcgtcaa gaaggcgata gaaggcgatg cgctgcgaat 4980 cgggagcggc gataccgtaa agcacgagga agcggtcagc ccattcgccg ccaagctctt 5040 cagcaatatc acgggtagcc aacgctatgt cctgatagcg gtccgccaca cccagccggc 5100 cacagtcgat gaatccagaa aagcggccat tttccaccat gatattcggc aagcaggcat 5160 cgccatgggt cacgacgaga tcctcgccgt cgggcatgct cgccttgagc ctggcgaaca 5220 gttcggctgg cgcgagcccc tgatgctctt gatcatcctg atcgacaaga ccggcttcca 5280 tccgagtacg tgctcgctcg atgcgatgtt tcgcttggtg gtcgaatggg caggtagccg 5340 gatcaagcgt atgcagccgc cgcattgcat cagccatgat ggatactttc tcggcaggag 5400 caaggtgaga tgacaggaga tcctgccccg gcacttcgcc caatagcagc cagtcccttc 5460 ccgcttcagt gacaacgtcg agcacagctg cgcaaggaac gcccgtcgtg gccagccacg 5520 atagccgcgc tgcctcgtct tgcagttcat tcagggcacc ggacaggtcg gtcttgacaa 5580 aaagaaccgg gcgcccctgc gctgacagcc ggaacacggc ggcatcagag cagccgattg 5640 tctgttgtgc ccagtcatag ccgaatagcc tctccaccca agcggccgga gaacctgcgt 5700 gcaatccatc ttgttcaatc atgcgaaacg atcctcatcc tgtctcttga tcgatctttg 5760 caaaagccta ggcctccaaa aaagcctcct cactacttct ggaatagctc agaggccgag 5820 gcggcctcgg cctctgcata aataaaaaaa attagtcagc catggggcgg agaatgggcg 5880 gaactgggcg gagttagggg cgggatgggc ggagttaggg gcgggactat ggttgctgac 5940 taattgagat gcatgctttg catacttctg cctgctgggg agcctgggga ctttccacac 6000 ctggttgctg actaattgag atgcatgctt tgcatacttc tgcctgctgg ggagcctggg 6060 gactttccac accctaactg acacacattc cacagctggt tctttccgcc tcaggactct 6120 tcctttttca ataaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa 6180 tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc 6240 tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct 6300 gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca 6360 gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt 6420 aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt 6480 gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 6540 ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc 6600 tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt 6660 atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact 6720 ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 6780 ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt 6840 ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg 6900 atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct 6960 gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 7020 tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt 7080 ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 7140 acatttcccc gaaaagtgcc acctgacgcg ccctgtagcg gcgcattaag cgcggcgggt 7200 gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc 7260 gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg 7320 gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat 7380 tagggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg 7440 ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct 7500 atctcggtct attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa 7560 aatgagctga tttaacaaaa atttaacgcg aattttaaca aaatattaac gcttacaatt 7620 tac 7623 <210> 75 <211> 5419 <212> DNA <213> Artificial <220> <223> pHYK / rev <400> 75 gcgcgcgttg acattgatta ttgactagtt attaatagta atcaattacg gggtcattag 60 ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 120 gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc 180 caatagggac tttccattga cgtcaatggg tggactattt acggtaaact gcccacttgg 240 cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 300 ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 360 tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 420 gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 480 gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 540 tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctctggc 600 taactagaga acccactgct tactggctta tcgaaattaa tacgactcac tatagggaga 660 cccaagctta gatggatgct ggggccagat acatgcgctt aactgggaag gaaaactggg 720 ttgaagtaac catggacgga gagaaggaaa ggaaaagaga aggtttcact gcgggacagc 780 aagatataca gaactctaag taccccgaca taccaacggg tcacagtcat catggaaaca 840 agagcagacg tcgcaggaga aaatcaggat tttggcgatg gcttagagga atcagacaac 900 agcgaaacaa gcgaaagagt gacagtacag aaagcttgga gccgtgcctg ggagctttgg 960 cagaactcac cctggaagga gccatggaaa aggggcctgc tgaggctgct cgtccttccg 1020 ctgacgatgg gaatctggat aaatggatgg cttggagaac accacaaaaa taagaattct 1080 gcagatatcc atcacactgg cggccgctcg agcatgcatc tagagggccc tattctatag 1140 tgtcacctaa atgctagagc tcgctgatca gcctcgactg tgccttctag ttgccagcca 1200 tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc 1260 ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg 1320 gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct 1380 ggggatgcgg tgggctctat ggcttctgag gcggaaagaa ccagtggcgg taatacggtt 1440 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 1500 caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga 1560 gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1620 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1680 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 1740 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1800 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1860 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1920 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt 1980 atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 2040 atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 2100 gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 2160 gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 2220 ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaacc 2280 tgaggctatg gcagggcctg ccgccccgac gttggctgcg agccctgggc cttcacccga 2340 acttgggggg tggggtgggg aaaaggaaga aacgcgggcg tattggcccc aatggggtct 2400 cggtggggta tcgacagagt gccagccctg ggaccgaacc ccgcgtttat gaacaaacga 2460 cccaacaccg tgcgttttat tctgtctttt tattgccgtc atagcgcggg ttccttccgg 2520 tattgtctcc ttccgtgttt cagttagcct ccccctaggg tgggcgaaga actccagcat 2580 gagatccccg cgctggagga tcatccagcc ggcgtcccgg aaaacgattc cgaagcccaa 2640 cctttcatag aaggcggcgg tggaatcgaa atctcgtgat ggcaggttgg gcgtcgcttg 2700 gtcggtcatt tcgaacccca gagtcccgct cagaagaact cgtcaagaag gcgatagaag 2760 gcgatgcgct gcgaatcggg agcggcgata ccgtaaagca cgaggaagcg gtcagcccat 2820 tcgccgccaa gctcttcagc aatatcacgg gtagccaacg ctatgtcctg atagcggtcc 2880 gccacaccca gccggccaca gtcgatgaat ccagaaaagc ggccattttc caccatgata 2940 ttcggcaagc aggcatcgcc atgggtcacg acgagatcct cgccgtcggg catgctcgcc 3000 ttgagcctgg cgaacagttc ggctggcgcg agcccctgat gctcttgatc atcctgatcg 3060 acaagaccgg cttccatccg agtacgtgct cgctcgatgc gatgtttcgc ttggtggtcg 3120 aatgggcagg tagccggatc aagcgtatgc agccgccgca ttgcatcagc catgatggat 3180 actttctcgg caggagcaag gtgagatgac aggagatcct gccccggcac ttcgcccaat 3240 agcagccagt cccttcccgc ttcagtgaca acgtcgagca cagctgcgca aggaacgccc 3300 gtcgtggcca gccacgatag ccgcgctgcc tcgtcttgca gttcattcag ggcaccggac 3360 aggtcggtct tgacaaaaag aaccgggcgc ccctgcgctg acagccggaa cacggcggca 3420 tcagagcagc cgattgtctg ttgtgcccag tcatagccga atagcctctc cacccaagcg 3480 gccggagaac ctgcgtgcaa tccatcttgt tcaatcatgc gaaacgatcc tcatcctgtc 3540 tcttgatcga tctttgcaaa agcctaggcc tccaaaaaag cctcctcact acttctggaa 3600 tagctcagag gccgaggcgg cctcggcctc tgcataaata aaaaaaatta gtcagccatg 3660 gggcggagaa tgggcggaac tgggcggagt taggggcggg atgggcggag ttaggggcgg 3720 gactatggtt gctgactaat tgagatgcat gctttgcata cttctgcctg ctggggagcc 3780 tggggacttt ccacacctgg ttgctgacta attgagatgc atgctttgca tacttctgcc 3840 tgctggggag cctggggact ttccacaccc taactgacac acattccaca gctggttctt 3900 tccgcctcag gactcttcct ttttcaataa atcaatctaa agtatatatg agtaaacttg 3960 gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 4020 ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 4080 atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 4140 agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 4200 ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 4260 tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 4320 ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 4380 caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 4440 gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 4500 atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 4560 accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 4620 aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 4680 gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 4740 tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 4800 aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 4860 ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 4920 aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgcgccct gtagcggcgc 4980 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 5040 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 5100 tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 5160 ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 5220 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 5280 aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 5340 ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 5400 attaacgctt acaatttac 5419 <210> 76 <211> 5729 <212> DNA <213> Artificial <220> PH223 / vif <400> 76 gcgcgcgttg acattgatta ttgactagtt attaatagta atcaattacg gggtcattag 60 ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 120 gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc 180 caatagggac tttccattga cgtcaatggg tggactattt acggtaaact gcccacttgg 240 cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 300 ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 360 tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 420 gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 480 gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 540 tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctctggc 600 taactagaga acccactgct tactggctta tcgaaattaa tacgactcac tatagggaga 660 cccaagcttg gtaccgagct cggatccgcg atgcaaaatt catcccgcca ccaacaaaag 720 aaaaggaata aaaaacctgg accagaatta cccttagcac tatggatcca tatagcagaa 780 agcattaatg gggatagctc atggtacata acaatgagac tgcaacagat gatgtgggga 840 aaaagaggaa ataagttaca atataagaat gaagacaggg aatatgaaaa ttgggaaatt 900 acatcatggg gatggaaaat gcacctaagg agagtgaaac aatggataca agacaacagg 960 agaggaagcc catggcagta caaagtagga ggaacatgga aaagtatagg agtgtggttc 1020 ctgcaagcag gagattacag aaaggtagac aggcacttct ggtgggcatg gaggatactg 1080 atatgttcct gcaggaaaga aaagtttgat ataagagaat ttatgagagg aagacataga 1140 tgggatttgt gcaaatcctg tgctcaagga gaagtagtaa agcatactag aacaaaaagt 1200 ctggaaagac tagtactgct acagatggta gaacagcatg tgtttcaagt attgccattg 1260 tggagagcca ggagaagtag tacaacagat ttcccatggt gcagggacac aacgggatac 1320 acgcatgcgt ggtctgtcca ggagtgctgg ttgatggaat atctcttaga ggatgagtga 1380 ccggaattct gcagatatcc atcacactgg cggccgctcg agcatgcatc tagagggccc 1440 tattctatag tgtcacctaa atgctagagc tcgctgatca gcctcgactg tgccttctag 1500 ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac 1560 tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgtca 1620 ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag 1680 caggcatgct ggggatgcgg tgggctctat ggcttctgag gcggaaagaa ccagtggcgg 1740 taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 1800 agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 1860 cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 1920 tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 1980 tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 2040 gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 2100 acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 2160 acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 2220 cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 2280 gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 2340 gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 2400 agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 2460 ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 2520 ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 2580 atgagtaacc tgaggctatg gcagggcctg ccgccccgac gttggctgcg agccctgggc 2640 cttcacccga acttgggggg tggggtgggg aaaaggaaga aacgcgggcg tattggcccc 2700 aatggggtct cggtggggta tcgacagagt gccagccctg ggaccgaacc ccgcgtttat 2760 gaacaaacga cccaacaccg tgcgttttat tctgtctttt tattgccgtc atagcgcggg 2820 ttccttccgg tattgtctcc ttccgtgttt cagttagcct ccccctaggg tgggcgaaga 2880 actccagcat gagatccccg cgctggagga tcatccagcc ggcgtcccgg aaaacgattc 2940 cgaagcccaa cctttcatag aaggcggcgg tggaatcgaa atctcgtgat ggcaggttgg 3000 gcgtcgcttg gtcggtcatt tcgaacccca gagtcccgct cagaagaact cgtcaagaag 3060 gcgatagaag gcgatgcgct gcgaatcggg agcggcgata ccgtaaagca cgaggaagcg 3120 gtcagcccat tcgccgccaa gctcttcagc aatatcacgg gtagccaacg ctatgtcctg 3180 atagcggtcc gccacaccca gccggccaca gtcgatgaat ccagaaaagc ggccattttc 3240 caccatgata ttcggcaagc aggcatcgcc atgggtcacg acgagatcct cgccgtcggg 3300 catgctcgcc ttgagcctgg cgaacagttc ggctggcgcg agcccctgat gctcttgatc 3360 atcctgatcg acaagaccgg cttccatccg agtacgtgct cgctcgatgc gatgtttcgc 3420 ttggtggtcg aatgggcagg tagccggatc aagcgtatgc agccgccgca ttgcatcagc 3480 catgatggat actttctcgg caggagcaag gtgagatgac aggagatcct gccccggcac 3540 ttcgcccaat agcagccagt cccttcccgc ttcagtgaca acgtcgagca cagctgcgca 3600 aggaacgccc gtcgtggcca gccacgatag ccgcgctgcc tcgtcttgca gttcattcag 3660 ggcaccggac aggtcggtct tgacaaaaag aaccgggcgc ccctgcgctg acagccggaa 3720 cacggcggca tcagagcagc cgattgtctg ttgtgcccag tcatagccga atagcctctc 3780 cacccaagcg gccggagaac ctgcgtgcaa tccatcttgt tcaatcatgc gaaacgatcc 3840 tcatcctgtc tcttgatcga tctttgcaaa agcctaggcc tccaaaaaag cctcctcact 3900 acttctggaa tagctcagag gccgaggcgg cctcggcctc tgcataaata aaaaaaatta 3960 gtcagccatg gggcggagaa tgggcggaac tgggcggagt taggggcggg atgggcggag 4020 ttaggggcgg gactatggtt gctgactaat tgagatgcat gctttgcata cttctgcctg 4080 ctggggagcc tggggacttt ccacacctgg ttgctgacta attgagatgc atgctttgca 4140 tacttctgcc tgctggggag cctggggact ttccacaccc taactgacac acattccaca 4200 gctggttctt tccgcctcag gactcttcct ttttcaataa atcaatctaa agtatatatg 4260 agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct 4320 gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg 4380 agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc 4440 cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa 4500 ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc 4560 cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt 4620 cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc 4680 ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt 4740 tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc 4800 catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt 4860 gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata 4920 gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga 4980 tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag 5040 catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 5100 aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt 5160 attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga 5220 aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgcgccct 5280 gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg 5340 ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg 5400 gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac 5460 ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct 5520 gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 5580 tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta taagggattt 5640 tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 5700 ttaacaaaat attaacgctt acaatttac 5729 <210> 77 <211> 9446 <212> DNA <213> Artificial <220> <223> pMGP / RRE <400> 77 aacaggaaag ttccattgga gccaagtaca ttgagtcaat agggactttc caatgggttt 60 tgcccagtac ataaggtcaa tgggaggtaa gccaatgggt ttttcccatt actggcacgt 120 atactgagtc attagggact ttccaatggg ttttgcccag tacataaggt caataggggt 180 gaatcaacag gaaagtccca ttggagccaa gtacactgag tcaataggga ctttccattg 240 ggttttgccc agtacaaaag gtcaataggg ggtgagtcaa tgggtttttc ccattattgg 300 cacgtacata aggtcaatag gggtgagtca ttgggttttt ccagccaatt taattaaaac 360 gccatgtact ttcccaccat tgacgtcaat gggctattga aactaatgca acgtgacctt 420 taaacggtac tttcccatag ctgattaatg ggaaagtacc gttctcgagc caatacacgt 480 caatgggaag tgaaagggca gccaaaacgt aacaccgccc cggttttccc tggaaattcc 540 atattggcac gcattctatt ggctgagctg cgttcacgtg ggtataagag gcgcgaccag 600 cgtcggtacc gtcgcagtct tcggtctgac caccgtagaa cgcagagctc ctcgctgcag 660 gcaagcttgg taccgagctc ggatcccggg gaggtaccaa aatccgccat ggtgagtcta 720 gatagagaca tggcgaggca agtctccggg gggaaaagag attatcctga gctcgaaaaa 780 tgtatcaagc atgcatgcaa gataaaagtt cgactcagag gggagcactt gacagaagga 840 aattgtttat ggtgccttaa aacattagat tacatgtttg aggaccataa agaggaacct 900 tggacaaaag taaaatttag gacaatatgg cagaaggtga agaatctaac tcctgaggag 960 agtaacaaaa aagactttat gtctttgcag gccacattag cgggtctaat gtgttgccaa 1020 atggggatga gacctgagac attgcaagat gcaatggcta cagtaatcat gaaagatggg 1080 ttactggaac aagaggaaaa gaaggaagac aaaagagaaa aggaagagag tgtcttccca 1140 atagtagtgc aagcagcagg agggagaagc tggaaagcag tagattctgt aatgttccag 1200 caactgcaaa cagtagcaat gcagcatggc ctcgtgtctg aggactttga aaggcagttg 1260 gcatattatg ctactacctg gacaagtaaa gacatactag aagtattggc catgatgcct 1320 ggaaatagag ctcaaaagga gttaattcaa gggaaattaa atgaagaagc agaaaggtgg 1380 agaaggaata atccaccacc tccagcagga ggaggattaa cagtggatca aattatgggg 1440 gtaggacaaa caaatcaagc agcagcacaa gctaacatgg atcaggcaag gcaaatatgc 1500 ctgcaatggg taataaatgc attaagagca gtaagacata tggcgcacag gccagggaat 1560 ccaatgctag taaagcaaaa aacgaatgag ccatatgaag attttgcagc aagactgcta 1620 gaagcaatag atgcagagcc agttacacag cctataaaag attatctaaa gctaacacta 1680 tcttatacaa atgcatcagc agattgtcag aagcaaatgg atagaacact aggacaaaga 1740 gtacaacaag ctagtgtaga agaaaaaatg caagcatgta gagatgtggg atcagaaggg 1800 ttcaaaatgc aattgttagc acaagcatta aggccaggaa aaggaaaagg gaatggacag 1860 ccacaaaggt gttacaactg tggaaaaccg ggacatcaag caaggcaatg tagacaagga 1920 atcatatgtc acaactgtgg aaagagagga catatgcaaa aagaatgcag aggaaagaga 1980 gacataaggg gaaaacagca gggaaacggg aggaggggga tacgtgtggt gccgtccgct 2040 cctcctatgg aataacttca gcaccaccta tggttcaggt ccgcataggt tcccagcaga 2100 ggaacttgtt atttgatacc ggggcggacc gaactatagt tagatggcat gagggctcgg 2160 gaaacccagc cggaaggata aaactgcaag gaataggagg aatagtagaa ggagaaaaat 2220 ggaataatgt agaattagaa tataaaggag aaacaagaaa gggaacaata gtagtgttac 2280 cacaaagtcc agtagaagta ttaggacgag ataacatggc ccgatttgga ataaagataa 2340 taatggcaaa tttagaggaa aaaagaatcc caattacaaa agtaaaattg aaagagggat 2400 gtacgggtcc acatgtccca caatggccat taacagaaga gaaattaaaa ggtctaacag 2460 aaatcataga taaattagtg gaagaaggaa aactaggaaa ggcaccccca cattggacat 2520 gtaatactcc aatcttttgc ataaaaaaga aatcagggaa gtggagaatg ttaatagatt 2580 tcagagaatt gaacaaacag acagaagatt taacagaagc gcagttagga ctcccgcatc 2640 cgggaggact acaaaagaaa aaacatgtta caatattgga cataggagat gcatatttta 2700 ctatacccct atatgaacca tatcgagagt acacatgttt tactctatta agtcctaata 2760 atctaggacc atgtaaaaga tactattgga aagtgctgcc acaaggttgg aaattgagtc 2820 catctgtata tcaatttact atgcaggaga tcttagagga ttggatacag cagcatccag 2880 aaattcaatt tggcatatat atggatgata tttacatagg aagtgattta gaaattaaaa 2940 agcatagaga aatagtgaaa gatttagcca attatattgc ccaatatgga ttcactctgc 3000 cagaagagaa gagacaaaag ggatatccag caaaatggct aggatttgaa ctacacccgc 3060 agacctggaa atttcagaag catacattac ctgaattaac aaagggaaca ataacattaa 3120 ataaattaca gaaattagta ggagaattag tatggagaca atccataatt gggaaaagca 3180 ttcctaacat tctgaaatta atggaaggag atagagaatt acaaagtgaa agaaaaattg 3240 aagaagtaca tgtgaaagaa tgggaagcat gtaggaaaaa attagaagaa atggaaggaa 3300 attattataa taaagacaaa gatgtctatg gacaattggc ttggggagac aaagctatag 3360 aatatatagt gtatcaggag aaagggaaac cattatgggt aaatgtggtt cacaatataa 3420 agaacctaag catcccgcaa caggttatta aagcagcgca aaaattaacc caagaagtca 3480 tcattaggac aggaaaaata ccatggatat tgttgccagg gaaagaagaa gattggagac 3540 tagaattgca attagggaac atcacatgga tgccaaaatt ttggtcctgt tatcgaggac 3600 atacaagatg gagaaaaaga aatataatag aagaagtagt agaagggcct acatattata 3660 cagatggagg aaaaaagaat aaagtaggaa gtctagggtt catagtatca acaggggaaa 3720 aatttagaaa gcatgaagag ggcacaaacc agcaactaga attaagagcc atagaggaag 3780 ctctaaaaca agggcctcaa acaatgaatt tagtaacaga tagtagatat gcatttgaat 3840 ttttattaag aaattgggat gaagaagtaa taaagaatcc aattcaagca agaattatgg 3900 aaattgccca caagaaagat aggataggag tgcattgggt gccaggacat aaagggattc 3960 cccaaaatga agaaatagac aaatatattt cggaaatatt tcttgcaaaa gaaggagaag 4020 gaattctccc aaaaagagaa gaggatgcag ggtatgattt aatatgccca gaagaggtta 4080 ccatagagcc aggacaagtg aaatgcatcc ccatagagct aagattaaat ttaaagaaat 4140 cacaatgggc tatgattgct acaaaaagca gcatggctgc caaaggagtg ttcacacaag 4200 gaggaatcat agactcagga tatcagggac aaatacaggt aataatgtat aatagcaata 4260 aaatagcagt agtcataccc caagggagaa aatttgcaca attaatatta atggataaaa 4320 agcatgaaaa attggaaccc tggggggaaa gcagaaaaac agaaagggga gaaaaaggat 4380 ttgggtctac aggaatgtat tggatagaaa atattcctct ggcagaggaa gaccacacaa 4440 aatggcatca agatgcccga tcattgcatc tagaatttga aattccaaga acagcagcag 4500 aagacatagt aaatcaatgt gaaatatgca aagaaggcag gacacctgca gtaattagag 4560 gcggaaacaa aaggggggta gatcattggc aagtggatta tacccattat gaaaatatca 4620 tactattagt atgggtagaa acaaattcag gactaatata tgcagaaaaa gtaaaaggag 4680 aatcagggca agaattcaga ataaaagtga tgcaatggta tgcattattt ggtccagagt 4740 cattgcagtc agacaatgga cctgcatttg cagcagagcc cacacagctg ttaatgcaat 4800 acctaggagt aaaacacaca acaggcatac cttggaatcc acagtctcag gctatagtag 4860 aaagggcaca tcaactattg aaaagcactt taaagaagtt ccagccacaa tttgtcgctg 4920 tagaatcagc catagcagca gccctagtcg ccataaatat aaaaagaaag ggtgggctgg 4980 ggacaagccc tatggatatt tttatatata ataaagaaca gaaaagaata aataataaat 5040 ataataaaaa ttctcaaaaa attcaattct gttattacag aataaggaaa agaggacatc 5100 caggagagtg gaaaggacca acccaggtac tgtggaaagg ggaaggagca attgtggtaa 5160 aggatataga aagtgaaaag tatttagtaa taccttacaa agatgcaaaa ttcatcccgc 5220 caccaacaaa agaaaaggaa taaaaaacct ggaccagaat tacccttagc actatggatc 5280 cactagtaac ggccgccagt gtgctggaat tctgcagata tccatcacac tggcggccgg 5340 gctgcaggaa ttcgatagaa aagatatcaa aaacaagaat cataaacagg aaaaaaagag 5400 aactcagcca caagaggaag aagagaggcg ttggcttggt cattatgcta gttatcatgg 5460 caatagtagc tgccgcaggg gcttctctgg gagtcgcaaa cgcgattcag cagtcttaca 5520 ctaaggcagc tgtccagacc cttgctaatg caactgctgc acagcaggat gtgttagagg 5580 caacctatgc catggtacag catgtggcta aaggcgtacg aatcttggaa gctcgagtgg 5640 ctcgagtgga agctatcaca gatagaatag cggccgccca tcaagcttat cgataccgtc 5700 ggccgctcga gcatgcatct agagggccct attctatagt gtcacctaaa tgctagagct 5760 cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc 5820 gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa 5880 attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac 5940 agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg 6000 gcttctgagg cggaaagaac cagtggcggt aatacggtta tccacagaat caggggataa 6060 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc 6120 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc 6180 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag 6240 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct 6300 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta 6360 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc 6420 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc 6480 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt 6540 gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct 6600 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc 6660 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca 6720 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta 6780 agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa 6840 atgaagtttt aaatcaatct aaagtatata tgagtaacct gaggctatgg cagggcctgc 6900 cgccccgacg ttggctgcga gccctgggcc ttcacccgaa cttggggggt ggggtgggga 6960 aaaggaagaa acgcgggcgt attggcccca atggggtctc ggtggggtat cgacagagtg 7020 ccagccctgg gaccgaaccc cgcgtttatg aacaaacgac ccaacaccgt gcgttttatt 7080 ctgtcttttt attgccgtca tagcgcgggt tccttccggt attgtctcct tccgtgtttc 7140 agttagcctc cccctagggt gggcgaagaa ctccagcatg agatccccgc gctggaggat 7200 catccagccg gcgtcccgga aaacgattcc gaagcccaac ctttcataga aggcggcggt 7260 ggaatcgaaa tctcgtgatg gcaggttggg cgtcgcttgg tcggtcattt cgaaccccag 7320 agtcccgctc agaagaactc gtcaagaagg cgatagaagg cgatgcgctg cgaatcggga 7380 gcggcgatac cgtaaagcac gaggaagcgg tcagcccatt cgccgccaag ctcttcagca 7440 atatcacggg tagccaacgc tatgtcctga tagcggtccg ccacacccag ccggccacag 7500 tcgatgaatc cagaaaagcg gccattttcc accatgatat tcggcaagca ggcatcgcca 7560 tgggtcacga cgagatcctc gccgtcgggc atgctcgcct tgagcctggc gaacagttcg 7620 gctggcgcga gcccctgatg ctcttgatca tcctgatcga caagaccggc ttccatccga 7680 gtacgtgctc gctcgatgcg atgtttcgct tggtggtcga atgggcaggt agccggatca 7740 agcgtatgca gccgccgcat tgcatcagcc atgatggata ctttctcggc aggagcaagg 7800 tgagatgaca ggagatcctg ccccggcact tcgcccaata gcagccagtc ccttcccgct 7860 tcagtgacaa cgtcgagcac agctgcgcaa ggaacgcccg tcgtggccag ccacgatagc 7920 cgcgctgcct cgtcttgcag ttcattcagg gcaccggaca ggtcggtctt gacaaaaaga 7980 accgggcgcc cctgcgctga cagccggaac acggcggcat cagagcagcc gattgtctgt 8040 tgtgcccagt catagccgaa tagcctctcc acccaagcgg ccggagaacc tgcgtgcaat 8100 ccatcttgtt caatcatgcg aaacgatcct catcctgtct cttgatcgat ctttgcaaaa 8160 gcctaggcct ccaaaaaagc ctcctcacta cttctggaat agctcagagg ccgaggcggc 8220 ctcggcctct gcataaataa aaaaaattag tcagccatgg ggcggagaat gggcggaact 8280 gggcggagtt aggggcggga tgggcggagt taggggcggg actatggttg ctgactaatt 8340 gagatgcatg ctttgcatac ttctgcctgc tggggagcct ggggactttc cacacctggt 8400 tgctgactaa ttgagatgca tgctttgcat acttctgcct gctggggagc ctggggactt 8460 tccacaccct aactgacaca cattccacag ctggttcttt ccgcctcagg actcttcctt 8520 tttcaataaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt 8580 aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact 8640 ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 8700 gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg 8760 aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg 8820 ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat 8880 tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc 8940 ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt 9000 cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc 9060 agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga 9120 gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc 9180 gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 9240 acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta 9300 acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg 9360 agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg 9420 aatactcata ctcttccttt ttcaat 9446 <210> 78 <211> 7856 <212> DNA <213> Artificial <220> <223> pCAH / SINd60 / hlacZ <400> 78 gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180 ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atggtgatgc ggttttggca gtacatcaat gggcgtggat 420 agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt 480 tttggcacca aaatcaacgg gactttccaa aatgtcgtaa caactccgcc ccattgacgc 540 aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcaa gcttgctgct 600 tgcacttcag agttctagga gagtccctcc tagtctctcc tctccgagga ggtaccgaga 660 cctcaaaata aaggagtgat tgccttactg ccgagtggag agtgattact gagcggccgg 720 tgtatcggga gtcgtccctt aatctgtgca ataccagagc ggctctcgca gctggcgccc 780 aacgtggggc ccgaggagaa gaaaagaaag cggccctgag aactcggctt ctgaaaaaga 840 ggaagaggac aagttgctat agcaacaaga gagaagaagt agagcaaagg tccagtggct 900 cggaaaaaga ggaactgaaa cttcggggac gcctgaagga gtaaggtaag tgactctgct 960 gtacgcgggg cgaggcagag gtttccttct aaattgaaag agaagtgttg ctgcgagagg 1020 tcttggtggt cgagaatcct gtacaaaaaa aaggagggat ctcggtcagg accaggaccc 1080 ctgggagtaa tacaacagca acaccgtaag aaaatccgcc taggtgagtc tagatagaga 1140 ctaggcgagg caagtctccg gggggaaaag agattatcct gcaggaattc gattctagag 1200 gtgatagaaa tgccagaaaa ctatgcaaaa acaagaatca taaacaggaa aaaaagagaa 1260 ctcagccaca agaggaagaa gagaggcgtt ggcttggtca ttatgctagt tatcatggca 1320 atagtagctg ccgcaggggc ttctctggga gtcgcaaacg cgattcagca gtcttacact 1380 aaggcagctg tccagaccct tgctaatgca actgctgcac agcaggatgt gttagaggca 1440 acctatgcca tggtacagca tgtggctaaa ggcgtacgaa tcttggaagc tcgagtggct 1500 cgagtggaag ctatcacaga tagaataatg ctataccaag aattggattg ttggcactag 1560 gatccatcag ccaccattaa cgcttacaat ttacgcgcgc gttgacattg attattgact 1620 agttattaat agtaatcaat tacggggtca ttagttcata gcccatatat ggagttccgc 1680 gttacataac ttacggtaaa tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg 1740 acgtcaataa tgacgtatgt tcccatagta acgccaatag ggactttcca ttgacgtcaa 1800 tgggtggact atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca 1860 agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcatta tgcccagtac 1920 atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc 1980 atggtgatgc ggttttggca gtacatcaat gggcgtggat agcggtttga ctcacgggga 2040 tttccaagtc tccaccccat tgacgtcaat gggagtttgt tttggcacca aaatcaacgg 2100 gactttccaa aatgtcgtaa caactccgcc ccattgacgc aaatgggcgg taggcgtgta 2160 cggtgggagg tctatataag cagagctctc tggctaacta gagaacccac tgcttactgg 2220 cttatcgaaa ttaatacgac tcactatagg gagacccaag ctgcttacca tggggggttc 2280 tcatcatcat catcatcatg gtatggctag catgactggt ggacagcaaa tgggtcggga 2340 tctgtacgac gatgacgata aggtacctaa ggatcagctt ggagttgatc ccgtcgtttt 2400 acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc 2460 ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt 2520 gcgcagcctg aatggcgaat ggcgctttgc ctggtttccg gcaccagaag cggtgccgga 2580 aagctggctg gagtgcgatc ttcctgaggc cgatactgtc gtcgtcccct caaactggca 2640 gatgcacggt tacgatgcgc ccatctacac caacgtaacc tatcccatta cggtcaatcc 2700 gccgtttgtt cccacggaga atccgacggg ttgttactcg ctcacattta atgttgatga 2760 aagctggcta caggaaggcc agacgcgaat tatttttgat ggcgttaact cggcgtttca 2820 tctgtggtgc aacgggcgct gggtcggtta cggccaggac agtcgtttgc cgtctgaatt 2880 tgacctgagc gcatttttac gcgccggaga aaaccgcctc gcggtgatgg tgctgcgttg 2940 gagtgacggc agttatctgg aagatcagga tatgtggcgg atgagcggca ttttccgtga 3000 cgtctcgttg ctgcataaac cgactacaca aatcagcgat ttccatgttg ccactcgctt 3060 taatgatgat ttcagccgcg ctgtactgga ggctgaagtt cagatgtgcg gcgagttgcg 3120 tgactaccta cgggtaacag tttctttatg gcagggtgaa acgcaggtcg ccagcggcac 3180 cgcgcctttc ggcggtgaaa ttatcgatga gcgtggtggt tatgccgatc gcgtcacact 3240 acgtctgaac gtcgaaaacc cgaaactgtg gagcgccgaa atcccgaatc tctatcgtgc 3300 ggtggttgaa ctgcacaccg ccgacggcac gctgattgaa gcagaagcct gcgatgtcgg 3360 tttccgcgag gtgcggattg aaaatggtct gctgctgctg aacggcaagc cgttgctgat 3420 tcgaggcgtt aaccgtcacg agcatcatcc tctgcatggt caggtcatgg atgagcagac 3480 gatggtgcag gatatcctgc tgatgaagca gaacaacttt aacgccgtgc gctgttcgca 3540 ttatccgaac catccgctgt ggtacacgct gtgcgaccgc tacggcctgt atgtggtgga 3600 tgaagccaat attgaaaccc acggcatggt gccaatgaat cgtctgaccg atgatccgcg 3660 ctggctaccg gcgatgagcg aacgcgtaac gcgaatggtg cagcgcgatc gtaatcaccc 3720 gagtgtgatc atctggtcgc tggggaatga atcaggccac ggcgctaatc acgacgcgct 3780 gtatcgctgg atcaaatctg tcgatccttc ccgcccggtg cagtatgaag gcggcggagc 3840 cgacaccacg gccaccgata ttatttgccc gatgtacgcg cgcgtggatg aagaccagcc 3900 cttcccggct gtgccgaaat ggtccatcaa aaaatggctt tcgctacctg gagagacgcg 3960 cccgctgatc ctttgcgaat acgcccacgc gatgggtaac agtcttggcg gtttcgctaa 4020 atactggcag gcgtttcgtc agtatccccg tttacagggc ggcttcgtct gggactgggt 4080 ggatcagtcg ctgattaaat atgatgaaaa cggcaacccg tggtcggctt acggcggtga 4140 ttttggcgat acgccgaacg atcgccagtt ctgtatgaac ggtctggtct ttgccgaccg 4200 cacgccgcat ccagcgctga cggaagcaaa acaccagcag cagtttttcc agttccgttt 4260 atccgggcaa accatcgaag tgaccagcga atacctgttc cgtcatagcg ataacgagct 4320 cctgcactgg atggtggcgc tggatggtaa gccgctggca agcggtgaag tgcctctgga 4380 tgtcgctcca caaggtaaac agttgattga actgcctgaa ctaccgcagc cggagagcgc 4440 cgggcaactc tggctcacag tacgcgtagt gcaaccgaac gcgaccgcat ggtcagaagc 4500 cgggcacatc agcgcctggc agcagtggcg tctggcggaa aacctcagtg tgacgctccc 4560 cgccgcgtcc cacgccatcc cgcatctgac caccagcgaa atggattttt gcatcgagct 4620 gggtaataag cgttggcaat ttaaccgcca gtcaggcttt ctttcacaga tgtggattgg 4680 cgataaaaaa caactgctga cgccgctgcg cgatcagttc acccgtgcac cgctggataa 4740 cgacattggc gtaagtgaag cgacccgcat tgaccctaac gcctgggtcg aacgctggaa 4800 ggcggcgggc cattaccagg ccgaagcagc gttgttgcag tgcacggcag atacacttgc 4860 tgatgcggtg ctgattacga ccgctcacgc gtggcagcat caggggaaaa ccttatttat 4920 cagccggaaa acctaccgga ttgatggtag tggtcaaatg gcgattaccg ttgatgttga 4980 agtggcgagc gatacaccgc atccggcgcg gattggcctg aactgccagc tggcgcaggt 5040 agcagagcgg gtaaactggc tcggattagg gccgcaagaa aactatcccg accgccttac 5100 tgccgcctgt tttgaccgct gggatctgcc attgtcagac atgtataccc cgtacgtctt 5160 cccgagcgaa aacggtctgc gctgcgggac gcgcgaattg aattatggcc cacaccagtg 5220 gcgcggcgac ttccagttca acatcagccg ctacagtcaa cagcaactga tggaaaccag 5280 ccatcgccat ctgctgcacg cggaagaagg cacatggctg aatatcgacg gtttccatat 5340 ggggattggt ggcgacgact cctggagccc gtcagtatcg gcggaattac agctgagcgc 5400 cggtcgctac cattaccagt tggtctggtg tcaaaaataa taaagccgaa ttctgcagat 5460 atccagcaca gtggcggccg ctagcacaaa aataaaaaaa gaaagggtga ctgtgagaca 5520 tgggctaaag aggagcggcc gctcgagtct agaactagtg gatcagcttt gctgcttgca 5580 cttcagagtt ctaggagagt ccctcctagt ctctcctctc cgaggaggta ccgagacctc 5640 aaaataaagg agtgattgcc ttactgccga gtggagagtg attactgagc ggccggtgta 5700 tcgggagtcg tcccttaatc tgtgcaatac cagagcggct ctcgcagccg acctcgaggg 5760 ggggccctat tctatagtgt cacctaaatg ctagagctcg ctgatcagcc tcgactgtgc 5820 cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg accctggaag 5880 gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat tgtctgagta 5940 ggtgtcattc tattctgggg ggtggggtgg ggcaggacag caagggggag gattgggaag 6000 acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctgaggcg gaaagaacca 6060 gtggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 6120 aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 6180 ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 6240 acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 6300 ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 6360 tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 6420 tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 6480 gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 6540 agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 6600 tacactagaa ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 6660 agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 6720 tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 6780 acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 6840 tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 6900 agtatatatg agtaacctga tcaggactct tccttttcat gaacaataaa actgtctgct 6960 tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac gtcttgctct 7020 aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg ggctcgcgat 7080 aatgtcgggc aatcaggtgc gacaatctat cgattgtatg ggaagcccga tgcgccagag 7140 ttgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga gatggtcaga 7200 ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat ccgtactcct 7260 gatgatgcat ggttactcac cactgcgatc cccgggaaaa cagcattcca ggtattagaa 7320 gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct gcgccggttg 7380 cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg tctcgctcag 7440 gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga cgagcgtaat 7500 ggctggcctg ttgaacaagt ctggaaagaa atgcataaac ttttgccatt ctcaccggat 7560 tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga ggggaaatta 7620 ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga tcttgccatc 7680 ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt tcaaaaatat 7740 ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga tgagtttttc 7800 taagaattcg cgcaattaac cctcactaaa gggaacaaaa gctgggtacc gggccc 7856 <210> 79 <211> 8127 <212> DNA <213> Artificial <220> <223> pCAH / SINd1 / hlacZ <400> 79 gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180 ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 240 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360 tattagtcat cgctattacc atggtgatgc ggttttggca gtacatcaat gggcgtggat 420 agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt 480 tttggcacca aaatcaacgg gactttccaa aatgtcgtaa caactccgcc ccattgacgc 540 aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcaa gcttgctgct 600 tgcacttcag agttctagga gagtccctcc tagtctctcc tctccgagga ggtaccgaga 660 cctcaaaata aaggagtgat tgccttactg ccgagtggag agtgattact gagcggccgg 720 tgtatcggga gtcgtccctt aatctgtgca ataccagagc ggctctcgca gctggcgccc 780 aacgtggggc ccgaggagaa gaaaagaaag cggccctgag aactcggctt ctgaaaaaga 840 ggaagaggac aagttgctat agcaacaaga gagaagaagt agagcaaagg tccagtggct 900 cggaaaaaga ggaactgaaa cttcggggac gcctgaagga gtaaggtaag tgactctgct 960 gtacgcgggg cgaggcagag gtttccttct aaattgaaag agaagtgttg ctgcgagagg 1020 tcttggtggt cgagaatcct gtacaaaaaa aaggagggat ctcggtcagg accaggaccc 1080 ctgggagtaa tacaacagca acaccgtaag aaaatccgcc taggtgagtc tagatagaga 1140 ctaggcgagg caagtctccg gggggaaaag agattatcct gagctcgaaa aatgtatcaa 1200 gcatgcatgc aagataaaag ttcgactcag aggggagcac ttgacagaag gaaattgttt 1260 atggtgcctt aaaacattag attacatgtt tgaggaccat aaagaggaac cttggacaaa 1320 agtaaaattt aggacaatat ggcagaaggt gaagaatcta actcctgagg agagtaacaa 1380 aaaagacttt atgtctttgc aggccacatt agcgggtcta atgtgttgcc aaatggggat 1440 gagaccgggc tgcaggaatt cgattctaga ggtgatagaa atgccagaaa actatgcaaa 1500 aacaagaatc ataaacagga aaaaaagaga actcagccac aagaggaaga agagaggcgt 1560 tggcttggtc attatgctag ttatcatggc aatagtagct gccgcagggg cttctctggg 1620 agtcgcaaac gcgattcagc agtcttacac taaggcagct gtccagaccc ttgctaatgc 1680 aactgctgca cagcaggatg tgttagaggc aacctatgcc atggtacagc atgtggctaa 1740 aggcgtacga atcttggaag ctcgagtggc tcgagtggaa gctatcacag atagaataat 1800 gctataccaa gaattggatt gttggcacta ggatccatca gccaccatta acgcttacaa 1860 tttacgcgcg cgttgacatt gattattgac tagttattaa tagtaatcaa ttacggggtc 1920 attagttcat agcccatata tggagttccg cgttacataa cttacggtaa atggcccgcc 1980 tggctgaccg cccaacgacc cccgcccatt gacgtcaata atgacgtatg ttcccatagt 2040 aacgccaata gggactttcc attgacgtca atgggtggac tatttacggt aaactgccca 2100 cttggcagta catcaagtgt atcatatgcc aagtacgccc cctattgacg tcaatgacgg 2160 taaatggccc gcctggcatt atgcccagta catgacctta tgggactttc ctacttggca 2220 gtacatctac gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa 2280 tgggcgtgga tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa 2340 tgggagtttg ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc 2400 cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctct 2460 ctggctaact agagaaccca ctgcttactg gcttatcgaa attaatacga ctcactatag 2520 ggagacccaa gctttaagct taccatgggg ggttctcatc atcatcatca tcatggtatg 2580 gcatgactgg tggacagcaa atgggtcggg atctgtacga cgatgacgat aaggtaccta 2640 aggatcagct tggagttgat cccgtcgttt tacaacgtcg tgactgggaa aaccctggcg 2700 ttacccaact taatcgcctt gcagcacatc cccctttcgc cagctggcgt aatagcgaag 2760 aggcccgcac cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tggcgctttg 2820 cctggtttcc ggcaccagaa gcggtgccgg aaagctggct ggagtgcgat cttcctgagg 2880 ccgatactgt cgtcgtcccc tcaaactggc agatgcacgg ttacgatgcg cccatctaca 2940 ccaacgtaac ctatcccatt acggtcaatc cgccgtttgt tcccacggag aatccgacgg 3000 gttgttactc gctcacattt aatgttgatg aaagctggct acaggaaggc cagacgcgaa 3060 ttatttttga tggcgttaac tcggcgtttc atctgtggtg caacgggcgc tgggtcggtt 3120 acggccagga cagtcgtttg ccgtctgaat ttgacctgag cgcattttta cgcgccggag 3180 aaaaccgcct cgcggtgatg gtgctgcgtt ggagtgacgg cagttatctg gaagatcagg 3240 atatgtggcg gatgagcggc attttccgtg acgtctcgtt gctgcataaa ccgactacac 3300 aaatcagcga tttccatgtt gccactcgct ttaatgatga tttcagccgc gctgtactgg 3360 aggctgaagt tcagatgtgc ggcgagttgc gtgactacct acgggtaaca gtttctttat 3420 ggcagggtga aacgcaggtc gccagcggca ccgcgccttt cggcggtgaa attatcgatg 3480 agcgtggtgg ttatgccgat cgcgtcacac tacgtctgaa cgtcgaaaac ccgaaactgt 3540 ggagcgccga aatcccgaat ctctatcgtg cggtggttga actgcacacc gccgacggca 3600 cgctgattga agcagaagcc tgcgatgtcg gtttccgcga ggtgcggatt gaaaatggtc 3660 tgctgctgct gaacggcaag ccgttgctga ttcgaggcgt taaccgtcac gagcatcatc 3720 ctctgcatgg tcaggtcatg gatgagcaga cgatggtgca ggatatcctg ctgatgaagc 3780 agaacaactt taacgccgtg cgctgttcgc attatccgaa ccatccgctg tggtacacgc 3840 tgtgcgaccg ctacggcctg tatgtggtgg atgaagccaa tattgaaacc cacggcatgg 3900 tgccaatgaa tcgtctgacc gatgatccgc gctggctacc ggcgatgagc gaacgcgtaa 3960 cgcgaatggt gcagcgcgat cgtaatcacc cgagtgtgat catctggtcg ctggggaatg 4020 aatcaggcca cggcgctaat cacgacgcgc tgtatcgctg gatcaaatct gtcgatcctt 4080 cccgcccggt gcagtatgaa ggcggcggag ccgacaccac ggccaccgat attatttgcc 4140 cgatgtacgc gcgcgtggat gaagaccagc ccttcccggc tgtgccgaaa tggtccatca 4200 aaaaatggct ttcgctacct ggagagacgc gcccgctgat cctttgcgaa tacgcccacg 4260 cgatgggtaa cagtcttggc ggtttcgcta aatactggca ggcgtttcgt cagtatcccc 4320 gtttacaggg cggcttcgtc tgggactggg tggatcagtc gctgattaaa tatgatgaaa 4380 acggcaaccc gtggtcggct tacggcggtg attttggcga tacgccgaac gatcgccagt 4440 tctgtatgaa cggtctggtc tttgccgacc gcacgccgca tccagcgctg acggaagcaa 4500 aacaccagca gcagtttttc cagttccgtt tatccgggca aaccatcgaa gtgaccagcg 4560 aatacctgtt ccgtcatagc gataacgagc tcctgcactg gatggtggcg ctggatggta 4620 agccgctggc aagcggtgaa gtgcctctgg atgtcgctcc acaaggtaaa cagttgattg 4680 aactgcctga actaccgcag ccggagagcg ccgggcaact ctggctcaca gtacgcgtag 4740 tgcaaccgaa cgcgaccgca tggtcagaag ccgggcacat cagcgcctgg cagcagtggc 4800 gtctggcgga aaacctcagt gtgacgctcc ccgccgcgtc ccacgccatc ccgcatctga 4860 ccaccagcga aatggatttt tgcatcgagc tgggtaataa gcgttggcaa tttaaccgcc 4920 agtcaggctt tctttcacag atgtggattg gcgataaaaa acaactgctg acgccgctgc 4980 gcgatcagtt cacccgtgca ccgctggata acgacattgg cgtaagtgaa gcgacccgca 5040 ttgaccctaa cgcctgggtc gaacgctgga aggcggcggg ccattaccag gccgaagcag 5100 cgttgttgca gtgcacggca gatacacttg ctgatgcggt gctgattacg accgctcacg 5160 cgtggcagca tcaggggaaa accttattta tcagccggaa aacctaccgg attgatggta 5220 gtggtcaaat ggcgattacc gttgatgttg aagtggcgag cgatacaccg catccggcgc 5280 ggattggcct gaactgccag ctggcgcagg tagcagagcg ggtaaactgg ctcggattag 5340 ggccgcaaga aaactatccc gaccgcctta ctgccgcctg ttttgaccgc tgggatctgc 5400 cattgtcaga catgtatacc ccgtacgtct tcccgagcga aaacggtctg cgctgcggga 5460 cgcgcgaatt gaattatggc ccacaccagt ggcgcggcga cttccagttc aacatcagcc 5520 gctacagtca acagcaactg atggaaacca gccatcgcca tctgctgcac gcggaagaag 5580 gcacatggct gaatatcgac ggtttccata tggggattgg tggcgacgac tcctggagcc 5640 cgtcagtatc ggcggaatta cagctgagcg ccggtcgcta ccattaccag ttggtctggt 5700 gtcaaaaata ataaagccga attctgcaga tatccagcac agtggcggcc gctagcacaa 5760 aaataaaaaa agaaagggtg actgtgagac atgggctaaa gaggagcggc cgctcgagtc 5820 tagaactagt ggatcagctt tgctgcttgc acttcagagt tctaggagag tccctcctag 5880 tctctcctct ccgaggaggt accgagacct caaaataaag gagtgattgc cttactgccg 5940 agtggagagt gattactgag cggccggtgt atcgggagtc gtcccttaat ctgtgcaata 6000 ccagagcggc tctcgcagcc gacctcgagg gggggcccta ttctatagtg tcacctaaat 6060 gctagagctc gctgatcagc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc 6120 ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa 6180 aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg 6240 gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg ggatgcggtg 6300 ggctctatgg cttctgaggc ggaaagaacc agtggcggta atacggttat ccacagaatc 6360 aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa 6420 aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa 6480 tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc 6540 ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc 6600 cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag 6660 ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga 6720 ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc 6780 gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac 6840 agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg 6900 cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca 6960 aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa 7020 aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa 7080 ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt 7140 aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaacctg atcaggactc 7200 ttccttttca tgaacaataa aactgtctgc ttacataaac agtaatacaa ggggtgttat 7260 gagccatatt caacgggaaa cgtcttgctc taggccgcga ttaaattcca acatggatgc 7320 tgatttatat gggtataaat gggctcgcga taatgtcggg caatcaggtg cgacaatcta 7380 tcgattgtat gggaagcccg atgcgccaga gttgtttctg aaacatggca aaggtagcgt 7440 tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat ttatgcctct 7500 tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca ccactgcgat 7560 ccccgggaaa acagcattcc aggtattaga agaatatcct gattcaggtg aaaatattgt 7620 tgatgcgctg gcagtgttcc tgcgccggtt gcattcgatt cctgtttgta attgtccttt 7680 taacagcgat cgcgtatttc gtctcgctca ggcgcaatca cgaatgaata acggtttggt 7740 tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag tctggaaaga 7800 aatgcataaa cttttgccat tctcaccgga ttcagtcgtc actcatggtg atttctcact 7860 tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg gacgagtcgg 7920 aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg agttttctcc 7980 ttcattacag aaacggcttt ttcaaaaata tggtattgat aatcctgata tgaataaatt 8040 gcagtttcat ttgatgctcg atgagttttt ctaagaattc gcgcaattaa ccctcactaa 8100 agggaacaaa agctgggtac cgggccc 8127  

Claims (78)

a) the untranslated region between (iii) the CAEV 5 ′ LTR and the CAEV gag -coding sequence, and (ii) the 1 to X nucleotides of the CAEV gag -coding sequence linked to the 3 ′ end of the untranslated region, wherein X Is less than 613 caprine arthritis encephalitis virus (CAEV) packaging sequence consisting essentially of; And b) cis -acting elements required for polyadenylation, RNA transport, reverse transcription, and integration, operably associated with said packaging sequence. Comprising a transition vector. The method of claim 1, X is from the group consisting of 60, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575 and 600 The transition vector, characterized in that the selection. The method of claim 1, Wherein said X is selected from the group consisting of: (1) X is greater than 25 but less than 600, (2) X is greater than 25 and less than 500, (3) X is greater than 25 and less than 400, (4) X is greater than 25 and less than 300, (5) X is greater than 25 and less than 200, (6) X is greater than 50 and less than 600, (7) X is greater than 50 and less than 500, (8) X is greater than 50 and less than 400, (9) X is greater than 50 and less than 300, (10) X is greater than 50 and less than 200, (11) X is greater than 75 and less than 600, (12) X is greater than 75 and less than 500, (13) X is greater than 75 and less than 400, (14) X is greater than 75 and less than 300, (15) X is greater than 75 and less than 200, (16) X is greater than 100 and less than 600, (17) X is greater than 100 and less than 500, (18) X is greater than 100 and less than 400, (19) X is greater than 100 and less than 300, (20) X is greater than 100 and less than 200, (21) X is greater than 125 and less than 600, (22) X is greater than 125 and less than 500, (23) X is greater than 125 and less than 400, (24) X is greater than 125 and less than 300, (25) X is greater than 125 and less than 200, (26) X is greater than 150 and less than 600, (27) X is greater than 150 and less than 500, (28) X is greater than 150 and less than 400, (29) X is greater than 150 and less than 300, (30) X is greater than 150 and less than 200, (31) X is greater than 200 and less than 600, (32) X is greater than 200 and less than 500, (33) X is greater than 200 and less than 400, (34) X is greater than 200 and less than 300, (35) X is greater than 200 and less than 200, (36) X is greater than 250 and less than 600, (37) X is greater than 250 and less than 500, (38) X is greater than 250 and less than 400, and (39) X is greater than 250 and less than 300. The method of claim 1, Wherein said X is greater than 40 and less than 613. The method of claim 1, And wherein X is greater than 57 and less than 613. The method of claim 1, Wherein said X is about 327. The method of claim 1, Wherein said start codon of said gag -coding sequence is mutated to prevent translation of gag protein. The method of claim 7, wherein Transition vector characterized in that the start codon is mutated to TAG. The method of claim 7, wherein Wherein the ATG codon of the gag -coding sequence located downstream of the x base pair of the start codon is mutated to prevent translation of the gag protein, wherein x is less than 30. The method of claim 9, Wherein x is about 21. 17. The method of claim 1, A transition vector further comprising an RRE region. The method of claim 1, The transition vector further comprising a CAEV 3 ′ LTR from which the U3 region is deleted. The method of claim 1, A transition vector further comprising a heterologous promoter. The method of claim 13, Wherein said heterologous promoter is a human cytomegalovirus major early promoter (HCMV MIEP). The method of claim 1, Transition vector, characterized in that the vector has a pCAH / SINd1 structure shown in Figure 3c. The method of claim 1, A transition vector further comprising a transcription cassette. The method of claim 16, Wherein said transcription cassette comprises a polynucleotide of interest operably linked to a heterologous promoter. The transition vector of claim 1; And a packaging vector system comprising a first polynucleotide comprising a CAEV gag-pol- coding sequence and a RRE, and a second polynucleotide comprising a viral envelope-coding sequence. The method of claim 18, Wherein said transfer vector further comprises a transcription cassette. The method of claim 19, Wherein said transcription cassette comprises a polynucleotide of interest operably linked to a heterologous promoter. The method of claim 18, Wherein said viral envelope-coding sequence is a non-CAEV envelope-coding sequence. The method of claim 21, Wherein said non-CAEV envelope-coding sequence is a VSV-G-coding sequence or a GaLV-coding sequence. The method of claim 22, Wherein said envelope-coding sequence is a VSV-G-coding sequence. The method of claim 22, And the envelope-coding sequence is a GaLV-coding sequence. The method of claim 18, Wherein said vector system further comprises a third polynucleotide sequence comprising a rev -coding sequence. The method of claim 18 or 25, Wherein said vector system further comprises a fourth polynucleotide sequence comprising a vif -coding sequence. The method according to any one of claims 18, 25 or 26, Wherein said first polynucleotide further comprises a heterologous regulatory sequence operably linked to said CAEV gag-pol -coding sequence. The method according to any one of claims 18, 21 or 22, Wherein said second polynucleotide further comprises a heterologous regulatory sequence operably linked to said viral envelope-coding sequence. The method of claim 18, Wherein said first polynucleotide further comprises a heterologous regulatory sequence operably linked to said CAEV gag-pol -coding sequence and wherein said second polynucleotide is operably linked to said viral envelope-coding sequence. The vector system further comprises. The method of claim 25, Wherein said third polynucleotide further comprises a heterologous regulatory sequence operably linked to said rev -coding sequence. The method of claim 26, Wherein said fourth polynucleotide further comprises a heterologous regulatory sequence operably linked to said vif -coding sequence. 32. The method of claim 27, 28, 29, 30, or 31, The heterologous control sequence is a vector system, characterized in that the promoter. The method of claim 18, Wherein said packaging vector system does not have a competent CAEV packaging sequence. The method of claim 18, Wherein the packaging vector system does not have a 5 'end region between the splicing providing location of the CAEV genome and the gag start codon. The method of claim 18, A vector system comprising a first vector comprising the first polynucleotide and a second vector comprising the second polynucleotide. The method of claim 25, A vector system comprising a first vector comprising the first polynucleotide, a second vector comprising the second polynucleotide, and a third vector comprising the third polynucleotide. The method of claim 26, A first vector comprising the first polynucleotide, a second vector comprising the second polynucleotide, a third vector comprising the third polynucleotide, and a fourth vector comprising the fourth polynucleotide Vector system, characterized in that. The method of claim 25, And a first vector comprising the first polynucleotide and the third polynucleotide, and a second vector comprising the second polynucleotide. The method of claim 26, And a first vector comprising the first polynucleotide and the fourth polynucleotide, and a second vector comprising the second polynucleotide. The method of claim 32, The CAEV gag-pol- coding sequence A vector system, operably connected to an MCMV MIEP promoter. The method of claim 40, The first system has a structure of pMGP / RRE shown in Figure 2a. 36. The method of claim 35 wherein The viral envelope-coding sequence is a VSV-G-coding sequence operably linked to an HCMV MIEP, wherein the second vector further comprises a beta globin intron. The method of claim 42, The vector system, characterized in that the second vector has a structure of pHGVSV-G shown in Figure 6a. 36. The method of claim 35 wherein The viral envelope-coding sequence is a GaLV-coding sequence operably linked to an MCMV MIEP, wherein the second vector further comprises a eukaryotic extension factor-1 alpha intron. The method of claim 44, The second system has a structure of pMYKEF-1 / env shown in Fig. 6b. The method of claim 36, The third system has a structure of pHYK / rev shown in FIG. 5. The method of claim 37, The fourth system has a structure of pHYK / vif shown in FIG. 1) transfecting cells with the vector system of claim 20; 2) culturing the cells under conditions capable of producing CAEV-based lentiviral vector particles, wherein the vector particles are infectious and eligible for transduction and are replication defective; And 3) recovering the vector particles Method for producing a CAEV-based vector particles comprising a. Vector particles produced by the method of claim 48. A composition comprising the vector particle of claim 49 and a carrier. 48. A kit comprising the vector system of any one of claims 18-47. A method of delivering a polypeptide to a mammalian cell comprising contacting the mammalian cell with the vector particle of claim 49. The method of claim 52, wherein Wherein said cell is isolated from the mammal prior to contacting the cell with the vector particles. The method of claim 52, wherein The mammalian cell is a dividing cell. The method of claim 52, wherein The mammalian cell is a non-dividing cell. The method of claim 52, wherein The mammalian cell is a CD34 + stem cell. 50. A method comprising administering the vector particle of claim 49 to a vertebrate. 18. A kit comprising the transition vector of any one of claims 1 to 17. The method according to any one of claims 18 to 47, The vector system further comprises a cell comprising the first polynucleotide. The method according to any one of claims 28, 30, 32, 36 or 38, The vector system further comprises a cell comprising the first and third polynucleotides. The method according to any one of claims 26 to 28, 31 to 32, 37, 39, 41, 43, or 45, The vector system further comprises a cell comprising the first and fourth polynucleotides. The method according to any one of claims 26 to 28, 31 to 32, 37, 39, 41, 43, or 45, The vector system further comprises a cell comprising said first, third and fourth polynucleotides. The method according to any one of claims 18 to 24, 26, 29, 33-35, 40, 42, 44, or 46, The vector system further comprises a cell comprising the first and second polynucleotides. The method according to any one of claims 25 to 28, 30, 32, 36, or 38, The vector system further comprises a cell comprising said first, second and third polynucleotides. The method according to any one of claims 26 to 28, 31 to 32, 37, 39, 41, 43, or 45, The vector system further comprises a cell comprising said first, second and fourth polynucleotides. The method according to any one of claims 26 to 28, 31 to 32, 37, 39, 41, 43, or 45, And a cell comprising said first, second, third, and fourth polynucleotides. The method according to any one of claims 35 to 47, The vector system further comprises a cell comprising said first and second vectors. The method according to any one of claims 36 to 46, The vector system further comprises a cell comprising said first, second and third vectors. The method according to any one of claims 36 to 47, The vector system further comprises a cell comprising said first, second, third, and fourth vectors. The method according to any one of claims 35 to 47, The vector system further comprises a cell comprising the first vector. 1) preparing a cell comprising a CAEV gag-pol -coding sequence and an RRE; 2) transfecting said cells with the transfer vector of claim 17; 3) culturing the cells under conditions capable of producing CAEV-based lentiviral vector particles, wherein the vector particles are infectious and eligible for transduction and are replication deficient; And 4) recovering the vector particles Including, a method of producing CAEV-based vector particles. 1) the untranslated region between the CAEV 5'LTR and the CAEV gag -coding sequence, and 2) the 1 to X nucleotides of the CAEV gag- coding sequence linked to the 3 'end of the untranslated region, wherein A X comprising a CAEV packaging sequence consisting essentially of X. The method of claim 15, Wherein said vector has at least 70% homology with SEQ ID NO: 68. 42. The method of claim 41 wherein And wherein said first vector has at least 70% homology with SEQ ID NO. The method of claim 43, Wherein said second vector has at least 70% homology with SEQ ID NO. The method of claim 45, Wherein said second vector has at least 70% homology with SEQ ID NO: 72. The method of claim 46, The vector system of claim 3, wherein the third vector has at least 70% homology with SEQ ID NO: 75. The method of claim 47, And said fourth vector has at least 70% homology with SEQ ID NO.

Images