KR100650384B1 - A composition for differntiation and a method for production of mature natural killer cell - Google Patents

Abstract

A method for differentiating precursor natural killer cell into mature natural killer cell is provided to obtain large amount of the mature natural killer cell by treating the precursor natural killer cell with Axl receptor tyrosine kinase. The composition for inducing differentiation of precursor natural killer cell into mature natural killer cell is characterized in that it includes at least one ligand selected from the group consisting of antibody of Axl receptor tyrosine kinase(Axl), gamma-carboxylated growth-arrest specific gene6(Gas6) protein and protein S as a ligand of the Axl. The method comprises the steps of: (a) treating hematopoietic stem cell with interleukin-7, stem cell factor and Flt3 ligand to be differentiated into precursor natural killer cell; and (b) treating the precursor natural killer cell with at least one selected from the group consisting of antibody of Axl receptor tyrosine kinase(Axl), gamma-carboxylated growth-arrest specific gene6(Gas6) protein and protein S.

Description

A composition for differentiation of a mature natural killer cell and a method of manufacturing the same {A composition for differntiation and a method for production of mature natural killer cell}

1 is a diagram showing the separation of hematopoietic stem cells from mouse bone marrow and induction of differentiation into mature natural killer cells (BM: bone marrow; HSC: hematopoietic stem cells; pNK: progenitor killer cells; mNK: mature nature). Killer cells).

Figure 2 shows the results of FACS analysis of the purity of cells in differentiation stages when differentiated from mature hematopoietic cells from hematopoietic stem cells isolated from mouse bone marrow according to a known method.

Figure 3 is a hematopoietic stem cell isolated from the bone marrow of the mouse, progenitor killer cells differentiated from the hematopoietic stem cells isolated according to a known method and mature spontaneous killer cells cultured and differentiated with or without OP9 stromal cells from the obtained precursor killer cells The specific gene expression in E. coli was the result of electrophoresis after RT-PCR.

4 is a result of FACS analysis of the degree of final differentiation of mouse progenitor killer cells into mature killer cells by coculture of stromal cells (cell name OP9).

5 is a schematic diagram for the discovery of specific genes expressed in each cell by differentiation stages when SAGE differentiates into mature natural killer cells by SAGE.

Figure 6 shows the agreement between electrophoresis results and SAGE results for Axl expressed in each cell by differentiation stages when mouse hematopoietic stem cells differentiate into mature natural killer cells.

7 is a result of FACS analysis showing the effect of Axl polyclonal antibody on the differentiation of mouse progenitor killer cells into mature killer cells according to the present invention.

8 is an electrophoresis result after RT-PCR showing the effect of Axl polyclonal antibody on the differentiation of mouse progenitor killer cells into mature killer cells according to the present invention.

9 is a FACS analysis result showing the effect of low concentrations of interleukin-15 and Axl polyclonal antibody on the differentiation of mouse progenitor killer cells into mature killer cells without co-culture with stromal cells according to the present invention.

10 shows electrophoresis results after RT-PCR showing the effect of low concentrations of interleukin-15 and Axl polyclonal antibodies on the differentiation of mouse progenitor killer cells into mature killer cells without coculture with stromal cells according to the present invention. to be.

11 is a result of analyzing the effect of Axl polyclonal antibody on interferon-gamma production of mature killer cells according to the present invention.

12 is a result of analyzing the effect of Axl polyclonal antibody on the proliferation of progenitor killer cells according to the present invention.

Figure 13 shows the results of analyzing the effect of mouse recombinant Gas6 on the differentiation of mouse natural killer cells.

14 shows the results of analyzing the effect of warfarin on the differentiation of mouse killer cells.

Figure 15 shows the results of analyzing the recombinant vector of the present invention cloned the mouse Gas6 cDNA.

16 shows the analysis results of the recombinant mouse Gas6 expression vector of the present invention.

17 shows the results of cloning and expression vectors of mouse Gas6 cDNA of the present invention.

18 is a result of analysis of Gas6 expression in a mouse Gas6 transfectant of the present invention.

19 is a FACS analysis showing the effect of mouse Gas6 transfectants on the differentiation of mouse progenitor killer cells into mature killer cells according to the present invention.

20 shows electrophoresis results after RT-PCR showing the effect of mouse Gas6 transfectants on differentiation from mouse progenitor killer cells to mature killer cells according to the present invention.

21 shows the results of analyzing the effect of mouse Gas6 transfectants on interferon-gamma production of mature killer cells according to the present invention.

22 is a result of analyzing the effect of mouse native Gas6 on the proliferation of progenitor killer cells according to the present invention.

Figure 23 shows the results of analysis of the direction of Axl cDNA cloned in the mouse Axl cDNA cloning and retroviral vector (pLXSN) of the present invention.

Figure 24 analyzes the production results of the mouse Axl-Fc expression vector of the present invention.

25 is a result of analyzing the effect of the mouse Axl-Fc fusion protein of the present invention on the differentiation of natural killer cells.

FIG. 26 is a schematic of the vector system used in the present invention based on Self-inactivating Lenti virus.

Figure 27 depicts the configuration of double-promoter siRNA cassettes and siRNA template oligomers used in the present invention.

Figure 28 analyzes the cloning results of the Axl siRNA of the present invention.

29 shows the result of analyzing the degree of infection of pFIV-U6 / H1-GFP virus in 293T cells.

30 shows the results of analysis of the degree of pFIV-U6 / H1-GFP virus infection in mouse hematopoietic stem cells and progenitor killer cells.

      Figure 31 shows the results of analyzing the effect of Axl siRNA of the present invention on the differentiation of mouse natural killer cells.

      32 shows the results of analyzing the anticancer activity of natural killer cells differentiated using Axl polyclonal antibody according to the present invention through animal experiments.

Figure 33 shows the results of analyzing the cancer cell killing ability of natural killer cells differentiated using Axl polyclonal antibody according to the present invention through a cell experiment.

34 is a recombinant expression vector pET-hAxl / ECD of the present invention expressing human Axl.

35 is a recombinant expression vector phGas6 of the present invention expressing human Gas6.

36 shows FACS analysis of mature natural killer cells differentiated from hematopoietic stem cells isolated from human umbilical cord blood into progenitor killer cells and treated with human Axl polyclonal antibodies.

The present invention may be abbreviated as Axl receptor tyrosine kinase (Axl), which induces differentiation from precursor natural killer cells (pNK) to mature natural killer cells (mNK). ) Ligands. More specifically, the present invention treats hematopoietic stem cells with interleukin-7, SCF (stem cell factor) and Flt3L (tymine tyrosine kinase 3 ligand similar to Fms) to differentiate into precursor natural killer cells (pNK), The present invention relates to a method for producing mature natural killer cells, characterized in that the progenitor killer cells are treated with a ligand of Axl to differentiate into mature natural killer cells.

Current cancer treatments, such as surgical surgery, drug therapy, and radiation therapy, may have a temporary therapeutic effect, but there are problems such as resistance, recurrence, or various side effects, so that many developed countries are immune to developing anticancer drugs or diagnostic reagents. Attempts have been made to use immunotherapies to modulate the response, but the development of immune cell therapies that can effectively develop the diagnosis, prevention and treatment of cancer is still known at an early stage. Natural Killer cells (NK) are involved in innate immunity that removes pathogens, cancers, allogeneic cells, interferon-gamma, tumor necrosis factor-alpha, interleukin-12, etc. It has been reported to have a function of regulating memory formation specific to cancer by secreting cytokines and mediating adaptive immunity, and defects in the function and differentiation of natural killer cells in several cancers. Conventional cancer therapy using natural killer cells has been used to enhance the immune response to cancer cells by activating natural killer cells with interleukin-2. These methods have side effects and persistence and resistance of individual therapeutic effects. And it is known that there are many problems such as the difference in the therapeutic effect. In order to enhance the cancer killing effect of natural killer cells, first of all, a large amount of highly active natural killer cells must be secured. Natural killer cells are likely to be applied to the treatment of cancer and intractable virus infections, so that the actual clinical use requires more than 10 billion natural killer cells. However, it has been tried to increase the number of cells very difficult, but interleukin-2 or interleukin-15 was limited to several tens of times, but after mixing cancer cells of others, it was found to increase several hundred times. The newest method of natural killer cell proliferation, released in 2005, is said to multiply and cultivate by culturing cancer cells of another person, which is a mixture of two genes. Increasing at least a hundredfold or more is basic to mix with other cancer cells. Mixing with other people's cancer cells or using genes has left unresolved safety and ethical issues.

An object of the present invention is to provide a large amount of mature natural killer cells by inducing differentiation from pro-natural killer cells to mature natural killer cells.

Another object of the present invention is to provide a substance for inducing differentiation from progenitor killer cells to mature killer cells.

Another object of the present invention is to provide mature mature killer cells activated by treating mature natural killer cells with a low dose of interleukin-2.

Another object of the present invention to provide an immune cell therapy using mature natural killer cells differentiated and activated according to the present invention.

In order to achieve the above technical problem, the present inventors studied the differentiation process from hematopoietic stem cells to mature natural killer cells (Fig. 1), unlike the mature natural killer cells used in most existing studies, and as a result differentiation We found Axl, a gene that promotes stimulation. Axl (p140) is a tyrosine receptor kinase belonging to the family of Sky, Eyk family. Axl has Rse (Sky, Brt, Tif, Dtk, Tyro3), Mer (Eyk, Nyk, Tyro12), and Axl, Rse and Mer Is known to be expressed in most tissues, but its function is not well known. Gas6 is known as a ligand of Axl, which is a vitamin K-dependent growth-potentiating factor, which is inferred to be involved in Axl's unique structural movement, growth and differentiation. Expression of Axl is reported in fibroblasts, myeloid progenigor, macrophages, nerve tissue, follicles, skeletal muscle, but not in lymphocytes. Although the role of Axl and Gas6 is known to regulate homeostasis and hematopoietic stem cell growth of antigen presenting cells, it is not known that Axl and Gas6 have a role in regulating the development and function of natural killer cells. The present inventors have found that Axl plays an essential role in the differentiation of progenitor killer cells into mature killer cells, and based on the discovery of Axl, which acts as a regulator of differentiation into natural killer cells, the hematopoietic stem cells from mouse bone marrow A system was harvested and differentiated into mature killer cells using Axl antibodies and / or Gas6 from these cells. Later, such a differentiation system was modified and applied to hematopoietic stem cells obtained from human peripheral blood, bone marrow, or umbilical cord blood to successfully produce large amounts of mature natural killer cells with enhanced function.

In accordance with this success, in one aspect, the present invention provides ligands of Axl that induce differentiation from hematopoietic stem cells to mature natural killer cells. Specifically, the present invention is a ligand of Axl receptor tyrosine kinase (Axl Receptor tyrosine kinase, "Axl"), the antibody to the Axl, gamma-carboxylated Gas6 (growth-arrest specific gene6) protein and protein S It provides a composition used to induce differentiation from progenitor killer cells to mature killer cells, characterized in that it contains one or more ligands of (protein S), wherein the term “ligand” in combination with Axl A polypeptide or compound that allows its receptor to exhibit a functional response The ligands according to the invention include antibodies to Axl, Gas6 and protein S. The term “differentiation” is generally relatively simple. It is a phenomenon in which a system is separated into two or more qualitatively different sub systems, that is, a structure or a function that is specialized. Maturation means that natural killer cells have the ability to perform their own functions, for example, they have the ability to recognize cancer cells and directly kill them. The expression material can be identified as a marker, which is well known in mice and humans, for example, NK1.1, CD122, and LY49 Family (Ly49A, Ly49C, Ly49D, Ly49E, Ly49F, Ly49G, Ly49H, Ly49I). NKG2A / C / E, and human markers include, for example, NKG2A, NKG2D, NKp30, NKp44 , NKp46, CD56, and CD161.The function of these markers is well recognized by those skilled in the art. .

In another aspect, the present invention is to (i) treat hematopoietic stem cells with interleukin-7, SCF and Flt3L to differentiate into progenitor killer cells, and (ii) treat progenitor killer cells with ligands of Axl to mature natural killer cells. It provides a method for producing mature natural killer cells, characterized in that differentiation to obtain mature natural killer cells.

In one embodiment, the present invention provides a method for producing human mature natural killer cells, characterized in that the hematopoietic stem cells are isolated from human bone marrow, peripheral blood or umbilical cord blood.

In another embodiment, the present invention provides a method for preparing human mature natural killer cells, wherein the ligand of Axl is selected from the group consisting of an antibody against Axl, human gamma-carboxylated Gas6, and a combination of the two. To provide.

In another aspect, the present invention provides a method of human mature natural killer cells, characterized in that the progenitor killer cells are treated with a ligand in the presence of human stroma cells.

In another aspect, the present invention is characterized in that (i) hematopoietic stem cells are treated with interleukin-7, SCF and Flt3L to differentiate into progenitor killer cells, and (ii) progenitor killer cells are treated with ligands of Axl to mature mature killer cells. Differentiated with to obtain mature natural killer cells, and (iii) provides a method for producing activated mature natural killer cells, characterized in that the activated mature natural killer cells by treatment with interleukin-2. In one embodiment, the invention provides a method characterized by treating differentiated mature natural killer cells with about 8-15 ng / ml of Interleukin-2.

In another aspect, the present invention provides an immune cell therapeutic agent comprising activated mature natural killer cells prepared according to the method of the present invention. Herein, the immune cell therapeutic agent may be used as various anticancer agents or immune enhancers. In activated mature killer cells, the term “activation” means that mature killer cells exert substantial cytotoxic efficacy by being stimulated by IL-2.

In another aspect, the present invention is to extract the hematopoietic stem cells from the blood and / or bone marrow of the patient, to treat the hematopoietic stem cells with interleukin-7, SCF and Flt3L to differentiate into progenitor killer cells, the progenitor cells are stromal cells Characterized in that the treatment with Axl ligand in the presence of differentiation into mature natural killer cells, the differentiated mature natural killer cells are treated with interleukin-2 and activated, and the activated mature natural killer cells are injected into the patient himself. Provide immune cell therapy. In the present invention, "autoimmune cell therapy" refers to the selective killing of cancer cells only by taking an immune cell from the patient's body or by using the patient's own hematopoietic stem cell to differentiate into immune cells at the in vitro level, that is, cultured in vitro. Increasing the number of immune cells or enhancing function and then injecting into the body to treat cancer.

In another aspect, the present invention extracts hematopoietic stem cells from human allogeneic umbilical cord blood, donor blood and / or bone marrow, and treats hematopoietic stem cells with interleukin-7, SCF and Flt3L to differentiate into progenitor killer cells, and progenitor killer cells. Is treated with a ligand of Axl in the presence of stromal cells to differentiate into mature natural killer cells, the differentiated mature natural killer cells are treated with interleukin-2 and activated, and the activated mature natural killer cells are injected into the patient. To provide allogeneic immune cell therapy. In the present invention, "homogenous immune cell therapy" refers to the number of immune cells capable of selectively killing only cancer cells through in vitro culture by differentiating them into immune cells at the in vitro level using adult stem cells from fetal cord blood. Increasing or enhancing function and then injected into the body to treat cancer.

Natural killer cells are leukocyte lymphocytes involved in the innate immune system that have a variety of biological functions, including specific microbial infections and the recognition and destruction of neoplasms (Moretta, A., Bottino, C., Mingari, MC, Biassoni, R. and Moretta, L., Nat. Immunol., 3, 6, 2002). Their morphological features show large Granular Lymphocyte (LGL) -like morphology based on the presence of densely pink-purple stained granules in the cytoplasm. These include about 10-20% in normal peripheral blood lymphocytes, 15-25% in hepatic lymphocytes and 1-5% in splenic lymphocytes. Dormant killer cells circulate in the blood, but after activation by cytokines they can leak and infiltrate into most tissues containing pathogen-infected or malignant cells (Colucci, F., Di Santo, JP and Leibson, PJ). , Nat. Immunol., 3, 807, 2002; Kelly JM, Darcy PK, Markby JL, Godfrey DI, Takeda K., Yagita H., Smyth MJ, Nat. Immunol., 3, 83, 2002; Shi FD, Wang HB, Li H., Hong S., Taniguchi M., Link H., Van Kaer L., Ljunggren HG, Nat. Immunol., 1, 245, 2000; Korsgren M., Persson CG, Sundler F., Bjerke T , Hansson T., Chambers BJ, Hong S., Van Kaer L., Ljunggren HG, Korsgren O., J. Exp. Med., 189, 553, 1999). In general, phenotypes of natural killer cells are expressed by CD56 and CD16 (human), NKR-P1C (NK1.1 in mice, CD161 in humans), DX5, Ly49 (mouse; these are limited to specific mouse strains) surface antigen and Characterized by the lack of CD3. The majority of human killer cells (90% of total killer cells) exhibit low density expression of CD56 (which is more cytotoxic than CD56 dim) and express high levels of Fcγ receptor III (FcγRIII, CD16), while about 10% Natural killer cells are CD56 ^bright CD16 ^dim or CD56 ^bright CD16 ⁻ (Schattner, A. and Duggan, DB, Arthritis Rheum., 27, 1072, 1984). Natural killer cells play a key role in early host methods through interactions between activating receptors and their ligands, without prior training in virus-infected cells, tumor cells and some normal allogeneic cells.

Natural killer cells differentiate normal cells from cells without expression of the major histocompatibility complex (MHC) class I molecules by recognition through natural killer cell inhibitory receptors. Have the power. The function of spontaneous killer cells is regulated by the balance between activating and inhibitory receptors that interact with ligands such as major histocompatibility complex class I or major histocompatibility complex class I-associated molecules (Rajaram, N., Tatake , RJ, Advani, SH and Gangal, SG, Br. J. Cancer, 62, 205, 1990). These receptors are classified into two structural families: the immunoglobulin superfamily (leukocyte inhibitory receptor, killer cell Ig-like receptor (KIR, CD158) and C-type lectin-like family (NKG2D, CD94 / NKG2, lymphocyte antigen 49 (LY49)) Natural killer cells produce several cytokines such as interferon-gamma and tumor necrosis factor-alpha after interaction between cell-surface receptors and their ligands (Bryson, JS and Flanagan, DL, J. Hematother. Stem). Cell Res ,. 9, 307, 2000).

The functional functions of natural killer cells can be stimulated in combination with the differential intervention of cytokines and cell surface receptors, including interleukin-2, interleukin-12, interleukin-15, interleukin-18, interleukin-21 and type I interferon-αβ. In contrast, they are associated with natural killer cell receptors as well as immunomodulatory cytokines such as interferon-gamma, interleukin-5, interleukin-10, interleukin-13, interferon-alpha and granulocyte-macrophage colony-stimulating factor (GM-CSF). After interaction between these ligands, many chemokines are produced (Shi FD, Wang HB, Li H., Hong S., Taniguchi M., Link H., Van Kaer L., Ljunggren HG, Nat. Immunol. , 1, 245, 2000). In humans, the CD56 ^bright NK cell subset also contains interferon-gamma, tumor necrosis factor-alpha, tumor necrosis factor-beta, interleukin-10 and granulocyte-macrophage colony-stimulating factors (Lian RH, Maeda M., Lohwasser. S., Delcommenne M., Nakano T., Vance RE, Raulet DH, Takei F., J. Immunol., 168, 4980, 2002), but a subset of CD56 ^dim killer cells Does not produce these cytokines (Colucci, F., Di Santo, JP and Leibson, PJ, Nat. Immunol., 3, 807, 2002; Shi FD, Wang HB, Li H., Hong S., Taniguchi M. , Link H., Van Kaer L., Ljunggren HG, Nat. Immunol., 1, 245, 2000). Although immature killer cells can produce Th2 cytokines such as interleukin-5 and interleukin-13, the ability to produce Th2 cytokines is lost upon final differentiation; Instead, mature natural killer cells acquire the ability to produce interferon-gamma (Van Beneden K., Stevenaert F., De Creus A., Debacker V., De Boever J., Plum J., Leclercq G., J. Immunol., 166, 4302, 2001). Natural killer cells are interleukin-15 (Crosier, KE and Crosier, PS, Pathology, 29, 131, 1997; Nakano, T., Kawamoto, K., Kishino, J., Nomura, K., Higashino, K. and Arita , H., J. Biochem., 323, 387, 1997; Fridell, YW, Villa, J., Jr, Attar, EC and Liu, ET, J. Biol. Chem., 273, 7123, 1997) or interleukin- XCL1, CCL1, CCL3, CCL4, CCL5, CCL22, and CXCL8 (Lundwall, A., partially regulated by Goruppi, S., Ruaro, E. and Schneider, C., Oncogene, 12, 471, 1996). , Dackowski, W., Cohen, E., Shaffer, M., Mahr, A., Dahlback, B., Stenclrclr, J. and Wydro, R., Proc. Natl Acad. Sci., 83, 6716, 1986) Secretes and reacts many chemokines, including. These chemokines play an important role in homing of killer cells against infectious and neoplastic cells in secondary lymphocyte tissues, and the production of interferon-gamma in the tissues can directly regulate T cell responses (Lundwall, A., Dackowski, W., Cohen, E., Shaffer, M., Mahr, A., Dahlback, B., Stenclrclr, J. and Wydro, R., Proc. Natl Acad. Sci., 83, 6716, 1986). The dormant CD56 ^dim / CD16 ⁺ natural killer cell subsets express CXCR1, CXCR2, CXCR3 and CXCR4, while the CD56 ^bright / CD16 ^- natural killer cells express high levels of CCR5 and CCR7. Cytolytic activity of natural killer cells is stimulated by CCL2, CCL3, CCL4, CCL5, CCL10 and CXC3L1.

There are two mechanisms by which natural killer cells kill cancer cells. By using cell receptors, natural killer cells express three types of tumor necrosis factor proteins on the cell surface. It is known to induce apoptosis of cancer cells by binding to these receptors in cancer cells with parsligand (FASL), tumor necrosis factor and trail (TRAIL) (Ashkenazi, A., Nature Rev. Cancer., 2, 420, 2002 ). Another way natural killer cells kill cancer cells is through cellular granules such as Perforin and Granzyme. These substances penetrate the cell membranes of cancer cells to dissolve the cancer cells and eventually cause them to die (Trapani, JA, Davis, J., Sutton, VR and Smyth, MJ, Curr. Opin. Immunol., 12, 323 , 2000).

It is well known that natural killer cells are derived from pluripotent hematopoietic stem cells (the cells that constitute blood and immune cells), but are not yet well known about its development (Lian RH, Maeda M., Lohwasser S). , Delcommenne M., Nakano T., Vance RE, Raulet DH, Takei F., J. Immunol., 168, 4980, 2002). Hematopoietic stem cells (the human Lin ^- CD34 ^+, Mouse ^{Lin - c-kit + Sca2 +} ) can be derived from the fetal thymus, fetal liver, umbilical cord blood and adult bone marrow, and they can differentiate into T cells or natural killer cells In vitro (Lian RH, Kumar V., Semin. Immunol., 14, 453, 2002; Douagi I., Colucci F., Di Santo JP., Cumano A., Blood, 99, 473, 2002) Incubated with interleukin-7, SCF, and flt3L have been known to have the ability to differentiate into pro-NK cells (Williams NS, Klem J., Puzanov IJ, Sivakumar PV, Bennett M., Kumar V., J. Immunol ,. 163, 2648, 1999). Differentiation is generally a phenomenon in which a relatively simple system is separated into two or more qualitatively different subsystems. In other words, it refers to a phenomenon in which a structure or a function is specialized. Progenitor killer cells are intermediate cells of hematopoietic stem cells to mature killer cells that are spread throughout the bone marrow, fetal thymus, blood, spleen and liver. However, they do not produce interferon-gamma and thus have no cytolytic capacity. In the present invention the markers c-kit ⁺ Lin hematopoietic stem cells for the ^(mouse), CD34 ⁺ (person).

Progenitor natural killer cells (CD56 ^- CD122 ⁺ CD34 ^{+ in} humans, CD122 ⁺ NK1.1 ^- DX5 ^-in mice) were treated with interleukin-15 and cultured with immature killer cells (CD122 ⁺ CD16l ^- CD56 ^- KIR ^-in humans). In mice, CD122 ⁺ CD2 ⁺ NK1.1 ⁺ DX5 ⁺ Ly49 ⁻ ) can be differentiated. When the bulb continuously cultured NK cells in a medium containing IL-15 premature (pseudomature) soluble natural killer cells ^{(CD122 + CD2 + NK1.1 + DX5} + CD94 / NKG2 + Ly49 -) to differentiate into cells It is known that they have little cytolytic ability. Stromal cells are cells that secrete many types of cytokines and substances that can react directly with natural killer cell surface receptors during development. These substances secreted by stromal cells have been reported to have the function of expressing LyS49 ⁺ in mature natural killer cells as an essential factor in the maturation process of mature natural killer cells (Iizuka K., Chaplin DD, Wang Y., Wu). Q., Pegg LE, Yokoyama WM, Fu YX, Proc. Natl. Acad. Sci., 96, 6336, 1999; Briard D., Brouty-Boye D., Azzarone B., Jasmin C., J. Immunol., 168, 4326, 2002). Ly49 ⁺ mature natural killer cells (CD56 ⁺ KIR ⁺ CD3 ^{− in} humans, CD122 ⁺ CD2 ⁺ NK1.1 ⁺ DX5 ⁺ CD94 / NKG2 ⁺ Ly49 ⁺ CD3 ^{− in} cells) are pro-natural in the presence of interleukin-15 Differentiation is possible through coculture of killer and stromal cells (Williams NS, Klem J., Puzanov IJ, Sivakumar PV, Bennett M., Kumar V., J. Immunol ,. 163, 2648, 1999). CD94, NKG2A, NKG2C and Ly49B are expressed in the early stages of development of natural killer cells, Ly49G, Ly49C and Ly49I are expressed in the next stage, and Ly49A, D, E and F are expressed in the final stage (Williams NS). , Kubota A., Bennett M., Kumar V., Takei F., Eur. J. Immunol., 30, 2074, 2000). In the present invention, a marker for precursor NK cells, CD122 ⁺ NK1.1 ^- was defined as (mouse).

Progenitor killer cells express transcription factors such as PU.1, GATA3, Id2 and Ets-1 (Boggs SS, Trevisan M., Patrene K., Geogopoulos K., Nat. Immunol., 16, 137, 1998) . Transcription factors ikaros, PU.1 (Colucci F., Samson SI, DeKoter RP, Lantz O., Singh H., Di Santo JP, Blood, 97, 2625, 2001) and Id2 (Ikawa T., Fujimoto S., Kawamoto H., Katsura Y., Yokota Y., Proc. Natl. Acad. Sci ,. 98, 5164, 2001) showed a decrease in the number of progenitor killer cells. Hematopoietic stem cells express transcription factors such as myb oncogene, c-myc and Oct 2b. These factors play an important role in the proliferation and development of progenitor killer cells (Bar-Ner M., Messing LT, Segal S., Immunobiology, 185, 150, 1992; Melotti P., Calabretta B., Blood, 87, 2221, 1996). In progenitor killer cells, Fc receptors, tumor necrosis factor receptors, interleukin-7 and chemokine receptors, and immunomodulators such as CD36 are known to play an important role in progenitor cell killing.

In mature killer cells, signal transduction molecules such as GGS (regulator of G protein signaling), lymphocyte-specific protein tyrosine kinase and Fyn oncogenes are known to be involved in the maturation of NK cells. Ikawa T., Fujimoto S., Kawamoto H., Katsura Y., Yokota Y., Proc. Natl. Acad. Sci ,. 98, 5164, 2001; Ogasawara K., Hida S., Azimi N., Tagaya Y. , Sato T., Yokochi-Fukuda T., Waldmann TA, Taniguchi T., Taki S., Nature, 391, 700, 1998). Mature natural killer cells are cells that have the ability to recognize cancer cells and directly kill them. The treatment of interleukin-2 in mature natural killer cells is known to induce proliferation and activity of mature natural killer cells. Receptor tyrosine kinases are composed of transmembrane proteins that signal extracellular stimuli into cells in response to cell proliferation, cell development, cell survival, and cell migration (Ullrich, A., Schlessinger, J., Cell, 61, 203, 1990; Fantl, WJ, Johnson, DE, Williams, LT, Biochem., 62, 453, 1993; Heldin, C., Cell, 80, 213, 1995). All receptor tyrosine kinases have a common cytoplasmic kinase domain. When growth factors bind to them, receptor tyrosine kinases are activated. In the present invention, the marker for mature natural killer cells is CD122 ⁺ NK1.1 ⁺ (mouse), CD34 ⁺ as a marker for the (person) was defined as mature fully mature cells among NK cells ^{Family Ly49A +, Ly49C +, Ly49D} +, Ly49E +, Ly49F +, Ly49G +, Ly49H +, Ly49I +, NKG2A / C / E ⁺ (mouse), CD56 ⁺ , NKG2A ⁺ , CD161 ⁺ , NKP46 ⁺ , NKP30 ⁺ , NKP44 ⁺ , NKG20 ⁺ (person).

The activity of receptor tyrosine kinases is achieved by self-phosphorylation and tyrosine phosphorylation. Axl (also called ARK or UFO and TYRO7) is one of the first superfamily of receptor tyrosine kinases found. Receptor tyrosine kinases have the following common structure. Two immunoglobulin-associated domains and two fibronectin type III repeat domains linked thereto. Finally, it consists of an extracellular domain containing cytoplasmic tolerant receptor tyrosine kinase (O'Bryan, JP, Frye, RA, Cogswell, PC, Neubauer, A., Kitch, B., Prokop, C., Espinosa, R. III, Lebeau, MM, Earp, HS, Liu, ET, Mol. Cell.Biol., 11, 5016, 1991). Axl is expressed in the chest, skeletal muscle, heart, hematopoietic tissue, testes, ovaries and endometrium (Faust, M., Ebensperger C., Schulz, AS, Schleithoff, L., Hameister, H., Bartram, CR and Janssen , JW, Oncogene, 7, 1287, 1992; Graham, DK, Bowman GW, Dawson, TL, Stanford WL, Earp, HS, and Snodgrass, HR, Oncogen, 10, 2349, 1995; Neubauer, A., Fiebeler, A Graham, DK, O'Bryan, JP, Schmidt, CA, Barckow, P., Serke, S., Siegert, W., Snodgrass, HR, Huhn, D., Blood, 84, 1931, 1994; Berclaz, G., Altermatt, HJ, Rohrbach, V., Kieffer, I., Dreffer, E. and Andres, AC, Ann.Oncol., 12, 819, 2001; Wimmel, A., Glitz, D., Kraus, A Roeder, J. and Schuermann, M., Eur.J. Cancer., 37, 2264, 2001; Sun, WS, Misao, R., Iwagaki, S., Fujimoto, J. and Tamaya, T., Mol Hum.Reprod., 8, 552, 2002). Axl is characterized by a cell adhesion molecule associated with an extracellular ligand binding domain, two immunoglobulin-like domains and two fibronectin type III domains. Recent studies have reported that Axl is involved in cancer formation, development of neurons and hematopoietic tissues (Crosier, K. E. and Crosier, P. S., Pathology, 29, 131, 1997).

Gas6 is a growth stop specific gene 6 protein and is one of the vitamin K dependent protein overload. These families are known as ligands for the Axl / sky families, including Axl and Sky (Rse, Brt, Tif, Dtk, Etk-2 and Tyro3) and Mer (c-Eyk, Nyk and Tyro12) (Godowski, PJ, Mark). , MR, Chen, J., Sadick, MD, Raab, H. and Hammonds RG, Cell, 82, 355, 1995; Varnum, BC, Young, C., Elliott, G., Garcia, A., Bartley, TD , Fridell, YW, Hunt, RW, Trail, G., Clogston, C., Toso, RJ, Nature, 373, 623, 1995; Chen, J., Carey, K. and Godowski, PJ, Oncogene, 14, 2033 , 1997). Gas6 has a 46% identical amino acid sequence and is similar in structure to protein S, a serum protein involved in blood coagulation control (Manconrftti, G., Brancolini, C., Avanzi, G. and Schneider, C., Mol) Cell Biol., 13, 4976, 1993). Gas6 is expressed in the intestines, testes, lung endothelium, endometrium and also in endometrial cancers (Prieto, AL, Weber, JL, Tracy, S., Heeb, MJ and Lai, C., Brain Res., 816 , 646, 1999; Chan, MCW, Mather, JP, Mccray, G. and Lee, WM, J. Androl., 21, 291, 2000; Wimmel, A., Glitz, D., Kraus, A., Roeder, J. and Schuermann, M., Eur. J. Cancer., 37, 2264, 2001).

In order for Gas6 to have full biological activity, vitamin K-dependent gamma-carboxylation must occur (Manconrftti, G., Brancolini, C., Avanzi, G. and Schneider, C., Mol. Cell. Biol., 13, 4976, 1993; Lundwall, A., Dackowski, W., Cohen, E., Shaffer, M., Mahr, A., Dahlback, B., Stenclrclr, J. and Wydro, R., Proc. Natl Acad. Sci., 83, 6716, 1986; Chen, J., Carey, K. and Godowski, PJ, Oncogene, 14, 2033, 1997). Gas6 acts as a factor for thrombin-induced cell growth in smooth muscle cells (Nakano, T., Kawamoto, K., Kishino, J., Nomura, K., Higashino, K. and Arita, H., J. Biochem., 323, 387, 1997). In addition, Gas6 is known to be a chemoattractant involved in Axl-mediated cell migration of vascular smooth muscle cells (Davis, JE, Smyth, MJ and Trapani, JA, Eur. J. Immunol., 31, 39-47 , 2001). Gas6 also protects NIH3T3 cells from serum death from cell death and keeps the cell cycle running (Goruppi, S., Ruaro, E. and Schneider, C., Oncogene, 12, 471, 1996). Recently, Gas6 has also been known to induce beta-catenin stabilization and transcriptional activity of T-cell factors in mammalian cells (Goruppi, S., Chiaruttini, C., Ruaro, ME, Varnum, B.). and Schneider, C., Mol. Cell. Biol., 21, 902, 2001).

Protein S is a vitamin-K dependent plasma glycoprotein that prevents coagulation and acts as a cofactor of activated protein C upon the degradation of coagulation factors Va and VIIIa. Protein S also acts as a mitogen in other cell types and is a ligand of Tyro3, a member of the tumorigenic Axl family (Wimmel A. et al., Cancer 1999 Jul 1; 86 (1): 43-9). Protein S, like Gas6, has been shown to stimulate members of the Axl / Sky family. Protein S has a structure similar to Gas6 (consists of an amino terminal Gla domain, four EGF-like domains, and a G domain such as a signal transduction molecule) and has the ability to phosphorylate the Axl / Sky superfamily (Evenas). P., et al., Biol Chem. 2000 Mar; 381 (3): 199-209).

Protein S is present in human plasma in complex form with free protein forms and C4b-binding proteins (Dahlback & Stenflo (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 2512-2516). Human protein S can be obtained by a simple purification method, for example barium citrate adsorption, DEAE-Sephacel chromatography and chromatography on blue sepharose (Dahlback B., Biochem. J.). (1983) 209, 837-846. Protein S can also be prepared by genetic recombination (Merel Van Wijnen, et al., Biochem. J. 330, 389-396).

Recombinant DNA methods used in the present invention are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) and / or Ausubel et al., Eds., Current Protocols in Molecular Biology, Green Publishers Inc. and Wiley and Sons, N.Y. (1994). For example, a large amount of the desired nucleotide sequence can be generated by inserting a nucleic acid sequence encoding Axl or Gas6 or Protein S into an appropriate vector as described exemplarily below. The sequence can then be used to generate detection probes or amplification primers. Alternatively, a large amount of protein can be produced by inserting a polynucleotide encoding Axl or Gas6 or protein S into an expression vector, introducing the resulting expression vector into an appropriate host, and culturing. Another method of obtaining nucleic acid sequences is PCR (polymerase chain reaction). Reverse transcriptase is used to prepare cDNA from poly (A) + RNA or total RNA. Typically, two primers complementary to two separate regions of the cDNA encoding the amino acid sequence of the polypeptide of Axl or Gas6 or Protein S are added to the cDNA together with a polymerase such as Taq polymerase and the polymerase cDNA between the two primers. Amplify the area. Nucleic acid molecules encoding the amino acid sequence of the polypeptide of Axl or Gas6 or protein S can be amplified / expressed in prokaryotic, yeast, baculovirus systems and / or eukaryotic host cells (Meth. Enz. Vol. 185 DV Goeddel). ed., Academic Press, Sna Diego Calif., 1990). Typically expression vectors contain sequences for plasmid maintenance and cloning and expression of foreign nucleotide sequences. Such sequences include promoters, enhancers, replicators, transcription termination sequences, secretory leader sequences, ribosomal binding sites, polyadenylation sequences, polylinkers for inserting the coding nucleic acid of the polypeptide to be expressed, and selection markers. Such flanking sequences are well known to those skilled in the art and can be readily used selectively.

Examples of suitable promoters for transcription of Axl or Gas6 or Protein S coding DNA in mammalian cells include the SV40 promoter (Subramani et al., Mol. Cell Biol. 1 (1981), 854-864), MT-1 (metallothionein gene) ) promoter (Palmiter et al., Science 222 (1983), 809-814), CMV promoter (Boshart et al., Cell 41: 521-530, 1985) or adenovirus 2 major late promoter (Kaufman and Sharp, Mol. Cell. Biol, 2: 1304-1319, 1982). Examples of promoters suitably used in insect cells include polyhedrin promoters (US Pat. No. 4,745,051; Vasuvedan et al., FEBS Lett. 311, (1992) 7-11), P10 promoters (JM Vlak et al., J. Gen. Virology 69, 1988, pp. 765-776), the baculovirus immediate early gene 1 promoter (US Pat. Nos. 5,155,037 and 5,162,222) or the baculovirus 39K delayed-early gene promoter (US Pat. No. 5,155,037 and 5,162,222). Suitable promoters for yeast host cells include, for example, the yeast glycolysis gene (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073-12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419-434) or alcohol dehydrogenase gene (Young et al., In Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982) or TPI1 (US Patent 4,599,311) or ADH2-4c (Russell et al., Nature 304 (1983), 652-654) promoter. Suitable promoters for fungal host cells include the ADH3 promoter (McKnight et al., The EMBO J. 4 (1985), 2093-2099) or the tpiA promoter. Examples of other suitable promoters include A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger or A. awamori glucoamylase (gluA) , Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase coding gene.

The DNA sequence can be used if necessary in human growth hormone terminator (Palmiter et al., Science 222, 1983, pp. 809-814) or TPI1 (Alber and Kawasaki, J. Mol. Appl. Gen. 1, 1982, pp. 419-434 ) Or ADH3 (McKnight et al., The EMBO J. 4, 1985, pp. 2093-2099) terminator. The expression vector may also contain a set of RNA splice sites downstream from the promoter and upstream from the insertion site of the DNA sequence. Preferred RNA splice sites can be obtained from adenovirus and / or immunoglobulin genes. The expression vector also includes a polyadenylation signal downstream of the insertion site. Particularly preferred polyadenylation signals are early or late polyadenylation signals from SV40, polyadenylation signals from adenovirus 5 Elb regions or human growth hormone gene terminators (DeNoto et al. Nucl. Acids Res. 9: 3719-3730, 1981 )to be. The expression vector may also contain a noncoding viral leader sequence, such as an adenovirus 2 tripartite leader, between the promoter and the RNA splice site and may contain an enhancer sequence, such as an SV40 enhancer.

In order to direct the proteins according to the invention into the secretory pathway of the host cell, secretory signal sequences (also known as leader sequences, prepro sequences or pre sequences) can be provided to the recombinant vector. The secretory signal sequence is bound to the peptide encoding DNA sequence in the correct reading frame. Secretory signal sequences are often located 5 'of the peptide coding sequence. Secretory signal sequences can be normally associated with the peptide or derived from coding genes of other secretory sequences. In order to be secreted from yeast cells, the secretory signal sequence can encode any signal peptide that ensures sufficient induction of the expression polypeptide into the cell's secretory pathway. The signal peptide may be a natural signal peptide or a functional part thereof or a synthetic peptide. Suitable signal peptides include alpha-factor signal peptide (US Pat. No. 4,870,008), mouse saliva amylase (O. Hagenbuchle et al., Nature 289, 1981, pp. 643-646), modified carboxypeptidase signal peptide (LA) Valls et al., Cell 48, 1987, pp. 887-897), yeast BAR1 signal peptide (WO 87/02670) or yeast aspartic acid protease 3 (YAP3) signal peptide (M. Egel-Mitani et al. , Yeast 6, 1990, pp. 127-137. For sufficient secretion in yeast, leader peptide coding sequences can be inserted downstream of the signal sequence and upstream of the coding DNA sequence. The function of the leader peptide allows the expressed peptide to migrate from the endoplasmic reticulum to the Golgi apparatus and secretory glands (ie, secretion of proteins along the cell wall or across the cell membrane around the cytoplasm) for secretion into the culture medium. The leader peptide may be a yeast alpha-factor leader (US Pat. No. 4,546,082, US Pat. No. 4,870,008, EP 123 294, EP 123 544 and EP 163 529). Alternatively, the leader peptide may be a synthetic leader peptide, and may be constructed as described, for example, in WO 89/02463 or W92 / 11378. Signal peptides for use in fungi may conveniently be derived from Aspergillus sp. Amylase or glucoamylase coding gene, Rhizomucor miehei lipase or protease or Humicola lanuginosa lipase coding gene. Signal peptides for use in insects may conveniently be derived from insect genes (International Patent No. WO90 / 05783), such as Lipidopteran Manduca sexta adipokinetic hormone precursor signal peptide (US Pat. No. 5,023,328).

Methods for transfecting and expressing DNA sequences in mammals are described, for example, in Kaufman and Sharp, J. Mol. Biol. 159 (1982), 601-621; Southern and Berg, J. Mol. Appl. Genet. 1 (1982), 327-341; Loyter et al., Proc. Natl. Acad. Sci. USA 79 (1982), 422-426; Wigler et al., Cell 14 (1978), 725; Corsaro and Pearson, Somatic Cell Genetics 7 (1981), 603, Graham and van der Eb, Virology 52 (1973), 456; and Neumann et al., EMBO J. 1 (1982), 841-845. The cloned DNA sequence is for example calcium phosphate-mediated transfection into cultured mammalian cells (Wigler et al., Cell 14: 725-732, 1978; Corsaro and Pearson, Somatic Cell Genetics 7: 603-616, 1981 Graham and Van der Eb, Virology 52d: 456-467, 1973) or electroporation (Neumann et al., EMBO J. 1: 841-845, 1982). Genes that provide a selective phenotype (selection marker) for identifying and selecting cells expressing foreign DNA are generally introduced into the cell along with the gene or cDNA. Preferred selectable markers include genes that provide resistance to drugs such as neomycin, hygromycin and methotrexate. The selectable marker may be an amplifiable selectable marker. Preferred amplifiable selectable markers are dihydrofolate reductase (DHFR) sequences. The selection marker may be introduced into the cell simultaneously with the gene of interest as a separate plasmid or into the same plasmid. In the same plasmid, the selectable marker and the corresponding gene may be under the control of another promoter or the same promoter, the latter arrangement producing a dicistronic message. Constructs of this type are known (US Pat. No. 4,713,339). It may also be advantageous to add additional DNA, known as carrier DNA, to the mixture that is introduced into the cell.

After the cells take up the DNA, they typically grow for 1-2 days in the appropriate growth medium to initiate expression of that gene. The term appropriate growth medium means a medium containing nutrients and other components necessary for the growth of cells and the expression of the protein of interest. In general, the medium includes a carbon source, a nitrogen source, essential amino acids, essential sugars, vitamins, salts, phospholipids, proteins and growth factors. For the production of gamma-carboxylated proteins, the medium contains vitamin K, preferably at a concentration of about 0.1 mug / ml to about 5 mug / ml. Drug screening is then applied to select the growth of cells expressing the selectable marker in a stable manner. For cells transfected with amplifiable selectable markers, the drug concentration can be increased to select for an increased copy number of the cloned sequence, thereby increasing the expression level. Clones of stably transfected cells are then screened for expression of the protein of interest.

The host cell into which the coding DNA sequence of the peptide is introduced may be any cell capable of producing post-transcriptional peptides, including yeast, fungal and higher eukaryotic cells. Examples of mammalian cell lines used in the present invention include COS-1 (ATCC CRL 1650), Baby Hamster Kidney (BHK) and 293 (ATCC CRL 1573; Graham et al., J. Gen. Virol. 36: 59-72, 1977) cell lines. Preferred BHK cell lines are tk-ts13 BHK cell lines (ATCC CRL 10314) (Waechter and Baserga, Proc. Natl. Acad. Sci. USA 79: 1106-1110, 1982). Other cell lines may also be used: rat Hep I (rat liver tumor; ATCC CRL 1600), rat Hep II (rat liver tumor; ATCC CRL 1548), TCMK (ATCC CCL 139), human lung (ATCC HB 8065), NCTC 1469 (ATCC CCL 9.1), CHO (ATCC CCL 61) and DUKX cells (Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77: 4216-4220, 1980). Examples of suitable yeasts include cells of Saccharomyces sp. Or Schizocaromyces spp., In particular Saccharomyces cerevisiae or Saccharomyces cluiberg. Methods for transforming yeast cells with heterologous DNA and generating heterologous polypeptides therefrom are described in US Pat. Nos. 4,599,311, 4,870,008, 5,037,743 and 4,845,075. Transformed cells are selected by a phenotype determined by a selection marker, typically drug resistance or the ability to grow in the absence of certain nutrients such as leucine. Preferred vectors for yeast are the POT1 vectors described in US Pat. No. 4,931,373. Examples of other filamentous fungal cells are strains of Aspergillus spp., Neurospora spp., Fusarium spp. Or Trichoderma spp., In particular A. oryzae, A. nidulans or A. niger. The use of Aspergillus species for protein expression is described, for example, in EP 272 277 and EP 238 023, EP 184 438. Transformation of F. oxysporum can be carried out as described, for example, in Malardier et al., 1989, Gene 78: 147-156. Transformation of Trichoderma species can be carried out as described in EP 244 234. When filamentous fungi are used as host cells, the DNA construct can conveniently be integrated into the host chromosome to obtain a recombinant host cell. This integration is generally considered an advantage because the DNA sequence remains stable in the cell. Incorporation of DNA constructs into host chromosomes is routine, for example homologous or heterologous.

It can be carried out by a combination. Transformation of insect cells and generation of heterologous polypeptides can be carried out as described in US Pat. Nos. 4,745,051, 4,879,236, 5,155,037 and 5,162,222 and EP 397,485. Insect cell lines used as hosts may suitably be Lepidoptera cell lines such as Spodoptera frugiperda cells or Trichoplusia ni cells (US Pat. No. 5,077,214). Culture conditions may suitably be as described in WO89 / 01029 or WO89 / 01028.

The above-described transformed or transfected host cells may be cultured in a suitable nutrient medium under conditions permitting the expression of the protein and then all or part of the resulting protein may be recovered from the culture. The medium used for culturing the cells may be a conventional medium suitable for growing host cells, for example a minimal or complex medium containing a suitable supplement. Suitable media can be obtained from the manufacturer or prepared as known (eg, catalog of ATCC). The protein produced by the cells can then be recovered from the culture medium by conventional procedures. Conventional procedures separate host cells from the medium by centrifugation or filtration, and precipitate the proteolytic components of the supernatant or filtrate with salts (e.g. ammonium sulfate) and perform several chromatography procedures (e.g. ion exchange chromatography). , Gel filtration chromatography, affinity chromatography, and the like).

Axl antibodies used in accordance with the present invention may be either polyclonal or monoclonal. Axl antibodies are available from Santa Cruz Biotech. In addition, the antibody used in the present invention can be prepared according to a known method.

Polyclonal antibodies are obtained by several subcutaneous or intraperitoneal injections of antigen and adjuvant into an animal. Proteins that are immunogenic in the species to be immunized (eg keyhole hatch hemocyanin, serum inducing agents (eg maleimidobenzoyl sulfosuccinimide ester, N-hydroxysuccinimide, glutaraldehyde, succinic anhydride, SOCl2) Etc.) Animals may contain, for example, three doses of a protein or conjugate (for rabbits or mice, respectively) of 100 mug or 5 mug to an antigen, immunogenic binder or derivative. Immunized by combining with complete excipients and percutaneously injecting the solution at several sites One month later animals are inoculated subcutaneously at several sites with 1/5 to 1/10 of the initial amount of peptide or conjugate in Freund's complete excipients. Blood is drawn from the animals after 14 to 14 days and the serum is assayed for antibody titer Inoculate the animal to the titer height and preferably the animal is the same antigen Inoculated in combination, but they cause in combination with other proteins, and / or other cross-linking agents. In addition, conjugates can be made in recombinant cell culture as protein fusion. Is also suitably used for the coagulant, such as alum enhance the immune response.

Monoclonal antibodies are obtained from the group of substantially homogeneous antibodies. That is, the individual antibodies, including that group, are identical except for possible naturally occurring mutations that may be present in small amounts. Thus, modified monoclonal refers to the properties of the antibody as not being a mixture of individual antibodies. For example, monoclonal antibodies are prepared using the hybridoma method described in Kohler et al., Nature, 256: 495 (1975), or by recombinant DNA method (US Pat. No. 4,816,567). can do. In hybridoma methods, mice or other suitable host animals (eg hamsters) are immunized as described above to induce lymphocytes that can produce or produce antibodies that specifically bind to the protein used for immunization. Alternatively, lymphocytes can be immunized in vitro. Lymphocytes are then fused with myeloma cells using a suitable fusing agent such as polyethylene glycol to form hybridoma cells (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59 103 (Academic Press, 1986). The prepared hybridoma cells are grown in a suitable culture medium, preferably containing one or more substances that inhibit the growth or survival of the unfused parental myeloma cells, for example, the parental myeloma cells are hypoxanthine guanine phosphory. Without the transferase (HGPRT or HPRT) to be seen, hybrido's culture medium will typically include hypoxanthine, aminopterin and thymidine (HAT medium).

These substances inhibit the growth of HGPRT-deficient cells. Preferred myeloma cells are those that fuse efficiently, support stable high-level antibody production of antibodies by selected antibody-producing cells, and are sensitive to media such as HATs. Among these, preferred myeloma cell lines are mouse myeloma cell lines, eg, MOPC-21 and PMC-11 mouse tumors available from Salk Institute Cell Distribution Center, San Diego, CA, USA, and SP-2 or X63-Ag8 available from ATCC, USA -653 cells. Human myeloma and mouse-human heteromyeloma cell lines can also be used for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51 63 (Marcel Dekker, Inc., New York, 1987)). Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies against the antigen. Preferably, the binding specificity of the monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or in vitro binding assays such as radioimmunoassay or enzyme-linked immunosorbent assay. The binding affinity of monoclonal antibodies can be determined, for example, by Scatchard analysis of Munson et al., Anal. Biochem., 107: 220 (1980). After identifying hybridoma cells that produce antibodies with the specificity, affinity, and / or activity of interest, they can be cloned by restriction dilution procedures to obtain clones and standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59 103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, hybridoma cells can be grown in vivo as ascites tumors in an animal. Monoclonal antibodies secreted by aclones are conventional antibody tablets such as, for example, protein A-sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography from culture media, ascites fluid or serum. Separate by procedure.

Hematopoietic stem cells have their own regenerative capacity and are the origin of progenitor cells committed during the lifetime of an individual. A general feature of primitive as well as more committed hematopoietic stem cells is the expression of CD34 antigens that can be detected by FACS (fluorescence-activated cell sorter) analysis using anti-CD34 monoclonal antibodies. Hematopoietic stem cells are derived from bone marrow, peripheral blood, umbilical cord blood and the like. Umbilical cord blood is known to be the most abundant source of hematopoietic stem cells. Umbilical cord blood obtained directly from the placenta after delivery is rich in hematopoietic stem cells and has a higher proliferative capacity than cells obtained from bone marrow and peripheral blood. Infusion of hematopoietic growth factors, such as granulocyte-colony stimulating factor, can significantly promote the mobilization of CD34 (+) cells (Beyer J et al., Hematopoietic rescue after high-dose chemotherapy using autologous peripheral-blood progenitor cells or bone marrow : a randomized comparison.J Clin Oncol 1995; 13: 1328-1335; and Smith TJ et al., Economic analysis of a randomized clinical trial to compare filgrastim-mobilized peripheral-blood progenitor-cell trnasplantation and autologous bone marrow transplantation in patients with Hodgkin's and non-Hodgkin's lymphoma. J Clin Oncol 1997; 15: 5-10). Granulocyte-colony stimulating factor is administered subcutaneously at a dose of 300-960 ug per day during the harvest of hematopoietic stem cells. There are many strategies used to isolate or purify hematopoietic stem cells. Among them, fluorescence (Preffer FI, et al., Lineage-negative side-population (SP) cells with restricted hematopoietic capacity circulate in normal human adult blood: immunophenotypic and functional characterization. STEM CELLS 2002; 20: 417427) or immunomagnetic techniques ( Using Przyborski SA.Isolation of human embryonal carcinoma stem cells by immunomagnetic sorting.Stem Cells 2001; 19: 500504), cells can be sorted according to specific cell surface markers, or utilizing the differential plate efficiency of stem cells in cultured plastics (Friedenstein). AJ, et al., Fibroblast precursors in normal and irradiated mouse hematopoietic organs.Exp Hematol 1976; 4: 267274), Huss R. Isolation of primary and immortalized CD34 hematopoietic and Mesenchymal stem cells from various sources. STEMCELLS 2000 18:19).

It is well known to use interleukin-2 to activate mature natural killer cells. Two treatment methods for interleukin-2 have been proposed. In the first method, natural killer cells are proliferated and activated in vivo by interleukin-2 administered by directly administering interleukin-2 to the patient. In the second method, mature natural killer cells are isolated from blood by collecting blood from the patient. By stimulating with Interleukin-2, the activated mature natural killer cells are then administered back to the patient. All of them aim to destroy cancer cells by activating natural killer cells by activating natural killer cells with interleukin-2. However, these methods use a high concentration (about 150ng / ml) of Interleukin-2, which is a side effect of this problem has emerged as a problem. Side effects to this include strong toxicity, fever and pulmonary edema and shock. These effects can cause T-lymphocytes to stimulate the production of other cytokines, such as tumor necrosis factor or interferon-gamma, Because it acts on the vascular endothelium and other cells. Studies on the use of low levels of interleukin-2 have been conducted to address these problems, but no satisfactory results have been reported (MJ Smyth, Y. Hayakawa, K. Takeda, H. Yagita, Nat Rev Cancer). 2,850, 2002; MA Caligiuri, et al., J. Exp. Med. 171, 1509,1990).

According to the present invention, it has been found that even when the differentiated mature killer cells of the present invention are treated with a low dose of Interleukin-2 at about 8-15 ng / ml, the mature natural killer cells can be sufficiently stimulated and activated. Preferred amount of interleukin-2 is about 10 ng / ml. Such low doses of interleukin-2 do not appear to cause toxic activated mature killer cells. Several methods are used for cell preservation, the best known of which is cryopreservation. HypoThermosol ™ (BioLife Solutions Inc.) series and DMSO solution (dimethyl sulfoxide) can also be used. As a further aspect of the invention, natural killer cells may be cryogenically stored before and after administration to a patient. Representative methods of cryogenic preservation are described in US Pat. No. 60,168,991. For small cryogenic warming cells can be resuspended at 200x10 ⁶ / ml in pre-chilled 5% human serum albumin (HAS). Subsequently, an equivalent amount of 20% dimethylsulfoxide (DMSO) is added dropwise to the HAS solution. The mixture is aliquoted in an cryogenic vial in an amount of 1 ml / vial and frozen overnight at −80 ° C. in a cryogenic chamber (Nalgene ™). For large scale cryogenic preservation, cells can be resuspended in AIM V at 600 × 10 ⁶ / ml. Then, an equivalent amount of 20% AIM V is added gradually. The mixture is frozen in freezer (Cryocyte, Baxter) at 20 ml / bag using a rate controlled freezing system (Forma ™). The cytotoxic effective amount of activated mature natural killer cells may vary depending on the in vitro and in vivo use as well as the amount and type of cells that are the ultimate target of these killer cells.

The effective cytotoxicity is defined as the amount of drug that can kill the mature natural killer cells (which can cause pharmacological action). In addition, the effective amount may vary depending on the patient's state of health and severity, so the physician must determine all variables appropriately. Generally, the amount administered to an adult cancer patient is 10 ⁶ to 10 ¹² cells per time, preferably 10 ⁸ to 10 ¹¹ cells per time, more preferably 10 ⁹ to 10 ¹⁰ cells per time. Mature natural killer cells propagated according to the method of the present invention may be administered to the patient subcutaneously, intramuscularly, intravenously, or intradural for treatment with a pharmaceutically acceptable carrier (eg, saline solution). The use of various biomaterials (cell carriers) can enhance the efficiency of natural killer cells being delivered to the target area and the ability of the natural killer cells to kill. Cell carriers include polysaccharide methyl cellulose (MC Tate, DA Shear, SW Hoffman, DG Stein, MC LaPlaca, Biomaterials 22, 1113, 2001), chitosan (Suh JKF, Matthew HWT. Biomaterials, 21, 2589, 2000; Lahiji A, Sohrabi A, Hungerford DS, et al., J Biomed Mater Res, 51, 586, 2000), P (NIPAM-co-AA) (YH Bae, B, based on N-isopropylacrylamide copolymer) Vernon, CK Han, SW Kim, J. Control.Release 53, 249,1998 H. Gappa, M. Baudys, JJ Koh, SW Kim, YH Bae, Tissue Eng. 7, 35, 2001). (Ethylene oxide) / poly (D, L-lactic acid-co-glycolic acid) (B. Jeong, KM Lee, A. Gutowska, YH An, Biomacromolecules 3, 865, 2002), P (PF-co-EG) ( Suggs LJ, Mikos AG.Cell Trans, 8, 345, 1999), PEO / PEG (Mann BK, Gobin AS, Tsai AT, Schmedlen RH, West JL., Biomaterials, 22, 3045, 2001 Bryant SJ, Anseth KS. Biomaterials , 22, 619, 2001), PVA (Chih-Ta Lee, Po-Han Kung and Yu-Der Lee, Carbohydrate Polymers, 61, 348, 2005), collagen (Lee CR, Grodzinsky AJ, Spector M., Biomaterials 22, 3145, 2001), alginate (Bouhadir KH, Lee KY, Alsberg E, Damm KL, Anderson KW, Mooney DJ.Biotech Prog 17, 945, 2001 Smidsrd O, Skjak-Braek G., Trends Biotech, 8, 71, 1990) are used as cell carriers for cell therapy in tissue engineering.

Hereinafter, the present invention will be illustrated by the following examples with reference to the drawings. However, these examples should not be construed as limiting the present invention.

Example  1. Identification of specific genes expressed according to differentiation stage of mouse natural killer cells

(A) Isolation of Hematopoietic Stem Cells from Bone Marrow (BM) and Differentiation of Natural Killer Cells

Whole bones of 8-12 week old mice (C57BL / 6, purchased from Korea Reasearch Bioscience and Biotechnology and administered according to animal care instructions under aseptic conditions) were isolated to obtain bone marrow cells, followed by cytolysis buffer (0.2% NaCl, 1.6 The cells were reacted with 2.4G2 supernatant for 10 min on ice and washed in phosphate buffer (buffer A) containing 2 mM EDTA. Suspend the cells in Buffer A (1 × 108/500 μl), add a biotin-attached antibody cocktail (Mac-1, Gr-1, B220, NK 1.1, CD2, TER-119, Pharmingen) and 10 at 4 ° C. After the reaction, the cells were washed with buffer A, and 900 µl of buffer A and 100 µl of streptavidin-microbeads (Miltenyi Biotec) were added to 1 × ^{10 8} cells for 15 minutes at 4 ° C. Reacted. The cells were washed and then suspended in MACS (Magnetic Bead-Activated Cell Sorter) buffer (phosphate buffer containing 2 mM EDTA and 0.5% BSA) and filtered through nylon mesh (70 μm). A magnetic column (CS column, Miltenyi Biotech) was placed in the super MACS, and the magnetic beads were passed through the labeled cells, the column was thoroughly washed with MACS buffer solution, and the solution passed through the column was centrifuged to give the Lineage negative (Lin ^−). ) Cells were obtained. Anti-c-kit (Pharmingen) with FITC attached to Lin ^- cells (1X10 ⁷ ) was reacted at 4 ° C for 10 minutes, washed, and reacted with anti-FITC microbeads (Miltenyi Biotec) again at 4 ° C for 15 minutes. And suspended in 500 μL MACS buffer and passed through an MS column in a magnetic field. The column was washed well and pushed out with 1 ml of MACS buffer to obtain c-kit + phosphorus cells to be used as hematopoietic stem cells. SCF (30 ng / ml, Biosource), Interleukin-7 (0.5 ng / ml, PeproTech), Flt3l (50 ng / ml, PeproTech), Indomethacin (2 ㎍) to differentiate the isolated hematopoietic stem cells into progenitor killer cells / ml, Sigma) and 24 well plate with RPMI (Gibco) medium containing gentamicin (2 μg / ml, Sigma) at a concentration of 1 × 10 ⁶ / ml Incubated). These cytokines were added for 6 days, followed by incubation with CD122-FITC antibody and multisort microbeads, followed by reaction with MACS to obtain CD122 ⁺ progenitor cells. In order to differentiate progenitor killer cells into mature killer cells, RPMI medium containing interleukin-15 (20 ng / ml), indomethacin (2 µg / ml) and gentamicin (2 µg / ml) was added for 6 days. Differentiation was performed using two methods, co-culture with stromal cells (ATCC) to differentiate into mature NK-2 cells and less mature natural killer cells without co-culture. NK-1), and the cells were harvested and analyzed for expression of natural killer cell surface molecules (FIG. 1).

(B) Purity of isolated cells in different stages of differentiation into mouse hematopoietic stem cells and mature natural killer cells

From 8 8-12 week old mice (C57BL / 6), 2 × 10 ⁸ total bone marrow cells were obtained using the method shown in Example 1 (A), followed by 4 × 10 ⁶ Lin ⁻ , c-kit ⁺ Phosphorus hematopoietic stem cells were isolated. CD122 ⁺ progenitor killer cells were obtained from these hematopoietic stem cells and these cells were co-cultured with stromal cells in the presence of interleukin-15 (+ OP9) or two mature spontaneous killer cells after monoculture (-OP9) of progenitor killer cells. By separating the purity of each of these differentiation step (purity) was confirmed through the following method. Characterization of cells in differentiation stages from hematopoietic stem cells to mature natural killer cells was adjusted to 1x10 ⁶ cells for immunostaining using antibodies against various cell surface molecules, and staining buffer solution (20 mM HEPES, 3% fetal bovine serum, Phosphate buffer with 0.1% NaN 3, pH 7.4). These markers were identified by differentiating cell differentiation stage markers (cell markers) combined with fluoresceinated isothiocyanate (FITC) or fluorescein attached isothiocyanate (PEIT) or PE (phycoerythrin). Antibodies such as (Pharmingen), NK1.1 (Pharmingen), CD122 (Pharmingen), and the like were added to cell samples, reacted at 0 ° C. for 30 minutes, washed twice with staining buffer solution, and analyzed by FACS (BD / Aria). Hematopoietic stem cells and c-kit were used for lineage (Pharmingen) markers (c-kit ⁺ Lin ^-) precursor NK cells (CD122 ⁺ NK1.1 ^-) and mature NK cells (CD122 ⁺ NK1.1 ⁺⁾ CD122 is (Pharmingen) and NK1.1 (Pharmingen) antibodies were analyzed by FACS. Hematopoietic stem cells were 96%, progenitor natural killer cells 95%, mature natural killer cells (-OP9) 94% and mature natural killer cells (+ OP9) was confirmed to be obtained in a 96% yield (Fig. 2).

(C) Identification of genes expressing specifically in mouse natural killer cells

Using the cells obtained above, the expression of CD122 and perforin, which are specifically expressed in natural killer cells, was confirmed by reverse transcriptase-polymerase chain reaction. Reverse transcription polymerase chain reaction was carried out in the following manner. In order to obtain total RNA from each cell, 2 x 10 ⁶ LK1 cells were washed once with phosphate buffer solution, and 500 µl of RNA isolation solution (RNAzol B, TEL- TEST) was added to each sample and gently pipetted. 50 μl of chloroform was added and mixed well, and then left for 5 minutes on ice. It was centrifuged at 12,000 rpm for 15 minutes at 4 ° C, the supernatant was taken, and the same amount of isopropyl alcohol was added and left on ice for 20 minutes. After centrifugation at 12,000 rpm for 20 minutes at 4 ° C., the precipitate was washed with 80% ethanol and dried, and 20 µl of water containing 0.1% diethyl pyrocarbonate was dissolved. Single stranded cDNA was synthesized from the RNA thus obtained using MMLV reverse transcriptase (Roche). Reverse transcription polymerase chain reaction was performed using 3 'and 5'-aaccagccacatagcacacat-3', beta-actin, 5'-gtggggcgccccaggcacca-3 'and 5'-ctccttaatgtcacgcacgatttc-3' as follows. 5 x reaction buffer (Roche) 5 μl, dNTP (dATP, dCTP, dGTP, TTP 5 μM, Roche) 2 μl, 3 μl primer 1 μl (20 pmol), distilled water 1 μl, total cell RNA 10 μl, reverse transcriptase 1 The reaction mixture (mu) (200 µl) (30 µl total) was reacted at 42 ° C for 30 minutes, and then the reaction was stopped at 90 ° C for 5 minutes. The reaction mixture thus obtained was mixed with the following sample to conduct a polymerase chain reaction. 20 μl of the reaction product, polymerase chain reaction 10 × buffer (Roche) 8 μl, 5 μl primer 1 μl (20 pmol), 3 ′ primer 1 μl (20 pmol), distilled water 69 μl, Taq polymerase (Takara) 1 μl (2.5 U) of reaction (100 μl total) was left at 95 ° C. for 5 minutes to inhibit any other enzymatic activity, followed by 1 minute 30 seconds at 95 ° C., 1 minute at 55 ° C. and 2 minutes at 72 ° C. The reaction was carried out about 30 times, and finally, the reaction was performed at 95 ° C. for 1 minute 30 seconds, at 55 ° C. for 1 minute, and at 72 ° C. for 5 minutes. 10 μl of the reaction product thus obtained was electrophoresed at 100 V for 1 minute on a 1% agarose gel. As a result, it was confirmed that the cells of each differentiation stage were consistent with the expression patterns of CD122 and perforin, which are known from previous studies. CD122 was more expressed in mature killer cells than in progenitor killer cells and was more expressed in coculture with stromal cells. Perforin is expressed in mature natural killer cells and observed to increase expression when co-cultured with stromal cells (FIG. 3).

(D) Differentiation of mature natural killer cells with or without co-culture with mouse stromal cells

Expression of mature natural killer cell surface molecules (NK1.1 and Ly49) using mature natural killer cells (-OP9 and + OP9) obtained above was performed in (B) using NK1.1 and Ly49 antibodies (Pharmingen) A FACS analysis was used to compare. Mature natural killer cells expressing NK1.1 and Ly49 cell surface molecules by culturing progenitor killer cells in the presence of interleukin-15 and coculture with stromal cells to differentiate them from cells not co-cultured with stromal cells. It was confirmed that there is an essential role and specificity for the final differentiation of cells. Ly49A ⁺ NK1.1 ⁺ phosphorus cells were 1.2%, Ly49C / I ⁺ NK1.1 ⁺ phosphorus cells were 25%, and Ly49D ⁺ NK1.1 ⁺ phosphorus cells were 2.1% , Ly49G2 ⁺ NK1.1 ⁺ cells were obtained with a 30% probability and cells without the above characteristics could not be obtained without coculture with stromal cells (FIG. 4).

(E) Discovery of differentiation inducer of mouse natural killer cells through SAGE

SAGE (Serial Analysis of gene expression) was performed to discover genes specifically expressed according to differentiation stages from isolated hematopoietic stem cells, progenitor killer cells and two mature killer cells (FIG. 5). The total RNA was isolated from hematopoietic stem cells, progenitor killer cells and two mature spontaneous killer cells in each differentiation step in the same manner as in (C), and 5 μg of each RNA was collected from oligo (dT) 25 beads (Dynal AS) and Reaction was isolated mRNA. CDNA was synthesized using the cDNA synthesis kit (Life Technology) using the isolated mRNA and 5 'biotin attached to the 3' position oligo (dT). SAGE tags reacted with cDNA were linked using T4 DNA ligase and the reaction was inserted into pZero-1 vector (Invitrogen) treated with restriction enzyme sphI (Roche) using T4 DNA ligase (Roche). The polymerase chain reaction in (C) was carried out using M13 F primer and M13 R primer to obtain a reaction product. The reaction was sequenced with Big-Dye Sequencing Kit and ABI1377 Sequencer (Perkin-elmer Applied Biosystems). Tag sequences were extracted using SAGE 300 software. The reference SAGE-tag database consists of the expression sequences of known mice in GenBank, which consist of the orientation of each transcript, the polu (A) signal (AATAAA EH is ATTAAA), the poly (A) tail, and the end of the sequence. Included CATG cleavage site. A computer program, Gene Identification and Sequence Topography (GIST), was used to analyze SAGE tags and reference SAGE databases. As a result, it was found that Axl genes were expressed only in progenitor killer cells and not in other differentiation stages in a large number and specifically in these cells (Table 1). The significance probability (p-value) for statistical analysis of the data was analyzed using a paired Student t test software program (all data in the examples). The expression of SAGE tags was evaluated using the v2, Audic, and Claveric methods (http: //telethon.bio.unipd.it/bioinfo/IDEG6_ form).

Genes Specific to Progenitor Natural Killer Cells Gene name HSC pNK mNK (-OP9) mNK (+ OP9) Unigene Id Axl 0 189 0 0 Mm.4128

It was confirmed by the reverse transcriptase polymerase chain reaction in (C) whether these gene expressions actually matched the SAGE results in the progenitor killer cells. That is, it was observed that the amount of Axl expression in progenitor killer cells was increased (FIG. 6).

Example  2. Axl Polyclonal  Effect of Antibodies on Differentiation of Natural Killer Cells

(A) Expression of mature natural killer cell specific receptors by Axl polyclonal antibody: co-culture with stromal cells

During the differentiation from mouse hematopoietic stem cells to natural killer cells, progenitor killer cells (day 7) were treated with 1 μg of Axl polyclonal antibody (Santa Cruz Biotechnology, Inc. sc-1096), and again in the same manner as described above. The cells were co-cultured with stromal cells under the condition of interleukin-15 (40ng / ml), and then differentiated into mature natural killer cells. The degree of differentiation was determined for NK1.1 antibodies and receptors specific for natural killer cells. After staining with antibodies (Ly49G2, Ly49A, Ly49C / F / I, Pharmingen) and FACS analysis in the same manner as in Example 1 (B), the control group treated with goat antibody (goat Ig, R & D) was not treated. Ly49A ⁺ NK1.1 ⁺ phosphorus cells from 1.2% to 3.2%, Ly49C / I ⁺ NK1.1 ⁺ phosphorus in cells treated with Axl polyclonal antibody as compared to the control group (obtained by the method of Example 1 (B)) cells in ^{1% 3.5%, Ly49G + NK1.1} + cells, which are fully mature natural killer cells in the minutes of a 1.2% to 3.2% It was confirmed that the conductivity is increased by about 2-fold by Axl polyclonal antibody affects the differentiation of NK cells (Fig. 7).

(B) Expression of mature natural killer cell specific genes by Axl polyclonal antibody: co-culture with stromal cells

Genes related to natural killer cells from natural killer cells under the same conditions as in (A) (interferon-gamma, 5'-agcggctgactgaactcagattg-3 'and 5'-gcacagttttcagctctatagg-3'; interleukin-15Ra, 5'-ccaacatggcctcgccgcagct-3 ' And 5'-ttgtagagaaagcttctggctc-3 'interleukin-18, 5'-aggtacaaccgcagtaatacgg-3' and 5'-agtgaacattacagatttatccc-3 'and perforin, 5'-gtcacgtcgaagtacttggtg-3' and 5'-aaccagccacatagcacacat-3 ') The reverse transcription polymerase chain reaction carried out in Example 1 (C) was analyzed. As a result, the expression of the above genes was increased in the cells treated with Axl polyclonal antibody compared to the control group treated with goat antibody, and thus the differentiation conductivity of fully mature natural killer cells was increased by Axl polyclonal antibody. It was confirmed (Fig. 8).

(C) Expression of mature natural killer cell specific receptors by Axl polyclonal antibody: culture without stromal cells

To determine the effect of differentiation into mature killer cells by Axl polyclonal antibodies under different conditions, pro-NK cells were not co-cultured with stromal cells, but at lower concentrations of interleukin-15 (25 ng / ml) and Axl. The polyclonal antibody (500 ng / ml) was directly treated and fixed in a culture vessel, and then the degree of differentiation into mature natural killer cells was determined by NK1.1 antibody and antibodies to receptors specific for natural killer cells (Ly49G2). , Ly49A, Ly49C / F / I, NKG2A / C / E) stained with FACS analysis in the same manner as in Example 1 (B), and treated with Axl polyclonal antibody even in the absence of stromal cells Cells with induction of differentiation from Ly49A + NK1.1 ⁺ to natural killer cells from 8.4% to 9.8% and 9.3%, and from Ly49C / F / I ⁺ NK1.1 ⁺ to 2.5%, Cells with 4% and 5.3% NKG2A / C / E ⁺ NK1.1 ⁺ increased from 9.3% to 18% and 16%. (Figure 9).

(D) Expression of mature natural killer cell specific genes by Axl polyclonal antibody: culture without stromal cells

Expression of genes related to natural killer cells (CD122, Perforin and Granzyme ratio) from natural killer cells under the same conditions as in Example 2 (C) was performed by reverse transcriptase polymerase chain reaction in Example 1 (C). Analyzed. As a result, the expression of the above genes was increased in the cells treated with Axl polyclonal antibody compared to the control group, and the differentiation conductivity of the fully mature natural killer cells was increased by the Axl polyclonal antibody even in the absence of stromal cells. It was confirmed that (Fig. 10).

Example  3. Axl Polyclonal  Effect of Antibodies on Interferon-gamma Production in Natural Killer Cells

Progenitor killer cells obtained in Example 1 (B) were co-cultured with Axl polyclonal antibody (500 ng / ml), interleukin-15 (10 ng / ml) and stromal cells to secure mature killer cells and then human interleukin- 2 (10ng / ml, R & D) was treated to activate mature natural killer cells. After 24 hours, the production of interferon-gamma was measured using the interferon-gamma eliminator (ELISA) kit (BD Pharmingen), and the production of interferon-gamma was increased in the experimental group treated with Axl polyclonal antibody compared to the control group. (Fig. 11)

Example  4. Axl  Effect of Polyclonal Antibodies on Proliferation of Progenitor Cell Killers

The stromal cells were plated at 1 × 10 ⁴ in a 96 well micro culture vessel and after one day, the progenitor killer cells obtained in Example 1 (B) were aliquoted to 2.5 × 10 ⁴ cells per well. MTS verification of proliferation of progenitor killer cells 48 hours after treatment with 500ng / ml of goat antibody, Axl polyclonal antibody (a-Axl) and Axl-Ig with all interleukin-15 (25ng / ml) (CellTiter 96 AQueous Assay, Promega, Madison, Wis.). MTS validation was performed on tetrazolium compounds [3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxy-phenyl) -2- (4-sulfophenyl) -2H-tetrazolium, inner salt; MTS] and phenazine methosulfate (PMS), an electron-coupling reagent, were added to each well for 30 minutes by adding 0.025 ml of MTS / PMS mixture to each well. After the reaction, the absorbance was measured and analyzed at a wavelength of 495 nm using an Eliser reader (Molecular Devices Co. Sunnyvale, CA, USA). When the Axl polyclonal antibody was treated compared to the control group, the proliferation of progenitor killer cells was doubled, and when the Axl-Ig treatment was observed, the proliferation of progenitor killer cells was decreased. It was observed that Axl signal transduction by A significantly affected progenitor killer cell proliferation (FIG. 12).

Example  5. Axl And objection Ligand Gas6 Effect of ROS on natural killer cell differentiation

To investigate the effect of signal transduction by the combination of Gas6 and Axl on differentiation of natural killer cells, the mouse recombinant Gas6 (500ng / ml, R & D) was treated during differentiation. It appears that (Fig. 13), in order to show the biological activity of Gas6 gamma-carboxylation process is required, and in subsequent experiments used Gas6 expressed in stromal cells. In order to inhibit Gas6 from acting as a ligand of Axl expressed in progenitor killer cells, we investigated the effect of Warlin (Sigma) on signal transduction through Axl. Differentiation of hematopoietic stem cells into progenitor killer cells followed by treatment with interleukin-15 (25ng / ml) and warperin at concentrations of 1 µg / ml, 2.5 µg / ml and 5 µg / ml, respectively, followed by stromal cells (2x104) for 7 days. ), And the degree of differentiation of progenitor killer cells into mature killer cells was analyzed by flow rate fluorescence spectroscopy in Example 1 (B). As a result, receptors specifically expressed in NK1.1, NKG2A / C / E and Ly49C / F / H / I natural killer cells also decreased concentration-dependently (NK1.1 ⁺ NKG2A / C / E ⁺ was 25% , 16%, 16%, 8.8%, NK1.1 ⁺ Ly49C / F / H / I ⁺ tended to 2.3%, 1.9%, 1.6%, 0.5%) (FIG. 14). These results confirm that the interaction of Axl with its ligand, Gas6, plays an important role in the differentiation of progenitor killer cells into mature killer cells.

Example  6. Mouse Gas6  Expression and Retroviral Vector Preparation

Reverse transcriptase polymerase chain reaction as described in Example 1 (C) with RNA and Gas6 primers (5'-ggcctcgagcatgccgccaccgcccgggc-3 'and 5'-ggcgaattccggtctagggggtggcatgc-3') isolated from mouse stromal cells to obtain gas6 with activity Gas6 cDNA (100ng) was amplified and cloned into pCR4-TOPO (50ng, Invitrogen) treated with EcoRI (1U, Roche) as a restriction enzyme (FIG. 15). Among the cloned clones, cDNA of the same clone as the reference sequence (gene ID; AK086187) was used for preparation of mouse Gas6 expression vector and retroviral vector. After retroviral vector pLXSN (Invitrogen) was treated with EcoRI (1U), the mouse Gas6 cDNA (100ng) isolated by treatment with EcoRI (1U) restriction enzyme (50ng) was added to pCR4-Gas6 # 8 and T4 DNA ligase ( 1U, Roche) to prepare a recombinant pLXSN-Gas6 (Fig. 16, left), pcDNA3.1 (+) treated with EcoRI (1U) and CIP (calf intestine alkaline phosphatase) enzyme (1U) Afterwards, mouse Gas6 cDNA (100 ng) isolated by treatment with EcoRI (1U) restriction enzyme was added to pCR4-Gas6 # 8, and the recombinant pcDNA3.1-Gas6 was prepared by connecting with T4 DNA ligase (1U). 16, right). The directions of the virus and CMV promoters of the mouse Gas6 cDNA in these expression vectors were confirmed using restriction enzymes XhoI (1U, Roche), respectively, and the forward and reverse clones were identified in the promoters pLXSN-Gas6 / F and pLXSN-Gas6, respectively. / R and pcDNA3.1-Gas6 / F, pcDNA3.1-Gas6 / R (Fig. 17).

Example  7. Mouse Gas6 Transfectants  Produce

PCDNA3.1 (+), pcDNA3.1-Gas6 / F, and pcDNA3.1-Gas6 / R were transfected into the NIH3T3 cell line (ATCC), which does not express the Gas6 gene, using lipofectamine reagent (Invitrogen), respectively. After transfectants were selected from the G418 antibiotic-containing medium, clones overexpressing the mouse Gas6 gene were obtained by limiting dilution. Meanwhile, gas6 retroviral vectors pLXSN-Gas6 / F and pLXSN-Gas6 / R were transfected into PT67, a cell line capable of forming viral structures, and selected in a G418-containing medium to perform mouse dilution. Afterwards, the degree of Gas6 expression in the retrovirus infected cell line NIH3T3 cells generated from the individual clones was the same as that of Example 1 (C) using Gas6 primers (5'-ggcctcgagcatgccgccaccgcccgggc-3 'and 5'-ggcgaattccggtctagggggtggcatgc-3'). Reverse transcription polymerase chain reaction (A) and Western blot (B) of the method was confirmed (Fig. 18). Western blot was performed in the following manner. Cell lysis buffer solution (lysis buffer, 20 mM HEPES pH 7.9, 100 mM KCL, 300 mM NaCl, 10 mM EDTA, 0.5% Nonidet P-40, 1 mM Na3VO4, 1 mM PMSF, 100 mg / ml) Cells were lysed with aprotinin, and 1 mg / ml leupeptin) and left on ice for 30 minutes. Protein concentration was measured using Bradford reagent (Bio-Rad, Hercules, CA). The same amount of protein lysate was electrophoresed on 10% SDS-PAGE and then electrophoresed on PVDF membranes (Millipore, Marlborough, MA). The PVDF membrane was reacted with blocking buffer (1% BSA and 5% skim milk in PBS) at 4 ° C. overnight and washed three times with TBST (50 mM Tris. PH 7.4, 150 mM NaCl, 0.05% Tween 20). The PVDF membrane containing the protein was first reacted with goat anti mouse Gas6 antibody (Santa Cruz) for 2 hours at room temperature, and then reacted with HRP conjugated anti-young IgG (Santa Cruz) for 2 hours at room temperature. After washing the membrane three times with TBS, signals were detected using an ECL system (Amersham-Pharmacia Biotech, Arlington Heights, IL).

Example  8. Mouse Gas6 Effect on differentiation of natural killer cells

Lin- and c-kit + hematopoietic stem cells from the bone marrow of mice were obtained by SCF (30 ng / ml), Interleukin-7 (0.5 ng / ml), Flt3L (50 ng / ml), Indomethacin (2 ug / ml), and Genta. RPMI medium containing mycin (2 μg / ml) was incubated in a 24-well culture vessel at a concentration of 1 × 10 ⁶ / ml. Incubate mouse gas6 transfectants with interleukin-15 (20ng / ml) for 24 hours in progenitor killer cells obtained by incubating for 6 days at 37 ° C and 5% CO2, and then recovering by centrifugation at 2,000 rpm for 10 minutes. Supernatant samples and mouse Gas6 and Axl polyclonal antibodies were further incubated for 6 days to differentiate into mature natural killer cells. These cells were harvested and analyzed for expression of natural killer cell surface molecules using FACS analysis used in Example 1 (B). At this time, the purity of the cells in each step was more than about 95% as observed using FACS analysis. To determine whether mouse Gas6 secreted from the Mouse Gas6 transfectant binds to Axl expressed in progenitor killer cells and differentiates them into mature killer cells, transfecting progenitor killer cells with normal NIH3T3 cell controls and vectors. The differentiation ability of natural killer cells by the control group and the co-transfectants overexpressing mouse Gas6 and their culture supernatants, respectively, was analyzed. As a result, it was confirmed that the progenitor killer cells co-cultured with the mouse Gas6 transfectant promoted differentiation into mature killer cells (increase from about 14% to 47%) compared to the control group (Fig. 19). In addition, when the culture supernatant of the transfectant (5x10 ³ ) overexpressed Gas6 (diluted at 1:20) was treated during differentiation, expression of genes specifically expressed in mature natural killer cells was carried out in Example 1 ( According to the same method as in C), the expression of genes such as perforin, interleukin-18, and interferon-gamma increased in cells treated with the culture supernatant of the transfectant (5x10 ³ ) overexpressed Gas6 compared to the control group. It was confirmed that (Fig. 20). Therefore, during the differentiation process from hematopoietic stem cells to natural killer cells, it was confirmed that Axl has a great effect on the differentiation of natural killer cells through signal transfer by binding to Gas6.

Example  9. Gas6 Effect of ROS on interferon-gamma production in natural killer cells

The progenitor killer cells obtained in Example 1 (B) were co-cultured with interleukin-15 (10 ng / ml) and stromal cells, followed by Gas6 antibody (500 ng / ml), Axl-Ig (500 ng / ml), and warrin ( 500ng / ml) was treated respectively. Herein, the culture supernatant of the transfectant of Gas6 was diluted 1:20 (test group) or the culture supernatant of the transfectant containing only the vector was diluted 1:20 and treated (control). After killing cells were treated with human interleukin-2 (10ng / ml, R & D). After 24 hours, the production of interferon-gamma was measured using the interferon-gamma eliminator kit (BD Pharmingen), and the production of interferon-gamma was increased in the experimental group diluted 1:20 with the culture supernatant of the transfectant of Gas6. Was observed. In the group treated with Gas6 antibody (500ng / ml), Axl-Ig (500ng / ml), and warperin (500ng / ml), the production of interferon-gamma decreased in the experimental group. Signal of Gas6 was delivered by Axl was confirmed to be involved in the activity of natural killer cells (Fig. 21).

Example  10. Gas6 Effect on proliferation of progenitor killer cells

The stromal cells were plated at 1 × 10 ⁴ in a 96 well micro culture vessel and after one day, the progenitor killer cells obtained in Example 1 (B) were aliquoted to 2.5 × 10 ⁴ cells per well. After treatment with Axl-Ig and Gas6 antibody (a-Gas6) at 500ng / ml, respectively, containing all interleukin-15 (25ng / ml), progenitor natural killing was performed 48 hours after adding the culture supernatant of Gas6 obtained in Example 8. The extent of proliferation of the cells was analyzed by MTS verification in the same manner as in Example 4. In the experimental group treated with the culture supernatant of the transfected cells overexpressing Gas6, the proliferative killer cell proliferation was increased compared with the control group treated with the culture supernatant of the cells transfected with the vector only. It was confirmed that proliferation of progenitor killer cells was induced by the interaction of Axl and Gas6 by seeing a decrease in spontaneous killer cell proliferation (FIG. 22).

Example  11. Mouse Axl  Expression system construction

Total RNA and Axl primers (sense; 5'-ggtgcccatcaacttcggaa, antisense; 5'-ggatgtcccaggtggaagatt) isolated from mouse RAW264.7 macrophage line with high expression of Axl, the same reverse transcription as Example 1 (C) Polymerase chain reaction was performed to clone 2,750 bp mouse Axl cDNA (100 ng) into pCR4-TOPO (50 ng) treated with restriction enzyme EcoRI (1 U) (FIG. 23). In addition, the retroviral vector pLXSN was treated with EcoRI (1U) and CIP enzyme (1U), and then added to ACR cDNA (100ng), which was isolated by treatment with EcoR I restriction enzyme to pCR4-Axl # 4, and T4 DNA ligase (1U). The recombinant pLXSN-Axl was prepared by ligation. The orientation of the promoter of Gas6 cDNA in the retroviral vector was confirmed by polymerase chain reaction and sequencing using primers under the cloning site and primers of Axl. PLXSN-Axl / F , pLXSN-Axl / R.

Example  12. Mouse Axl - IgG Fusion protein  (fusion protein) manufacturing

To transfect PT67 cell line and prepare Axl-IgG fusion protein expressing cell line in the same manner as Gas6 expressing retroviral preparation, BhoH and 3 'Xho I linker was added to 5' of mouse IgG1 constant fragment (Fc) site. In the same manner as in Example 1 (C), the polymerase chain reaction was amplified and cloned into pCR4-TOPO (pCR4-Fc). In addition, 3 'of the extracellular domain (ECD) of the Axl gene was amplified by adding a BamHI linker and cloned into pCR4-TOPO (pCR4-Axl / ECD). The pCR4-Fc was treated with Xho I (1U) and BamHI (1U, Roche) to isolate about 820 bp Fc. The pCR4-Axl / ECD was treated with EcoRI (1U) and BamHI (1U) for 1350 bp Axl. Cloning Fc and Axl / ECD fragments at pcDNA3.1 (50ng) EcoRI-XhoI site / ECD (100ng) and DNA clones were constructed with BamHI (1U), BamHI (1U) / XhoI (1U) restriction enzymes (FIG. 24). Finally, the pcDNA3.1 / Axl-Fc plasmid was transfected into 293T cells to select a transfectant in a G418-containing medium and to obtain a clone expressing an excess of Axl-IgG fusion protein by limiting dilution.

Example  13. Mouse Axl - IgG Fusion proteins  Effect on Differentiation of Natural Killer Cells

To determine the effect of blocking signal transduction of Axl on spontaneous killer cell differentiation, interleukin-15 (25ng / ml) and interleukin-15 cells were co-cultured with stromal cells (2x10 ⁴ ) for 7 days. After treatment with Axl-Ig, progenitor killer cells were differentiated into mature killer cells and stained with NK1.1, NKG2A / C / E, and Ly49G2 antibodies, and FACS analysis was performed. As a result, when Axl and its ligand, Gas6, were blocked with Axl-Ig, Axl-Gas6 action was reduced by decreasing the number of NK1.1, NKG2A / C / E and Ly49G2 positive cells. It was observed that it plays an important role in the differentiation of killer cells into mature natural killer cells (FIG. 25).

Example  14. Axl  Differentiation of Natural Killer Cells by Inhibition of Expression

Lenti virus vectors were used to remove Axl from natural killer cells (FIG. 26).

(1) siRNA production

In order to remove the function of the Axl gene by selectively blocking the site having the function of Axl, the oligonucleotide was designed as the target sequence of the Axl gene as follows. After selecting three gtctcccgtacttcctgga (# 1), ctcacccactg caacctgc (# 2), and agacctacacagtttcctc (# 3), each base sequence is a sense primer and a primer containing aaag overhangs at the 5 'site and its base The oligomer was prepared by attaching aaaa to the 5 'site to the antisense primer. Each oligomer was annealed at 95 ° C. to prepare double strands, and the double promoter pFIV-H1 / U6 siRNA-GFP expression vector was digested with BbsI (Roche) and purified and cloned (FIG. 27). In order to find clones containing siRNA among the clones obtained from the transformation after cloning, polymerase chain reaction was carried out using U6 polymerase chain reaction primer and anti-sense siRNA oligonucleotide. The polymerase chain reaction product was confirmed at about 100 bp (FIG. 28).

(2) lentiviral siRNA expression system establishment

In order to make a lentiviral that can be infected with natural killer cells, a lentiviral vector expressing siRNA and helper vectors VSVG, RSV-REV, and pMDL g / pRRE were used. 293T cells (ATCC), a cell line capable of forming virus constructs, were added to about 5x10 ⁵ cells in a 10 cm2 dish, and after 24 hours, 1.5 µg each of the vectors prepared above was transfected with lipofectamine. After the time was changed to fresh DMEM medium and incubated in 37 ℃, CO2 incubator. After about 48 hours, the medium was centrifuged at 3000 rpm for 5 minutes to remove cell debris, and the culture supernatant was stored by filtration with a Millex-HV 0.45um PVDF filter. In order to confirm virus production in the culture supernatant thus obtained, 293T cells were added to a 6 well culture vessel of 1x105 cells, and after 24 hours, virus particles were mixed 1: 1 with DEME medium containing 10% fetal bovine serum and 293T. The cells were treated. At this time, polybrene was added at a concentration of 8 ㎍ / ml to increase the degree of binding of virus capsid to the cell membrane. After infecting the virus for 24 hours, the cells were changed to DMEM medium containing 10% fetal bovine serum, and then cultured for 48 hours, followed by fluorescence microscopy and FACS analysis performed in Example 1 (B). This confirmed that the GFP-labeled pFIV expression vector was efficiently transduced (FIG. 29).

(3) Lentivirus infection during differentiation from hematopoietic stem cells to natural killer cells

Hematopoietic stem cells were isolated from mouse bone marrow cells and virus particles were added per 1x10 ⁶ cells and infected for 24 hours to add interleukin-7 (0.5 ng / ml), FLT3L (50 ng / ml) and SCF (30 ng / ml). After culturing for about 6 days in one medium, progenitor killer cells were harvested and the presence of transduction was confirmed by FACS analysis performed in Example 1 (B). As a result, the lentiviral was well infected and the expression of GFP was increased. Differentiation of natural killer cells was also suppressed (FIG. 30, FIG. 31).

Example  15. Induced by natural killer cells in animal cancer models Cancer formation Inhibitory ability  Identification

To establish an animal cancer model, the day after the intravenous injection of B16F10 melanoma cells, C57BL / 6-derived cancer cells, at 5x10 ⁴ into 7-8 week old C57BL / 6 mice, the control antibody (1 μg / ml) and human interleukin- Mature natural killer cells differentiated by treatment with 2 (10 ng / ml, Sigma) or Axl polyclonal antibody (1 ug / ml) and interleukin-2 (10 ng / ml) were injected intravenously with 1 × 10 ⁶ water, respectively. The number of these B16F10 melanoma cells was measured in and analyzed for metastatic capacity and anticancer effects. As a result, the colony count of cancer cells observed in lung tissue injected with Axl polyclonal antibody-stimulated mature natural killer cells was reduced compared to mice injected with mature natural killer cells treated with control antibody (approximately 4-10 times). However, the number of colonies in lung tissues injected with Axl-Ig-treated mature natural killer cells increased significantly, indicating that Axl can activate natural killer cells and control metastatic capacity as well as the formation of cancer cells. ).

Example  16. Cancer cells caused by natural killer cells in animal cancer models Killing power  Identification

To compare cancer cell killing ability by natural killer cells, cells were isolated from the mouse spleen of Example 15, stimulated with human interleukin-2 (10 ng / ml) for 48 hours and labeled with ⁵¹ Cr (100uci) for 2 hours. YAC-1 cells were mixed at a ratio of 1: 100, 1:50, and 1:25 and reacted. After 4 hours, the amount of 51Cr secreted into the culture supernatant was measured. In the experimental group injected with natural killer cells differentiated by the control antibody, the experimental group treated with natural killer cells differentiated with the Axl polyclonal antibody showed about 75% killing ability of cancer cells. It was confirmed that it shows a high cancer cell killing ability (Fig. 33).

Example  17. People Axl  Preparation of Escherichia Coli Expression Vectors

Example 1 (C) In the same manner as in the Axl-expressing cell line HUVEC (Human Umbilical Vein Endothelial Cell, ATCC) to isolate the total RNA and Axl primer (sense; 5'-cca tat gga aag tcc ctt cgt ggg caa c, antisense; reverse transcription polymerase chain reaction using 5'-cct cga gca cca gct ggt gga ctg gct g) to remove hAxl cDNA fragments corresponding to extracellular domain (ECD) from which signaling sequence was removed. Amplification yielded 1214 bp cDNA. Axl cDNA (100ng) fragments were cloned using T4 DNA ligase (1U) at the NETI (1U, Roche) and XhoI (1U) sites of pET29a (50ng) to target (his) 6 at the C-terminus. . The clone obtained here was named pET-hAxl / ECD (FIG. 34).

Example  18. People Axl  Antigen manufacturing

To express the Axl- (his) 6 protein, E. coli BL21 (DE3) was transformed with pGEX-4T-3-Axl / F and pGEX-4T-3-Axl / R, respectively. The transformed colonies obtained here were inoculated into culture broths (LB broth, Gibco) containing bacterial antibiotics (kanamycin), followed by incubation for 4 hours in a 25 ° C. incubator with 0.5 mM IPTG (Sigma). The suspended bacteria were centrifuged at 6,000 rpm for 10 minutes and then the bacteria were recovered and suspended in 1X PBS. After leaving it on ice, the supernatant was separated from the bacterial debris by centrifugation at 12,000 rpm for 30 minutes after completely dissolving the bacteria using a sonicator. In order to purify the fusion protein from the water-soluble and insoluble hAxl / ECD present in the bacterial lysate (supernatant), the bacterial lysate was obtained using the HiTrap ™ chelating HP (Amersham pharmacia) to obtain the Axl- (his) 6 fusion protein.

Example  19. People Axl  Protein specific Polyclonal  Preparation of Antibodies

The human recombinant Axl antigen was obtained from E. coli and used as an antigen to obtain anti rabbit human Axl. To produce antigen-specific polyclonal antibodies, 300 μg of purified human Axl protein dissolved in phosphate buffer solution at a concentration of 1 mg / ml was emulsified with an equivalent amount of Freund's adjuvant to 10-week-old rabbits. The first vaccine was ���. After the first inoculation, the first and the same antigens were emulsified with Freund's adjuvant in 2, 3, and 4 weeks at intervals of 2 weeks, 1 week, and 1 week. Seven days after the fourth intramuscular injection, blood was collected by cardiac puncture. Serum was obtained by allowing the collected blood to stand at room temperature for 30 minutes and overnight at 4 ° C. for complete coagulation and centrifugation at 2,500 rpm for 30 minutes to obtain supernatant. Serum was purified on Protein A column by diluting 5 times with 1 × PBS.

Example  20. People Axl  Specific Monoclonal  Preparation of Antibodies

25 μg / 100 μl of purified human Axl was emulsified with the same amount of Freund's adjuvant and then injected intraperitoneally into BALB / c mice 6-8 weeks old at intervals of 2 weeks. After the last injection, the production of antibodies against anti-Axl was confirmed by the Eliser assay, and after 2 weeks, the cells were finally immunized with 25 μg of human Axl. After 5 days, the splenocytes were extracted from the mouse, and the ratio of Sp2 / 0 myeloma cells and 10: 1 The mixture was allowed to stand for 3 minutes in a 50% polyethylene glycol 1500 solution to carry out cell fusion. After centrifugation at 1,200rpm for 8 minutes to obtain cell precipitate, suspended in HAT RPMI-1640 medium containing 10% fetal bovine serum to 3.5 × 10 6 cells per ml and dispense 0.1 ml per well in a 96-well culture vessel Were incubated in a 37 ° C., 5% CO 2 incubator. After 3 days, 0.1 ml per well of 10% fetal calf serum-containing HAT RPMI-1640 medium was added and about half of the medium was changed to fresh medium every 4 days. Eliminators were cultured on the cultures and cells from wells with high antibody titers were harvested and cultured by limiting dilution. The cells were prepared in a 0.5 cell / well / 96 well culture vessel and subjected to elimination to select antigen-specific and high activity hybridomas. After HAT selective culture, the production of antibodies of hybridoma cells was confirmed by enzyme-immunoassay. That is, human Axl used for immunization was diluted to 0.1 µg / ml in 0.01 M carbonate-bicarbonate buffer (pH 9.6), and 50 µl of each well was added and coated overnight at 4 ° C. It was then washed four times with PBST (phosphate buffer saline, 137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 2mM KH2PO4, 0.15% Tween 20) and blocked with 0.1% albumin for 30 minutes at 37 ° C. The culture supernatant of the cells was added to 50 μl per well and reacted for 2 hours at room temperature, and then washed four times with PBST. The anti-mouse immunoglobulin antibody, a secondary antibody with biotin, was diluted with 0.1% BSA-PBST to 1 µg / ml, and then 50 µl of each well was reacted at 37 ° C for 1 hour. Again, after washing four times with PBST, streptavidin-horseradish peroxidase was diluted 1000-fold with 0.1% BSA-PBST, and 50 µl of each well was added and reacted at 37 ° C. for 30 minutes. Wash 4 times. As a substrate for the enzymatic reaction, 50 μl of Tetra-Methylbenzidine (TMB) solution was added to each well, and the reaction was performed at room temperature. The reaction was stopped with 2N-sulfuric acid, and the absorbance was measured with an eliminator reader at 450 nm. Cells obtained from the wells showing positive anti-Axl antibody production were subcloned and cultured three times to be 0.3 cells per well by restriction dilution to produce anti-human Axl monoclonal antibody. Hybridomas were obtained. To obtain anti human Axl monoclonal antibody from the culture supernatant of the hybridomas, the antibody was isolated and dialyzed using a GC column to obtain an anti human Axl monoclonal antibody.

Example  21. People Gas6  Expression Vector Preparation

In the same manner as in Example 1 (C), total RNA was isolated from the human cell line HUVEC (American Type Culture collection) expressing Gas6, and reverse transcriptase polymerase chain using Gas6 primer (sense; 5'-ggcccgtggccccttcgctct, antisense; ggcctaggctgcggcgggct) The reaction was performed to amplify 2041 bp cDNA, which was cloned into a PCR cloning vector and sequenced. The analyzed human Gas6 cDNA was isolated by cutting with EcoRI (1U). Human Gas6 cDNA (100ng) was cloned into pcDNA3.1 vector (50ng) using T4 DNA ligase (1U) by treating pcDNA3.1 vector with EcoRI restriction enzyme (1U) to prepare human Gas6 expression vector pchGas6 ( 35).

Example  22. Gamma Carboxylated  Person Gas6 Manufacture

To obtain gamma-carboxylated human Gas6, human Gas6 expression vector pchGas6 was transfected into human 293 (ATCC) cells using lipfectamine reagent (Invitrogen, Carlslbad, Calif.) And containing 0.75 mg / ml G418 (Gibco) antibiotic. After transfecting each of the transfectants, the clones overexpressing the human Gas6 gene were obtained by restriction analysis. 293 cells transformed with human Gas6 secrete excess of gamma-carboxylated human Gas6 into the culture supernatant, which was confirmed to be a clone that overexpresses the human Gas6 gene by performing Western blot in the same manner as in Example 8. It was. To induce differentiation of human natural killer cells, the culture supernatant of 293 cells transformed with human Gas6 was diluted 1:20 to confirm the function of gamma-carboxylated human Gas6 contained in the culture supernatant.

Example  23. Axl Polyclonal  Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Using Antibodies (Santa cruz) from Mature natural killer cells  differentiation

(A) Differentiation of natural killer cells from human cord blood-derived hematopoietic stem cells

Hematopoietic stem cells were isolated from umbilical cord blood using the following method. After 25ml of human cord blood was divided into 50ml tubes (1pack = 100ml), 1X PBS was added in the same amount (25ml) and mixed slowly. After dividing 20ml of Picoll into a new 50ml tube, a 1: 1 mixture of human cord blood and 1XPBS was poured to prevent damage to the layer and filled to 50ml. It was centrifuged at 2000 rpm and 25 degreeC for 20 minutes (brake | released). After the centrifugation, only a white layer (cell layer = about 10ml) between the upper yellow layer (serum) and the lower clear layer is separated and transferred to a 50ml tube containing 20ml of 1XPBS. Centrifuge for 10 minutes at. When the pellet is found to be underneath, discard the supernatant, tap the pellet to loosen it, and then mix with ACK buffer solution (0.15 M NH4Cl, 1 mM KHCO3, 0.1 mM EDTA (disodium salt), pH 7.2). It was left to stand at 37 degreeC for 10 minutes. After centrifugation at 2500 rpm for 4 minutes at 4 ° C, the supernatant was discarded and the pellet was struck by a tube. Add about 2ml of MACS buffer solution (2mM EDTA and 0.5% BSA dissolved in 1XPBS and filter), and pipet the mixture. Filter it with a new 50ml tube and filter it. Add 10 ml of MACS buffer to the tube containing cells. 50 ml was filled by repeating the filter and straining the filter.

The cells contained in the obtained 50 ml tube were measured for cell number using a cell counting instrument (HEMOCYTOMETER, MARIENFELD). After centrifugation at 2000C for 10 minutes at 4 ℃, compare 1C10 ⁸ with one reaction and compare the results with the result of measuring the cell number. Divided into prepared 1.5 ml tubes. After centrifugation at 1700 rpm for 3 minutes, the supernatant was discarded and the pellet was washed three times by releasing the pellet using a buffer solution. Finally, 500 μl MACS buffer solution was added, the pellets were released, and each 1.5 ml tube was mixed with 25 μl CD34 ⁺ micro bead-25 μl and blocking reagent 25 μl. After reaction at 4 ° C. for 30 minutes, the tube was turned upside down 10 times every 5 minutes. After 30 minutes, centrifuged at 1700 rpm for 3 minutes, and the supernatant was discarded three times. Finally, 500 µl of MACS buffer solution was added, and the pellet was released. MACS column was installed in MACS and washed with 3 ml of MACS buffer. Carefully pour out the pellets before the buffer is completely down, and when the pellets are all down again, 5 ml of the MACS buffer was lowered again, and 2 ml of the MACS buffer was added to the column and again removed.

The column was separated from the MACS, and then 5 ml of MACS buffer was added and the piston was pushed out into a 15 ml tube, and then 5 ml of the MACS buffer was again pushed out, and the obtained cell number was measured. (Human SCF-30ng / ml (Pepro Tech), human FLT3L50ng / ml (Pepro Tech), human Interleukin-7 10ng / ml, (Pepro Tech)) in a 1ml aliquot of 1X10 ⁶ cells / ml per well, 37 ° C, 5 Cultured in a% CO ₂ incubator. CD34 ⁺ cells isolated from human hematopoietic stem cells to progenitor killer cells were Myelocult H5100 containing human SCF (30 ng / ml), Flt-3L (50 ng / ml) and interleukin-7 (10 ng / ml). (Gibco) medium was suspended in a concentration of 1x10 ⁶ / ml and cultured in a 24-well culture vessel. Every three days, half of the medium was subcultured with fresh medium. These cells were cultured for 14 days to obtain human progenitor killer cells. Progenitor killer cells generated after 14 days of culture to differentiate from human progenitor killer cells to mature killer cells were isolated from cord blood in MyeloCult medium (Gibco) containing human interleukin-15 (20 ng / ml, Pepro Tech). Stromal Cells (Isolation Method: CD34 ⁻ Cells After Separation of Hematopoietic Stem Cells from Umbilical Cord Blood and Plated in 10% RPMI Medium and Incubated in 5% (CO ₂ ) Incubator for 2 hours. After 4 days and 7 days, the medium was removed and the medium was removed on the 8th day, and 3 ml of 1XPBS was added and left in the incubator for 5 minutes. The cells were washed using RPMI medium, and cells were collected by centrifugation and co-cultured with stromal cells 4 × 10 ⁴ per 24 wells) to obtain mature natural killer cells.

(B) Differentiation from human progenitor killer cells to mature killer cells without stromal cells

Expression of mature natural killer cell surface molecules including CD56 (Pharmingen) was differentiated from human progenitor killer cells to mature killer cells without using human stromal cells under the same conditions as in (A). As a result of FACS analysis, the expression level was significantly lower than that of co-culture of human stromal cells to differentiate mature natural killer cells. This study confirmed that human stromal cells are essential for inducing differentiation from human progenitor natural killer cells to mature natural killer cells.

(C) Differentiation of mature natural killer cells from human umbilical cord blood-derived hematopoietic stem cells using Axl polyclonal antibody (Santa cruz)

The progenitor killer cells obtained in (A) were differentiated for 14 days by adding 1 µg / ml Axl polyclonal antibody (Santa Cruz) instead of interleukin-15 treatment under the same conditions as in (A). The cells were FACS analyzed in the same manner as in Example 1 (B) to confirm their differentiation. The markers of mature natural killer cells for humans were NKG2A (Pharmingen), CD161 (Pharmingen), NKP46 (Pharmingen), NKP30 (Pharmingen), NKP44 (Pharmingen), NKG20 (Pharmingen) and CD56 (Pharmingen). CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ one cells showed about 2 to 3 times increased differentiation rate when treated with Axl polyclonal antibody compared to control group treated with goat antibody (FIG. 36).

       In addition, under the same conditions, differentiation rate was confirmed by treating progenitor killer cells with Axl antibody (Santa Cruz) in an amount of 1 μg / ml at a ratio of 1: 1 with interleukin-15 (Pepro Tech). As a result, it showed a slightly increased differentiation rate compared with the Axl antibody alone.

Example  24. The person Axl Polyclonal  Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Using Antibodies from Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 23 (A) were treated with interleukin-15 under the same conditions as those of Example 23 (A), and then 14 days by adding 1 µg / ml of human Axl polyclonal antibody obtained in Example 19. After differentiation, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells showed about 2 to 3 fold increase in differentiation rate when treated with human Axl polyclonal antibody compared to control group treated with goat antibody. Similar results were obtained using the Axl polyclonal antibody purchased to differentiate mature killer cells.

In addition, under the same conditions, differentiation rate was confirmed by treating progenitor killer cells with Axl polyclonal antibody in an amount of 1 μg / ml at a ratio of 1: 1 with interleukin-15 (Pepro Tech). As a result, it showed a slightly increased differentiation rate compared to the case of treatment with Axl polyclonal antibody alone.

Example  25. People Axl Monoclonal  Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Using Antibodies from Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 23 (A) were treated with interleukin-15 under the same conditions as those of Example 23 (A), and 14 days were added by adding 1 µg / ml of human Axl monoclonal antibody obtained in Example 20. After differentiation, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells showed about 2 to 3 fold differentiation rate when treated with human Axl monoclonal antibody compared with goat antibody treated controls. Similar results were obtained using the Axl polyclonal antibody purchased to differentiate mature killer cells.

In addition, under the same conditions, differentiation rate was confirmed by treating progenitor killer cells with Axl monoclonal antibody in an amount of 1 μg / ml at a ratio of 1: 1 with interleukin-15 (Pepro Tech). The results showed a slightly increased differentiation rate when treated with Axl monoclonal antibody alone.

Example  26. Gamma Carboxylated  Person Gas6 From Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

Instead of treating interleukin-15 in the same conditions as in Example 23 (A), the progenitor killer cells obtained in Example 23 (A) were diluted 1:20 with the culture supernatant obtained by transfection of Gas6 obtained in Example 22. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm the degree of differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells showed a differentiation rate of about 2 to 3 times when treated with gamma-carboxylated human Gas6 compared to the control group treated with the vector-transfected culture supernatant. Similar results were obtained when differentiating mature killer cells using human Axl polyclonal antibodies or Axl monoclonal antibodies.

        In addition, under the same conditions, progenitor killer cells were treated with gamma-carboxylated human Gas6 along with interleukin-15 (Pepro Tech) to confirm the differentiation rate. The results showed a slightly increased differentiation rate compared to the treatment with gamma-carboxylated human Gas6 alone.

Example  27. Axl Polyclonal  Antibodies ( Santa Cruz ) And gamma Carboxylated  Person Gas6 From Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 23 (A) were treated with Interleukin-15 under the same conditions as those of Example 23 (A), 1 μg / ml of Axl polyclonal antibody (Santa Cruz) and Gas6 obtained in Example 22. The culture supernatant obtained by transfection was diluted 1:20 and treated simultaneously. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells were treated with gamma-carboxylated human Gas6 and Axl polyclonal antibodies compared to controls treated with culture supernatants transfected with human Gas6 only and controls treated with Axl polyclonal antibody (Santa Cruz) only. Treatment at the same time showed slightly increased differentiation.

Further, under the same conditions, progenitor killer cells were treated with Axl polyclonal antibody (Santa Cruz) and gamma-carboxylated human Gas6 with interleukin-15 (Pepro Tech) (1: 1 ratio with antibody). The rate of fire was confirmed. The results showed a slightly increased differentiation rate when treated with Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  28. People Axl Polyclonal  Antibodies and Gammas Carboxylated  Person Gas6 From Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 23 (A) were treated with 1 µg / ml of Axl polyclonal antibody obtained in Example 19 and Example 22 instead of treatment with interleukin-15 under the same conditions as in Example 23 (A). Culture supernatants obtained by transfection of gamma-carboxylated human Gas6 were diluted 1:20 and treated simultaneously. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells treated with gamma-carboxylated human Gas6 and Axl polyclonal antibodies at the same time compared to controls treated with culture supernatant transfected with human Gas6 only with Axl polyclonal antibody Slightly increased differentiation rate. The culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6 was simultaneously treated to obtain similar results as the differentiation of mature natural killer cells.

In addition, under the same conditions, progenitor killer cells were treated with Axl polyclonal antibody and gamma-carboxylated human Gas6 with interleukin-15 (Pepro Tech) (1: 1 ratio with antibody) to confirm the differentiation rate. . The results showed a slightly increased differentiation rate when treated with Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  29. People Axl Monoclonal  Antibodies and Gammas Carboxylated  Person Gas6 From Human Umbilical Cord Blood-derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 23 (A) were treated with 1 μg / ml of Axl monoclonal antibody obtained in Example 20 and Example 22 instead of treatment with interleukin-15 under the same conditions as Example 23 (A). Culture supernatants obtained by transfection of gamma-carboxylated human Gas6 were diluted 1:20 and treated simultaneously. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells treated with gamma-carboxylated human Gas6 and Axl monoclonal antibodies at the same time compared to controls treated with culture supernatant transfected with human Gas6 and only with Axl monoclonal antibody Slightly increased differentiation rate. The culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6 was simultaneously treated to obtain similar results as the differentiation of mature natural killer cells.

In addition, progenitor killer cells were treated with Axl monoclonal antibody and gamma-carboxylated human Gas6 together with interleukin-15 (Pepro Tech) (1: 1 ratio with antibody) under the same conditions to confirm the differentiation rate. . The results showed a slightly increased differentiation rate when treated with Axl monoclonal antibody and gamma-carboxylated human Gas6.

Example  30. Human Umbilical Cord Blood-Derived Hematopoietic Stem Cells in Animal Cancer Models in Axl Polyclonal  Differentiation Induced by Antibody (Santa Cruz) On mature natural killer cells  Anticancer activity

Nude Balb / c mouse, genetically deficient in immune function, 5 week old male nude mouse (MOD) to observe whether human cancer cells are killed by mature human killer cells differentiated with Axl polyclonal antibody (Santa Cruz) Mice, Orient Bio) was used to measure the anticancer activity. Nude mice were administered in accordance with animal care guidelines in a sterile animal room. Human-derived cancer cells (gastric cancer cells, KCLB no.00638; uterine cancer cells, KCLB no.10002; breast cancer cells, KCLB no.30022; kidney cancer cells, KCLB no.30044; melanoma cancer cells, KCLB no.30068; lung cancer cells, KCLB no.30053; various types including ovarian cancer cells, KCLB no.30077;) were cultured in a CO ₂ incubator at 37 ° C. using RPMI 1640 cell culture medium (Gibco) containing 10% fetal bovine serum. The cultured cancer cells were washed with 1XPBS and then treated with trypsin-EDTA (Gibco) to recover the cancer cells. Trypsin-EDTA was removed from the cells, the cells were suspended in 1XPBS, and prepared by measuring the cell number to 10 ⁸ cells / 0.1 μl. 10 ⁸ cancer cells were injected subcutaneously with nude mice using an insulin syringe (Pharmingen), and cancer cells were grown for about 1 week until the diameter was about 0.8 mm. Human mature natural killer cells (1 × 10 ⁶ ) differentiated with Axl polyclonal antibody (Santa Cruz) were formed in the formed cancer tissues, and then activated with human interleukin-2 (10 ng / ml), and then injected into cancer tissues. As a result of measuring the volume of cancer tissues by time, human mature natural killer cells differentiated with Axl polyclonal antibody (Santa Cruz) were injected compared to the control group injected with mature natural killer cells differentiated by goat antibody treatment. In one group, a significant decrease in cancerous tissue volume was observed.

Example  31. Human Umbilical Cord Blood-Derived Hematopoietic Stem Cells in Animal Cancer Models in  Person Axl  Fockle Ronald  Differentiation Induced by Antibody On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by human mature natural killer cells differentiated using human Axl polyclonal antibody, the mature natural killer cells treated with goat antibodies were injected in the same manner as in Example 30. Compared with one control group, a significant decrease in cancer tissue volume was observed in the group injected with mature natural killer cells differentiated with human Axl polyclonal antibody. Similar results were obtained when using mature natural killer cells differentiated with the purchased Axl polyclonal antibody and a reduction in cancer tissue volume.

Example  32. Human Umbilical Cord Blood-Derived Hematopoietic Stem Cells in Animal Cancer Models in  Person Axl Monoclonal  Differentiation Induced by Antibody On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by human mature natural killer cells differentiated using human Axl monoclonal antibody, the mature natural killer cells treated with goat antibodies were injected in the same manner as in Example 30. Compared to one control group, a significant decrease in cancer tissue volume was observed in the group injected with mature natural killer cells differentiated with human Axl monoclonal antibody. Similar results were obtained when using mature natural killer cells differentiated with the purchased Axl polyclonal antibody and a reduction in cancer tissue volume.

Example  33. Gamma in Human Umbilical Cord Blood-derived Hematopoietic Stem Cells in Animal Cancer Models Carboxylated  Differentiation Induced by Human Gas6 On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by human mature natural killer cells differentiated with gamma-carboxylated human Gas6, the culture supernatant transfected with vector was treated as a result of experiment in the same manner as in Example 30. Compared to the control group injected with mature natural killer cells, a significant decrease in the volume of cancer tissue was observed in the group injected with mature natural killer cells differentiated by treatment with gamma-carboxylated human Gas6. Similar results were obtained with the use of mature natural killer cells differentiated with Axl polyclonal antibody in the reduction of cancer tissue volume.

Example  34. Human Umbilical Cord Blood-Derived Hematopoietic Stem Cells in Animal Cancer Models in Axl Polyclonal  Antibodies (Santa Cruz) and Gamma Carboxylated  Person Gas6  Differentiation induced by On mature natural killer cells  Anticancer activity

      Axl polyclonal antibody (Santa Cruz) and gamma-carboxylated human gas6 by using the same method as in Example 30 to observe whether human cancer cells are killed by mature human killer cells differentiated Axl Axl polyclonal antibody (Santa Cruz) and gamma-carboxylated human Gas6 were compared to the control group differentiated only with polyclonal antibody (Santa Cruz) and the control group differentiated with only gamma-carboxylated human Gas6. In the group injected with mature natural killer cells treated with differentiation at the same time, the decrease rate of cancer tissue volume was slightly increased.

Example  35. Human Umbilical Cord Blood-Derived Hematopoietic Stem Cells in Animal Cancer Models in  Person Axl  Fockle in Raw Antibody and Gamma Carboxylated  Person Gas6  Differentiation induced by On mature natural killer cells  Anticancer activity

      In order to observe whether human cancer cells are killed by mature human killer cells differentiated using human Axl polyclonal antibody and gamma-carboxylated human Gas6, human Axl polyclonal was tested in the same manner as in Example 30. Mature natural killer cells differentiated by treatment with human Axl polyclonal antibody and gamma-carboxylated human Gas6 at the same time compared to the control group differentiated by treatment with raw antibody only and the gamma-carboxylated human Gas6. In the group injected with a slight increase in cancer tissue volume was observed. Similar results were obtained when using mature natural killer cells obtained using the culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  36. Human Umbilical Cord Blood-Derived Hematopoietic Stem Cells in Animal Cancer Models in  Person Axl Monoclaw Raw Antibody and Gamma Carboxylated  Person Gas6  Differentiation induced by On mature natural killer cells  Anticancer activity

      In order to observe whether human cancer cells are killed by mature human killer cells differentiated using human Axl monoclonal antibody and gamma-carboxylated human Gas6, human Axl monoclonal was tested in the same manner as in Example 30. Mature natural killer cells differentiated by treatment with human Axl monoclonal antibody and gamma-carboxylated human Gas6 at the same time compared to the control group differentiated by treatment with raw antibody only and the gamma-carboxylated human Gas6. In the group injected with a slight increase in cancer tissue volume was observed. Similar results were obtained when using mature natural killer cells obtained using the culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  37. Axl Polyclonal  Human Bone Marrow-derived Hematopoietic Stem Cells Using Antibodies (Santa cruz) from Mature natural killer cells  differentiation

       (A) Differentiation of natural killer cells from human bone marrow-derived hematopoietic stem cells

In order to separate hematopoietic stem cells from human bone marrow, 25 ml of human bone marrow was divided into 50 ml tubes, and hematopoietic stem cells and progenitor killer cells were separated and differentiated into mature killer cells in the same manner as in Example 23 (A). Human stromal cells used herein were isolated from human bone marrow, and stromal cell separation from bone marrow was performed using the same method as that of stromal cell separation from cord blood of Example 23 (A).

(B) Differentiation of mature natural killer cells using Axl polyclonal antibody (Santa cruz)

The progenitor killer cells obtained in (A) were differentiated for 14 days by adding 1 µg / ml Axl polyclonal antibody (Santa Cruz) instead of interleukin-15 treatment under the same conditions as in (A). The cells were FACS analyzed in the same manner as in Example 1 (B) to confirm the degree of differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ one cells showed about 2 to 3 times increased differentiation rate when treated with Axl polyclonal antibody compared to control group treated with goat antibody (FIG. 36).

In addition, under the same conditions, differentiation rate was confirmed by treating Axl polyclonal antibody (Santa Cruz) with interleukin-15 (Pepro Tech) at a ratio of 1 μg / ml in a 1: 1 ratio. As a result, it showed a slightly increased differentiation rate compared to the case of treatment with Axl polyclonal antibody alone.

Example  38. People Axl Polyclonal  Differentiation of Mature Natural Killer Cells from Human Bone Marrow Hematopoietic Stem Cells Using Antibodies

The progenitor killer cells obtained in Example 37 (A) were treated with Interleukin-15 under the same conditions as in Example 37 (A), and then 1 μg / ml of the Axl polyclonal antibody obtained in Example 19 was added for 14 days. After differentiation, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells showed an increase of about 2 to 3 times differentiation rate when treated with Axl polyclonal antibody compared to the goat antibody treated control group. Similar results were obtained using the Axl polyclonal antibody purchased to differentiate mature killer cells.

In addition, under the same conditions, differentiation rate was confirmed by treating progenitor killer cells with Axl polyclonal antibody in an amount of 1 μg / ml at a ratio of 1: 1 with interleukin-15 (Pepro Tech). As a result, it showed a slightly increased differentiation rate compared to the case of treatment with Axl polyclonal antibody alone.

Example  39. People Axl Monoclonal  Differentiation of Mature Natural Killer Cells from Human Bone Marrow-derived Hematopoietic Stem Cells Using Antibodies

The progenitor killer cells obtained in Example 37 (A) were treated with 1 µg / ml human Axl monoclonal antibody obtained in Example 20 instead of treating Interleukin-15 under the same conditions as in Example 37 (A). After differentiation, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells showed about 2 to 3 fold differentiation rate when treated with human Axl monoclonal antibody compared with goat antibody treated controls. Similar results were obtained using the Axl polyclonal antibody purchased to differentiate mature killer cells.

In addition, under the same conditions, differentiation rate was confirmed by treating progenitor killer cells with Axl monoclonal antibody in an amount of 1 μg / ml at a ratio of 1: 1 with interleukin-15 (Pepro Tech). The results showed a slightly increased differentiation rate when treated with Axl monoclonal antibody alone.

Example  40. Gamma Carboxylated  Person Gas6 Differentiation of Mature Natural Killer Cells from Human Bone Marrow-derived Hematopoietic Stem Cells

Instead of treating interleukin-15 on the same conditions as in Example 37 (A), the progenitor killer cells obtained in Example 37 (A) were diluted 1:20 with the culture supernatant obtained by transfection of Gas6 obtained in Example 22. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm the degree of differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells showed a differentiation rate of about 2 to 3 times when treated with gamma-carboxylated human Gas6 compared to the control group treated with the vector-transfected culture supernatant. Similar results were obtained when differentiating mature killer cells using human Axl polyclonal antibodies or Axl monoclonal antibodies.

In addition, progenitor cells were treated with gamma-carboxylated human Gas6 together with interleukin-15 (Pepro Tech) under the same conditions to confirm the differentiation rate. The results showed a slightly increased differentiation rate compared to the treatment with gamma-carboxylated human Gas6 alone.

Example  41. Axl Polyclonal  Antibodies ( Santa Cruz ) And gamma Carboxylated  Person Gas6 From Human Bone Marrow Derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 37 (A) were treated with Interleukin-15 under the same conditions as in Example 37 (A), but 1 μg / ml of Axl polyclonal antibody (Santa Cruz) and Gas6 obtained in Example 22. The culture supernatant obtained by transfection was diluted 1:20 and treated simultaneously. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells were treated with gamma-carboxylated human Gas6 and Axl polyclonal antibodies compared to controls treated with culture supernatants transfected with human Gas6 only and controls treated with Axl polyclonal antibody (Santa Cruz) only. Treatment at the same time showed slightly increased differentiation.

     In addition, under the same conditions, progenitor killer cells were treated with Axl polyclonal antibody (Santa Cruz) and gamma-carboxylated human Gas6 with interleukin-15 (Pepro Tech) (1: 1 ratio with antibody). The rate of fire was confirmed. The results showed a slightly increased differentiation rate when treated with Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  42. People Axl Polyclonal  Antibodies and Gammas Carboxylated  Person Gas6 From Human Bone Marrow Derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 37 (A) were treated with 1 µg / ml Axl polyclonal antibody obtained in Example 19 and Example 23 instead of the treatment of interleukin-15 under the same conditions as Example 37 (A). Culture supernatants obtained by transfection of gamma-carboxylated human Gas6 were diluted 1:20 and treated simultaneously. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells were treated with both gamma-carboxylated human Gas6 and human Axl polyclonal antibodies at the same time compared to controls treated with culture supernatant transfected with human Gas6 and only with Axl polyclonal antibody. The case showed slightly increased differentiation rate. The culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6 was simultaneously treated to obtain similar results as the differentiation of mature natural killer cells.

In addition, under the same conditions, progenitor killer cells were treated with Axl polyclonal antibody and gamma-carboxylated human Gas6 with interleukin-15 (Pepro Tech) (1: 1 ratio with antibody) to confirm the differentiation rate. . The results showed a slightly increased differentiation rate when treated with Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  43. People Axl Monoclonal  Antibodies and Gammas Carboxylated  Person Gas6 From Human Bone Marrow Derived Hematopoietic Stem Cells Mature natural killer cells  differentiation

The progenitor killer cells obtained in Example 37 (A) were treated with 1 μg / ml of human Axl monoclonal antibody obtained in Example 20 and Example 22, instead of the treatment of interleukin-15 under the same conditions as Example 37 (A). The culture supernatant obtained by transfection of the obtained gamma-carboxylated human Gas6 was diluted 1:20 and treated simultaneously. After differentiation for 14 days, human mature natural killer cells were analyzed by FACS in the same manner as in Example 1 (B) to confirm their differentiation. NKG2A, CD161, NKP46, NKP30, NKP44, NKG20 and CD56 were used as markers of mature natural killer cells in humans. CD56 ⁺ NKG2A ⁺ _{, ^{CD56 + CD161 +, CD56 + NKP46}} +, CD56 + NKP30 +, CD56 + NKP44 + and CD56 ⁺ NKG20 ⁺ cells were treated with both gamma-carboxylated human Gas6 and human Axl monoclonal antibodies at the same time compared to controls treated with culture supernatant transfected with human Gas6 only and with controls with Axl monoclonal antibody only. The case showed slightly increased differentiation rate. Similar results were obtained using the culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6.

In addition, progenitor killer cells were treated with Axl monoclonal antibody and gamma-carboxylated human Gas6 together with interleukin-15 (Pepro Tech) (1: 1 ratio with antibody) under the same conditions to confirm the differentiation rate. . The results showed a slightly increased differentiation rate when treated with Axl monoclonal antibody and gamma-carboxylated human Gas6.

Example  44. Human Bone Marrow-derived Hematopoietic Stem Cells in Animal Cancer Models in Axl Polyclonal  Antibodies ( Santa Cruz Differentiation induced by On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by human mature natural killer cells differentiated using Axl polyclonal antibody (Santa Cruz), the mature natural killer killed by treatment with goat antibodies was tested in the same manner as in Example 30. A significant decrease in the volume of cancer tissue was observed in the group injected with mature natural killer cells differentiated with Axl polyclonal antibody (Santa Cruz) compared to the control group injected with cells.

Example  45. Human Bone Marrow-derived Hematopoietic Stem Cells in Animal Cancer Models in  Person Axl Polyclonal  Differentiation Induced by Antibody On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by human mature natural killer cells differentiated using human Axl polyclonal antibody, the mature natural killer cells treated with goat antibodies were injected in the same manner as in Example 30. Compared with one control group, a significant decrease in cancer tissue volume was observed in the group injected with mature natural killer cells differentiated with human Axl polyclonal antibody. Similar results were obtained when using mature natural killer cells differentiated with the purchased Axl polyclonal antibody and a reduction in cancer tissue volume.

Example  46. Human Bone Marrow-derived Hematopoietic Stem Cells in Animal Cancer Models in  Person Axl  Monoclaw day  Differentiation Induced by Antibody On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by mature natural killer cells differentiated using human Axl monoclonal antibodies, the mature natural killer cells treated with goat antibodies were injected in the same manner as in Example 30. Compared to the control group, a significant decrease in the volume of cancer tissues was observed in the group injected with mature natural killer cells differentiated with human Axl monoclonal antibody. Similar results were obtained when using mature natural killer cells differentiated with the purchased Axl polyclonal antibody and a reduction in cancer tissue volume.

Example  47. Gamma in Human Bone Marrow-derived Hematopoietic Stem Cells in Animal Cancer Models Carboxylated  Differentiation Induced by Human Gas6 On mature natural killer cells  Anticancer activity

In order to observe whether human cancer cells are killed by mature natural killer cells differentiated with gamma-carboxylated human Gas6, the culture supernatants transfected with the vector were treated and differentiated in the same manner as in Example 30. Compared with the control group injected with mature natural killer cells, a significant decrease in the volume of cancer tissue was observed in the group injected with mature natural killer cells differentiated by treatment with gamma-carboxylated human Gas6. Similar results were obtained with the use of mature natural killer cells differentiated with Axl polyclonal antibody in the reduction of cancer tissue volume.

Example  48. Human Bone Marrow-derived Hematopoietic Stem Cells in Animal Cancer Models in Axl Polyclonal  Antibodies ( Santa Cruz ) And gamma Carboxylated  Person Gas6  Differentiation induced by On mature natural killer cells  Anticancer activity

      Axl polyclonal antibody (Santa Cruz) and gamma-carboxylated human gas6 by using the same method as in Example 30 to observe whether human cancer cells are killed by mature human killer cells differentiated Axl Axl polyclonal antibody (Santa Cruz) and gamma-carboxylated human Gas6 were compared to the control group differentiated only with polyclonal antibody (Santa Cruz) and the control group differentiated with only gamma-carboxylated human Gas6. In the group injected with mature natural killer cells treated with differentiation at the same time, the decrease rate of cancer tissue volume was slightly increased.

Example  49. Humans from Human Bone Marrow-derived Hematopoietic Stem Cells in Animal Cancer Models Axl Polyclonal  Antibodies and Gammas Carboxylated  Person Gas6  Differentiation induced by On mature natural killer cells  Anticancer activity

      In order to observe whether human cancer cells are killed by mature human killer cells differentiated using human Axl polyclonal antibody and gamma-carboxylated human Gas6, human Axl polyclonal was tested in the same manner as in Example 30. Mature natural killer cells differentiated by treatment with human Axl polyclonal antibody and gamma-carboxylated human Gas6 at the same time compared to the control group differentiated by treatment with raw antibody only and the gamma-carboxylated human Gas6. In the group injected with a slight increase in cancer tissue volume was observed. Similar results were obtained when using mature natural killer cells obtained using the culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6.

Example  50. Humans from human bone marrow-derived hematopoietic stem cells in animal cancer models Axl Monoclonal  Antibodies and Gammas Carboxylated  Person Gas6  Differentiation induced by On mature natural killer cells  Anticancer activity

     In order to observe whether human cancer cells are killed by mature human killer cells differentiated using human Axl monoclonal antibody and gamma-carboxylated human Gas6, human Axl monoclonal was tested in the same manner as in Example 30. Mature natural killer cells differentiated by treatment with human Axl monoclonal antibody and gamma-carboxylated human Gas6 at the same time compared to the control group differentiated by treatment with raw antibody only and the gamma-carboxylated human Gas6. In the group injected with a slight increase in cancer tissue volume was observed. Similar results were obtained when using mature natural killer cells obtained using the culture supernatant obtained by transfection of the purchased Axl polyclonal antibody and gamma-carboxylated human Gas6.

clinical

For two patients with distant metastasized colorectal cancer, one patient with recurrent lung metastasis, one patient with non-Hodgkin's lymphoma, and one patient with acute lymphocytic leukemia, each patient received chemotherapy according to their respective appropriate protocol. The first granulocyte-colony stimulating factor was injected at a subcutaneous dose of 600-900 ug / d. CD34 ⁺ PBSC was monitored daily as soon as leukocytes (WBC) recovered (> 1 × ^{10 9} / liter of blood). Blood was collected at 20 × 10 ⁶ CD34 ⁺ cells / liter of blood. The absolute number of CD34 ⁺ cells was assessed using a FACScan analyzer (Becton Dickinson / Aria) and an appropriate isotype-matched negative control. Peripheral blood drawn from the patient was isolated according to the method described in Example 23, and then differentiated into hematopoietic killer cells, and then the differentiated mature killer cells were treated with interleukin-2 (10 ng / ml) to activate the patient. Self-treatment by injection. Although the number of cases was small, all patients had a marked therapeutic effect of tumor reduction.

Claims (10)

As a ligand of Axl receptor tyrosine kinase (“Axl”), any one of an antibody against Axl, a gamma-carboxylated Gas6 (growth-arrest specific gene6) protein, and protein S (protein S) A composition used for inducing differentiation from progenitor killer cells to mature killer cells, characterized by containing the above ligands. The composition of claim 1, wherein said ligand is an antibody against Axl. The composition of claim 1, wherein said ligand is a gamma-carboxylated Gas6 protein. (i) Hematopoietic stem cells were treated with interleukin-7, SCF (stem cell factor) and Flt3L (Flt3 Ligand) to differentiate into progenitor killer cells, and (ii) progenitor killer cells were Axl receptor tyrosine kinase. , To differentiate into mature natural killer cells by treatment with at least one of an antibody against “Axl”), a gamma-carboxylated gas-arrest specific gene6 protein and a protein S. Method for producing a mature natural killer cells, characterized in that obtained. The method of claim 4, wherein the hematopoietic stem cells are derived from any one selected from the group consisting of human bone marrow, peripheral blood and umbilical cord blood. delete The method of claim 4, wherein the progenitor killer cells are treated with the ligand in the presence of human stromal cells. (i) Hematopoietic stem cells were treated with interleukin-7, SCF (stem cell factor) and Flt3L (Flt3 Ligand) to differentiate into progenitor killer cells, and (ii) progenitor killer cells were Axl receptor tyrosine kinase. , To differentiate into mature natural killer cells by treatment with at least one of an antibody against “Axl”), a gamma-carboxylated gas-arrest specific gene6 protein and a protein S. And (iii) treating the differentiated mature killer cells with interleukin-2 to activate them. The method of claim 8, wherein the throughput of interleukin-2 is 8-15 ng / mg. A therapeutic agent for colorectal cancer, breast cancer, non-Hodgkin's lymphoma or acute lymphocytic leukemia, characterized in that it comprises activated mature natural killer cells prepared according to claim 8.

Images