KR20050035306A - Method for identificating borrelia burgdorferi using groel gene - Google Patents

Method for identificating borrelia burgdorferi using groel gene Download PDF

Info

Publication number
KR20050035306A
KR20050035306A KR1020030070588A KR20030070588A KR20050035306A KR 20050035306 A KR20050035306 A KR 20050035306A KR 1020030070588 A KR1020030070588 A KR 1020030070588A KR 20030070588 A KR20030070588 A KR 20030070588A KR 20050035306 A KR20050035306 A KR 20050035306A
Authority
KR
South Korea
Prior art keywords
borrelia burgdorferi
bacteria
borrelia
corridor
seq
Prior art date
Application number
KR1020030070588A
Other languages
Korean (ko)
Other versions
KR100525763B1 (en
Inventor
이승현
박효순
이정희
Original Assignee
학교법인 건국대학교
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 학교법인 건국대학교 filed Critical 학교법인 건국대학교
Priority to KR10-2003-0070588A priority Critical patent/KR100525763B1/en
Publication of KR20050035306A publication Critical patent/KR20050035306A/en
Application granted granted Critical
Publication of KR100525763B1 publication Critical patent/KR100525763B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113PCR

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 보렐리아 복도페리(Borrelia burgdorferi) 균을 동정하는 방법에 관한 것으로, 더욱 자세하게는 세균의 groEL 유전자의 염기서열을 비교하여 보렐리아 균종을 동정 및 검출하는 방법에 관한 것이다.The present invention relates to a method for identifying Borrelia burgdorferi bacteria, and more particularly, to a method for identifying and detecting Borrelia species by comparing nucleotide sequences of the groEL genes of bacteria.

본 발명에 따르면, 기존 16S rDNA 유전자 비교 분석이나 인터제닉 스페이서 엠플리콘을 이용한 RFLP 방법보다 빠르고 간편하게 보렐리아를 동정 및 검출할 수 있다.According to the present invention, it is possible to identify and detect Borrelia faster and more conveniently than the conventional 16S rDNA gene comparison analysis or the RFLP method using the intergenic spacer amplicon.

Description

지알오이엘 유전자를 이용한 보렐리아 복도페리의 동정방법 {Method for Identificating Borrelia burgdorferi Using groEL Gene} Method for Identificating Borrelia burgdorferi Using groEL Gene}

본 발명은 보렐리아 복도페리(Borrelia burgdorferi) 균을 동정 및 검출하는 방법에 관한 것으로, 더욱 자세하게는 세균의 groEL유전자의 염기서열을 비교하여 보렐리아 균종을 동정 및 검출하는 방법에 관한 것이다.The present invention relates to a method for identifying and detecting Borrelia burgdorferi bacteria, and more particularly, to a method for identifying and detecting Borrelia species by comparing nucleotide sequences of groEL genes of bacteria.

라임병은 스웨덴의 의사 Afzelius에 의해 1905년에 증상이 알려지게 되었으나 그 당시에는 원인균을 알지 못한 상태에서 증상을 기준으로 하여 ACA(Acrodermatitis Chronicum Atrophicans)나 Pick Herxheimer병으로 불렸다. 그 후 1975년 미국의 코네티컷주의 라임지방에서 발생한 다수의 유년기 류마티즘 환자가 위에서 서술한 만성유주성홍반(Erythema Chronicum Migrans)을 동반함을 알게 되었으며, 1984년에 Burgdorfer에 의해 원인균이 진드기로부터 분리됨으로써 위 질병들이 모두 같은 질병인 것이 밝혀지게 되었고 이를 라임병이라 명명하였다. 또한 라임병을 일으키는 균종들을 재귀열과 관련된 보렐리아(Borrelia) 균종들과 비교하여 보렐리아 복도페리 sensu lato로 명명하였다.Lyme disease became known in 1905 by Swedish doctor Afzelius, but at that time it was called ACA (Acrodermatitis Chronicum Atrophicans) or Pick Herxheimer disease based on symptoms without knowing the causative organism. Later, in 1975, a number of childhood rheumatism patients in Lyme, Connecticut, USA were found to be accompanied by Erythema Chronicum Migrans, described above. It turned out that the diseases were all the same disease, which was named Lyme disease. Also it borelri the species that cause Lyme disease and relapsing fever associated Ah (Borrelia) With fungi Compare Borrelia Hallway Ferry It was named sensu lato.

보렐리아 복도페리 sensu lato(Borrelia burgdorferi sensu lato)는 그람음성 미호기세균으로 20-30 ㎛ 길이에 직경 0.2-0.3 ㎛인 나선균이다. 이분법으로 분열하며 플라젤라의 수가 7-11개로 재귀열을 일으키는 보렐리아 균종들은 15-30개이다. 이 균은 참진드기(Ixodes속)의 중장(midgut)에서 발견되며 전염은 진드기가 물 때 중장액(suspension)의 역류로 이루어진다고 알려져 있다. Borrelia burgdorferi sensu lato is a Gram-negative microaerobic bacterium that is 20-30 µm long and 0.2-0.3 µm in diameter. Borelia, dividing by dichotomy, recursion with 7-11 flagella The number of species is 15-30. The fungus is found in the midgut of true mites (genus Ixodes ), and transmission is known to be caused by the reflux of the suspension when the tick bites.

진드기에 물리면 열, 피로감, 근육통, 관절통 등을 동반하는 감기와 비슷한 증상이 나타나고 유주성홍반(Erythema migrans)이라는 특징적인 피부증상이 나타난다. 치료를 받지 않으면 안면근 마비, 신경염, 뇌막염 등의 신경학적 증상들과 관절염, 심근염 등을 일으킬 수 있다. 또한 ACA (Acrodermatitis chronica atrophicans) 같은 피부 증상이 나타나기도 한다. If you bite a tick, you may experience a cold-like condition with fever, fatigue, muscle pain, joint pain, and a characteristic skin condition called Erythema migrans. If left untreated, it can cause neurological symptoms such as facial muscle paralysis, neuritis, and meningitis, as well as arthritis and myocarditis. In addition, skin symptoms such as ACA (Acrodermatitis chronica atrophicans) may occur.

보렐리아 복도페리 sensu lato에는 현재까지 11개의 종이 알려져 있다. 1984년에 라임병의 원인균이 진드기로부터 분리된 이래 세계 각 국에서 많은 수의 보렐리아 복도페리 sensu lato가 분리되었다. 처음엔 하나의 종으로 알려져 있었으나 단백질염색 양상과 단세포군 항체반응, PCR 방법에 의해 보렐리아 복도페리 sensu lato(Borrelia burgdorferi sensu lato)를 보렐리아 복도페리 sensu stricto, 보렐리아 가니(B. garinii), 보렐리아 아프젤리(B.afzelii), 보렐리아 자포니카( B. japonica) 등 크게 4개의 종(species)으로 분류하였다.Borelia corridor Ferry sensu lato eleven species are known to date. Since the causative agent of Lyme disease was isolated from ticks in 1984, a large number of Borelia corridors in countries around the world sensu lato was isolated. At first it was known as a species, but by protein staining, unicellular antibody reaction and PCR Borrelia corridor Ferry sensu lato ( Borelia burgdorferi sensu lato) Borrelia corridor Ferry sensu stricto, Borelia gani ( B. garinii ) , Borelia afzelii , B. japonica ( B. japonica ) Etc. It was classified into four species (species).

그러나 최근에 멀티로커스 효소 전기영동법(multilocus enzyme electrophoresis), DNA 절단효소 분석법, rrf-rrl 유전자 사이의 엠플리콘(amplicons)을 이용한 RFLP 방법, 16S rDNA 시퀀싱 등이 이용되면서, 또 다른 7개, 즉 보렐리아 발라이시아나(B. valaisiana), 보렐리아 루시타니(B. lusitaniae), 보렐리아 안더소니(B. andersonii), 보렐리아 트루디(B. turdi ), 보렐리아 타누키(B. tanukii), 보렐리아 비세티(B. bissettii), 보렐리아 시니카( B. sinica) 등의 새로운 균종이 첨가되었다.In recent years, however, multilocus enzyme electrophoresis, DNA cleavage assays, RFLP methods using amplicons between rrf-rrl genes, and 16S rDNA sequencing have been used. B. valaisiana , B. lusitaniae , B. andersonii , B. turdi , B. tanukii , Borelli New species, such as B. bissettii and B. sinica , were added.

지금까지 균종과 매개체, 임상증상 관계에 대한 역학연구가 많이 이루어졌다. 보렐리아 복도페리 sensu stricto는 주로 미국과 유럽에서 분리가 되고, 보렐리아 가니(B. garinii), 보렐리아 아프젤리(B. afzelii)는 유럽과 아시아에서 분리되고 있다. 진드기 중 이소더스 퍼설카투스(I. persulcatus)는 보렐리아 가니(B. garinii)와 보렐리아 아프젤리(B. afzelii)의 균주만 갖고 있다. 보렐리아 자포니카(B. japonica), 보렐리아 투디(B. turdae), 보렐리아 타누키(B. tanukii)는 일본에서 분리되었으며, 각각 익소더스 오바투스(Ixodes ovatus), 익소더스 터두스(I. turdus), 익소더스 타누키(I. tanuki)가 매개진드기이다. 미국에서 분리된 보렐리아 안더소니(B. andersonii)는 매개진드기가 익소더스 덴타투스(I. dentatus)이다. 또한 보렐리아 비세티(B. bissettii)는 미국에서 분리된 반면에 보렐리아 발라이시아나(B. valaisiana), 보렐리아 루시타니(B. lusitaniae)는 유럽에서 분리되었다.There have been many epidemiological studies on the relationship between species, mediators, and clinical symptoms. The Borelia corridor sensu stricto is mainly separated in the United States and Europe, while the Borelia Gani ( B. garinii ) and Borelia afzelii are separated in Europe and Asia. Traders ISO of mites spread seolka tooth (I. persulcatus) has only the strain of going borelri Oh (B. garinii) and borelri ah hurt jelly (B. afzelii). B. japonica, B. turdae and B. tanukii were separated from Japan, and Ixodes ovatus and Ixos turdus ( I. turdus ), and Iso tanuki ( I. tanuki ) are mediated ticks. Borella B. andersonii , isolated from the United States, has a mediated tick of I. dentatus . Also, B. bissettii was isolated in the United States, while B. valaisiana and B. lusitaniae were separated in Europe.

이러한 유전자 그룹화는 각 지역에 따른 임상증상의 차이와도 관련이 있을 것으로 보고되고 있다. 그 예로써 미국에서는 보렐리아 복도페리 sensu stricto군이 주로 분리되며 주 증상으로 관절염을 수반하고 있으나, 유럽에서는 보렐리아 가니(B. garinii) 및 보렐리아 아프젤리(B. afzelii)군이 주요 분리균주이며, 주로 신경학적 증상은 보렐리아 가니(B. garinii)와 피부증상인 ACA(Acrodermatitis chronica atrophicans)는 보렐리아 아프젤리(B. afzelii)와 연관되어 있다. 따라서 간편한 분류·동정법의 개발은 균종과 매개체, 임상증상의 관계에 대한 역학연구를 더욱 활발히 이루어 질 수 있도록 할 것이다.It is reported that this gene grouping may be related to the difference in clinical symptoms according to each region. For example, in the United States, the Borrelia corridor sensu stricto group is mainly isolated and has arthritis as the main symptom. In Europe, the major isolates are Borrelia gani ( B. garinii ) and Borrelia afzelii group. The neurological symptoms are mainly Borrelia gani ( B. garinii ) and skin symptoms ACA (Acrodermatitis chronica atrophicans) are associated with Borrelia afzelii ( B. afzelii ). Therefore, the development of simple classification and identification methods will enable more active epidemiological studies on the relationship between species, mediators and clinical symptoms.

국내에서는 1992년 본 발명자들이 익소더스 니폰네시스(Ixodes nipponensis)라는 진드기에서 처음 분리한 이래 진드기 및 들쥐에서 23 균주가 분리되었으며 (표 1), 단백질 염색 양상, 단세포군 항체와의 반응양상, PCR방법으로 동정을 시도한 결과 23주의 분리균주중 11 균주가 보렐리아 아프젤리(B. afzelii)로 동정되었고, 12 균주는 보렐리아 가니(B. garinii)일 것으로 추정되었다. 그러나, 단세포군 항체반응양상에서 보렐리아 가니로 추정되었던 일부균주들(전남 해남에서 분리된 일부균주들)이 다른 나라 참조균주와 다른 양상을 보이고, 23S rRNA의 유전자일부를 프로브로 이용한 RFLP 패턴이 참조균주들과 다른 양상을 보였다. 따라서 이 균주들이 기존에 알려진11개의 균종들과 다른 균종인지 더욱 정확한 동정이 필요하다In 1992, the inventors of the present invention called Ixodes nipponensis Since the first separation from mites, 23 strains were isolated from ticks and mice (Table 1). As a result of protein staining pattern, reaction pattern with unicellular antibody, and PCR method, 11 strains of 23 strains were Borelia aching. It was identified as jelly ( B. afzelii ) and 12 strains were assumed to be Borelia garniii ( B. garinii ). However, some strains (strains isolated from Haenam, Jeollanam-do), which were presumed to be Borelia crucibles in unicellular antibody reactions, showed a different pattern from reference strains in other countries. It is different from the reference strains. Therefore, it is necessary to more accurately identify whether these strains are different from the 11 known species.

한국에서 분리된 보렐리아 복도페리 센수 라토(Borrelia burgdorferisensu lato) Borrelia burgdorferi sensu lato isolated in Korea 분리지역Separation 매개체Media Bell 시험수Test 배양수Culture water 분리균Isolate 충청북도Chung-cheong bukdo 진드기mite I. nipponensisI. nipponensis 77 KK1, KK2, KK5, CJ1, CJ2, CJ3, CJ21KK1, KK2, KK5, CJ1, CJ2, CJ3, CJ21 rat A. agrariusA. agrarius 1212 22 KM4, KM10KM4, KM10 전라남도Jeollanam-do 진드기mite I. granulatusI. granulatus 2929 44 HN6, HN7, HN8, HN9,HN6, HN7, HN8, HN9, rat A. agrariusA. agrarius 2020 99 HN11, HN12, HN13, HN14, HN15, HN16, HN17, HN18, HN19HN11, HN12, HN13, HN14, HN15, HN16, HN17, HN18, HN19 강원도Gangwon-do 진드기mite I. persulcatusI. persulcatus 1616 1One KW3KW3

기존 분류법의 단점:Disadvantages of traditional taxonomy:

보렐리아 복도페리 sensu lato의 동정은 단백질 염색양상, 단세포군 항체반응, 멀티로커스 효소 전기영동법, DNA절단효소 분석법, 리보타이핑, 플라스미드 성질 분석법 같은 여러 방법이 이용되어 왔다. 근래에는 rrf-rrl 유전자 사이의 인터제닉 스페이스 엠플리콘(intergenic spacer amplicons)을 이용한 RFLP 방법을 많이 사용하고 있으며, 16S rDNA 시퀀싱이 gold standard로 사용되고 있다.Borelia Hallway Ferry The identification of sensu lato has been used for various methods such as protein staining, unicellular antibody reaction, multi-locus enzyme electrophoresis, DNA cleavage assay, ribotyping, and plasmid characterization. Recently, many RFLP methods using intergenic spacer amplicons between rrf-rrl genes have been used, and 16S rDNA sequencing has been used as a gold standard.

그러나 rrf-rrl 유전자 사이의 엠플리콘을 이용한 RFLP 방법은 목표서열(target sequence)의 크기가 220~260 bp로 작아서 동정하기가 유용하나 처음과 달리 종별로 새로운 RFLP 양상이 나타나고 있다. 16S rDNA 유전자 비교분석에는 목표서열 크기 (약 1,550bp)가 너무 커서 염기서열 결정이 어렵다.However, the RFLP method using amplicons between rrf-rrl genes is useful for identification because the size of the target sequence is small ( 220-260 bp). In the 16S rDNA gene comparison analysis, the target sequence size (about 1,550bp) is too large to determine the sequencing.

따라서 과변이 부분(hypervariable region) 일부분만 균 동정에 사용하기도 하는데, 보렐리아는 과변이 부분(hypervariable region) 일부분만 유전자 분석하여 동정하는 것이 쉽지 않아 보렐리아는 반드시 800 bp 이상의 염기서열이 분석되어야 했다. 또한 16S rDNA를 목표로 한 종 특이 프라이머를 이용한 진단법도 일부 균종에서 문제가 나타나기 시작했다.Therefore, only a part of the hypervariable region is used for germ identification. Borelia is not easy to genetically identify only a part of the hypervariable region, and thus, Borelia must analyze a nucleotide sequence of 800 bp or more. In addition, diagnostics using species-specific primers targeting 16S rDNA have started to show problems in some species.

이에 본 발명자들은 기존의 보렐리아 복도페리 sensu lato(Borrelia burgdorferi sensu lato)의 분류· 동정법의 단점을 보완할 수 있는 새로운 유전학적 분류법을 개발하고자 노력한 결과, GroEL 단백이 샤페론(chaperone)으로써 모든 생물체에서 보존되어 있고, 세포 및 박테리아의 생존에 절대 필요하며, 특히 스트레스에 저항하는 단백으로 알려져 있어 보렐리아(Borrelia) 균주들의 진화를 잘 반영할 수 있을 것이는 점에 착안하여, groEL 유전자 염기서열을 이용해서 보렐리아(Borrelia) 균주들을 빠르게 동정할 수 있다는 것을 확인하고 본 발명을 완성하였다.Therefore, the present inventors have tried to develop a new genetic classification method that can compensate for the shortcomings of the classification and identification method of Borrelia burgdorferi sensu lato ( Borelia corridor sensu lato). Gr oEL gene sequencing, conserved in, and essential for the survival of cells and bacteria, particularly known as stress-resistant proteins, may well reflect the evolution of Borrelia strains. It was confirmed that Borrelia strains can be quickly identified using the to complete the present invention.

본 발명의 목적은 세균의 groEL 유전자 염기서열을 이용하여 보렐리아(Borrelia) 균주들을 동정하는 방법을 제공하는데 있다.It is an object of the present invention to provide a method for identifying Borrelia strains using bacterial gr oEL gene sequences.

본 발명의 또 다른 목적은 보렐리아 복도페리(Borrelia burgdorferi)균의 groEL 유전자 염기서열 중 일부를 포함하는 프라이머를 이용하는 것을 특징으로 하는 보렐리아 복도페리(Borrelia burgdorferi) 균의 검출방법을 제공하는데 있다.A further object of the present invention to provide a method for detecting a borelri Oh corridor Perry (Borrelia burgdorferi) borelri, characterized in that using a primer that contains a part of the bacteria gr oEL gene sequence ah corridor Perry (Borrelia burgdorferi) bacteria .

상기의 목적을 달성하기 위하여, 본 발명은 세균의 groEL 유전자 서열을 비교하는 것을 특징으로 하는 보렐리아 복도페리(Borrelia burgdorferi) 균의 동정방법을 제공한다.In order to achieve the above object, the present invention provides a method for identifying Borrelia burgdorferi bacteria characterized by comparing the groEL gene sequence of the bacteria.

상기 groEL 유전자는 서열 1과 서열 2의 프라이머로 PCR 반응하여 얻어진 DNA인 것을 특징으로 할 수 있다.The groEL gene may be a DNA obtained by PCR reaction with the primers of SEQ ID NO: 1 and SEQ ID NO: 2.

본 발명은 또한, groEL 유전자 서열을 비교하는 것을 특징으로 하는 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato)의 분류방법을 제공한다.The present invention also provides a method for classifying Borrelia burgdorferi sensu lato, characterized by comparing the groEL gene sequence.

상기 방법은 상기 groEL 유전자는 서열 1과 서열 2의 프라이머로 PCR 반응하여 얻어진 DNA인 것을 특징으로 할 수 있다.The method may be characterized in that the groEL gene is DNA obtained by PCR reaction with the primers of SEQ ID NO: 1 and SEQ ID NO: 2.

본 발명은 또한, 보렐리아 복도페리(Borrelia burgdorferi) 균의 groEL 유전자 서열 중 일부를 포함하는 것을 특징으로 하는 (Borrelia burgdorferi) 균의 검출용 프라이머 쌍을 제공한다.The present invention also provides a primer pair for detecting ( Borelia burgdorferi ), which comprises a part of the groEL gene sequence of Borrelia burgdorferi .

상기 프라이머는 서열 1 및 서열 2의 염기서열을 가지는 것을 특징으로 할 수 있다.The primer may be characterized by having the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2.

본 발명은 또한, 보렐리아 복도페리(Borrelia burgdorferi) 균 감염 의심 환자 유래의 임상 샘플에서 추출된 DNA를 상기 프라이머 쌍을 이용한 PCR을 통하여 상기 주형 DNA를 증폭하는 단계를 포함하는 것을 특징으로 하는 보렐리아 복도페리(Borrelia burgdorferi) 균의 검출방법을 제공한다.The present invention also includes amplifying the template DNA by PCR using the primer pairs from the DNA extracted from a clinical sample derived from a patient suspected of Borrelia burgdorferi infection. Provided is a method for detecting Borrelia burgdorferi bacteria.

본 발명은 또한, 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato) 균 감염 의심 환자 유래의 임상 샘플에서 추출된 DNA를 상기 프라이머 쌍을 이용한 PCR을 통하여 증폭하는 단계를 포함하는 것을 특징으로 하는 라임병의 진단방법을 제공한다.The present invention also comprises amplifying DNA extracted from a clinical sample derived from a patient suspected of Borrelia burgdorferi sensu lato infection by PCR using the primer pair. It provides a diagnostic method.

이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

특히, 하기 실시예에서는 보렐리아 복도페리의 동정방법 만을 예시하였으나, 본 발명의 groEL 유전자 서열을 포함하는 프라이머를 이용하여 보렐리아 복도페리 균주를 검출하는 방법 및 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato) 균의 감염여부를 확인하는 것을 특징으로 하는 라임병의 진단방법은 당업자에게 있어 자명하다 할 것이다.In particular, the following examples exemplify a method of identifying Borrelia corridor ferry, but a method for detecting Borreli corridor strain using a primer comprising the groEL gene sequence of the present invention and Borrelia corridor sensulato ( Borrelia burgdorferi sensu). The diagnosis of Lyme disease, characterized by checking whether or not lato) bacteria will be apparent to those skilled in the art.

실시예 1. 균배양 및 게놈 DNA 분리Example 1 Culture and Genomic DNA Isolation

국내에서 분리된 23 균주(표 1 참조)와 외국 참조균주 31균주(표 2 참조)의 배양액 5 ㎖을 100 ㎖의 BSK-Ⅱ 배지에 식균하여 32℃에서 4-5 일간 배양하였다. 배양 후 9,000g로 10 분간 원심 침전하여 모은 균 침사액을 다시 PBS로 부유시킨 후 다시 9,000g로 10 분간 원심 침전하여 균 침사액을 모았다. 배양한 분리균주를 SDS (0.5%)와 proteinase K (10 ㎕/ ㎖)를 이용하여 세포벽을 녹이고 페놀-클로로포름-이소아밀알콜을 이용하여 지방과 단백성분을 제거하고 상청액을 얻었다. 이를 3M 소디움 아세테이트 (pH 5.2)와 에탄올로 DNA를 침전시킨 후 원심침전하고 다시 70% 에탄올로 세척 후 건조하여 TE 완충액에 녹였다. 5 ml of the culture solution of 23 strains (see Table 1) and 31 foreign strains (see Table 2) isolated from Korea were inoculated in 100 ml of BSK-II medium and incubated at 32 ° C for 4-5 days. After incubation, the fungus sediment collected by centrifugation at 9,000 g for 10 minutes was suspended in PBS again, followed by further centrifugation at 9,000 g for 10 minutes to collect the fungal sediment. The cultured isolates were dissolved in SDS (0.5%) and proteinase K (10 μl / ml), and the fat and protein were removed using phenol-chloroform-isoamyl alcohol to obtain supernatant. The DNA was precipitated with 3M sodium acetate (pH 5.2) and ethanol, followed by centrifugation, followed by washing with 70% ethanol and drying to dissolve in TE buffer.

본 실험에서 사용한 외국 참조 균주Foreign Reference Strains Used in the Experiment Bell StrainStrain 분리체Separators 분리지역Separation Accession No.Accession No. B. burdorferiB. burdorferi B31B31 진드기mite 미국United States of America AE001166AE001166 Sh-2-82Sh-2-82 진드기mite 미국United States of America AF517948AF517948 MM1MM1 진드기mite 미국United States of America AF517949AF517949 ZS7ZS7 진드기mite 독일Germany X65139X65139 CT20001CT20001 진드기mite 프랑스France AF517950AF517950 2000420004 진드기mite 프랑스France AF517951AF517951 IP2IP2 진드기mite 프랑스France AF517952AF517952 B. afzeliiB. afzelii Iper3Iper3 사람Person 러시아Russia AF517953AF517953 VS461VS461 진드기mite 스위스Swiss AF517954AF517954 M7M7 진드기mite 중국China AF517955AF517955 ACA1ACA1 진드기mite 스웨덴Sweden X54059X54059 Pko-85Pko-85 피부skin 독일Germany AF517956AF517956 B. gariniiB. garinii PBiPBi 사람Person 독일Germany AF517957AF517957 PD89PD89 사람Person 중국China AF517958AF517958 IP90IP90 진드기mite 러시아Russia AF517959AF517959 G1G1 사람Person 독일Germany AF517960AF517960 G2G2 사람Person 독일Germany AF517961AF517961 G25G25 진드기mite 스웨덴Sweden AF517962AF517962 Sika1Sika1 진드기mite 일본Japan AF517963AF517963 Sika2Sika2 진드기mite 일본Japan AF517964AF517964 Sika3Sika3 진드기mite 일본Japan AF517965AF517965 HP1HP1 진드기mite 일본Japan AF517966AF517966 HP13HP13 진드기mite 일본Japan AF517967AF517967 K48K48 진드기mite 슬로바키아Slovakia AF517968AF517968 IP89IP89 진드기mite 러시아Russia AF517969AF517969 B. japonicaB. japonica HO14HO14 진드기mite 일본Japan AF517970AF517970 B. valaisianaB. valaisiana VS116VS116 진드기mite 스위스Swiss AF517971AF517971 B. turdiB. turdi Ya501Ya501 진드기mite 일본Japan AF517972AF517972 B. lusitaniaeB. lusitaniae PotiB2PotiB2 지드기Tick 포르투칼Portugal AF517973AF517973 B. bissettiiB. bissettii DN127DN127 진드기mite 미국United States of America AF517974AF517974 B. andersoniiB. andersonii 2112321123 진드기mite 미국United States of America AF517975AF517975 B. hermsiiB. hermsii HS1HS1 진드기mite 미국United States of America AF518000AF518000

실시예 2. Example 2. groEL groEL 유전자 염기서열 결정Gene sequencing

GF 프라이머(서열 1)와 GR 프라이머(서열 2) 두 개의 프라이머를 이용하여 PCR을 수행하였다. PCR was performed using two primers, a GF primer (SEQ ID NO: 1) and a GR primer (SEQ ID NO: 2).

서열 1: 5'-TACGATTTCTTATGTTGAGGG-3'SEQ ID NO: 5'-TACGATTTCTTATGTTGAGGG-3 '

서열 2: 5'-CATTGCTTTTCGTCTATCACC-3'SEQ ID NO: 5'-CATTGCTTTTCGTCTATCACC-3 '

각 프라이머 20 pmol과 증류수, 상기에서 분리한 게놈 DNA인 주형 DNA 50 ng을 섞어 최종부피를 20 ul로 맞춘 뒤, PCR mixture tube (AccuPower PCR PreMix, Bioneer, Korea)에 섞어, 첫 번째 변성 94℃ 5분, 30 cycle로 변성 94℃ 30초, 어닐링 59℃ 30초, 신장 72℃ 30초, 최종 신장 72℃ 5분으로 PCR (Perkin-Elmer Cetus, Model 9600 Thermocycler, Norwalk, U.S.A.)을 수행하였다.Mix 20 pmol of each primer with distilled water and 50 ng of template DNA, the genomic DNA isolated above, and adjust the final volume to 20 ul. PCR (Perkin-Elmer Cetus, Model 9600 Thermocycler, Norwalk, USA) was performed for 5 minutes of denaturation at 94 ° C 30 seconds, annealing 59 ° C 30 seconds, elongation 72 ° C 30 seconds, and final extension 72 ° C for 5 minutes.

증폭된 PCR 산물을 1.5% 아가로스 젤에 전기 영동한 후, QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany)을 이용하여 용출하였다. DNA 20ng과 pGEM-T 벡터를 42 ℃에서 5분간 반응시킨 뒤 1 ㎕의 T4 DNA 라이게이즈를 첨가하여 16℃에서 18시간 동안 반응시켰다. 라이게이션 혼합액을 CaCl2 방법으로 대장균 XL1-blue를 이용하여 형질전환한 뒤 형질전환된 대장균 XL1-blue를 50 ㎕/ ㎖의 암피실린이 함유된 LB 평판배지에 도말 후 37 ℃에서 16 시간 동안 배양하고, 암피실린에 대해 내성이 있는 집락을 채취하여 플라스미드를 분리하였다.The amplified PCR product was electrophoresed on 1.5% agarose gel and eluted using QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany). After 20 ng of DNA and the pGEM-T vector were reacted at 42 ° C. for 5 minutes, 1 μl of T4 DNA ligase was added and reacted at 16 ° C. for 18 hours. The ligation mixture was transformed using Escherichia coli XL1-blue by CaCl 2 method, and the transformed Escherichia coli XL1-blue was plated in LB plate medium containing 50 μl / ml of ampicillin and incubated at 37 ° C. for 16 hours. Colonies resistant to ampicillin were harvested to separate plasmids.

자동 염기서열 분석은 CEQ 2000XL DNA Analysis System과 CEQ 2000 Dye Terminator Cycle Sequencing Kit (Beckman Coulter Inc., Fullerton, U.S.A.)를 이용하였다. 플라스미드 115 ng, 프라이머 10 pmol, 10X 시퀀싱 반응 완충액 2 ㎕, dNTP 혼합액 1 ㎕, ddUTP, ddGTP, ddCTP, ddATP 각각 2 ㎕, DNA 폴리머라아제 1 ㎕를 DW와 혼합하여 20 ㎕를 만든 다음 사이클링 시퀀싱을 수행하였다. 반응은 Perkin Elmer Cetus 9600을 사용하여, 96℃ 20초, 50℃ 20초, 60℃ 4분으로 30 사이클을 시행하였다. Automated sequencing was performed using CEQ 2000XL DNA Analysis System and CEQ 2000 Dye Terminator Cycle Sequencing Kit (Beckman Coulter Inc., Fullerton, U.S.A.). 115 ng of plasmid, 10 pmol of primer, 2 μl of 10X sequencing reaction buffer, 1 μl of dNTP mixture, 2 μl of ddUTP, ddGTP, ddCTP, ddATP, and 1 μl of DNA polymerase to make 20 μl, followed by cycling sequencing Was performed. The reaction was carried out using Perkin Elmer Cetus 9600, 30 cycles of 96 ℃ 20 seconds, 50 ℃ 20 seconds, 60 ℃ 4 minutes.

보렐리아 복도페리 B31 게놈 DNA를 GF와 GR 프라이머를 사용한 PCR 반응 산물인 groEL 유전자 단편의 서열(310bp)을 서열 3에 나타내었다.The sequence (310bp) of the groEL gene fragment, which is a PCR reaction product of Borrelia corridor B31 genomic DNA using GF and GR primers, is shown in SEQ ID NO: 3.

서열 3:SEQ ID NO 3:

GFGF

TACGATTTCTTATGTTGAGGG TATGCAATTTGATAGAGGATATCTTTCTC 50 TACGATTTCTTATGTTGAGGG TATGCAATTTGATAGAGGATATCTTTCTC 50

CTTATTTTTCTACCAATAAAGAAAATATGAGTGTTAATTTTGACGATGCT 100CTTATTTTTCTACCAATAAAGAAAATATGAGTGTTAATTTTGACGATGCT 100

TTCATATTGATATATGAGAAAAAGATTAGTTCTATTAAAGAGCTTTTACC 150TTCATATTGATATATGAGAAAAAGATTAGTTCTATTAAAGAGCTTTTACC 150

AGTTCTTGAGAAAGTTTTAGGGACAAATAAACCTTTATTAATTATTGCTG 200AGTTCTTGAGAAAGTTTTAGGGACAAATAAACCTTTATTAATTATTGCTG 200

AGGATATTGAGGGGGATGCTCTTGCTGCTCTTGTTTTAAACAGCGTTAGA 250 AGGATATTGAGGGGGATGCTCTTGCTGCTCTTGTTTTAAACAGCGTTAGA 250

GGAGCTTTAAAGGTATGTGCAATTAAATCTCCTGGTTTT GGTGATAGACG 300GGAGCTTTAAAGGTATGTGCAATTAAATCTCCTGGTTTT GGTGATAGACG 300

AAAAGCAATG 310 AAAAGCAATG 310

GRGR

실시예 3. 보렐리아 복도페리Example 3 Borelia Corridor Ferry sensu lato 표준균주의 sensu lato standard strain groEL groEL 유전자 유사도 분석Genetic Similarity Analysis

31개 표준균주 모두 결손이나 첨가 없이 잘 보존되어 있었고, 기존에 같은 종으로 알려진 균주들간은 매우 높은 유사도를 보여 주고 있다. 즉, 보렐리아 가니(B. garinii)에 속하는 균주들 간에는 97.4 % 이상의 유사도를 보여주고 있고, 보렐리아 아프젤리(B. afzelii)에 속하는 균주들과 보렐리아 복도페리에 속하는 균주들은 각각 99.4 % 이상의 유사도를 보여주고 있다. 따라서 이 염기서열을 이용하여 종의 구별이 가능함을 알 수 있다. 보렐리아 복도페리 sensu lato는 서로 92.3% 이상의 유사도를 보여주고 있다.All 31 standard strains were well preserved without deletion or addition, and show very high similarity among the strains known as the same species. That is, the strains belonging to B. garinii showed more than 97.4% similarity, and the strains belonging to B. afzelii and the strains belonging to Borreli corridor were more than 99.4%, respectively. Similarity is shown. Therefore, it can be seen that species can be distinguished using this base sequence. Borelia Hallway Ferry sensu lato shows more than 92.3% similarity with each other.

또한 보렐리아 복도페리 sensu lato와 재귀열과 관련있는 균주간은 81.3에서 84.8 %를 보이고 있어 보렐리아 복도페리 sensu lato와 다른 보렐리아와도 이 염기서열을 이용하여 잘 구분할 수 있음을 알 수 있다.Borelia Hallway Ferry Strains related to sensu lato and recursive fever were 81.3 to 84.8%, indicating the Borelia corridor It can be seen that sensu lato and other borelia can also be distinguished using this sequence.

실시예 4. 보렐리아 복도페리Example 4 Borelia Corridor Ferry sensu lato 국내 분리균주의 sensu lato isolates groEL groEL 유전자 유사도 분석Genetic Similarity Analysis

23개의 국내 분리균주의 groEL 유전자의 염기서열을 분석하였다. 국내분리균주 모두 보렐리아 복도페리 sensu lato와는 90.0% 이상의 유사도를 보이고, 보렐리아 험시(B. hermsii)와는 82.6~84.6%의 낮은 유사도를 보이고 있다. 단백질 염색 양상, 단세포군 항체와의 반응양상, PCR방법과 rrf(5S)-rrl(23S) 인터제닉 스페이스 유전자의 PCR-RFLP 결과와 마찬가지로 보렐리아 가니(B. garinii)인 KW3 균주는 보렐리아 가니 표준균주들과 98.1 % 이상의 유사도를 보이고 있고 다른 보렐리아 복도페리 sensu lato와는 92.0에서 95.8% 이상의 유사도를 보이고 있다.The nucleotide sequences of the groEL gene of 23 domestic isolates were analyzed. Borelia corridor ferries The sensu lato has similarity with more than 90.0% and the low similarity with B. hermsii is 82.6 ~ 84.6%. As with the protein staining pattern, the pattern of reaction with unicellular antibody, PCR method and PCR-RFLP results of the rrf (5S) -rrl (23S) intergenic space gene, KW3 strain B. garinii More than 98.1% similarity with standard strains and other Borelia corridors Sensu lato showed more than 95.8% similarity in 92.0.

보렐리아 아프젤리(B. afzelii) 균주들인 KK1, KK2, KM4, KK5, KM10, HN9, HN17, CJ1, CJ2, CJ3, CJ21들은 보렐리아 아프젤리(B. afzelii) 표준균주들과 98.4%에서 99.7%의 유사도를 보이고 다른 보렐리아 복도페리 sensu lato와는 90.7에서 96.5% 이상의 유사도를 보이고 있다. rrf(5S)-rrl(23S) 인터제닉 스페이스 유전자의 PCR-RFLP 결과와 16S rDNA 결과로 새로운 종일 가능성이 높은 해남그룹 균주들간은 98.7 % 이상의 유사도를 보이고 있으며 다른 보렐리아 복도페리 sensu lato 균주와는 90.0에서 94.9 %의 유사도를 보이고 있다. B. afzelii The strains KK1, KK2, KM4, KK5, KM10, HN9, HN17, CJ1, CJ2, CJ3, CJ21 are B. afzelii 98.4% to 99.7% similarity with standard strains and other Borelia corridors The similarity with sensu lato was 90.7 to 96.5%. The PCR-RFLP and 16S rDNA results of the rrf (5S) -rrl (23S) intergenic space gene showed more than 98.7% similarity between the Hainan group strains, which are likely to be new species. The sensu lato strain showed similarity between 90.0 and 94.9%.

실시예 5. Example 5. groEL groEL 유전자 염기서열의 계통도의 구축Construction of gene sequence

보렐리아 groEL 유전자 염기서열을 DNASTAR program을 사용하여 clustal method로 multialignment하고, 각 염기서열을 MEGA 프로그램을 사용하여 Jukes-Cantor distance, UPGMA method로 계통도를 완성하였다.The Borrelia groEL gene sequence was multialigned by clustal method using DNASTAR program, and the sequence was completed by Jukes-Cantor distance and UPGMA method using MEGA program.

보렐리아 복도페리 sensu lato 31균주의 groEL 유전자 염기서열을 바탕으로 계통도를 구성하였다. 보렐리아 복도페리 sensu lato는 outgroup인 B. hermsii에 대해서 하나의 클러스터를 형성하고 있다.Borelia Hallway Ferry A phylogenetic tree was constructed based on the groEL gene sequence of sensu lato 31 strain. Borelia Hallway Ferry sensu lato forms a cluster for the outgroup B. hermsii .

보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato)는 11개의 종으로 나뉘어져 있는데, 본 계통도는 전반적으로 보렐리아 복도페리 센수 라토의 계통적 관계를 잘 반영하고 있다. 즉, 보렐리아 가니(B. garinii)에 속한 12 개의 균주는 다른 보렐리아 복도페리 sensu lato에 대해 하나의 클러스터를 형성하고 있고 보렐리아 아프젤리(B. afzelii)에 속하는 5개의 균주와 보렐리아 복도페리에 속하는 7개 균주들도 보렐리아 복도페리 sensu lato에 대해 하나의 클러스터를 형성하고 있다. 다른 종들도 보렐리아 복도페리 sensu lato에 대해 독립적으로 분지하고 있음을 보여주고 있다 (도 1). 이와 같은 계통도는 groEL 유전자 염기서열을 이용하여 보렐리아 복도페리 sensu lato를 동정할 수 있음을 보여주고 있다. Borrelia burgdorferi sensu lato is divided into eleven species, and the schematic reflects the systematic relationship of Borrelia corridor ferris sensu lato. That is, the 12 strains belonging to B. garinii are different Borelia corridors It forms one cluster for sensu lato, five strains belonging to B. afzelii and seven strains belonging to Borelia corridor ferry. It forms one cluster for sensu lato. Other species Borelia Hallway Ferry Independently branching on sensu lato is shown (FIG. 1). This schematic is based on the groEL gene sequence, a Borelia corridor ferry. It shows that sensu lato can be identified.

실시예 6. 보렐리아 복도페리Example 6 Borelia Corridor Ferry sensu lato 국내 분리균주의 sensu lato isolates groEL groEL 유전자 계통도 Gene tree

23개의 국내분리균주의 groEL 유전자 염기서열을 바탕으로 계통도를 구성하였다 (도 2). 단백질 염색 양상, 단세포군 항체와의 반응양상, PCR방법과 rrf(5S)-rrl(23S) 인터제닉 스페이스 유전자의 PCR-RFLP 결과와 마찬가지로 보렐리아 가니(B. garinii)인 KW3 균주는 보렐리아 가니 표준균주들과 보렐리아 아프젤리(B. afzelii) 균주들인 KK1, KK2, KM4, KK5, KM10, HN9, HN17, CJ1, CJ2, CJ3, CJ21들은 보렐리아 아프젤리(B. afzelii) 표준균주들과 클러스터를 형성함을 보여주고 있다. rrf(5S)-rrl(23S) 인터제닉 스페이스 유전자의 PCR-RFLP 결과와 16S rDNA 결과로 새로운 종일 가능성이 높은 해남그룹 균주들은 다른 보렐리아 복도페리 sensu lato 균주와 독립적으로 클러스터를 형성함을 보여주고 있다.The phylogenetic tree was constructed based on groEL gene sequences of 23 domestic isolates (FIG. 2). As with the protein staining pattern, the pattern of reaction with unicellular antibody, PCR method and PCR-RFLP results of the rrf (5S) -rrl (23S) intergenic space gene, KW3 strain B. garinii Standard strains and B. afzelii The strains KK1, KK2, KM4, KK5, KM10, HN9, HN17, CJ1, CJ2, CJ3, CJ21 are B. afzelii It has been shown to form clusters with standard strains. As a result of PCR-RFLP and 16S rDNA results of rrf (5S) -rrl (23S) intergenic space genes, the Haenam strains, which are more likely to be new species, were identified as other Borelia corridors. It has been shown to form clusters independently from the sensu lato strain.

본 발명은 세균의 groEL 유전자 염기서열을 이용해서 보렐리아(Borrelia) 균주들을 동정하는 방법을 제공하는 효과가 있으며, 보렐리아 복도페리(Borrelia burgdorferi)균의 groEL 유전자 염기서열을 이용해서 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato)의 분류방법을 제공하는 효과가 있다.The invention borelri using the groEL gene sequences of bacteria Oh (Borrelia) has an effect to provide a method for identifying a strain borelri Oh corridor Perry (Borrelia burgdorferi) borelri using the groEL gene sequences of bacteria Oh corridor Perry It is effective to provide a classification method of Borrelia burgdorferi sensu lato.

본 발명에 따르면, 기존 16SrDNA 유전자 비교 분석이나 인터제닉 스페이스 엠플리콘을 이용한 RFLP 방법보다 빠르고 간편하게 보렐리아를 검출할 수 있다.According to the present invention, it is possible to detect borelia faster and more conveniently than the conventional 16SrDNA gene comparison analysis or the RFLP method using the intergenic space amplicon.

도 1은 보렐리아 복도페리 센수 라토 (Borrelia burgdorferi sensu lato) 표준균주의 groEL 유전자 계통도를 나타낸 것이다.Figure 1 shows the groEL gene system of the Borrelia burgdorferi sensu lato standard strain.

도 2는 보렐리아 복도페리 센수 라토(B. burgdorferi sensu lato) 국내 분리균주의 groEL 유전자 계통도를 나타낸 것이다.Figure 2 shows the groEL gene flow diagram of the domestic strain of B. burgdorferi sensu lato Borrelia corridor.

<110> Konkuk University <120> Method for Identificating Borrelia burgdorferi Using groEL Gene <130> KUP03-033 <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 1 tacgatttct tatgttgagg g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 2 cattgctttt cgtctatcac c 21 <210> 3 <211> 310 <212> DNA <213> Borrelia burgdorferi <400> 3 tacgatttct tatgttgagg gtatgcaatt tgatagagga tatctttctc cttatttttc 60 taccaataaa gaaaatatga gtgttaattt tgacgatgct ttcatattga tatatgagaa 120 aaagattagt tctattaaag agcttttacc agttcttgag aaagttttag ggacaaataa 180 acctttatta attattgctg aggatattga gggggatgct cttgctgctc ttgttttaaa 240 cagcgttaga ggagctttaa aggtatgtgc aattaaatct cctggttttg gtgatagacg 300 aaaagcaatg 310<110> Konkuk University <120> Method for Identificating Borrelia burgdorferi Using groEL Gene <130> KUP03-033 <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 1 tacgatttct tatgttgagg g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 2 cattgctttt cgtctatcac c 21 <210> 3 <211> 310 <212> DNA <213> Borrelia burgdorferi <400> 3 tacgatttct tatgttgagg gtatgcaatt tgatagagga tatctttctc cttatttttc 60 taccaataaa gaaaatatga gtgttaattt tgacgatgct ttcatattga tatatgagaa 120 aaagattagt tctattaaag agcttttacc agttcttgag aaagttttag ggacaaataa 180 acctttatta attattgctg aggatattga gggggatgct cttgctgctc ttgttttaaa 240 cagcgttaga ggagctttaa aggtatgtgc aattaaatct cctggttttg gtgatagacg 300 aaaagcaatg 310

Claims (8)

세균의 groEL 유전자 서열을 비교하는 것을 특징으로 하는 보렐리아 복도페리(Borrelia burgdorferi) 균의 동정방법.Method for identifying Borrelia burgdorferi bacteria characterized by comparing the groEL gene sequence of bacteria. 제1항에 있어서, groEL 유전자는 서열 1과 서열 2의 프라이머를 이용하여 PCR로 증폭된 DNA인 것을 특징으로 하는 보렐리아 복도페리(Borrelia burgdorferi) 균의 동정방법.According to claim 1, groEL gene borelri Oh corridor Perry (Borrelia burgdorferi) method identified in bacteria, characterized in that the DNA amplified by PCR using primers of SEQ ID NO: 1 and SEQ ID NO: 2. 보렐리아 복도페리(Borrelia burgdorferi) 균의 groEL 유전자 서열을 비교하는 것을 특징으로 하는 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato)의 분류방법.Classification of borelri Oh corridor Perry (Borrelia burgdorferi) borelri Oh corridor Perry sensu gelato (Borrelia burgdorferi sensu lato), characterized in that for comparing the groEL gene sequences of bacteria. 제3항에 있어서, groEL 유전자는 서열 1과 서열 2의 프라이머를 이용하여 PCR로 증폭된 DNA인 것을 특징으로 하는 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato)의 분류방법.The method of claim 3, wherein the groEL gene is DNA amplified by PCR using primers of SEQ ID NO: 1 and SEQ ID NO: 2. Borrelia burgdorferi sensu lato. 보렐리아 복도페리(Borrelia burgdorferi) 균의 groEL 유전자 서열에서 유래된 것을 특징으로 하는(Borrelia burgdorferi) 균의 검출용 프라이머 쌍.Borelri Oh corridor Perry (Borrelia burgdorferi) (Borrelia burgdorferi), characterized in that derived from the groEL gene sequences of bacteria of the pair of primers for detecting fungi. 제5항에 있어서, 서열 1 및 서열 2의 염기서열을 가지는 프라이머 쌍.The primer pair of claim 5, wherein the primer pair has the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2. 보렐리아 복도페리(Borrelia burgdorferi) 균 감염 의심 환자 유래의 임상 샘플 추출된 DNA를 제5항 또는 제6항의 프라이머 쌍을 이용한 PCR을 통하여 상기 주형 DNA를 증폭하는 단계를 포함하는 것을 특징으로 하는 보렐리아 복도페리(Borrelia burgdorferi) 균의 검출방법.Amplifying the template DNA by PCR using a primer pair of claim 5 or claim 6 DNA sample from a suspected patient Borrelia burgdorferi infection Method for detecting Borrelia burgdorferi bacteria. 보렐리아 복도페리 센수 라토(Borrelia burgdorferi sensu lato) 균 감염 의심 환자 유래의 임상 샘플에서 추출된 DNA를 제5항 또는 제6항의 프라이머 쌍을 이용한 PCR을 통하여 증폭하는 단계를 포함하는 것을 특징으로 하는 라임병의 진단방법.Amplifying DNA extracted from a clinical sample derived from a patient suspected of Borrelia burgdorferi sensu lato infection by a PCR using the primer pair of claim 5 or claim 6 How to diagnose the disease.
KR10-2003-0070588A 2003-10-10 2003-10-10 Method for Identificating Borrelia burgdorferi Using groEL Gene KR100525763B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR10-2003-0070588A KR100525763B1 (en) 2003-10-10 2003-10-10 Method for Identificating Borrelia burgdorferi Using groEL Gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR10-2003-0070588A KR100525763B1 (en) 2003-10-10 2003-10-10 Method for Identificating Borrelia burgdorferi Using groEL Gene

Publications (2)

Publication Number Publication Date
KR20050035306A true KR20050035306A (en) 2005-04-18
KR100525763B1 KR100525763B1 (en) 2005-11-03

Family

ID=37238760

Family Applications (1)

Application Number Title Priority Date Filing Date
KR10-2003-0070588A KR100525763B1 (en) 2003-10-10 2003-10-10 Method for Identificating Borrelia burgdorferi Using groEL Gene

Country Status (1)

Country Link
KR (1) KR100525763B1 (en)

Also Published As

Publication number Publication date
KR100525763B1 (en) 2005-11-03

Similar Documents

Publication Publication Date Title
Young et al. The genome of Rhizobium leguminosarum has recognizable core and accessory components
Roux et al. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB).
Di Pinto et al. A collagenase-targeted multiplex PCR assay for identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio parahaemolyticus
EP0355147B1 (en) Dna probe specific for pathogenic listeria
Menard et al. Clonal diversity of the taxon Porphyromonas gingivalis assessed by random amplified polymorphic DNA fingerprinting
CA2115554A1 (en) Osp a proteins of borrelia burgdorferi subgroups, encoding genes and vaccines
Qian et al. Two-component signal transduction systems of Xanthomonas spp.: a lesson from genomics
JP2006501846A (en) Nucleic acid and polypeptide sequences from Lawsonia intracellularis and methods of use
Baranton et al. Borrelia burgdorferi sensu lato diversity and its influence on pathogenicity in humans
Rico et al. Nontoxigenic strains of Pseudomonas syringae pv. phaseolicola are a main cause of halo blight of beans in Spain and escape current detection methods
CN111020041B (en) 16 different serotype salmonella specific new molecular targets and rapid detection method thereof
Wang Borrelia burgdorferi and other Borrelia species
Silva et al. Strains of the group I lineage of Acidovorax citrulli, the causal agent of bacterial fruit blotch of cucurbitaceous crops, are predominant in Brazil
Schulte-Spechtel et al. Molecular analysis of decorin-binding protein A (DbpA) reveals five major groups among European Borrelia burgdorferi sensu lato strains with impact for the development of serological assays and indicates lateral gene transfer of the dbpA gene
Hu et al. New mutations of penicillin-binding proteins in Streptococcus agalactiae isolates from cattle with decreased susceptibility to penicillin
Amouriaux et al. Polymerase chain reaction with the 30-kb circular plasmid of Borrelia burgdorferi B31 as a target for detection of the Lyme borreliosis agents in cerebrospinal fluid
CN110129237B (en) Novel K serotype vibrio parahaemolyticus and application thereof
Nefedova et al. Multilocus sequence analysis of “atypical” Borrelia burgdorferi sensu lato isolated in Russia
Gebriel et al. The detection and characterization of pathogenic Leptospira and the use of OMPs as potential antigens and immunogens
KR100525763B1 (en) Method for Identificating Borrelia burgdorferi Using groEL Gene
US7601822B2 (en) Molecular identification of bacteria of genus Streptococcus and related genera
Modarres et al. Phenotypic and genetic diversity of motile aeromonads isolated from diseased fish and fish farms
KR100557748B1 (en) Method for Identificating Borrelia burgdorferi Using PCR-RFLP
US6676942B1 (en) Osp a proteins of Borrelia burgdorferi subgroups, encoding genes and vaccines
Gulla et al. Vibrio tapetis from wrasse used for ectoparasite bio-control in salmon farming: phylogenetic analysis and serotyping

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20101004

Year of fee payment: 6

LAPS Lapse due to unpaid annual fee