KR100525763B1 - Method for Identificating Borrelia burgdorferi Using groEL Gene - Google Patents

Abstract

The present invention relates to a method for identifying Borrelia burgdorferi bacteria, and more particularly, to a method for identifying and detecting Borrelia species by comparing nucleotide sequences of the groEL genes of bacteria.

According to the present invention, it is possible to identify and detect Borrelia faster and more conveniently than the conventional 16S rDNA gene comparison analysis or the RFLP method using the intergenic spacer amplicon.

Description

Method for Identificating Borrelia burgdorferi Using groEL Gene}

The present invention relates to a method for identifying and detecting Borrelia burgdorferi bacteria, and more particularly, to a method for identifying and detecting Borrelia species by comparing nucleotide sequences of groEL genes of bacteria.

Lyme disease became known in 1905 by Swedish doctor Afzelius, but at that time it was called ACA (Acrodermatitis Chronicum Atrophicans) or Pick Herxheimer disease based on symptoms without knowing the causative organism. Later, in 1975, a number of childhood rheumatism patients in Lyme, Connecticut, USA were found to be accompanied by Erythema Chronicum Migrans, described above. It turned out that the diseases were all the same disease, which was named Lyme disease. Also it borelri the species that cause Lyme disease and relapsing fever associated Ah (Borrelia) With fungi Compare Borrelia Hallway Ferry It was named sensu lato.

Borrelia burgdorferi sensu lato is a Gram-negative microaerobic bacterium that is 20-30 µm long and 0.2-0.3 µm in diameter. Borelia, dividing by dichotomy, recursion with 7-11 flagella The number of species is 15-30. The fungus is found in the midgut of true mites (genus Ixodes ), and transmission is known to be caused by the reflux of the suspension when the tick bites.

If you bite a tick, you may experience a cold-like condition with fever, fatigue, muscle pain, joint pain, and a characteristic skin condition called Erythema migrans. If left untreated, it can cause neurological symptoms such as facial muscle paralysis, neuritis, and meningitis, as well as arthritis and myocarditis. In addition, skin symptoms such as ACA (Acrodermatitis chronica atrophicans) may occur.

Borelia corridor Ferry sensu lato eleven species are known to date. Since the causative agent of Lyme disease was isolated from ticks in 1984, a large number of Borelia corridors in countries around the world sensu lato was isolated. At first it was known as a species, but by protein staining, unicellular antibody reaction and PCR Borrelia corridor Ferry sensu lato ( Borelia burgdorferi sensu lato) Borrelia corridor Ferry sensu stricto, Borelia gani ( B. garinii ) , Borelia afzelii , B. japonica ( B. japonica ) Etc. It was classified into four species (species).

In recent years, however, multilocus enzyme electrophoresis, DNA cleavage assays, RFLP methods using amplicons between rrf-rrl genes, and 16S rDNA sequencing have been used. B. valaisiana , B. lusitaniae , B. andersonii , B. turdi , B. tanukii , Borelli New species, such as B. bissettii and B. sinica , were added.

There have been many epidemiological studies on the relationship between species, mediators, and clinical symptoms. The Borelia corridor sensu stricto is mainly separated in the United States and Europe, while the Borelia Gani ( B. garinii ) and Borelia afzelii are separated in Europe and Asia. Traders ISO of mites spread seolka tooth (I. persulcatus) has only the strain of going borelri Oh (B. garinii) and borelri ah hurt jelly (B. afzelii). B. japonica, B. turdae and B. tanukii were separated from Japan, and Ixodes ovatus and Ixos turdus ( I. turdus ), and Iso tanuki ( I. tanuki ) are mediated ticks. Borella B. andersonii , isolated from the United States, has a mediated tick of I. dentatus . Also, B. bissettii was isolated in the United States, while B. valaisiana and B. lusitaniae were separated in Europe.

It is reported that this gene grouping may be related to the difference in clinical symptoms according to each region. For example, in the United States, the Borrelia corridor sensu stricto group is mainly isolated and has arthritis as the main symptom. In Europe, the major isolates are Borrelia gani ( B. garinii ) and Borrelia afzelii group. The neurological symptoms are mainly Borrelia gani ( B. garinii ) and skin symptoms ACA (Acrodermatitis chronica atrophicans) are associated with Borrelia afzelii ( B. afzelii ). Therefore, the development of simple classification and identification methods will enable more active epidemiological studies on the relationship between species, mediators and clinical symptoms.

In 1992, the inventors of the present invention called Ixodes nipponensis Since the first separation from mites, 23 strains were isolated from ticks and mice (Table 1). As a result of protein staining pattern, reaction pattern with unicellular antibody, and PCR method, 11 strains of 23 strains were Borelia aching. It was identified as jelly ( B. afzelii ) and 12 strains were assumed to be Borelia garniii ( B. garinii ). However, some strains (strains isolated from Haenam, Jeollanam-do), which were presumed to be Borelia crucibles in unicellular antibody reactions, showed a different pattern from reference strains in other countries. It is different from the reference strains. Therefore, it is necessary to more accurately identify whether these strains are different from the 11 known species.

Borrelia burgdorferi sensu lato isolated in Korea Separation Media Bell Test Culture water Isolate Chung-cheong bukdo mite I. nipponensis 7 KK1, KK2, KK5, CJ1, CJ2, CJ3, CJ21 rat A. agrarius 12 2 KM4, KM10 Jeollanam-do mite I. granulatus 29 4 HN6, HN7, HN8, HN9, rat A. agrarius 20 9 HN11, HN12, HN13, HN14, HN15, HN16, HN17, HN18, HN19 Gangwon-do mite I. persulcatus 16 One KW3

Disadvantages of traditional taxonomy:

Borelia Hallway Ferry The identification of sensu lato has been used for various methods such as protein staining, unicellular antibody reaction, multi-locus enzyme electrophoresis, DNA cleavage assay, ribotyping, and plasmid characterization. Recently, many RFLP methods using intergenic spacer amplicons between rrf-rrl genes have been used, and 16S rDNA sequencing has been used as a gold standard.

However, the RFLP method using amplicons between rrf-rrl genes is useful for identification because the size of the target sequence is small ( 220-260 bp). In the 16S rDNA gene comparison analysis, the target sequence size (about 1,550bp) is too large to determine the sequencing.

Therefore, only a part of the hypervariable region is used for germ identification. Borelia is not easy to genetically identify only a part of the hypervariable region, and thus, Borelia must analyze a nucleotide sequence of 800 bp or more. In addition, diagnostics using species-specific primers targeting 16S rDNA have started to show problems in some species.

Therefore, the present inventors have tried to develop a new genetic classification method that can compensate for the shortcomings of the classification and identification method of Borrelia burgdorferi sensu lato ( Borelia corridor sensu lato). Gr oEL gene sequencing, conserved in, and essential for the survival of cells and bacteria, particularly known as stress-resistant proteins, may well reflect the evolution of Borrelia strains. It was confirmed that Borrelia strains can be quickly identified using the to complete the present invention.

It is an object of the present invention to provide a method for identifying Borrelia strains using bacterial gr oEL gene sequences.

A further object of the present invention to provide a method for detecting a borelri Oh corridor Perry (Borrelia burgdorferi) borelri, characterized in that using a primer that contains a part of the bacteria gr oEL gene sequence ah corridor Perry (Borrelia burgdorferi) bacteria .

In order to achieve the above object, the present invention provides a method for identifying Borrelia burgdorferi bacteria characterized by comparing the groEL gene sequence of the bacteria.

The groEL gene may be a DNA obtained by PCR reaction with the primers of SEQ ID NO: 1 and SEQ ID NO: 2.

The present invention also provides a method for classifying Borrelia burgdorferi sensu lato, characterized by comparing the groEL gene sequence.

The method may be characterized in that the groEL gene is DNA obtained by PCR reaction with the primers of SEQ ID NO: 1 and SEQ ID NO: 2.

The present invention also provides a primer pair for detecting ( Borelia burgdorferi ), which comprises a part of the groEL gene sequence of Borrelia burgdorferi .

The primer may be characterized by having the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2.

The present invention also includes amplifying the template DNA by PCR using the primer pairs from the DNA extracted from a clinical sample derived from a patient suspected of Borrelia burgdorferi infection. Provided is a method for detecting Borrelia burgdorferi bacteria.

The present invention also comprises amplifying DNA extracted from a clinical sample derived from a patient suspected of Borrelia burgdorferi sensu lato infection by PCR using the primer pair. It provides a diagnostic method.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

In particular, the following examples exemplify a method of identifying Borrelia corridor ferry, but a method for detecting Borreli corridor strain using a primer comprising the groEL gene sequence of the present invention and Borrelia corridor sensulato ( Borrelia burgdorferi sensu). The diagnosis of Lyme disease, characterized by checking whether or not lato) bacteria will be apparent to those skilled in the art.

Example 1 Culture and Genomic DNA Isolation

5 ml of the culture solution of 23 strains (see Table 1) and 31 foreign strains (see Table 2) isolated from Korea were inoculated in 100 ml of BSK-II medium and incubated at 32 ° C for 4-5 days. After incubation, the fungus sediment collected by centrifugation at 9,000 g for 10 minutes was suspended in PBS again, followed by further centrifugation at 9,000 g for 10 minutes to collect the fungal sediment. The cultured isolates were dissolved in SDS (0.5%) and proteinase K (10 μl / ml), and the fat and protein were removed using phenol-chloroform-isoamyl alcohol to obtain supernatant. The DNA was precipitated with 3M sodium acetate (pH 5.2) and ethanol, followed by centrifugation, followed by washing with 70% ethanol and drying to dissolve in TE buffer.

Foreign Reference Strains Used in the Experiment Bell Strain Separators Separation Accession No. B. burdorferi B31 mite United States of America AE001166 Sh-2-82 mite United States of America AF517948 MM1 mite United States of America AF517949 ZS7 mite Germany X65139 CT20001 mite France AF517950 20004 mite France AF517951 IP2 mite France AF517952 B. afzelii Iper3 Person Russia AF517953 VS461 mite Swiss AF517954 M7 mite China AF517955 ACA1 mite Sweden X54059 Pko-85 skin Germany AF517956 B. garinii PBi Person Germany AF517957 PD89 Person China AF517958 IP90 mite Russia AF517959 G1 Person Germany AF517960 G2 Person Germany AF517961 G25 mite Sweden AF517962 Sika1 mite Japan AF517963 Sika2 mite Japan AF517964 Sika3 mite Japan AF517965 HP1 mite Japan AF517966 HP13 mite Japan AF517967 K48 mite Slovakia AF517968 IP89 mite Russia AF517969 B. japonica HO14 mite Japan AF517970 B. valaisiana VS116 mite Swiss AF517971 B. turdi Ya501 mite Japan AF517972 B. lusitaniae PotiB2 Tick Portugal AF517973 B. bissettii DN127 mite United States of America AF517974 B. andersonii 21123 mite United States of America AF517975 B. hermsii HS1 mite United States of America AF518000

Example 2. groEL Gene sequencing

PCR was performed using two primers, a GF primer (SEQ ID NO: 1) and a GR primer (SEQ ID NO: 2).

SEQ ID NO: 5'-TACGATTTCTTATGTTGAGGG-3 '

SEQ ID NO: 5'-CATTGCTTTTCGTCTATCACC-3 '

Mix 20 pmol of each primer with distilled water and 50 ng of template DNA, the genomic DNA isolated above, and adjust the final volume to 20 ul. PCR (Perkin-Elmer Cetus, Model 9600 Thermocycler, Norwalk, USA) was performed for 5 minutes of denaturation at 94 ° C 30 seconds, annealing 59 ° C 30 seconds, elongation 72 ° C 30 seconds, and final extension 72 ° C for 5 minutes.

The amplified PCR product was electrophoresed on 1.5% agarose gel and eluted using QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany). After 20 ng of DNA and the pGEM-T vector were reacted at 42 ° C. for 5 minutes, 1 μl of T4 DNA ligase was added and reacted at 16 ° C. for 18 hours. The ligation mixture was transformed using Escherichia coli XL1-blue by CaCl ₂ method, and the transformed Escherichia coli XL1-blue was plated in LB plate medium containing 50 μl / ml of ampicillin and incubated at 37 ° C. for 16 hours. Colonies resistant to ampicillin were harvested to separate plasmids.

Automated sequencing was performed using CEQ 2000XL DNA Analysis System and CEQ 2000 Dye Terminator Cycle Sequencing Kit (Beckman Coulter Inc., Fullerton, U.S.A.). 115 ng of plasmid, 10 pmol of primer, 2 μl of 10X sequencing reaction buffer, 1 μl of dNTP mixture, 2 μl of ddUTP, ddGTP, ddCTP, ddATP, and 1 μl of DNA polymerase to make 20 μl, followed by cycling sequencing Was performed. The reaction was carried out using Perkin Elmer Cetus 9600, 30 cycles of 96 ℃ 20 seconds, 50 ℃ 20 seconds, 60 ℃ 4 minutes.

The sequence (310bp) of the groEL gene fragment, which is a PCR reaction product of Borrelia corridor B31 genomic DNA using GF and GR primers, is shown in SEQ ID NO: 3.

SEQ ID NO 3:

GF

TACGATTTCTTATGTTGAGGG TATGCAATTTGATAGAGGATATCTTTCTC 50

CTTATTTTTCTACCAATAAAGAAAATATGAGTGTTAATTTTGACGATGCT 100

TTCATATTGATATATGAGAAAAAGATTAGTTCTATTAAAGAGCTTTTACC 150

AGTTCTTGAGAAAGTTTTAGGGACAAATAAACCTTTATTAATTATTGCTG 200

AGGATATTGAGGGGGATGCTCTTGCTGCTCTTGTTTTAAACAGCGTTAGA 250

GGAGCTTTAAAGGTATGTGCAATTAAATCTCCTGGTTTT GGTGATAGACG 300

AAAAGCAATG 310

GR

Example 3 Borelia Corridor Ferry sensu lato standard strain groEL Genetic Similarity Analysis

All 31 standard strains were well preserved without deletion or addition, and show very high similarity among the strains known as the same species. That is, the strains belonging to B. garinii showed more than 97.4% similarity, and the strains belonging to B. afzelii and the strains belonging to Borreli corridor were more than 99.4%, respectively. Similarity is shown. Therefore, it can be seen that species can be distinguished using this base sequence. Borelia Hallway Ferry sensu lato shows more than 92.3% similarity with each other.

Borelia Hallway Ferry Strains related to sensu lato and recursive fever were 81.3 to 84.8%, indicating the Borelia corridor It can be seen that sensu lato and other borelia can also be distinguished using this sequence.

Example 4 Borelia Corridor Ferry sensu lato isolates groEL Genetic Similarity Analysis

23 domestic isolatesgroELThe base sequence of the gene was analyzed. Borelia corridor ferries sensu lato has a similarity with more than 90.0%,B. hermsii) Has a low similarity between 82.6% and 84.6%. Protein staining pattern, pattern of reaction with unicellular antibody, PCR methodrrf(5S)-rrl(23S) As in the PCR-RFLP result of the intergenic space gene, Borelia Gany (B. gariniiKW3 strain is Borelia Gany More than 98.1% similarity with standard strains and other Borelia corridors Sensu lato showed more than 95.8% similarity in 92.0.

Borrelia Agrily (B. afzelii) Strains KK1, KK2, KM4, KK5, KM10, HN9, HN17, CJ1, CJ2, CJ3, CJ21 were Borelia asplices (B. afzelii) 98.4% to 99.7% similarity with standard strains and other Borelia corridors The similarity with sensu lato was 90.7 to 96.5%.rrf(5S)-rrlThe PCR-RFLP results of the (23S) intergenic space gene and the 16S rDNA result showed similarities among the Haenam group strains, which are more likely to be new species. The sensu lato strain showed similarity between 90.0 and 94.9%.

Example 5. groEL Construction of gene sequence

The Borrelia groEL gene sequence was multialigned by clustal method using DNASTAR program, and the sequence was completed by Jukes-Cantor distance and UPGMA method using MEGA program.

Borelia Hallway Ferry A phylogenetic tree was constructed based on the groEL gene sequence of sensu lato 31 strain. Borelia Hallway Ferry sensu lato forms a cluster for the outgroup B. hermsii .

Borrelia burgdorferi sensu lato is divided into eleven species, and the schematic reflects the systematic relationship of Borrelia corridor ferris sensu lato. That is, the 12 strains belonging to B. garinii are different Borelia corridors It forms one cluster for sensu lato, five strains belonging to B. afzelii and seven strains belonging to Borelia corridor ferry. It forms one cluster for sensu lato. Other species Borelia Hallway Ferry Independently branching on sensu lato is shown (FIG. 1). This schematic is based on the groEL gene sequence, a Borelia corridor ferry. It shows that sensu lato can be identified.

Example 6 Borelia Corridor Ferry sensu lato isolates groEL Gene tree

The phylogenetic tree was constructed based on groEL gene sequences of 23 domestic isolates (FIG. 2). As with the protein staining pattern, the pattern of reaction with unicellular antibody, PCR method and PCR-RFLP results of the rrf (5S) -rrl (23S) intergenic space gene, KW3 strain B. garinii Standard strains and B. afzelii The strains KK1, KK2, KM4, KK5, KM10, HN9, HN17, CJ1, CJ2, CJ3, CJ21 are B. afzelii It has been shown to form clusters with standard strains. As a result of PCR-RFLP and 16S rDNA results of rrf (5S) -rrl (23S) intergenic space genes, the Haenam strains, which are more likely to be new species, were identified as other Borelia corridors. It has been shown to form clusters independently from the sensu lato strain.

The invention borelri using the groEL gene sequences of bacteria Oh (Borrelia) has an effect to provide a method for identifying a strain borelri Oh corridor Perry (Borrelia burgdorferi) borelri using the groEL gene sequences of bacteria Oh corridor Perry It is effective to provide a classification method of Borrelia burgdorferi sensu lato.

According to the present invention, it is possible to detect borelia faster and more conveniently than the conventional 16SrDNA gene comparison analysis or the RFLP method using the intergenic space amplicon.

Figure 1 shows the groEL gene system of the Borrelia burgdorferi sensu lato standard strain.

Figure 2 shows the groEL gene flow diagram of the domestic strain of B. burgdorferi sensu lato Borrelia corridor.

<110> Konkuk University <120> Method for Identificating Borrelia burgdorferi Using groEL Gene <130> KUP03-033 <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 1 tacgatttct tatgttgagg g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PCR Primer <400> 2 cattgctttt cgtctatcac c 21 <210> 3 <211> 310 <212> DNA <213> Borrelia burgdorferi <400> 3 tacgatttct tatgttgagg gtatgcaatt tgatagagga tatctttctc cttatttttc 60 taccaataaa gaaaatatga gtgttaattt tgacgatgct ttcatattga tatatgagaa 120 aaagattagt tctattaaag agcttttacc agttcttgag aaagttttag ggacaaataa 180 acctttatta attattgctg aggatattga gggggatgct cttgctgctc ttgttttaaa 240 cagcgttaga ggagctttaa aggtatgtgc aattaaatct cctggttttg gtgatagacg 300 aaaagcaatg 310

Claims (8)

Method for identifying Borrelia burgdorferi bacteria characterized by comparing the groEL gene sequence of bacteria. According to claim 1, groEL gene borelri Oh corridor Perry (Borrelia burgdorferi) method identified in bacteria, characterized in that the DNA amplified by PCR using primers of SEQ ID NO: 1 and SEQ ID NO: 2. Classification of borelri Oh corridor Perry (Borrelia burgdorferi) borelri Oh corridor Perry sensu gelato (Borrelia burgdorferi sensu lato), characterized in that for comparing the groEL gene sequences of bacteria. The method of claim 3, wherein the groEL gene is DNA amplified by PCR using primers of SEQ ID NO: 1 and SEQ ID NO: 2. Borrelia burgdorferi sensu lato. Borelri Oh corridor Perry (Borrelia burgdorferi) (Borrelia burgdorferi), characterized in that derived from the groEL gene sequences of bacteria of the pair of primers for detecting fungi. The primer pair of claim 5, wherein the primer pair has the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2. Amplifying the template DNA by PCR using a primer pair of claim 5 or claim 6 DNA sample from a suspected patient Borrelia burgdorferi infection Method for detecting Borrelia burgdorferi bacteria. Amplifying DNA extracted from a sample from a suspected Borrelia burgdorferi sensu lato-infected animal by PCR using the primer pair of claim 5 or claim 6 How to diagnose Lyme disease in excluded animals.