KR20040079889A - Expression cassette of recombination protein for efficient production of protease using colicin promoter - Google Patents

Abstract

PURPOSE: An expression cassette of a recombination protein for the efficient production of a protease using a colicin promoter is provided, thereby easily mass-producing the protease by one purification process, and improving productivity of the protease. CONSTITUTION: The expression cassette of a recombination protein for the efficient production of a protease using a colicin promoter comprises the steps of: digesting an expression plasmid containing a transcription termination factor with enzyme, inserting the digested DNA fragments into a plasmid pLitmus28 to modify the restriction enzyme recognition site, and inserting the modified digested DNA fragments of the transcription termination factor into a colicin plasmid; inserting a gene fragment for affinity purification into the colicin plasmid; and inserting a gene Tag of the protease into the colicin plasmid.

Description

Expression system of recombinant protein for mass production of proteolytic enzymes using colysine promoter. {Expression cassette of recombination protein for efficient production of protease using colicin promoter}

The present invention relates to a recombinant protein expression system, and more particularly, to construct a new expression plasmid using a colysine promoter and to use it to mass produce protease in a simpler and higher yield. It relates to an expression system.

With the development of genetic recombination technology, a lot of researches have been conducted on mass production of target proteins using bacteria, copper, or plants as host cells, and many kinds of proteins have been produced in this way. In the production of such proteins, E. coli is generally the most widely used host for mass production of various types of useful proteins.

However, many problems are pointed out when the target protein is produced in the cytoplasm of E. coli. In other words, proteins produced in the cytoplasm have to undergo a highly complex and expensive separation and purification process, have low yields, and insoluble states in which the overexpressed proteins in the cytoplasm are not fully folded and lose their activity. Since inclusion bodies are often formed, obtaining a water-soluble protein having biological activity from the insoluble protein is complicated and expensive.

In order to solve this problem, not only is the productivity of the target protein improved through the recombination of various strong promoters, terminators, and structural genes, but also the recombinant vector linking the signal sequence to the structural gene is introduced into the microorganism, which naturally exists in the cell membrane. By secreting proteins outside the cell membrane, desired proteins are accumulated at higher concentrations in the culture medium, thereby reducing the purification process and improving the recovery rate.

Among the target proteins for mass production, proteases or carboxypeptidases are proteases that decompose proteins themselves. In order to mass-produce these protease enzymes, many problems occur when expressed using a powerful gene expression system that is generally used. In other words, if the mass production of this enzyme is induced in cells, another mechanism that inhibits expression induction occurs because the produced enzyme breaks down the proteins that make up the components of the cells and becomes fatal to the growth of the cells themselves. Gene expression systems for robust protein expression in general terms result in reduced production.

Therefore, in order to produce proteases such as proteases in large quantities, expression must be induced by a new method different from the general expression system.

Accordingly, the present invention is to solve the above problems, to provide a recombinant protein expression system capable of mass production of proteolytic enzymes using an expression system using a colicin promoter capable of forcing different expression than existing gene expression systems. Its purpose is to.

Figure 1 is a diagram showing the formation process of colysine plasmid according to the present invention for the production of protease.

Figure 2 shows the appearance of the protein produced by the colysine plasmid according to the present invention.

In order to achieve the above object, the present invention provides a large amount of protease by using a promoter formed by introducing a gene terminator for transcription terminator and affinity purification into a colysine plasmid and introducing a Taq gene of a protease. There is a technical point of providing a recombinant protein expression system for production.

And, preferably, the transcription terminator may introduce a DNA fragment generated by cleaving a separate expression plasmid containing the transcription terminator into pLitmus28 to change the restriction enzyme site, and then to the NcoI and EcoRI sites of the colysine plasmid. To be introduced.

Therefore, according to the present invention, there is an advantage of providing a method for expressing a new protease.

Hereinafter, the present invention having the characteristics as described above will be described in more detail with reference to the illustrated embodiment. And shown in the following examples are not intended to limit the present invention to any particular scope, it will be apparent to those skilled in the art that various applications within the technical scope of the present invention.

First, the present invention is to create a system for the expression of recombinant proteins using the colysine promoter. The reason for using this colysine promoter is because it uses a very important reaction system to ensure the survival of bacteria called the SOS response of bacteria because of the characteristics of the colysine promoter. Get help from special proteins. Therefore, it can be inferred that the formation of an insoluble inclusion body, which is shown in a general gene expression system, is inhibited, and degradation of other proteins by the production enzyme itself is inhibited, thereby enabling the production of a desired enzyme. The present inventors have predicted that the proteolytic enzyme, which is difficult to mass-produce in a general expression system for the above reason, can be mass-produced when using the colichin promoter, and has completed the present invention through numerous trials and errors.

The present invention is subjected to the following process using the colysine promoter.

1) Determination of the base sequence of the colysine promoter

2) Introduction of transcription terminator into the colisin plasmid

3) Completion of new expression system by introducing gene fragments for affinity purification

4) Construction of expression plasmids of harmful proteins using a novel expression system

5) Expression and Purification of Protease Using a Novel Expression System

Hereinafter, each process will be described in detail.

1) Determination of the base sequence of the colysine promoter

The inventors determined the base sequence of the colysine promoter site using pSH357, a colysine plasmid stored in the laboratory. As a result, the base sequence of about 200bp was determined, and in order to verify the adequacy of the base sequence of the colysine promoter, the colline promoter and the base sequence of the commonly known ColE3-CA38 plasmid were compared. The results are shown below, it has a homology of about 90%, it can be seen that the inventors possessed the colysine promoter can be used. It is of course also possible to use the colysine promoter of the existing commercially available product ColE3-CA38 plasmid.

ColE3-CA38 151 TTTGTGGCCCGCTCTGCGTTTT-CTAAGTGTTATCCCTCCTGATTTCTAA 199

ColPro 1 GGCCCGCTATGCGTTTTGCTAAGTGTTATCCCTCCTGATTTCTAA 45

******** ******** ***************************

ColE3-CA38 200 AAAATTTTCCACCTGAACTTGACAGAAAAAACGATGACGAGTACTTTTTG 249

ColPro 46 AAAATTTTCCACCTGAACTTGACAGAAAAAACGATGACGAGTACTTTTTG 95

**************************************************

ColE3-CA38 250 ATCTGTACATAAACCCAGTGGTTTTATGTACAGTATTAATCGTGTAATCA 299

ColPro 96 ATCTGTACATAAACCCAGTGGTTTTATGTACAGTATTAATCGTGTAATCA 145

**************************************************

ColE3-CA38 300 ATTGTTTTAACGCTTAAAAGAGGGAATTTTTATGAGCGGTGGCGATGGAC 349

ColPro 146 ATTGTTTTAACGCTTAAAAGAGGGAATTTCCATGACTCCGGAAGCCGCTT 195

***************************** **** * * *

ColE3-CA38 350 GCGGCCATAACACGGGCGCGCATAGCACAAGTGGTAACATTAATGGTGGC 399

ColPro 196 A --- TCAGAACCTG 206

** *** *

Comparison of the base sequence of the known colysine promoter region of ColE3-CA38 plasmid with the cosine promoter region (ColPro) of pSH357. An asterisk (*) indicates the same nucleotide sequence between two nucleotide sequences.

2) Introduction of transcription terminator into the colisin plasmid

To construct an expression plasmid using the colysine plasmid pSH357, the NcoI and EcoRI restriction enzyme sites on this plasmid must be cleaved to remove unnecessary gene fragments. However, when such an operation is performed, there is a problem that the transcription termination site originally held by pSH357 is also removed at the same time. The transcription termination site in the expression plasmid is a site that stops the transcription of mRNA and is an essential site for effective expression. Therefore, in order to remove unnecessary sites and bind transcription terminators, it is necessary to introduce a separate transcription terminator. For the introduction of such transcription terminator, an electron terminator fragment of pkk223-3, which is a well-known expression plasmid, may be introduced. The present inventors introduced a fragment of the electron terminator of pEXE7, which is stored in the laboratory instead of the transcription terminator of the expression plasmid and described in the present contribution paper of the inventor. The reason for using the transcription terminator was easily stored because it is stored in a laboratory, but as described above, it is also possible to use a general transcription terminator fragment.

Of course, the introduction of the electron terminator fragment into the plasmid is a well-known general procedure, but briefly, the introduction process of the restriction enzyme by introducing a 524 bp DNA fragment resulting from cleavage of the expression plasmid pEXE7 with BamHI and SspI was introduced into pLitmus28. The site was changed and then introduced into the NcoI and EcoRI sites of pSH357. The plasmid thus obtained will be referred to as pCol-rrnBTlT2 for convenience of explanation. And, this process is shown in Figure 1 to facilitate the understanding.

3) Completion of a new expression system by introducing gene fragments for affinity purification

An affinity tag was introduced to facilitate purification of the expression system using the colysine plasmid. Specifically, pCol-InteinCBD-rrnBTlT2 was prepared by introducing the InteinCBD site, which is an affinity tag of pTXB3 (New England Biolab, USA), which is generally widely available in the market, to pCol-rrnBTlT2 obtained in 2). This process is shown in FIG.

4) Construction of Protease Expression Plasmid Using a Novel Expression System

Into the pCol-InteinCBD-rrnBTlT2 plasmid constructed in 3), a carboxypeptidase Taq gene, which is a type of protease, is introduced to construct a plasmid for expression of protease. Since the introduction of the Taq gene is a common conventional technique well known in the art, a detailed description of the gene introduction process will be omitted. The expression plasmid generated by this method is called pCol-CPaseTaq-InteinCBD-rrnBTlT2. The structure of the expression plasmid and several restriction enzyme sites constructed for ease of understanding by those skilled in the art are shown below.

-176 -166 -156 -146 -136 -126 -116

G GCCCGCTATG CGTTTTGCTA AGTGTTATCC CTCCTGATTT CTAAAAAATT TTCCACCTGA

-106 -96 -86 -76 -66 -56 -46

ACTTGACAGA AAAAACGATG ACGAGTACTT TTTGATC TGT ACATAAACCC AGTGGTTTTA TGTACAGTAT

Colicin Promoter

-36 -26 -16 -6 Mat Ala HisMet Thr Pro Glu ---

TAATCGTGTA ATCAATTGTT TTAACGCTTA A AAGAGG GAA TTT CCATG G CT CAT | ATG ACG CCG GAA ---

SD Nco I Nde I CPase Taq - >

--- Arg Tyr Leu Glu Ala Lys Tyr Gly Ala Leu Tyr Gly Phe | Arg Gly Arg Glu Phe Leu

--- A GG TAC C TG GAG GCC AAG TAC G GG GCC C TT TAC GGC TTC | CGC GGC CGC GAA TTC CTC

Kpn I Apa I <- CPase Taq Sac II Not I Xho I

Glu Gly Ser Ser | Cys

GAG G GC TCT TC C | TGC-> MxeIntein

Sap I

* Structure of the expression plasmid of carboxypeptidase Taq (CPase Taq ), a harmful protein.

The location of the colicin promoter and ribosomal binding site (SD) are underlined and restriction enzyme sites are indicated for cloning the new gene.

5) Expression and Purification of Degraded Protein Using a New Expression System

E. coli W3110 strain was transformed to express pCol-CPaseTaq-InteinCBD-rrnBTlT2, an expression plasmid of CPase Taq . The E. coli cells were incubated overnight at 37 ° C. in 10 ml of LB (Amp. 100 μg / ml) medium. The medium was incubated for 30 minutes at 37 ° C. in 1 L of LB (Amp. 100 μg / ml) medium, followed by addition of mitomycin C (Sigma, USA) to a final concentration of 0.4 μg / ml. Incubated for 9 hours at ℃. The cells were recovered by centrifugation of the culture medium, and 30 ml of cold column buffer (20 mM Tris (pH7.4), 0.5M NaCl, 0.2% Triton X-100, 2mM EDTA) was added thereto and disrupted by ultrasonication. The lysate was centrifuged at 20,000 × g for 20 minutes, and the supernatant was purified using chitin bead column (20 ml set volume). SDS-PAGE photograph of the purified protein is shown in FIG.

As shown in FIG. 2, the proteins produced and purified by the expression plasmid using the colysine promoter according to the present invention are protease 2 and generally produce carboxypeptidase which is a kind of protease. A protein derived from the known Thermomus aquaticus is shown in 3. Both are the same material because the position on the column is the same, that is to say that the usefulness of the expression plasmid according to the present invention.

Next, the production efficiency and productivity of the protein using the expression plasmid according to the present invention as described above was compared with the general method.

Table 1 shows the activity and yield of the purified product obtained from the expression plasmid according to the present invention. As shown in the table, about 47 mg of purified protein was obtained through one purification process in 1 L of carboxypeptidase Tak, a kind of protease. On the contrary, Table 2 shows the results of generating CPase Taq using the existing expression system (tac promoter). As shown in Table 2, in the existing expression system as well as the inconvenience of having to perform a three-step purification can be seen that the yield also drops significantly to 6mg.

TABLE 1 Expression and Purification of CPase Taq Using the Colysine Expression System.

_____________________________________________________________________________

Purification Total Total Specific Yield

step protein activity activity

(mg) (U) (U / mg) (%)

_____________________________________________________________________________

Cell-free extract 192.0 251,000 1,307 100

Affinity chromatography 47.2 182,000 3,856 73

_____________________________________________________________________________

TABLE 2 Expression and purification of CPase Taq using existing expression system (using tac promoter).

_____________________________________________________________________________

Purification Total Total Specific Yield

step protein activity activity

(mg) (U) (U / mg) (%)

_____________________________________________________________________________

Cell-free extract 350 24,800 70 100

Heat treatment 39 24,500 630 99

Butyl-Toyopearl 16 20,400 1280 82

DEAE-Toyopearl 6 18,000 3000 73

_____________________________________________________________________________

On the other hand, the expression of CPase Taq using pET15b system (Novagen, USA), which is an expression system using a powerful T7 promoter developed for mass expression of protein, was not obtained at all. In other words, it can be seen that the proteolytic enzymes are not suitable for the existing mass expression system. In other words, it can be seen that the expression system according to the present invention is suitable for the mass expression of proteolytic enzymes.

As described above, according to the present invention, there is an effect that mass production of protease is easily performed.

In addition, the expression system according to the present invention has another effect that the production of the protein through a single purification process is more simple and the productivity is improved.

Claims (2)

Recombinant protein for mass production of the protease using the choline protein promoter, characterized in that the introduction of a gene terminator for transcription terminator and affinity purification into the choline plasmid and introducing the Taq gene of the protease Expression system. The method of claim 1, wherein the transcription terminator, A cholicin promoter characterized by introducing a DNA fragment generated by cleaving a separate expression plasmid containing a transcription terminator into the pLitmus28 to change the restriction enzyme site, and then introduced into the NcoI and EcoRI sites of the colysine plasmid. Recombinant protein expression system for mass production of protease using.