KR20070030115A - A method for production of natural killer cell - Google Patents

Abstract

A method for production of a natural killer(NK) cell is provided to avoid side effects in cancer therapy by using a natural killer cell differentiated from a hematopoietic stem cell instead of a matured natural killer cell. The adult natural killer cell is produced by treating the hematopoietic stem cell with IL-7(interleukine 7), SCF(stem cell factor) and Flt3L(fms-related tyrosine kinase 3 ligand) to differentiate the hematopoietic stem cell into a NK precursor cell, and treating the NK precursor cell with the Axl receptor and its ligand Gas6. The hematopoietic stem cell is isolated from the human cord blood; the Axl is a recombinant Axl produced from a transformant containing a recombinant vector pLXSN-Axl; the host cell of the transformant containing the recombinant vector pLXSN-Axl is a mouse RAW264.7 macrophage; the recombinant Gas6 is produced from a transformant containing a recombinant vector pcDNA3.1(+)-GAS6; and the host cell of the transformant containing the recombinant vector pcDNA3.1(+)-GAS6 is a mouse OP9 cell line.

Description

A method for production of natural killer cell

Figure 1 shows the isolation of hematopoietic stem cells and differentiation into natural killer cells from rat bone marrow,

Figure 2 shows the results of the vector system analysis based on the Self-inactivating Lenti virus,

Figure 3 shows the purity of cells (pNK, mNK) of different stages of natural killer cells isolated from hematopoietic stem cells (HSC),

4 shows gene expression specific for natural killer cells in hematopoietic stem cells and natural killer cell differentiation stage cells.

Figure 5 shows the results of analyzing the degree of final differentiation of natural killer cells by co-culture of natural killer cell progenitor cells and OP9 stromal cells,

Figure 6 shows a schematic diagram for the discovery of specific genes expressed by differentiation stages of natural killer cells by SAGE,

Figure 7 shows the agreement between gene expression and SAGE results in progenitor cells of natural killer cells,

Figure 8 shows the effect of Axl antibody on the differentiation of natural killer cells,

Figure 9 shows the differentiation effect of natural killer cells by low concentration of IL-15 and Axl antibody without co-culture with OP9 stromal cells,

10 shows the effect of mouse recombinant Gas6 on the differentiation of natural killer cells,

11 shows a g-carboxylation process in the Vitamin K cycle,

12 shows the effect of Warfarin on the differentiation of natural killer cells,

Figure 13 shows the cloning results of the mouse Gas6 cDNA,

Figure 14 shows the results of the production of the gas6 expression vector,

Figure 15 shows the results of cloning and expression vector of the mouse Gas6 cDNA,

16 shows the results of confirming Gas6 expression in the mouse Gas6 stable transfectant,

Figure 17 shows the effect of Gas6 transfectant on the differentiation of natural killer cells,

18 shows the results of cloning mouse Axl cDNA and confirming the orientation of Axl cDNA cloned in retroviral vector (pLXSN),

19 shows the results of the preparation of the mouse Axl-Fc expression vector,

Figure 20 shows the configuration of the double-promoter siRNA cassette and siRNA template oligomers,

21 shows the cloning result of siRNA construct,

22 shows the results of analyzing the degree of infection of pFIV-U6 / H1-GFP virus in 293T cells.

Figure 23 shows the results of analyzing the degree of pFIV-U6 / H1- GFP virus infection in progenitor cells of hematopoietic stem cells and natural killer cells.

* The present invention can be used in the field of cancer treatment by the method of cloning and isolating and purification of Axl receptor and its ligand Gas6 which can control the differentiation and activity of hematopoietic stem cells from natural killer cells and its activity. .

Current cancer treatments, such as surgical surgery, drug therapy, and radiation therapy, may have a temporary therapeutic effect, but there are problems such as resistance, recurrence, and various side effects, so that many developed countries develop anticancer drugs or diagnostic reagents. Attempts have been made to use immunotherapy to modulate the immune response, but the development of immune cell therapies that can effectively develop the diagnosis, prevention and treatment of cancer is still known at an early stage.

Natural killer cells are involved in innate immunity, which removes pathogens, cancers, and allogeneic cells, and mediates adaptive immunity by secreting cytokines such as TNF-α, IFN-γ, and IL-12. It has been reported to have a function of regulating memory formation specific to cancer, and defects in the function and differentiation ability of natural killer cells in several cancers. Conventional cancer therapy using natural killer cells has been used to enhance the immune response to cancer cells by activating natural killer cells with interleukin-2. These methods have side effects and persistence and resistance of individual therapeutic effects. And it is known that there are many problems such as differences in the therapeutic effect. Therefore, in order to solve these problems, the present invention, unlike mature natural killer cells used in most of the existing studies, promotes the differentiation process of natural killer cells from hematopoietic stem cells (HSC) (Fig. 1). Axl was found.

Axl receptor tyrosine kinase (p140) is a tyrosine receptor kinase belonging to the Sky, Eyk family. The Axl family contains Rse (Sky, Brt, Tif, Dtk, Tyro3), Mer (Eyk, Nyk, Tyro12). Axl, Rse, and Mer are known to be expressed in most tissues, but its function is not well known. Gas6 is known as a ligand of Axl, which is a vitamin K-dependent growth-potentiating factor, which is inferred to be involved in Axl's unique structural cell migration, growth and differentiation. Expression of Axl is expressed in fibroblasts, myeloid progenigor cells, macrophages, neural tissues, ovarian follicles, skeletal muscle, but not in lymphocytes. It has been.

In the present invention, a serial analysis capable of analyzing a large amount of genetic information by analyzing almost all transcripts from a gene by analyzing a short sequence tag of a transcript designed for quantitative and qualitative analysis of gene expression at the gene level The novel function of the Axl receptor and its ligand, Gas6, which is involved in the differentiation and activity of natural killer cells obtained by using of gene expression (SAGE) technology was cloned.

For this purpose, the present invention provides a method for producing adult NK cells, characterized in that the adult stem cells are treated with Axl and Gas6 to obtain adult NK cells.

The present invention also provides a method characterized in that the adult stem cells are treated with IL-7, SCF and Flt3L to differentiate into NK progenitor cells, and then NK progenitor cells are treated with Axl and Gas6. Here, the cells may be treated with IL-15 together with Axl and Gas6.

In the present invention, the adult stem cells are preferably derived from human or umbilical cord blood.

Axl used in the present invention is preferably recombinant Axl. Here, the recombinant Axl may be more preferably generated from a transfectant including the recombinant vector pLXSN-Axl.

In addition, the host used in the present invention is preferably a mouse RAW264.7 macrophage line.

Furthermore, Gas6 used in the present invention is preferably gamma-carboxylated recombinant Gas6, in particular, such recombinant Gas6 is more preferably generated from a transfectant containing the recombinant vector pcDNA3.1 (+)-GAS6. will be.

In another aspect of the invention, a method is also provided wherein the host is a mouse OP9 cell line.

Natural killer cells are leukocyte lymphocytes involved in the innate immune system that have a variety of biological functions, including certain microbial infections and the recognition and destruction of neoplasms (Moretta, A., Bottino, C., Mingari, MC, Biassoni, R. and Moretta, L., Nat. Immunol ., 3, 6, 2002). Their morphological features show huge granular lymphocyte (LGL) -like morphology based on the presence of densely pink-purple dyed granules in the cytoplasm. These include about 10-20% in normal peripheral blood lymphocytes, 15-25% in liver lymphocytes and 1-5% in splenic lymphocytes. Dormant NK cells circulate in the blood, but after activation by cytokines they can leak and infiltrate into most tissues containing pathogen-infected or malignant cells (Colucci, F., Di Santo, JP and Leibson, PJ, Nat.Imunmun. , 3, 807, 2002; Kelly JM, Darcy PK, Markby JL, Godfrey DI, Takeda K., Yagita H., Smyth MJ, Nat.Imunmun., 3, 83, 2002; Shi FD, Wang HB , Li H., Hong S., Taniguchi M., Link H., Van Kaer L., Ljunggren HG, Nat. Immunol., 1, 245, 2000; Korsgren M., Persson CG, Sundler F., Bjerke T. , Hansson T., Chambers BJ, Hong S., Van Kaer L., Ljunggren HG, Korsgren O., J. Exp. Med., 189, 553, 1999). In general, the phenotypes of NK cells are CD56 and CD16 (human), NKR-P1C (NK1.1 in mouse, CD161 in human), DX5, Ly49 (mouse; these are limited to specific mouse strains) surface antigen expression and CD3 Characterized by the lack of The majority of human NK cells (90% of total NK cells) show low density expression of CD56 (which is more cytotoxic than CD56 ^dim ) and express high levels of Fcγ receptor III (FcγRIII, CD16), whereas about 10% NK cells are CD56 ^bright CD16 ^dim Or CD56 ^bright CD16 ⁻ (Schattner, A. and Duggan, DB, Arthritis Rheum ., 27, 1072, 1984).

NK cells play a key role in early host methods through the interaction between activating receptors and their ligands without prior training in virus-infected cells, tumor cells and some normal allogeneic cells. NK cells have the ability to distinguish normal cells from cells without expression of the major histocompatibility complex (MHC) class I molecules due to recognition through NK inhibitory receptors specific for the major histocompatibility complex (MHC) class I molecules. . The function of NK cells is regulated by the balance between activating and inhibitory receptors that interact with ligands such as MHC class I or MHC class I-associated molecules in target cells (Rajaram, N., Tatake, RJ, Advani, SH and Gangal, SG, Br. J. Cancer, 62, 205, 1990). These receptors are classified into two structural families: the immunoglobulin parent family (leukocyte inhibitory receptor, killer cell Ig-like receptor (KIR, CD158) and C-type lectin-like family (NKG2D, CD94 / NKG2, lymphocyte antigen 49 (LY49) ).

NK cells produce several cytokines such as interferon-γ and tumor-necrosis factor-α (TNF-α) after interaction between cell-surface receptors and their ligands (Bryson, JS and Flanagan, DL, J). Hematother Stem Cell Res, 9, 307, 2000). The functional function of NK cells is characterized by the differential intervention of cytokines and cell surface receptors, including interleukin (IL-2), IL-12, IL-15, IL-18, IL-21 and type I interferon (IFN-αβ). Whereas they can be stimulated in combination, they are not only immunomodulatory cytokines such as IFN-γ, IL-5, IL-10, IL-13, INF-α and granulocyte-macrophage colony-stimulating factor (GM-CSF) Many chemokines are produced after interaction between NK receptors and their ligands (Shi FD, Wang HB, Li H., Hong S., Taniguchi M., Link H., Van Kaer L., Ljunggren HG, Nat. Immunol. , 1, 245, 2000). In humans, CD56 ^bright NK cell subsets are also expressed in IFN-g, TNF-a, TNF-b, IL-10 and GM-CSF (Lian RH, Maeda M., Lohwasser S., Delcommenne M., Nakano T. , Vance RE, Raulet DH, Takei F., J. Immunol., 168, 4980, 2002), but a subset of CD56 ^dim NK cells does not produce these cytokines (Colucci, F , Di Santo, JP and Leibson, PJ, Nat.Imunmun., 3, 807, 2002; Shi FD, Wang HB, Li H., Hong S., Taniguchi M., Link H., Van Kaer L., Ljunggren HG, Nat. Immunol., 1, 245, 2000). Although immature NK cells can produce Th2 cytokines such as IL-5 and IL-13, the ability to produce Th2 cytokines is lost upon final differentiation; Instead mature NK cells acquire the ability to produce IFN-g (Van Beneden K., Stevenaert F., De Creus A., Debacker V., De Boever J., Plum J., Leclercq G., J. Immunol , 166, 4302, 2001).

NK cells are IL-15 (Crosier, KE and Crosier, PS, Pathology, 29, 131, 1997; Nakano, T., Kawamoto, K., Kishino, J., Nomura, K., Higashino, K. and Arita, H., J. Biochem., 323, 387, 1997; Fridell, YW, Villa, J., Jr, Attar, EC and Liu, ET, J. Biol. Chem., 273, 7123, 1997) or IL-2 (XCL1, CCL1, CCL3, CCL4, CCL5, CCL22, and CXCL8 (Lundwall, A., partially regulated by Goruppi, S., Ruaro, E. and Schneider, C., Oncogene, 12, 471, 1996). Dackowski, W., Cohen, E., Shaffer, M., Mahr, A., Dahlback, B., Stenclrclr, J. and Wydro, R., Proc. Natl Acad. Sci., 83, 6716, 1986). It secretes and reacts to many chemokines, including. These chemokines play an important role in NK cell homing to infectious and neoplastic cells in secondary lymphocyte tissues, and the production of IFN-g in those tissues can directly regulate T cell responses (Lundwall, A., Dackowski). , W., Cohen, E., Shaffer, M., Mahr, A., Dahlback, B., Stenclrclr, J. and Wydro, R., Proc. Natl Acad. Sci., 83, 6716, 1986). Dormant CD56 ^dim / CD16 ⁺ NK cell subsets express CXCR1, CXCR2, CXCR3 and CXCR4, while CD56 ^bright / CD16 ^- NK cells express high levels of CCR5 and CCR7. Cytolytic activity of NK cells is stimulated by CCL2, CCL3, CCL4, CCL5, CCL10 and CXC3L1.

There are two mechanisms by which NK cells kill cancer cells. By using cell receptors, NK cells express three types of TNF proteins on the cell surface. It is known as a FAS ligand (FASL), TNF and TNF related apoptosis inducing ligand (TRAIL), which is known to induce cancer cell death by defects with these receptors in cancer cells (Ashkenazi, A., Nature Rev. Cancer., 2, 420, 2002). Another way NK cells kill cancer cells is through cellular granules such as Perorin and Granzyme. These substances penetrate the cell membranes of cancer cells to dissolve the cancer cells and eventually cause them to die (Trapani, JA, Davis, J., Sutton, VR and Smyth, MJ, Curr. Opin. Immunol., 12, 323 , 2000).

It is well known that NK cells are derived from pluripotent hematopoietic stem cells, but little is known about their development (Lian RH, Maeda M., Lohwasser S., Delcommenne M., Nakano T., Vance RE, Raulet DH). Takei F., J. Immunol., 168, 4980, 2002). Hematopoietic stem cells (Lin ^- CD34 ⁺ in human, Lin ^- c-kit ⁺ Sca2 ⁺ in mouse) can be derived from fetal thymus, fetal liver, umbilical cord blood and adult bone marrow, which can differentiate into T / NK As precursor (Lian RH, Kumar V., Semin. Immunol., 14, 453, 2002; Douagi I., Colucci F., Di Santo JP., Cumano A., Blood, 99, 473, 2002) at the in vitro level Incubated with IL-7, stem cell factor (SCF), and flt3L has the ability to differentiate into pNK (Williams NS, Klem J., Puzanov IJ, Sivakumar PV, Bennett M., Kumar V., J Immunol, 163, 2648, 1999). pNK cells are spread evenly in bone marrow, fetal thymus, blood, spleen and liver, but do not produce IFN-γ and have no cytolytic ability but express CD122 (IL-2 / 15Rβ ⁺ ).

pNK (CD56 ^- CD122 ⁺ CD34 ⁺ in human, CD122 ⁺ NK1.1 ^- DX5 ^- in mouse) cells were treated with IL-15 and cultured with immature NK (CD122 ⁺ CD16 ^lo CD56 ^- KIR ^- in human, CD122 ⁺ CD2 ⁺ NK1.1 ⁺ DX5 ^- Ly49 ^- in mouse) cells. When the pNK cells continuously to the culture in the medium containing the IL-15 soluble pseudomature cells NK (CD122 ⁺ CD2 ⁺ NK1.1 ⁺ DX5 ⁺ CD94 / NKG2 ⁺ Ly49 ^-) can differentiate into cells, but their cytolytic capacity Is known to be rare. It has been reported that stromal cells secrete various cytokines and substances that can react directly with NK cell surface receptors during development. These substances secreted by stromal cells are essential for mNK cell maturation and have the ability to express LyS49 ⁺ in mNK cells (Iizuka K., Chaplin DD, Wang Y., Wu Q., Pegg LE, Yokoyama WM). , Fu YX, Proc. Natl. Acad. Sci., 96, 6336, 1999; Briard D., Brouty-Boye D., Azzarone B., Jasmin C., J. Immunol., 168, 4326, 2002). Ly49 ⁺ mNK cells with cytolytic ability (CD56 ⁺ KIR ⁺ CD3 ^- in human, CD122 ⁺ CD2 ⁺ NK1.1 ⁺ DX5 ⁺ CD94 / NKG2 ⁺ Ly49 ⁺ CD3 ^- in mouse) cells are interstitial with pNK cells in the presence of IL-15 Differentiation can be achieved through coculture of cells (Williams NS, Klem J., Puzanov IJ, Sivakumar PV, Bennett M., Kumar V., J. Immunol ,. 163, 2648, 1999). In the early stages of development of Nk cells, CD94, NKG2A, NKG2C and Ly49B are expressed, followed by Ly49G, Ly49C, Ly49I and Ly49A, D, E and F (Williams). NS, Kubota A., Bennett M., Kumar V., Takei F., Eur. J. Immunol., 30, 2074, 2000).

pNK cells were PU.1, GATA3, Id2, and Ets-1. Express transcription factors such as (Boggs SS, Trevisan M., Patrene K., Geogopoulos K., Nat. Immunol., 16, 137, 1998). Transcription factors ikaros, PU.1 (Colucci F., Samson SI, DeKoter RP, Lantz O., Singh H., Di Santo JP, Blood, 97, 2625, 2001), and Id2 (Ikawa T., Fujimoto S., Kawamoto H., Katsura Y., Yokota Y., Proc. Natl Acad. Sci, 98, 5164, 2001), a decrease in the number of pNK cells is observed in mice lacking. Hematopoietic stem cells express transcription factors such as myeloblastosis (myb) oncogene, forkhead-related transcription factor 1C, c-myc, and Oct 2b. These factors play an important role in the proliferation and development of pNK cells (Bar-Ner M., Messing LT, Segal S., Immunobiology, 185, 150, 1992; Melotti P., Calabretta B., Blood, 87, 2221, 1996). In pNK cells, immunomodulators such as Fc receptors, RNF receptors, IL-7 receptors and chemokine receptors, and CD36 are known to play an important role in the pNK cell phase.

Signaling molecules such as regulators of G protein signaling (RGS), lymphocyte-specific protein tyrosine kinase, Fyn proto-oncogene, and mitogen activated protein kinase 1 in mNK cells are involved in the maturation of NK cells (Ikawa T., Fujimoto S., Kawamoto H., Katsura Y., Yokota Y., Proc.Natl.Acad.Sci ,. 98, 5164, 2001; Ogasawara K., Hida S., Azimi N., Tagaya Y., Sato T. , Yokochi-Fukuda T., Waldmann TA, Taniguchi T., Taki S., Nature, 391, 700, 1998). Treatment of IL-2 on mNK cells is known to induce proliferation and activity of mNK cells.

Receptor tyrosine kinases consist of transmembrane proteins that signal into the cell extracellular stimuli for cell proliferation, cell development, cell survival and cell migration. (Ullrich, A., Schlessinger, J., Cell, 61, 203, 1990; Fantl, WJ, Johnson, DE, Williams, LT, Biochem., 62, 453, 1993; Heldin, C., Cell, 80, 213 , 1995). All receptor tyrosine kinases have a cytoplasmic kinase domain in common, and when growth factors bind, receptor tyrosine kinases are activated. The activity of receptor tyrosine kinases is achieved by self-phosphorylation and tyrosine phosphorylation. Axl receptor tyrosine kinase (also called ARK or UFO, TYRO7) is one of the first superfamily of receptor tyrosine kinases found. Receptor tyrosine kinases have the following common structure. It consists of two immunoglobulin-associated domains and two fibronectin type III repeat domains linked thereto, and finally an extracellular domain containing the cytoplasmic receptor tyrosine kinase (O'Bryan, JP, Frye, RA, Cogswell, PC). , Neubauer, A., Kitch, B., Prokop, C., Espinosa, R. III, Lebeau, MM, Earp, HS, Liu, ET, Mol. Cell. Biol., 11, 5016, 1991). Axl is expressed in the chest, skeletal muscle, heart, hematopoietic tissue, testes, ovaries and endometrium (Faust, M., Ebensperger C., Schulz, AS, Schleithoff, L., Hameister, H., Bartram, CR and Janssen, JW, Oncogene, 7, 1287, 1992; Graham, DK, Bowman GW, Dawson, TL, Stanford WL, Earp, HS, and Snodgrass, HR, Oncogen, 10, 2349, 1995; Neubauer, A., Fiebeler, A., Graham, DK, O'Bryan, JP, Schmidt, CA, Barckow, P., Serke, S., Siegert, W., Snodgrass, HR, Huhn, D., Blood, 84, 1931, 1994; Berclaz , G., Altermatt, HJ, Rohrbach, V., Kieffer, I., Dreffer, E. and Andres, AC, Ann.Oncol., 12, 819, 2001; Wimmel, A., Glitz, D., Kraus, A., Roeder, J. and Schuermann, M., Eur.J. Cancer., 37, 2264, 2001; Sun, WS, Misao, R., Iwagaki, S., Fujimoto, J. and Tamaya, T., Mol. Hum.Reprod., 8, 552, 2002). Axl is characterized by a cell adhesion molecule associated with an extracellular ligand binding domain, two immunoglobulin-like domains, and two fibronectin type III domains. Recent studies have reported that Axl is involved in the development of cancer, the development of nerves and hematopoietic tissues (Crosier, K. E. and Crosier, P. S., Pathology, 29, 131, 1997).

Gas6 is a growth stop specific gene 6 protein and is one of a family of vitamin K dependent proteins. These families are known as ligands for the Axl / sky family of receptor tyrosine kinases, including Axl, Sky (Rse, Brt, Tif, Dtk, Etk-2 and Tyro3) and Mer (c-Eyk, Nyk and Tyro12). (Godowski, PJ, Mark, MR, Chen, J., Sadick, MD, Raab, H. and Hammonds RG, Cell, 82, 355, 1995; Varnum, BC, Young, C., Elliott, G., Garcia, A., Bartley, TD, Fridell, YW, Hunt, RW, Trail, G., Clogston, C., Toso, RJ, Nature, 373, 623, 1995; Chen, J., Carey, K. and Godowski, PJ , Oncogene, 14, 2033, 1997). Gas6 has a 46% identical amino acid sequence to protein S, a protein related to blood coagulation regulation, and a similar structure to protein S (Manconrftti, G., Brancolini, C., Avanzi, G. and Schneider, C., Mol. Cell. Biol., 13, 4976, 1993). Gas6 is expressed in the intestine, testes, lung endothelium, endometrium and also in endometrial cancers (Prieto, AL, Weber, JL, Tracy, S., Heeb, MJ and Lai, C., Brain Res., 816, 646, 1999; Chan, MCW, Mather, JP, Mccray, G. and Lee, WM, J. Androl., 21, 291, 2000; Wimmel, A., Glitz, D., Kraus, A., Roeder , J. and Schuermann, M., Eur. J. Cancer., 37, 2264, 2001).

Vitamin K dependent γ-carboxylation must be achieved for Gas6 to have full biological activity (Manconrftti, G., Brancolini, C., Avanzi, G. and Schneider, C., Mol. Cell. Biol., 13, 4976 Lundwall, A., Dackowski, W., Cohen, E., Shaffer, M., Mahr, A., Dahlback, B., Stenclrclr, J. and Wydro, R., Proc. Natl Acad. , 83, 6716, 1986; Chen, J., Carey, K. and Godowski, PJ, Oncogene, 14, 2033, 1997). Gas6 acts as a factor for thrombin-induced cell growth in smooth muscle cells. (Nakano, T., Kawamoto, K., Kishino, J., Nomura, K., Higashino, K. and Arita, H., J. Biochem., 323, 387, 1997). In addition, Gas6 is known to be a chemoattractant involved in cell migration by Axl mediation of vascular smooth muscle cells (Davis, JE, Smyth, MJ and Trapani, JA, Eur. J. Immunol., 31, 39-47, 2001). Gas6 also protects NIH3T3 cells from serum deficiency from cell death and keeps the cell cycle running (Goruppi, S., Ruaro, E. and Schneider, C., Oncogene, 12, 471, 1996). Recently, Gas6 has been reported to induce b-catenin stabilization and T-cell factor transcriptional activity in mammalian cells (Goruppi, S., Chiaruttini, C., Ruaro, ME, Varnum, B. and Schneider, C.). , Mol. Cell. Biol., 21, 902, 2001).

Protein S is a vitamin-K dependent plasma glycoprotein that prevents coagulation and acts as a cofactor of activated protein C upon degradation of coagulation factors Va and VIIIa. Protein S also acts as a mitogen in distinct cell types and is a ligand of Tyro3, a member of the Axl family of oncogenic receptor tyrosine kinases (Wimmel A. et al., Cancer 1999 Jul 1; 86 (1): 43- 9). Receptor protein S, like Gas6, has been shown to stimulate members of the Axl / Sky family of receptor tyrosine kinases. Protein S has a structure similar to Gas6 (consists of an amino terminal Gla domain, four EGF-like domains, and a G domain such as a signaling molecule) and has the ability to phosphorylate the Axl / Sky superfamily of receptor tyrosine kinases. (Evenas P., et al., Biol Chem. 2000 Mar; 381 (3): 199-209). Protein S can be prepared by genetic recombination (Merel Van Wijnen, et al., Biochem. J. 330, 389-396).

Recombinant DNA methods used in the present invention are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and / or Ausubel et al., Eds., Current Protocols in Molecular Biology, Green Publishers Inc. and Wiley and Sons, N.Y. (1994). For example, large amounts of the desired nucleotide sequence can be generated by inserting a nucleic acid sequence encoding an Axl or Gas6 protein into an appropriate vector via recombinant expression techniques as exemplarily described below. The sequence can then be used to generate detection probes or amplification primers. Alternatively, a large amount of protein can be produced by inserting a polynucleotide encoding an Axl or Gas6 protein into an expression vector and introducing the resulting expression vector into an appropriate host and culturing. Another method of obtaining nucleic acid sequences is PCR (polymerase chain reaction). Reverse transcriptase is used to prepare cDNA from poly (A) + RNA or total RNA. Typically, two primers complementary to two separate regions of cDNA (oligonucleotide) encoding the amino acid sequence of an Axl or Gas6 polypeptide are added to the cDNA with a polymerase such as Taq polymerase and the polymerase is the cDNA between the two primers. Amplify the area. Nucleic acid molecules encoding amino acid sequences of Axl or Gas6 polypeptides can be amplified / expressed in prokaryotic, yeast, baculovirus systems and / or eukaryotic host cells (Meth. Enz. Vol. 185 DV Goeddel ed., Academic Press, Sna Diego Calif., 1990). Typically expression vectors contain sequences for plasmid maintenance and cloning and expression of foreign nucleotide sequences. Such sequences include promoters, enhancers, replicators, transcription termination sequences, secretory leader sequences, ribosomal binding sites, polyadenylation sequences, polylinkers for inserting the coding nucleic acid of the polypeptide to be expressed, and selection markers. Such flanking sequences are well known to those skilled in the art and can be readily used selectively.

Axl antibodies used in accordance with the present invention may be either polyclonal or monoclonal. Axl antibodies can be purchased from Santa Cruz Biotech. In addition, the antibody used in the present invention can be prepared according to a known method. Polyclonal antibodies are obtained by several subcutaneous or intraperitoneal injections of antigen and adjuvant into an animal. Proteins that are immunogenic in the species to be immunized (e.g. keyhole clam hemocyanin, serum inducers (e.g. maleimidobenzoyl sulfosuccinimide ester, N-hydroxysuccinimide, glutaraldehyde, succinic anhydride, SOCl) ₂ ), etc. Animals can be administered in three doses, eg, 100 mug or 5 mug of protein or conjugate (for rabbits or mice, respectively) to an antigen, immunogenic binder or derivative. Immunized by combining with Freund's complete excipients and percutaneously injecting the solution at several sites One month later animals are inoculated subcutaneously at several sites with 1/5 to 1/10 of the initial amount of peptide or conjugate in Freind's complete excipients. Blood is drawn from the animals after 7 to 14 days and the serum is assayed for antibody titer Inoculate the animal up to the titer level Preferably, the animals are treated with the same term Inoculated with the original conjugate, but also combined with other proteins and / or other crosslinking reagents, which can also be made in recombinant cell culture as protein fusions, and coagulants such as alum are suitably used to enhance immune responses. .

Monoclonal antibodies are obtained from the group of substantially homogeneous antibodies. That is, the individual antibodies, including that group, are identical except for possible naturally occurring mutations that may be present in small amounts. Thus, modified monoclonal refers to the properties of the antibody as not being a mixture of individual antibodies. For example, monoclonal antibodies are prepared using the hybridoma method described in Kohler et al., Nature, 256: 495 (1975), or by recombinant DNA method (US Pat. No. 4,816,567). can do. In hybridoma methods, mice or other suitable host animals (eg hamsters) are immunized as described above to induce lymphocytes that can produce or produce antibodies that specifically bind to the protein used for immunization. Alternatively, lymphocytes can be immunized in vitro. Lymphocytes are then fused with myeloma cells using a suitable fusing agent such as polyethylene glycol to form hybridoma cells (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59 103 (Academic Press, 1986). The prepared hybridoma cells are grown in a suitable culture medium, preferably containing one or more substances that inhibit the growth or survival of the unfused parental myeloma cells, for example, the parental myeloma cells are hypoxanthine guanine phosphory. Without the transferase (HGPRT or HPRT) to be seen, hybrido's culture medium will typically include hypoxanthine, aminopterin and thymidine (HAT medium), which inhibit the growth of HGPRT-deficient cells. Preferred myeloma cells fuse efficiently and support stable high level antibody production of antibodies by selected antibody-producing cells Among these, preferred myeloma cell lines are from mouse myeloma cell lines, such as MOPC-21 and PMC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, CA, USA and ATCC Available SP-2 or X63-Ag8-653 cells Human myeloma and mouse-human heteromyeloma cell lines can also be used for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984). and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51 63 (Marcel Dekker, Inc., New York, 1987)). The binding specificity of the monoclonal antibodies produced by the hybridoma cells is preferably immunoprecipitated or in vitro binding assays (e.g., radioimmunoassay or efficacy). Small-linked immunosorbent assay). The binding affinity of monoclonal antibodies can be determined, for example, by Scatchard analysis of Munson et al., Anal. Biochem., 107: 220 (1980). After identifying hybridoma cells that produce antibodies with the specificity, affinity, and / or activity of interest, they can be cloned by restriction dilution procedures to obtain clones and standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59 103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, hybridoma cells can be grown in vivo as ascites tumors in an animal. Monoclonal antibodies secreted by aclones are conventional antibody tablets such as, for example, protein A-sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography from culture media, ascites fluid or serum. Separate by procedure.

Hematopoietic stem cells have their own regenerative capacity and are the origin of progenitor cells committed during the lifetime of an individual. A common feature of primitive as well as more committed hematopoietic stem cells is the expression of CD34 antigens that can be detected by FACS (fluorescence-activated cell sorter) analysis using anti-CD34 monoclonal antibodies. Hematopoietic stem cells are derived from bone marrow, peripheral blood, umbilical cord blood and the like. Umbilical cord blood is known to be the most abundant source of hematopoietic stem cells. Cord blood obtained directly from the placenta after delivery is rich in hematopoietic stem cells and has a higher proliferative capacity than cells obtained from bone marrow and peripheral blood. Infusion of hematopoietic growth factors such as G-CSF can significantly promote the mobilization of CD34 (+) cells (Beyer J et al., Hematopoietic rescue after high-dose chemotherapy using autologous peripheral-blood progenitor cells or bone marrow: a randomized comparison.J Clin Oncol 1995; 13: 1328-1335; and Smith TJ et al., Economic analysis of a randomized clinical trial to compare filgrastim-mobilized peripheral-blood progenitor-cell trnasplantation and autologous bone marrow transplantation in patients with Hodgkin's and non-Hodgkin's lymphoma.J Clin Oncol 1997; 15: 5-10). G-CSF is administered subcutaneously at a dose of 300-960 ug per day during the harvesting period of HSC. There are many strategies used to isolate or purify hematopoietic stem cells. Among them, fluorescence (Preffer FI, et al., Lineage-negative side-population (SP) cells with restricted hematopoietic capacity circulate in normal human adult blood: immunophenotypic and functional characterization. STEM CELLS 2002; 20: 417427) or immunomagnetic techniques ( Using Przyborski SA.Isolation of human embryonal carcinoma stem cells by immunomagnetic sorting.Stem Cells 2001; 19: 500504), cells can be sorted according to specific cell surface markers, or utilizing the differential plate efficiency of stem cells in cultured plastics (Friedenstein). AJ, et al., Fibroblast precursors in normal and irradiated mouse hematopoietic organs.Exp Hematol 1976; 4: 267274), column-separation technique (Huss R. Isolation of primary and immortalized CD34 hematopoietic and Mesenchymal stem cells from various sources. 18:19).

It is well known to use IL-2 to activate mature NK cells. Two methods of treating IL-2 have been proposed. In the first method, NK cells are proliferated and activated in vivo by IL-2, which is administered by directly administering IL-2 to the patient. In the second method, the adult NK cells are isolated from the blood by collecting blood from the patient. There is a method of activating mature NK cells after stimulation with -2 and activating them. All of them aim to destroy cancer cells by NK cells activated by activating NK cells with IL-2. However, these methods use a high concentration (about 150ng / ml) of IL-2, and the side effects are emerging as a problem. Side effects to this include strong toxicity, fever and pulmonary edema and shock, which effects IL-2 stimulating T lymphocytes to produce other cytokines such as TNF or IFN-γ. Because it acts on and other cells. Although studies on the use of low concentrations of IL-2 have been conducted to address these problems, no satisfactory results have been reported (MJ Smyth, Y. Hayakawa, K. Takeda, H. Yagita, Nat Rev Cancer). 2,850, 2002; MA Caligiuri, et al., J. Exp. Med. 171, 1509,1990).

According to the present invention, it has been found that the treatment of differentiated mNK cells of the present invention with a low dose of IL-2 of about 8 to 15 ng / ml can sufficiently stimulate and activate mNK cells. Preferred amount of IL-2 is about 10 ng / ml. Such low doses of IL-2 do not appear to cause activated mNK to cause toxicity.

Several methods are used for cell preservation, the best known of which is cryopreservation. HypoThermosol ^™ BioLife Solutions Inc.) series and DMSO solution (dimethyl sulfoxide) can also be used. As a further aspect of the invention, NK cells may be cryogenically stored before and after administration to a patient. Representative methods of cryogenic preservation are described in US Pat. No. 60,168,991. For small cryogenic insulation, cells can be resuspended at 20 200x10 ⁶ / ml in pre-chilled 5% human serum albumin (HAS). Subsequently, an equivalent amount of 20% dimethylsulfoxide (DMSO) is added dropwise to the HAS solution. The mixture is aliquoted in cryogenic vials in 1 ml / vial and frozen overnight at -80 ° C. in a cryogenic chamber (Nalgene ^™ ). For large cryogenic preservation, cells can be resuspended in AIM V at 30 600 × 10 ⁶ / ml. Then, an equivalent amount of 20% AIM V is added gradually. The mixture is frozen in freezer (Cryocyte, Baxter) at 20 ml / bag using a rate controlled freezing system (Forma ^™ ).

The cytotoxic effective amount of activated mNK cells can vary depending on the in vitro and in vivo use as well as the amount and type of cells that are the ultimate target of these killing cells. In addition, the effective amount may vary depending on the patient's state of health and severity, so the physician must determine all variables appropriately. Generally, the amount administered to an adult cancer patient is 10 ⁶ to 10 ¹² cells per time, preferably 10 ⁸ to 10 ¹¹ cells per time, more preferably 10 ⁹ to 10 ¹⁰ cells per time. MNK cells proliferated according to the method of the present invention can be administered to the patient subcutaneously, intramuscularly, intravenously, intrathecal for treatment with a pharmaceutically acceptable carrier (eg saline solution). The use of various biomaterials (cell carriers) can enhance the efficiency of NK cell delivery to target sites and the efficiency of assassination by NK cells. Cell carriers include polysaccharide methylcellulose (MC Tate, DA Shear, SW Hoffman, DG Stein, MC LaPlaca, Biomaterials 22, 1113, 2001), chitosan (Suh JKF, Matthew HWT. Biomaterials, 21, 2589, 2000; Lahiji A , Sohrabi A, Hungerford DS, et al., J Biomed Mater Res, 51, 586, 2000), P (NIPAM-co-AA) based on N-isopropylacrylamide copolymer (YH Bae, B. Vernon, CK Han, SW Kim) , J. Control.Release 53, 249,1998 H. Gappa, M. Baudys, JJ Koh, SW Kim, YH Bae, Tissue Eng. 7, 35, 2001), and others such as Poly (ethylene oxide) / poly (D , L-lactic acid-co-glycolic acid) (B. Jeong, KM Lee, A. Gutowska, YH An, Biomacromolecules 3, 865, 2002), P (PF-co-EG) (Suggs LJ, Mikos AG.Cell Trans, 8, 345, 1999), PEO / PEG (Mann BK, Gobin AS, Tsai AT, Schmedlen RH, West JL., Biomaterials, 22, 3045, 2001 Bryant SJ, Anseth KS. Biomaterials, 22, 619, 2001) , PVA (Chih-Ta Lee, Po-Han Kung and Yu-Der Lee, Carbohydrate Polymers, 61, 348, 2005), collagen (Lee CR, Grodzinsky AJ, Spector M., Biomaterials 22, 314 5, 2001), alginate (Bouhadir KH, Lee KY, Alsberg E, Damm KL, Anderson KW, Mooney DJ. Biotech Prog 17, 945, 2001 Smidsrd O, Skjak-Braek G., Trends Biotech, 8, 71, 1990) are used as cell carriers for cell therapy in tissue engineering.

Hereinafter, the present invention will be illustrated by the following examples. However, these examples should not be construed as limiting the present invention.

Reference Example  1. From the rat bone marrow Hematopoietic stem cell  Separation and To natural killer cells  Eruption induction

Bone marrow was isolated from whole bones of 8-12 week old mice (C57BL / 6), and red blood cells were removed with lysis buffer (0.2% NaCl, 1.6% NaCl) to remove cells for 10 minutes with 2.4G2 supernatant. Reaction was performed on ice and washed in phosphate buffer (buffer A) containing 2 mM EDTA. Suspend the cells in Buffer A (1X108 / 500µl), add a biotinylated antibody cocktail (Pharmingen, Mac-1, Gr-1, B220, natural killer cells 1.1, CD2, TER-119), and react at 4 ° C for 10 minutes. The cells were washed with buffer A, 900 μl of buffer A and 100 μl of streptavidin-microbeads (Miltenyi Biotec) were added to 1 × 10 8 cells and allowed to react at 4 ° C. for 15 minutes. After washing the cells, suspended in a magnetic bead-activated cell sorter (MACS) buffer (phosphate buffer solution containing 2mM EDTA and 0.5% BSA) was prepared by filtering with nylon mesh (70㎛). A magnetic column (CS column, Miltenyi Biotech) was placed in a Super MACS (magnetic bead cell sorter), passed through cells labeled with magnetic beads, the column was washed thoroughly with MACS buffer, and centrifuged through the column. Lin- cells were obtained. FITC conjugated anti- c-kit (Pharmingen) was added to Lin-cells (1X107), reacted at 4 ° C for 10 minutes, washed, and reacted with anti-FITC microbead (Miltenyi Biotec) for 15 minutes at 4 ° C. Suspended in MACS buffer and passed through MS column in magnetic field. After washing the column sufficiently, 1ml of MACS buffer was added and pushed out to the flunger to obtain magnetic positive cells ( c-kit +), which was used as hematopoietic stem cells. Stem cell factor (30 ng / ml), IL-7 (0.5 ng / ml), Flt-3 ligand (50 ng / ml), to differentiate the isolated hematopoietic stem cells into progenitor cells (pre NK) of natural killer cells RPMI medium (CM) containing indometacin (2 μg / ml) and gentamycin (2 μg / ml) was incubated in 24 well culture plates at a concentration of 1 × 10 6 / ml, with half the medium freshly changed every 3 days. These cytokines were added for 6 days, followed by incubation with CD122-FITC antibody and multisort microbead, followed by MACS to obtain CD122 + p natural killer cells. RPMI-1640 medium supplemented with IL-15 (20ng / ml), Indometacin (2µg / ml) and Gentamycin (2µg / ml) for 6 days to differentiate progenitor cells of natural killer cells into mature killer cells Differentiation was carried out using two methods, which were co-cultured with OP9 stromal cells to differentiate into mature natural killer cells (mature NK-2) and less mature natural killer cells (mature NK) without co-culture. -1) was performed and these cells were harvested (harvest) and analyzed for the expression of natural killer cell surface molecules using a cell fluorescence analyzer (Fig. 1).

Reference Example  2. Flow cytometry  (flow cytometry Analysis of Cell Surface Molecules

Characterization of cells in differentiation stages from hematopoietic stem cells to mature natural killer cells was adjusted to 1x106 cells for immunostaining with antibodies to various cell surface molecules (20mM HEPES, 3% fetal bovine serum, 0.1 Phosphate buffer with% NaN3, pH 7.4). The cell markers of the natural killer cell differentiation stages combined with fluoresceinated isothiocyanate (FITC) or phycoerythrin (PE) fluorescent substance, that is, natural killer cell 1.1, CD122, Ly49, NKG2, etc. were added to the cell sample at 0 ° C. The reaction was performed for 30 minutes, washed twice with staining buffer, and analyzed by cell fluorescence analyzer.

Reference Example 3. Gene expression analysis by RT-PCR (Reverse transcriptase -polymerase chain reaction)

In order to obtain total RNA from each cell, 2 × 10 6 LK1 cells were washed once with phosphate buffer solution, and 500 µl of RNA isolation solution (RNAzol B, TEL-TEST) was added to each sample and gently pipetted. Break, add 50µl of chloroform, mix well, and leave for 5 minutes on ice. It was centrifuged at 12,000 rpm for 15 minutes at 4 ° C, the supernatant was taken, and the same amount of isopropyl alcohol was added and left on ice for 20 minutes. After centrifugation at 12,000 rpm for 20 minutes at 4 ° C., the precipitate was washed with 80% ethanol and dried, and 20 µl of water containing 0.1% diethyl pyrocarbonate was dissolved. Single stranded cDNA was synthesized from the RNA thus obtained using MMLV reverse transcriptase, and reverse transcriptase polymerase chain reaction was performed using the respective primers. The reaction mixture is as follows.

5 x 5 μl reaction buffer

2 μl dNTP (5 μM each for dATP, dCTP, dGTP, TTP)

1 μl primer

1 μl of distilled water

10 μl total cell RNA

1μl reverse transcriptase (200U)

20 μl total

The mixture was reacted at 42 ° C for 30 minutes, and then the reaction was stopped at 90 ° C for 5 minutes. The reaction mixture thus obtained was mixed with the following sample to conduct a polymerase chain reaction.

20 μl of gastric reaction

PCR 10 x buffer 8 μl

1 μl * 5 'primer (20 pmol)

1 μl 3 'primer (20 pmol)

69 μl of distilled water

1μl Taq polymerase (2.5U)

100 μl total

The reaction was allowed to stand at 95 ° C. for 5 minutes to inhibit any other enzymatic activity, followed by 30 cycles of 1 minute 30 seconds at 95 ° C., 1 minute at 55 ° C. and 2 minutes at 72 ° C., and finally 95 The reaction was carried out at 1 ° C. for 30 minutes, at 55 ° C. for 1 minute, and at 72 ° C. for 5 minutes. 10 μl of the reaction product was taken and electrophoresed at 100 V for 30 minutes on a 1% agarose gel.

Reference Example 4. Gas6 and the culture supernatants of transfectant Effect of Gas6 and Axl Antibodies on Differentiation and Activity of Natural Killer Cells

Lin- and c-kit + hematopoietic stem cells from rat bone marrow were obtained from stem cell factor (30 ng / ml), IL-7 (0.5 ng / ml), Flt-3 ligand (50 ng / ml), and indometacin (2 ㎍). / ml), RPMI medium containing gentamycin (2 μg / ml) at a concentration of 1 × 10 6 / ml in a 24-well culture plate. Incubate gas6 transfectant with IL-15 (20ng / ml) in natural killer cell progenitor cells (pre-natural killer cells) obtained by incubating in CM for 6 days at 37 ° C and 5% CO2 for 10 minutes at 2,000rpm. The culture supernatant sample collected by centrifugation and Gas6 and Axl antibodies were further incubated for 6 days to differentiate into mature natural killer cells. These cells were harvested and analyzed for expression of natural killer cell surface molecules using a harvest cell fluorescence analyzer. At this time, the purity of the cells in each step was more than about 95% as a result of analysis using a cell fluorescence analyzer.

Reference Example  5. Axl  Receptor Tyrosine  Kinase siRNA

1) Purpose of Self-inactivating Lenti virus-based vector system

Retroviral vectors are widely used as carriers for the stable and efficient transport of foreign genes into mammalian cells. Among the various retroviral vectors, Lentiviral vectors efficiently transport external genes to non-cycling and post-mitotic cells. In particular, Lentiviral vectors have the advantage of stably expressing in vitro without foreign silencing during cell development. Therefore, we conducted a small interfering RNA (siRNA) experiment that silencing the expression of genes expressed in primary cells rather than normal cell lines using the Lentivirus system. In addition, Lentiviral vector is known to silencing gene expression by infecting hematopoietic stem cells derived from bone marrow cells. In the present invention, Lenti virus-based vector is selected as a vector system for silencing Axl receptor tyrosine kinase gene in natural killer cells. (FIG. 2).

2) oligonuclotide design for siRNA

Axl, a target gene for silencing, consists of three functional domains.

(1) immunoglobulin domain (GTCTCCCGTACTTCCTGGA)

(2) fibronectin type III domain (CTCACCCACTGCAACCTGC)

(3) tyrosine kinase catalytic domain (AGACCTACACAGTTTCCTC).

In the present invention, oligonuclotide was designed as follows to selectively silencing these functional domains to inhibit the function of Axl and candidate genes.

3) Cloning

After annealing Sense oligonuclotide and antisense oligonuclotide and cloning to the BglII-HindIII site of pSUPER vector, these clones were identified by sequencing and the sites containing oligonuclotides were ligation to Lentiviral vector using XhoI and XbaI from H1 promotor. A vector expressing RNAi-inducing siRNA was designed.

4) Self-inactivating Lentivirus stock preparation

In order to make Lenti virus capable of infecting natural killer cells, siRNA-expressing Lentiviral vectors and helper vectors VSVG, RSV-REV, and pMDL g / pRRE were co-transfected into 293T cells by calcium phosphate transfection. After 36-48 hours, harvest the cell supernatant, remove cell debris with a 0.45um filter, centrifuge at 25,000 rpm for 90 minutes, add cold phosphate buffer solution, and incubate overnight at 4 ℃ (overnight). A concentrate was obtained.

5) Established Lentivirus siRNA Expression System

In the present invention, since the primary cells are relatively difficult to transfect in normal mammalian cells, a lentivirus system having high transduction efficiency is used in these cells. 10 cm ² of the virus packaging cell line 293T cells to obtain virus particles Approximately 5x105 cells were added to the culture dish, and after 24 hours, 1.5 ㎍ of each virus packaging plasmid mixture and expression construct were transfected with Lipofectamine. After 4 hours, the cells were changed to fresh DMEM medium and cultured at 37 ° C in a CO ₂ incubator. It was. After 48 hours, the cell containing debris was centrifuged at 3000 rpm for 5 minutes to remove cell debris. The culture supernatant was then filtered and stored with a Millex-HV 0.45um PVDF filter. To confirm virus production in the culture supernatant thus obtained, add 293T cells to 6-well plates of 1x105 cells and 24 hours later, mix virus particles 1: 1 with DEME medium containing 10% fetal bovine serum and 293T. The cells were treated. At this time, polybrene was added at a concentration of 8 ㎍ / ml to increase the binding of psedoviral capsid to the cell membrane. After infecting the virus for 24 hours, the cells were changed to DMEM medium containing 10% fetal bovine serum, and then cultured for 48 hours, and confirmed by fluorescence microscopy and flow cytometry.

Example  One. Hematopoietic stem cells  And separation of cells by differentiation stages of natural killer cells

2 × 108 total myeloid cells were obtained from 8 8-12 week old mice (C57BL / 6) to obtain 4 × 10 7 Lin-cells after MACS. The cells thus obtained were reacted with c-kit microbead to perform MACS again to finally separate hematopoietic stem cells of 4 × 10 6 Lin- and c-kit +. Progenitor cells of CD122 + natural killer cells obtained from these hematopoietic stem cells were obtained and co-cultured with OP9 stromal cells in the presence of IL-15 (+ OP9) or after cultivation of progenitor cells of natural killer cells (-OP9). Hematopoietic stem cells used c-kit and lineage markers to identify the mature natural killer cells and their purity. As a result of analysis with a cell fluorescence analyzer using NK1.1 antibody, cells were obtained for each differentiation stage having a purity of about 95% (FIG. 3).

Expression of genes well known to be specifically expressed in natural killer cells was analyzed by reverse transcriptase polymerase chain reaction in these cells, and the cells of each differentiation stage were consistent with the expression patterns of CD122 and perforin genes known in previous studies. (FIG. 4).

In particular, mature natural killer cells which differentiated progenitor cells of natural killer cells by co-culture with OP9 stromal cells in the presence of IL-15, compared to cells that were not co-cultured with stromal cells, expressed NK1.1 and Ly49 cell surface molecules. The cells were confirmed to have an essential role and specificity for the final differentiation of natural killer cells (FIG. 5).

Example  2. Identification of specific genes expressed according to differentiation stages of natural killer cells

SAGE was performed to discover genes specifically expressed according to differentiation stages from hematopoietic stem cells isolated from Example 1, progenitor cells of natural killer cells, and two mature natural killer cells (FIG. 6). As a result, lysozyme, ferritin heavy chain, Axl, kit ligand, calgranulin B, IL-7 receptor, beta-2 microglobulin, Fc gamma receptor, among genes expressed only in progenitor cells of natural killer cells but not at different stages of differentiation Genes were expressed in a large number of copies and specifically in these cells (Table 1).

Table 1. Genes specifically expressed in progenitor cells of natural killer cells

It was confirmed by reverse transcriptase polymerase chain reaction whether these gene expressions were actually consistent with SAGE results in progenitor cells of natural killer cells, and it was confirmed that the number of SAGE tags was consistent with the expression pattern of genes (FIG. 7).

Based on these results, it is judged that the structure and function of Axl receptor kinase are most likely to influence the differentiation and activity of natural killer cell cells among the genes specifically expressed in progenitor cells of natural killer cell. Cloning and function were clarified.

Example  2. Axl  Effect of Receptor Kinase on Differentiation of Natural Killer Cells

During the differentiation process from hematopoietic stem cells to natural killer cells, progenitor cells of natural killer cells (day 7) were treated with 1 µg of mouse Axl antibody and IL-15 (40 ng / ml) for 6 days in the same manner as described above. Under these conditions, the cells were co-cultured with OP9 stromal cells to differentiate into mature natural killer cells, and then differentiated to NK1.1 antibodies and antibodies to receptors specific for natural killer cells (Ly49G2, Ly49A, Ly49C / F). / I) and stained with flow cytometry, the concentration of differentiation of Axl antibody-treated cells into fully mature natural killer cells was approximately doubled as compared to goat-goat (goat Ig) -treated controls. It was found that Axl affects the differentiation of natural killer cells (FIG. 8).

In order to confirm the differentiation effect of Axl antibodies into mature natural killer cells under different conditions, progenitor cells of natural killer cells were not co-cultured with OP9 stromal cells but with lower concentrations of IL-15 (25 ng / ml) and Axl. After direct treatment with the antibody (500 ng / ml) and immobilization at the same time on the culture well plate, the degree of differentiation into mature natural killer cells was determined. Axl antibody was not treated even without OP9 stromal cells. As compared with the time, the induction of differentiation into natural killer cells was significantly increased in the treated cells (FIG. 9).

Example  3. Axl and Gas6 Effect of ROS on natural killer cell differentiation

Gas6 is known to require a vitamin K-dependent g-carboxylation process for its biological activity as a ligand of Axl.

In order to examine the effect of the signal transduction by the combination of Gas6 and Axl on the differentiation of natural killer cells, the mice treated with recombinant Gas6 during the differentiation process did not show a significant effect on the differentiation of natural killer cells (FIG. 10). In addition, g-carboxylation was required for the biological activity of Gas6. Thus, native gas6 expressed in OP9 stromal cells was used in subsequent experiments.

Gas6 is a vitamin K-dependent carboxylase that uses g-carboxylglutamates, vitamin K 2 and 3-epoxide to reduce carbon dioxide to the glutamic acid side chain to form carbon dioxide, and vitamin K epoxide reductase. K will be reduced. In this cycle, warfarin inhibits reductase and eventually interferes with g-carboxylation of vitamin K-dependent proteins, resulting in uncarboxylated Gas6 eventually losing biological activity (Figure 11).

Therefore, we investigated the effects of warfarin on signaling through Axl receptors to inhibit Gas6 from acting as a ligand of Axl receptors expressed in progenitor cells of natural killer cells. Hematopoietic stem cells were differentiated into progenitor cells of natural killer cells, and then treated with IL-15 (25ng / ml) and warfarin at concentrations of 1 µg / ml, 2.5 µg / ml and 5 µg / ml, respectively. After co-culture with cells (2x104), the progenitor cells of natural killer cells were differentiated into mature natural killer cells by flow cytometry. As a result, not only NK1.1 but also receptors such as NKG2A / C / E and LY49C / F / H / I, which are specifically expressed in natural killer cells, were found to be reduced in a concentration-dependent manner (FIG. 12). These results indicate that the interaction between Axl receptor and its ligand, Gas6, plays an important role in the differentiation of progenitor cells from natural killer cells into mature killer cells.

Example  4. Mice Gas6  Expression vector and retroviral  Vector manufacturing

As described above, recombinant Gas6 was found to be unable to activate the Axl receptor because it was biologically inactive, and RNA and Gas6 primers (sense; 5'-ggcctcgagcatgccgccaccgccccccc) isolated from the OP9 cells of the mouse stromal cell line were obtained to obtain the native Gas6. , antisense; ggcgaattccggtctagggggtggcatgc) was subjected to reverse transcription polymerase chain reaction to amplify Gas6 cDNA and cloned into pCR4-TOPO (Invitrogen Co.) (FIG. 13).

Among cloned clones, cDNA of the same clone as the reference sequence (gene ID; AK086187) was used to prepare Gas6 expression vector and retroviral vector. After retroviral vector pLXSN was treated with EcoRI and CIP enzymes, Gas6 cDNA isolated by treatment with EcoRI restriction enzyme was added to pCR4-Gas6 # 8, and the recombinant pLXSN-Gas6 was prepared by ligation with T4 DNA ligase (FIG. 14, Left), pcDNA3.1 (+) was treated with EcoRI and calf intestinal alkaline phosphatase (CIP) enzymes, and then added Gas6 cDNA isolated from EcoRI restriction enzyme to pCR4-Gas6 # 8 and ligation with T4 DNA ligase. Recombinant pcDNA3.1-Gas6 was prepared (FIG. 14, right).

Orientation of the viral and CMV promoters of Gas6 cDNA in these expression vectors was confirmed by restriction enzyme XhoI, respectively, and the forward and reverse clones were identified in the promoters pLXSN-Gas6 / F, pLXSN-Gas6 / R, and pcDNA3.1-Gas6 / F, pcDNA3.1-Gas6 / R (Fig. 15).

Example  5. Gas6  stable transfectant  Produce

After transfection of pcDNA3.1 (+), pcDNA3.1-Gas6 / F, and pcDNA3.1-Gas6 / R to Swiss3T3 cell line that does not express Gas6 gene, each selected stable transfectants in G418 antibiotic-containing medium and limiting dilution Clones that overexpress the Gas6 gene were obtained. Meanwhile, gas6 retroviral vectors pLXSN-Gas6 / F and pLXSN-Gas6 / R were transfected into PT67, a viral packaging cell line, and screened in G418-containing medium for limiting dilution. Gas6 expression in the infected cell line Swiss 3T3 cells was confirmed by reverse transcriptase chain reaction (A) and Western blot (B) (FIG. 16).

Example  6. Native Gas6 Effect on differentiation of natural killer cells

To determine whether native gas6 secreted from the gas6 transfectant binds to Axl expressed in progenitor cells of natural killer cells and affects their differentiation into mature natural killer cells, we used a vector of normal 3S3 cell controls and vectors in natural killer cells. Differentiation ability of natural killer cells by transfected mock control, and transfectant overexpressing Gas6 and coculture or their culture supernatant, respectively, was analyzed. As a result, it was found that progenitor cells of natural killer cells co-cultured with Gas6 transfectant promoted differentiation into mature natural killer cells compared to the control group (increase from about 14% to 47%) (FIG. 17). Therefore, it can be seen that the Axl receptor tyrosine kinase has a great effect on the differentiation of natural killer cells through the signaling by binding to Gas6 during the differentiation from hematopoietic stem cells to natural killer cells.

Example  7. Mice Axl  Expression system construction

2,750 bp Axl cDNA was subjected to reverse transcriptase polymerase chain reaction with total RNA and Axl primers (sense; 5'-ggtgcccatcaacttcggaa, antisense; 5'-ggatgtcccaggtggaagatt) isolated from a high-expression mouse RAW264.7 macrophage line. Cloned in -TOPO (FIG. 18). In addition, the retroviral vector pLXSN was treated with EcoRI and CIP enzymes, followed by addition of Axl cDNA isolated by treatment with EcoR I restriction enzyme to pCR4-Axl # 4 and ligation with T4 DNA ligase to prepare recombinant pLXSN-Axl. The direction of the viral promoter of Gas6 cDNA in retroviral vectors was confirmed by polymerase chain reaction and sequencing using primers at the downstream of the cloning site and Axl primers. PLXSN-Axl / F , pLXSN-Axl / R.

Example  8. Mice Axl - IgG Fusion protein  (fusion protein) manufacturing

In order to prepare stable transfectant and Axl-IgG fusion protein expressing cell lines by transfection into PT67 cell line in the same manner as gas6 expressing retrovirus, Xho I linker was added at 5 'to BamHI and 3' at mouse IgG1 Fc (constant fragment) site. Was amplified by polymerase chain reaction and cloned into pCR4-TOPO (pCR4-Fc). In addition, amplification was performed by adding a BamHI linker to 3 ′ of the extracellular domain (ECD) of the Axl gene and cloned into pCR4-TOPO (pCR4-Axl / ECD). Xho I and BamHI were treated with pCR4-Fc to isolate 820 bp Fc region, and EcoRI and BamHI were treated with pCR4-Axl / ECD to give 1350 bp Axl / ECD at Fc and Axl at pcDNA3.1 EcoRI-XhoI site. The / ECD fragment was cloned and DNA clones were constructed with BamHI, BamHI / XhoI restriction enzymes (FIG. 19). Finally, PCDNA3.1 / Axl-Fc plasmid was transfected into 293T cells to select transfectants in G418-containing medium and to obtain clones expressing excessive Axl-IgG fusion protein by limiting dilution.

Example  9. Axl  Differentiation of Natural Killer Cells by Inhibition of Expression

siRNA (Post gene transcriptional gene silencing and RNA interference) is useful for elucidating gene function by suppressing specific genes by complementary double strand RNA, and specific target mRNA sequences using 19 bp to 21 bp double stranded RNA It is a technology that can induce silencing of genes in cells by dissolving them automatically.

(1) siRNA construct production

Three target sequences were selected: gtctcccgtacttcctgga (# 1), ctcacccactg caacctgc (# 2), and agacctacacagtttcctc (# 3) as target sequences of the Axl gene, and each base sequence was a sense primer and a primer containing aaag overhangs sequence at 5'site. An oligomer was prepared by attaching aaaa overhangs to the 5 'site to the antisense primer, a complementary base sequence. Each oligomer was annealed at 95 ° C. to prepare a double strand, and the double promoter pFIV-H1 / U6 siRNA-GFP expression vector was digested with BbsI and purified and cloned (FIG. 20).

In order to find clones containing siRNA template inserts among clones obtained by tranformation after cloning, polymerase chain reaction was performed using U6 polymerase chain primer and anti-sense strand siRNA oligonucleotide. In the clone, the polymerase chain reaction product was identified at about 100bp (FIG. 21).

(2) Establishment of Lentivirus siRNA expression system

As described in the reference example, 293T cells were infected with virus for 24 hours using the lentivirus siRNA expression system, and then changed into DMEM medium containing 10% fetal bovine serum, followed by incubation for 48 hours, followed by fluorescence microscopy and flow cytometry. As a result of confirming infection and expression through the analyzer, it was found that the packaged pFIV expression construct tagged with GFP was efficiently transduced (FIG. 22).

(3) lentivirus infection during differentiation from hematopoietic stem cells to natural killer cells

Hematopoietic stem cells were isolated from bone marrow cells of mice, added virus particles per 1x106 cells, infected for 24 hours, incubated for 6 days with medium containing IL-7, FLT3L, and SCF, and then progenitor cells of natural killer cells were obtained. As a result of harvesting and analyzing the presence of transduction through flow cytometry, it was found that lentivirus was well infected and GFP expression was increased, and differentiation of natural killer cells by Axl inhibition was also inhibited (FIG. 23).

The present invention can be used in the field of cancer treatment by cloning and separating and purification of Axl receptor and its ligand Gas6, which can regulate differentiation and activity from hematopoietic stem cells to natural killer cells.

Claims (10)

A method for producing adult NK cells, comprising treating adult stem cells with Axl and Gas6 to obtain adult NK cells. The method of claim 1, wherein the adult stem cells are treated with IL-7, SCF and Flt3L to differentiate into NK progenitor cells, and then the NK progenitor cells are treated with Axl and Gas6. The method of claim 1 or 2, wherein the cells are treated with IL-15 together with Axl and Gas6. The method of claim 1, wherein the adult stem cells are derived from humans. The method of claim 4, wherein the adult stem cells are derived from umbilical cord blood. The method of claim 1, wherein Axl is recombinant Axl. The method of claim 6, wherein the recombinant Axl is generated from a transfectant comprising the recombinant vector pLXSN-Axl. 8. The method of claim 7, wherein the host is a mouse RAW264.7 macrophage line. The method of claim 8, wherein the recombinant Gas6 is generated from a transfectant comprising the recombinant vector pcDNA3.1 (+)-GAS6. The method of claim 9, wherein the host is a mouse OP9 cell line.

Images