KR20070013802A - Recombinant adeno-associated virus comprising antisense cdnas of vegf-a, vegf-b and vegf-c and gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer comprising the same - Google Patents

Abstract

A recombinant adeno-associated virus comprising antisense cDNAs of VEGF-A(vascular endothelial growth factor-A), VEGF-B and VEGF-C and a gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer comprising the same virus are provided to reduce proliferation of tumor cells by inhibiting expression of VEGF associated with angiogenesis which is necessary for proliferation and transition of tumor cells. The recombinant adeno-associated virus(rAAV) vector comprises an antisense cDNA of VEGF-A of SEQ ID NO:1, an antisense cDNA of VEGF-B of SEQ ID NO:4 and an antisense cDNA of VEGF-C of SEQ ID NO:7, wherein the rAAV vector is prepared by (a) transfecting an animal cell line with pAAV vector containing the antisense cDNA of VEGF-A of SEQ ID NO:1, the antisense cDNA of VEGF-B of SEQ ID NO:4 and the antisense cDNA of VEGF-C of SEQ ID NO:7, an AAV rep-cap plasmid DNA and an adenovirus helper plasmid, (b) culturing the transfected animal cell line, and (c) destroying the cultured animal cell line, and isolating and purifying the rAAV particle. The gene therapeutic agent specific to large intestine cancer, bladder cancer and/or lung cancer comprises the recombinant adeno-associated virus(rAAV) vector.

Description

Recombinant Adeno-associated Virus Comprising Antisense cDNAs containing antisense cDNA of anti-F, A, VF-C and VF-C of VEGF-A, VEGF-B and VEGF-C and Gene Therapeutic Agent Specific to Large Intestine Cancer, Bladder Cancer and / or Lung Cancer Comprising the Same}

1 is a genetic map of pAAV-AShVEGF-ABC-IRES-EGFP according to the present invention.

2 is a genetic map of pAAV-AShVEGF-ABC according to the present invention.

3 is a graph showing changes in tumor volume in nude mice intraperitoneally injected with rAAV vectors.

4A and 4B are photographs showing the results of H & E staining of each tissue of nude mice intraperitoneally injected with the rAAV vector. The left photograph of each tissue shows the control group injected with HEPES buffer, and the right photograph shows the rAAV according to the present invention. The experimental group injected with the vector (1.5 X 10 ¹¹ ) is shown.

The present invention relates to gene therapy using antisense cDNA and adeno-associated virus (AAV) systems of VEGF-A, VEGF-B and VEGF-C, and more particularly, VEGF-A antisense cDNA, VEGF-B antisense cDNA. And a rAAV vector containing VEGF-C antisense cDNA and a colorectal cancer, bladder cancer and / or lung cancer-specific gene therapy comprising the rAAV vector.

The mortality rate from cancer is increasing year by year, both at home and abroad. Cancer is one of the leading causes of death in the world, along with infectious and cardiovascular diseases. According to the World Health Report of the World Health Organization (WHO), 7,121,000 people, 12.5% of all deaths in 2004, died of cancer and cancer populations in the next 25 years due to changes in eating habits, the environment and life expectancy. Is expected to increase to about 30 million people annually, with 20 million people dying from cancer.

Currently, the methods used for the treatment of cancer are largely surgical surgery, radiation treatment and drug treatment, these methods are used independently for the treatment of cancer or two or more methods are used in combination.

In general, surgical procedures can be applied at various stages of cancer. Early stage cancers can usually be treated by surgical surgery, but if the cancer is advanced or metastasized, the surgery is difficult because of surgery alone.

Radiation therapy treats cancer by irradiating the cancer cells with X-rays or γ-rays from external radiation or radioactive substances administered into the body.

Drug therapy is a method of destroying or inhibiting DNA or related enzymes necessary for the proliferation of cancer cells by administering oral or injection anticancer drugs. The advantage of pharmacotherapy over other methods is that the drug can reach any cancer in any part of the body and treat the metastasized cancer. Drug therapy is currently used as a standard therapy for the treatment of metastatic cancer. Of course, metastatic cancer cannot be cured by pharmacotherapy, but it plays an important role in prolonging lifespan by alleviating symptoms. However, chemotherapeutic agents that are the mainstay of such drug therapy have problems such as side effects and anticancer drug resistance.

However, thanks to remarkable developments in the life sciences, biotherapeutics are growing rapidly. Biotherapeutics are the therapeutic basis for preventing cancer progression by weakening the activity of cancer cells by restoring or increasing the body's natural immune function. Cancer cells can be effectively killed when the body's immune system is functioning, but otherwise cancer cells can easily proliferate or other pathogens can easily attack. It may be used with other therapies such as surgical surgery, radiotherapy, chemotherapy and the like to compensate for the above disadvantages of biotherapeutics.

Biotherapeutics currently of interest in the life sciences include antisense anticancer agents and angiogenesis inhibitors. Antisense anticancer agents induce cancer cell death by inhibiting the processing of mRNA or the expression of proteins using DNA fragments that can bind complementarily to the specific mRNA of cancer cells. As a result of the Human Genome Project, over 30,000 gene sequences were read and over 100,000 mRNA sequences were available. As a result, a large amount of information about mRNA candidate groups associated with cancer cells is secured, and antisense anticancer agents for genes related to signaling systems, apoptosis and cell proliferation are screened for clinical trials.

Tumor growth is only possible with the creation of new blood vessels that provide the oxygen and nutrients needed for this. In general, as cancer cells proliferate, the inside of the tumor becomes hypoxic and the tissues become necrotic. In addition, the hypoxia worsens because blood vessels are destroyed by the pressure of the tumor itself. To overcome this hypoxic state, the tumor expresses factors related to neovascularization (VEGF, bFGF, IL-8, PDGF, PD-EGF, etc.) to promote neovascular production. In other words, neovascularization is an essential process for tumor growth.

Neovascularization inhibitors aim to treat cancer by interfering with neovascularization of such tumors and inhibiting tumor growth. Direct neovascularization inhibitors interfere with the proliferation and migration of vascular endothelial cells or inhibit neovascular production by inhibiting the response to neovascular generating factors. Direct neovascularization inhibitors have the advantage of less inducing acquired drug resistance.

Indirect neovascularization inhibitors inhibit neovascularization by inhibiting protein expression in tumors that activate neovascularization or by blocking binding between the tumor protein and vascular endothelial cell surface receptors.

As described above, looking at the changes in the field of treatment, it can be seen that the change from the artificial chemicals to using the natural in vivo material. In particular, as genome research projects in various fields progress, genes that act as etiologies for various diseases are being discovered. In order to link these findings with clinical treatment or preventive effects, researches on gene transfer technology that normalizes function or activates therapeutic function by introducing genes for correcting lost or modified genes in the body, In other words, research is being actively conducted in the field of gene therapy. The field of gene therapy has been rapidly increasing in recent years with a lot of attention and research.

Gene therapy is a method of treating diseases by gene transfer and expression. Unlike drug therapy, gene therapy is a method of correcting genetic defects targeting a specific gene with a disorder. The ultimate goal of gene therapy is to genetically modify living cells to obtain a beneficial therapeutic effect. These therapies have the advantages of accurate delivery of the gene to the disease site, complete degradation in vivo, absence of toxic and immunogenic antigens, and long-term stable expression of the gene, thus providing the best possible treatment for the disease. It is in the spotlight as a treatment.

The main research field of gene therapy is to introduce genes that have a therapeutic effect on specific diseases, enhance resistance of normal cells to show resistance to anticancer drugs, or replace modified or missing genes in various genetic diseases. Can be summarized.

Gene therapy is largely divided into in vivo and in vitro . in vivo Gene therapy involves injecting therapeutic genes directly into the body, and in vitro gene therapy involves primarily culturing the target cells in vitro, introducing the genes into these cells, and then introducing the genetically modified cells back into the body. To inject. In vivo in current gene therapy research In vitro gene therapy is used more than gene therapy.

Gene delivery techniques are largely based on viral vector-based transfer methods, non-viral delivery methods using synthetic phospholipids or synthetic cationic polymers, and transient electrical stimulation on cell membranes. The present invention can be classified into physical methods such as electroporation to introduce genes.

Among the delivery techniques, the method of using a viral transporter is a preferred method for gene therapy because the transfer of genes can be efficiently carried out as a vector lacking the replication ability of some or all of the genes replaced with the therapeutic genes. to be. Viruses used as viral transporters or viral vectors include RNA viral vectors (retroviral vectors, lentivirus vectors, etc.) and DNA viral vectors (adenovirus vectors, adeno-associated virus vectors, etc.), as well as herpes simplex virus vectors. (herpes simplex viral vector) and alpha viral vector. Particularly active studies are retroviruses and adenoviruses.

The characteristics of retroviruses that integrate into the genome of host cells are harmless to the human body, but they can inhibit the function of normal cells during integration, infect various cells, easily proliferate, and range from 1 to 7 kb. Is able to accept the external genes of the genes and to generate replication-deficient viruses. However, it is difficult to infect cells after mitosis, it is difficult to transfer genes in vivo , and somatic cell tissues must be proliferated in vitro at all times. Retroviruses can also be integrated into the proto-oncogene, which is a risk of mutations and can also kill cells.

Adenoviruses, on the other hand, have a number of advantages as cloning vectors, which can be replicated in the nucleus of a medium size, are clinically non-toxic, and stable even when external genes are inserted. Eukaryotes can be transformed without rearrangement or loss of genes, and are expressed at stable and high levels even when integrated into host cell chromosomes. Good host cells for adenoviruses are the cells responsible for human hematopoiesis, lymph, and myeloma. However, because it is linear DNA, it is difficult to proliferate, it is not easy to recover the infected virus, and the infection rate of the virus is low. In addition, the expression of the delivered gene is greatest after 1 to 2 weeks, and in some cells, expression is maintained for only 3 to 4 weeks. Also problematic is the high immunogenicity.

Adeno-associated virus (AAV) has recently been preferred because it can complement the above problems, and has many advantages as a gene therapy agent. AAV is a single-stranded provirus, which requires an auxiliary virus to replicate, and the AAV genome is 4,680 bp and can be inserted into a specific region of chromosome 19 of an infected cell. Transgene (trans -gene) is inserted in the plasmid DNA (plasmid DNA) is connected by two inverted terminal repeats of 145bp (inverted terminal repeat, ITR) sequence and partial signal sequence (signal sequence) part, respectively. Transfection with other plasmid DNA expressing the AAV rep portion and the cap portion is added and adenovirus is added as a co-virus. AAV has a wide range of host cells that deliver genes, fewer immune side effects when repeated administration, and long gene expression periods. Moreover, it is safe for the AAV genome to integrate into the chromosome of the host cell and does not modify or rearrange the gene expression of the host.

Since 1994, AAV vectors containing CFTR genes have been approved by the NIH for the treatment of cystic fibrosis, and have been used for clinical treatment of various diseases. AAV vectors containing a factor IX gene, which is a coagulation factor, are used for the treatment of hemophilia B (hemophilia B), and development of a hemophilia A (hemophilia A) therapeutic agent using the AAV vector is in progress. In addition, AAV vectors containing various types of anticancer genes have been certified for use as tumor vaccines.

Gene therapy with VEGF can be exemplified by the recombinant defective adenovirus (Korean patent application: 10-2001-7013633) comprising a nucleic acid encoding an angiogenic factor to treat pulmonary circulatory boost, but the therapy is a VEGF sense base. Because the sequence is used, it can be used only for the treatment of ischemic diseases, and cannot be used for the treatment of neovascularization diseases, especially cancer. Moreover, adenoviruses are not suitable for therapeutic use because they have high immunogenicity, low infectivity to host cells, and short duration of expression.

Although there have been many studies on polypeptides for treating cancer, most of the substances belong to chemotherapeutic agents. In addition, although researches on polynucleotides have been continuously conducted, the results are insufficient in connection with a method of efficiently moving in vivo through a viral vector or the like.

Accordingly, the present inventors have prepared rAAV-AShVEGF-ABC which is designed to insert the antisense cDNA of VEGF-A, VEGF-B and VEGF-C into the rAAV vector having high anticancer effect, so that the rAAV-AShVEGF-ABC is in vivo . Confirmed that the tumor suppression effect has been completed the present invention.

It is a main object of the present invention to provide an rAAV vector containing VEGF-A antisense cDNA, VEGF-B antisense cDNA and VEGF-C antisense cDNA for gene therapy.

Another object of the present invention is to provide a colorectal cancer, bladder cancer and / or lung cancer specific gene therapy containing the rAAV vector.

 In order to achieve the above object, the present invention provides an rAAV vector containing a VEGF-A antisense cDNA of SEQ ID NO: 1, a VEGF-B antisense cDNA of SEQ ID NO: 4 and a VEGF-C antisense cDNA of SEQ ID NO: 7.

In the present invention, the rAAV vector is (a) a pAAV vector containing a VEGF-A antisense cDNA of SEQ ID NO: 1, a VEGF-B antisense cDNA of SEQ ID NO: 4 and a VEGF-C antisense cDNA of SEQ ID NO: 7, AAV rep- transfecting cap plasmid DNA and adenovirus helper plasmids into animal cell lines; (b) culturing the transfected animal cell line; And (c) crushing the cultured cell line, and then separating and purifying the recombinant rAAV particles.

The present invention also provides a colorectal cancer, bladder cancer and / or lung cancer-specific gene therapy comprising the rAAV vector.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1. Preparation of pAAV-AShVEGF-ABC

In order to prepare rAAV vectors into which the antisense cDNAs of VEGF-A, VEGF-B, and VEGF-C were inserted, a pAAV vector into which the antisense cDNA was inserted, pAAV-AShVEGF-ABC-IRES-EGFP, was prepared. To prepare pAAV-AShVEGF-ABC-IRES-EGFP, first, pAAV-AShVEGF-B-IRES-EGFP was prepared, and the cDNAs of AShVEGF-A and AShVEGF-C were combined. The trans-gene was inserted into pAAV plasmid DNA linked by two inverted terminal repeat sequences (ITRs) of 145 bp, a human cytomegalovirus (CMV) immediate early promoter, and an SV40 early mRNA polyadenylation signal sequence.

(1) Construction of pAAV-AShVEGF-A

RNA was extracted from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells to synthesize cDNA, and 429 bp human VEGF-A isoform antisense cDNA (SEQ ID NO: 1) by RT-PCR method using the following AShVEGF-A primer. ) (Positions 1025-1453). The amplification fragment was restriction enzyme Kpn I and Treatment with Xho I and ligation with pAAV-FIX cis plasmid DNA (US 6,093,292) digested with the same restriction enzymes yielded pAAV-AShVEGF-A.

AShVEGF-A F2: GG GGTACC GTCTTGCTCTATCTTTC (SEQ ID NO: 2)

Kpn I

AShVEGF-A R1: CC CTCGAG GGCCTCCGAAACCATGAACT (SEQ ID NO: 3)

Xho I

(2) Construction of pAAV-AShVEGF-B

RNA was extracted from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells to synthesize cDNA, and 466bp of human VEGF-B isoform antisense cDNA (SEQ ID NO: 4) by RT-PCR method using the following AShVEGF-B primer. (Positions 41-506) were amplified. Amplification fragments restriction enzyme Eco RV and Treatment with Xho I ligated with pAAV-FIX cis plasmid DNA digested with the same restriction enzyme to prepare pAAV-AShVEGF-B.

AShVEGF-B F2: A GATATC CAGAGTCCCAGCCCGGAACAGA (SEQ ID NO: 5)

Eco RV

AShVEGF-B R2: CC CTCGAG ATGAGCCCTCTGCTCCG (SEQ ID NO: 6)

Xho I

(3) Construction of pAAV-AShVEGF-C

RNA was extracted from HUVEC cells to synthesize cDNA, and 383bp of human VEGF-C isoform antisense cDNA (SEQ ID NO: 7) (positions 536-918) was amplified by RT-PCR method using the following AShVEGF-C primers. The amplified fragment with restriction enzymes Kpn I and Xho I by treatment with, to the ligated DNA and plasmid pAAV-FIX cis Lai cut with the same restriction enzymes, to prepare the pAAV-AShVEGF-C.

AShVEGF-C F1: GG GGTACC ACATCTGTAGACGGACACACA (SEQ ID NO: 8)

Kpn I

AShVEGF-C R3: CC CTCGAG CTCGACCTCTCGGACGC (SEQ ID NO: 9)

Xho I

(4) Construction of pAAV-AShVEGF-B-IRES-EGFP

pIRES2-EGFP plasmid DNA (Clontech, Cat # 6029-1, USA) restriction enzyme Xho I And IRES-EGFP cDNA insert was prepared by treating with Not I and klenow fragments. PAAV-AShVEGF-B plasmid DNA prepared in the above (2) restriction enzyme Xho I and Linearized vectors were prepared by treatment with Bam HI and klenow fragments. PAAV-AShVEGF-B-IRES-EGFP was prepared by mixing the insert DNA with the linearized vector and subcloning by adding T4 DNA ligase.

(5) Construction of pAAV-AShVEGF-AB-IRES-EGFP construct

The pAAV-AShVEGF-A plasmid DNA produced in the above (1) restriction enzyme Kpn I and AShVEGF-A cDNA insert was prepared by treating with Xho I and klenow fragments, and a linearized vector was prepared by treating pAAV-AShVEGF-B-IRES-EGFP plasmid DNA prepared in (4) with restriction enzyme Eco RV. PAAV-AShVEGF-AB-IRES-EGFP was prepared by mixing the insert DNA with the linearized vector, subcloning by adding T4 DNA ligase.

In order to confirm the orientation of the prepared DNA of pAAV-AShVEGF-AB-IRES-EGFP, the following AShVEGF-A F2 primer (SEQ ID NO: 10) designed using the sequence of cDNA of antisense A and cDAN of antisense B PCR was performed using the following AShVEGF-B R2 primer (SEQ ID NO: 11) designed using the sequence of.

AShVEGF-A F2: GGGGTACCGTCTTGCTCTATCTTTC (SEQ ID NO: 10)

AShVEGF-B R2; CCCTCGAGATGAGCCCTCTGCTCCG (SEQ ID NO: 11)

(6) Construction of pAAV-AShVEGF-ABC-IRES-EGFP

The pAAV-AShVEGF-C plasmid DNA prepared in (3) above was treated with restriction enzymes Kpn I and Bam HI and klenow fragments to prepare AShVEGF-C cDNA insert DNA. PAAV-AShVEGF-AB-IRES-EGFP plasmid DNA constructed in (5) above Linearized vectors were prepared by treatment with restriction enzymes Xho I and klenow fragments. The insert DNA was mixed with the linearized vector, and subcloning was performed by adding T4 DNA ligase to prepare pAAV-AShVEGF-ABC-IRES-EGFP (FIG. 1).

(7) Construction of pAAV-AShVEGF-ABC

PAAV-AShVEGF-ABC-IRES-EGFP prepared in (6) was treated with restriction enzymes Xba I and Xho I to obtain AShVEGF-ABC fragments, and the same restriction enzymes Xba I and Xho I as the AShVEGF-ABC fragments were obtained. The treated pAAV-FIX cis plasmids were mixed and ligated to prepare pAAV-AShVEGF-ABC (FIG. 2).

Example 2 Construction of rAAV-AShVEGF-ABC Vectors for Use as Gene Therapeutics

To produce recombinant AAV (rAAV) vector for use in gene therapy of plasmid DNA in addition to Example 1, the pAAV AAV rep-cap plasmid DNA rep AAV (pAAV-RC plasmid expressing part and the cap portion, produced by Stratagene Co., USA) and adenovirus helper plasmids (pHelper plasmid, Stratagene Co., USA). All three kinds of plasmid DNA were transfected into HEK293 (human embryonic kidney 293; ATCC CRL-1573) cells, and then cultured for 96 hours, HEK293 cells were collected and sonicated, and recombinant AAV (rAAV) particles were transformed into CsCl. The density gradient centrifugation was repeated three times, and the portions having RI (Refractive Index) of 1.37 to 1.41 g / ml were collected and separated to obtain rAAV-AShVEGF-ABC.

Example 3. Analysis of anticancer effect using rAAV-AShVEGF-ABC (Xenograft analysis)

(1) Experimental animals and environmental conditions

Human lung cancer cell line NCI-H460 (Human lung cell) (ATCC HTB-177) was introduced into four-week-old male BABL / c nu / nu mice (Central Laboratory Animals, Japan SLC, Inc.) weighing 16 ± 0.2 g. After making a solid cancer induction model, the efficacy of rAAV-CMV-AShVEGF-ABC gene therapy was confirmed.

Nude mice used in this example were subjected to veterinary quarantine for general health at the time of acquisition, with a period of 1 week of acclimation to screen healthy individuals suitable for conducting the test. This experiment was conducted in a laboratory dedicated to animal experiments with temperature 23 ± 2 ℃, relative humidity 55 ± 5%, ventilation times 10-12 times / hr, lighting time 12 hours (07: 00 ~ 19: 00), and illuminance 150-300 Lux. Was carried out. Feed was freely ingested sterile solid feed (Samtaco Bio Korea Co., Ltd.) for experimental animals, drinking water was freely ingested sterile purified water.

The drinking water was tested by the Chungcheongbuk-do Institute of Health and Environment (140-50 Songjeong-dong, Cheongju-si, Chungcheongbuk-do). Original E. coli, E. coli group was not detected

(2) experimental conditions

The darkening process of BABL / c nu / nu mice used in this experiment is as follows. After incubating NCI-H460 cells in 10% FBS and antibiotic-added RPMI-1640 medium for 3 passages or more, 5 x 10 ⁸ cells / ml of NCI-H460 cells were injected into the subcutaneous subcutaneous subcutaneous syringe (26 gauge). After 0.2 ml injection, the tumors were extracted 20 days later and subjected to second passage using new solid tumor tissue at the edge. After 14 to 16 days, tumors were cut into 3x3x3 mm tumors (3 x 3 x 3 mm) in the mouse for the final experiment in the same way as the secondary passage. Individuals up to ³ mm in diameter were selected and grouped to test intraperitoneally.

In this example, rAAV-AShVEGF-ABC prepared in Example 2 was administered to mice by an intraperitoneal injection in the amount of 1.5 x 10 ¹¹ virus particles / mouse. In addition, rAAV-EGFP was included in the control group because it has been reported to have anticancer effects by the rAAV2 serotype vector itself. In the rAAV-AShVEGF-ABC vector according to the present invention, 5 × 10 ¹¹ virus particles / ml were administered to a 6-week-old male mouse by 0.3 ml (1.5 × 10 ¹¹ virus particles / mouse) intraperitoneally. Meanwhile, HEPES buffer used as a vehicle in the control group was also administered by intraperitoneal administration (Table 1).

Test group (IP) by abdominal cavity administration Test group (abdominal administration group) Dose (virus particles / mouse) The number of animals Control rAAV-EGFP (Control) rAAV-AShVEGF-ABC HEPES buffer 1.5 × 10 ¹¹ 1.5 × 10 ¹¹ 8 8 8

Survival confirmation and other clinical symptoms were observed until 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 12 hours after administration, and then survival and abnormality of mice were observed twice daily for 4 weeks.

(3) Weight change and tumor volume measurement

Body weights of all animals were measured immediately before administration and twice a week after administration of the test substance, and tumor volume was also measured for 4 weeks using Vernier calipers twice a week. As a result, low weight gain rate was observed and there was no correlation between cancer treatment effect and weight change rate of test animals.

On the other hand, as a result of examining the tumor volume change rate, the HEPES control group and the rAAV-EGFP vector control group showed little difference in cancer growth rate, but the rAAV-AShVEGF-ABC vector administration group showed a 35% cancer growth inhibition effect compared to the control group. (FIG. 3). From this result, it can be seen that the rAAV2 used as a control group has almost no anticancer effect by the serotype itself, and it was confirmed that the rAAV-AShVEGF-ABC vector according to the present invention showed excellent tumor suppression effect.

(4) immunohistochemical and histological analysis

After immobilizing the tumor tissue in formalin, immunohistochemistry analysis was performed using anti-CD34 antibody to measure endothelial cell density by making paraffin embedded sections, and tumor nodule and major organs by H & E staining. Histopathological analyzes were performed (kidney, liver, heart, lung, spleen, epididymis, testes) (FIGS. 4A and 4B).

In the HEPES buffer, rAAV-AShVEGF-ABC, and rAAV-EGFP-treated groups, no specific changes or abnormalities of liver tissues (lobules, degeneration of sinusoid structures, perivascular changes, bile ducts and portal vein) were observed. Capillary, nasal, red medulla, white medulla, follicular margin, blood vessels and lymphatic vessels) were also in normal form, and some immature cells were observed, but it was difficult to find significant findings.

In the renal tissue condition, no significant lesions were observed in glomeruli including proximal, distal, and ductal epithelial cells in the HEPES buffer, rAAV-AShVEGF-ABC, and rAAV-EGFP groups. No significant pathological findings were observed in the tissues.

In the effect of rAAV vector on lung tissue, lung lobes were well maintained, alveoli were well opened, and epilepsy was thin and wide in the HEPES buffer administration group, but no infiltration of inflammatory cells was observed. These findings were similarly observed in the rAAV-AShVEGF-ABC and rAAV-EGFP administration groups, and no significant change was observed by administration of the test substance.

The effects of rAAV vector on testicular and epididymal tissues showed that seminiferous tubules and Leydig's cells were well-organized in the HEPES buffered control group. Spermatid and fully mature sperm cells were present on it, and no significant findings were observed in other histological and epididymal tissues. These findings were similarly observed in the rAAV-AShVEGF-ABC and rAAV-EGFP administration groups, and no significant change was observed by administration of the test substance.

Regarding the effect of rAAV vector on the tumor tissues, the control group administered with HEPES buffer had a large distribution of dead and dead cells on the inner side of the tumor tissue, whereas the outer side had a large number of living cells. Was similar in the rAAV-AShVEGF-ABC and rAAV-EGFP administration groups.

Having described the specific parts of the present invention in detail, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be.

The present invention has the effect of providing a rAAV vector containing VEGF-A antisense cDNA, VEGF-B antisense cDNA and VEGF-C antisense cDNA for gene therapy, specific for colorectal cancer, bladder cancer and / or lung cancer containing the rAAV vector It has the effect of providing gene gene therapy.

In accordance with the present invention, gene therapeutic agents can be effectively used to treat cancer at the genetic level by efficiently inhibiting the expression of VEGF involved in angiogenesis essential for tumor proliferation and metastasis, thereby reducing tumor growth.

<110> PARK, Keerang          AHN, Mee-Young          KIM, Wun-Jae          HWANG, Seock-Yeon          CHO, Young-Hwa          LEE, Heuiran <120> Recombinant Adeno-associated Virus Comprising Antisense cDNAs of          VEGF-A, VEGF-B and VEGF-C and Gene Therapeutic Agent Specific to          Large Intestine Cancer, Bladder Cancer and / or Lung Cancer          Comprising the Same <130> P05-B127 <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 429 <212> DNA <213> Homo sapiens <400> 1 gggcctccga aaccatgaac tttctgctgt cttgggtgca ttggagcctt gccttgctgc 60 tctacctcca ccatgccaag tggtcccagg ctgcacccat ggcagaagga ggagggcaga 120 atcatcacga agtggtgaag ttcatggatg tctatcagcg cagctactgc catccaatcg 180 agaccctggt ggacatcttc caggagtacc ctgatgagat cgagtacatc ttcaagccat 240 cctgtgtgcc cctgatgcga tgcgggggct gctgcaatga cgagggcctg gagtgtgtgc 300 ccactgagga gtccaacatc accatgcaga ttatgcggat caaacctcac caaggccagc 360 acataggaga gatgagcttc ctacagcaca acaaatgtga atgcagacca aagaaagata 420 gagcaagac 429 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggggtaccgt cttgctctat ctttc 25 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ccctcgaggg cctccgaaac catgaact 28 <210> 4 <211> 406 <212> DNA <213> Homo sapiens <400> 4 atgagccctc tgctccgccg cctgctgctc gccgcactcc tgcagctggc ccccgcccag 60 gcccctgtct cccagcctga tgcccctggc caccagagga aagtggtgtc atggatagat 120 gtgtatactc gcgctacctg ccagccccgg gaggtggtgg tgcccttgac tgtggagctc 180 atgggcaccg tggccaaaca gctggtgccc agctgcgtga ctgtgcagcg ctgtggtggc 240 tgctgccctg acgatggcct ggagtgtgtg cccactgggc agcaccaagt ccggatgcag 300 atcctcatga tccggtaccc gagcagtcag ctgggggaga tgtccctgga agaacacagc 360 cagtgtgaat gcagacctaa ccgttctgtt ccgggctggg actctg 406 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 agatatccag agtcccagcc cggaacaga 29 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ccctcgagat gagccctctg ctccg 25 <210> 7 <211> 383 <212> DNA <213> Homo sapiens <400> 7 ctcgacctct cggacgcgga gcccgacgcg ggcgaggcca cggcttatgc aagcaaagat 60 ctggaggagc agttacggtc tgtgtccagt gtagatgaac tcatgactgt actctaccca 120 gaatattgga aaatgtacaa gtgtcagcta aggaaaggag gctggcaaca taacagagaa 180 caggccaacc tcaactcaag gacagaagag actataaaat ttgctgcagc acattataat 240 acagagatct tgaaaagtat tgataatgag tggagaaaga ctcaatgcat gccacgggag 300 gtgtgtatag atgtggggaa ggagtttgga gtcgcgacaa acaccttctt taaacctcca 360 tgtgtgtccg tctacagatg tgg 383 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ggggtaccac atctgtagac ggacacaca 29 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccctcgagct cgacctctcg gacgc 25 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ggggtaccgt cttgctctat ctttc 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccctcgagat gagccctctg ctccg 25  

Claims (3)

RAAV vector containing VEGF-A antisense cDNA of SEQ ID NO: 1, VEGF-B antisense cDNA of SEQ ID NO: 4 and VEGF-C antisense cDNA of SEQ ID NO: 7 The rAAV vector of claim 1, wherein the rAAV vector is prepared by the following steps: (a) a pAAV vector containing the VEGF-A antisense cDNA of SEQ ID NO: 1, the VEGF-B antisense cDNA of SEQ ID NO: 4 and the VEGF-C antisense cDNA of SEQ ID NO: 7, an AAV rep-cap plasmid DNA and an adenovirus helper plasmid Transfecting the animal cell line; (b) culturing the transfected animal cell line; And (c) crushing the cultured cell line, and then separating and purifying the recombinant rAAV particles. A colorectal cancer, bladder cancer and / or lung cancer-specific gene therapy comprising the rAAV vector of claim 1.

Images