KR20040038445A - Hybridization method using periodic heating and cooling and polynucleotide detection apparatus using the same - Google Patents

Abstract

PURPOSE: A hybridization method through periodic heating and cooling and a polynucleotide detection apparatus using the same are provided, thereby reducing the time for hybridization and increasing the specificity of hybridization, so that the disorder of target polynucleotide can be rapidly and accurately detected. CONSTITUTION: A hybridization method through periodic heating and cooling comprises the steps of: supplying a probe with a target polynucleotide; and circulating a high temperature hybridization process, wherein the hybridization is carried out at higher temperature than the melting point of the probe and target polynucleotide hybrid, and a low temperature hybridization process wherein the hybridization is carried out at lower temperature than the melting point of the probe and target polynucleotide hybrid two or more times, wherein the high temperature is at least 20 deg. C as higher as the melting point; and the low temperature is at least 5 deg. C as lower as the melting point.

Description

Hybridization method using periodic heating and cooling and polynucleotide detection apparatus using the same {Hybridization method using periodic heating and cooling and polynucleotide detection apparatus using the same}

The present invention relates to a method for hybridizing a probe and a target polynucleotide with increased hybridization specificity in a short time, and a polynucleotide detection apparatus using the same.

The polynucleotide detection device basically stores an amplification unit for amplifying a target polynucleotide to be analyzed, an analysis unit for determining whether there is an abnormality on a sequence in the amplified polynucleotide, a fluid control unit for buffer transfer, a buffer, a reagent, and the like. It consists of wealth. Among these, most of the time for using the polynucleotide detection apparatus in the amplification unit and the analysis unit is required. Recently, the amplification unit uses a small amount of reaction solution using PCR (polymerase chain reaction), thereby saving a lot of time and money. Therefore, an analytical unit that uses a hybridization method that basically takes several hours or more and analyzes the results by a fluorescence labeling method, an electrophoresis method, an electrochemical method, etc. has influenced the performance of the polynucleotide detection device.

Therefore, in order to improve the performance of the polynucleotide detection apparatus, the performance of the analysis unit should be improved. In particular, it is a single base change of a nucleotide sequence known to exist in 1000 to 2000 bp of human DNA, and it is expected to be a single base abnormality (SNP) or a base of a known DNA sequence that is expected to be an effective marker for preventing the cause of the disease. Analysis of point mutations that cause changes in the function of the protein encoded by the change requires hybridization to proceed with specificity in a shorter time. Hybridization specificity (stringency or specificity) refers to the degree of specific hybridization between complementary sequences when hybridizing two complementary and non-complementary nucleic acids together. In general, higher hybridization specificities are obtained by controlling the concentration and temperature of salts in the buffer, by adding additives such as Denhart's solutions, or by adding non-specific DNA or RNA to induce hybridization competition. However, these methods require more than a few hours. Therefore, there is a need for development of a hybridization method capable of maintaining hybridization specificity and finishing hybridization in a shorter time.

The technical problem to be achieved by the present invention is to provide a hybridization method that can increase the hybridization rate and hybridization specificity.

Another object of the present invention is to provide a polynucleotide detection apparatus using a hybridization method with increased hybridization rate and hybridization specificity.

1 is a flowchart of a hybridization method according to an embodiment of the present invention.

FIG. 2A is a schematic diagram before hybridization, and FIG. 2B is a schematic diagram after performing two cycles of high temperature and low temperature hybridization, respectively.

3 is a graph showing the temperature change of the hybridization step.

Figure 4 is a photograph of electrophoresis after amplifying the brca1 exon, a target DNA.

5 shows the result of aligning the amplified target DNA with brca1 exon sequence of the gene bank (Genbank).

6 shows the result of detecting the degree of hybridization by X-ray film photosensitive method based on the chemiluminescence method.

<Explanation of symbols for the main parts of the drawings>

100: substrate 210: first probe

220: second probe 300: target polynucleotide

400: sign

Hybridization method according to the present invention for achieving the above technical problem is a hybridization method through periodic heating and cooling. First, a target polynucleotide is supplied to a probe. Subsequently, a high temperature hybridization step of hybridizing at a temperature higher than the melting temperature of the hybridization of the probe and the target polynucleotide and a low temperature hybridization step of hybridizing at a temperature lower than the melting temperature are performed in a cycle of two or more times.

Preferably, the high temperature is at least 20 ° C. above the melting temperature and the low temperature is at least 5 ° C. below the melting temperature.

Preferably, the probe comprises a first probe that is completely complementary to the target polynucleotide and a second probe that is at least one base non-complementary with the target polynucleotide.

The transition from the high temperature hybridization step to the low temperature hybridization step preferably occurs during a ramping time such that nonspecific hybridization does not occur.

Polynucleotide detection apparatus according to the present invention for achieving the above another technical problem is a device using the hybridization method.

Other remaining details are included in the detailed description and drawings, but the invention is defined only by the scope of the claims.

Hereinafter, an embodiment of a hybridization method according to the present invention will be described in detail with reference to the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in various forms, and only the present embodiments are intended to complete the disclosure of the present invention and to those skilled in the art to fully understand the scope of the invention. It is provided to inform you. Solid supports, labels, etc. in the drawings are exaggerated or outlined for convenience of description. Like reference numerals refer to like elements throughout.

Hereinafter, an embodiment of the hybridization method according to the present invention will be described with reference to FIGS. 1 to 3.

1 is a flowchart of a hybridization method according to an embodiment of the present invention. FIG. 2A is a schematic diagram before hybridization, and FIG. 2B is a schematic diagram after two cycles of high temperature and low temperature hybridization. 3 is a graph showing the temperature change of each hybridization step.

First, the probes are fixed (S10 of FIG. 1). In order to determine the SNP or point mutation in the target polynucleotide based on the hybridization specificity, as shown in FIG. 2A, the first probe 210 and the first probe 210 are completely complementary to the target polynucleotide. The second probe 220 having only one base is immobilized on the solid support 100. The term polynucleotide as used in the present invention includes all DNA, RNA, modified DNA, modified RNA.

The solid support 100 may be a substrate installed in a chamber constituting an analysis unit of a gene diagnosis apparatus or a substrate of a polynucleotide chip. As the substrate, nitrocellulose, nylon, glass, polyacrylate, mixed polymer, polystyrene, silane polypropylene, or the like may be used. In the case of the polynucleotide chip, the solid support 100 is composed of an electrode layer formed by depositing gold, silver, copper or platinum on a silicon or glass substrate by an evaporation or sputtering method. Immobilization is carried out using a self-assembly (Langmuir Blodgett) method, such as a self-assembly (third group).

Next, high temperature hybridization is performed (S20 of FIG. 1). High temperature hybridization proceeds by supplying a hybridization buffer solution comprising a target polynucleotide sample onto the solid support 100 to which the first and second probes 210 and 220 are coupled. Target polynucleotide samples are amplified by PCR, strand displacement amplification (SDA), nucleic acids sequence-based amplification (NASBA), and transcription-mediated amplification (TMA) methods. As shown in FIG. 3, the high temperature hybridization proceeds for a predetermined time t _H at a temperature higher than the T _m (melting temperature) of the hybridization complex of the first probe and the target polynucleotide. T _m is defined as the intermediate temperature between the temperature at which the first probe and the target polynucleotide are fully annealed and the temperature at which it is fully denaturated. The high temperature hybridization is preferably performed at a temperature at least 20 ° C. higher than the T _m from the viewpoint of increasing the hybridization specificity. The high temperature hybridization process denatures much of the nonspecific hybrids.

Temperature control can be controlled by any method known to those skilled in the art related to polynucleotide detection devices or by various methods apparent to those skilled in the art. For example, the chamber constituting the analysis unit in which the solid support 100 is placed may be a chamber capable of temperature control, and the chamber of the analysis unit in which the solid support 100 is placed is provided on the hot plate having a hot plate which is capable of temperature control. The temperature may be controlled by placing the solid support 100. In some cases, the hybridization temperature may be controlled by placing the solid support 100 on a hot plate provided in the PCR amplification unit instead of the analysis unit.

Subsequently, low temperature hybridization is performed (S30). The transition from high temperature hybridization to low temperature hybridization is controlled by appropriately adjusting the ramping time (t _R ) for lowering from high temperature to low temperature as shown in FIG. 3. Too fast a cooling rate results in non-specific hybridization, making it difficult to maximize the hybridization difference between the first and second probes and the target polynucleotide. That is, the ramping time t _R is appropriately adjusted according to the temperatures of the high temperature hybridization and the low temperature hybridization so that nonspecific hybridization does not occur.

Low temperature hybridization proceeds for a predetermined time t _L at a temperature lower than T _m . It is preferable from the viewpoint of hybridization efficiency to proceed at a temperature at least 5 ° C. lower than T _m .

Preferably, the high temperature hybridization and the low temperature hybridization are repeated two or more times. When the hybridization is performed again after the low temperature hybridization, the nonspecific hybridization of the probe with the non-complementary base and the target polynucleotide is separated from each other or the binding is loose. Repeating this process at least twice makes hybridization very specific. As a result, as shown in FIG. 2B, only the fully complementary first probe 210 and the target polynucleotide 300 hybridize, and only one base mismatches the second probe 220 with the target polynucleotide 300. ) Will not combine. That is, the hybridization specificity can be easily increased through periodic heating and cooling.

After the hybridization reaction is completed, the degree of cleaning and hybridization is detected (S40). The washing removes remaining target polynucleotides without participating in the hybridization reaction. Washing is performed using a buffer. The degree of hybridization is detected by labeling the target polynucleotide and then determining the degree of hybridization using an appropriate detection method according to the label used. As shown in FIG. 2B, the label 400 may be labeled in advance at the time of amplification of the target polynucleotide, followed by hybridization, or may be labeled after the hybridization is completed. As the label 400, a fluorescent substance, a chemiluminescent substance, a radioisotope, biotin, avidin, an enzyme or an enzyme substrate, and the like may be used. The detection methods may include fluorescence, chemiluminescence, electrochemical methods, and radiographic imaging. Can be used.

The hybridization method in the above manner can be usefully used in various polynucleotide detection apparatuses to obtain information on abnormalities in the polynucleotide sequence in a shorter time.

More detailed information about the present invention will be described through the following specific experimental examples, and details not described herein will be omitted because it is sufficiently technically inferred by those skilled in the art.

Probe Manufacturing

As shown in the sequence list of Table 1 below, 127 bases, which are some of the exons of the human breast cancer-related gene brca1, were selected as the target DNA, and one base (g) indicated in italics among the bold oyster sequences was selected. The base to be analyzed was selected.

TABLE 1

Sequence name Length order Target DNA 127 tgcttgtgaattttctgagacggatgtaacaaatactgaacatcatcaacc cag taataat g atttgaa caccactgagaagcgtgcagctgagaggcatccagaaaagcatcggggtagttctgtt First probe 18 5'-thiolated-cagtaataat g atttgaa-3 ' Second probe 18 5'-thiolated-cagtaataat t atttgaa-3 '

Allele probes were prepared according to sequences comprising the selected base of analysis. As described in Table 1, the first probe with a completely complementary sequence and the second probe with only one base were designed. A thiol group was attached to one end of the probe (5 'end).

<Probe Immobilization>

A glass substrate was used as the solid support. The thiol group of the probe was first reacted with mercaptosilane to connect with double disulfied bonds and the mercapto silane-probe molecules were reacted with glass to immobilize. The probe was fixed in the form of three spots per two glass substrates, and the bottom left of the substrate was used as a negative control by spotting the reaction buffer (acetate buffer). That is, three probe spots and one buffer spot were made on each of two glass substrates.

Target DNA Amplification

The brca 1 exon was amplified using the primer pairs described in Table 2 below.

TABLE 2

Sequence name Length order Primer pair 26 (left) 5'-tgcttgtgaattttctgagacggatg-3 ' 28 (right) 5'-aacagaactaccctgatacttttctgga-3 '

Primers were designed such that no primer dimer was produced by interaction. After completion of PCR amplification, a portion of the PCR solution was electrophoresed to obtain a photo as shown in FIG. 4. The size was approximately confirmed by comparison with the marker DNA (arrow-marked portion).

The sequence was cloned into the vector and sequenced for identification. Genebank (Genebank) sequence and sequencing results were aligned with each other to confirm the PCR product as shown in FIG.

During PCR amplification, DIG was labeled on the target DNA obtained by adding DIG labeled UTP.

<Hybridization>

After amplification of the target DNA, a portion of the PCR solution may be mixed with 2 × SSC (1 × SSC solution = 0.15M sodium chloride / 0.015M sodium citrate solution) or 2M sodium chloride solution to sufficiently cover the glass substrate on which the probe is fixed. After the addition, the mixture was placed on a flat portion on the PCR device block, and the hybridization was repeated by heating and cooling periodically at 80 ° C. 5 minutes → 45 ° C. 5 minutes → 80 ° C. 5 minutes → 45 ° C. 5 minutes. At this time, the ramping time, which is the time taken to reach the specified temperature from one temperature to another, was set to 5 minutes.

Detecting degree of cleaning and hybridization

After completion of hybridization, the cells were washed with buffer solution and then reacted with an alkaline anti-DIG antibody bound to alkaline phosphatase in 2 × SSC or 1 × SSC solution. After about 2 to 4 hours, the cover glass surface was cleaned with a tissue, and then treated with a chemiluminescent alkaline phosphatase substrate in a dark room and exposed to an X-ray film. The film was developed to confirm the results as shown in FIG. 6. In FIG. 6, A is a glass substrate to which a first probe completely complementary to a target DNA is immobilized, and B is a glass substrate to which a second probe having a different base is immobilized. The buffer spot site used as the negative control appeared white. Thus, the black spots were found to be due to specific hybridization rather than nonspecific hybridization. That is, it was found that the target DNA hybridized only with the first probe that was completely complementary (region A), and that the hybridization did not occur with the second probe having a different base (region B). Thus, when using the hybridization method according to the present invention, it was found that hybridization can proceed with hybridization specificity in a short time.

Hybridization method according to the present invention has the advantage that the hybridization can be achieved in a short time. In particular, hybridization specificity can be maximized when a probe that is completely complementary to the target polynucleotide and a probe that is not complementary to some bases can be maximized to detect abnormality on the sequence of the target polynucleotide very quickly and precisely. Therefore, the characteristics of the polynucleotide detection apparatus using the hybridization method according to the present invention can be speeded up and precision.

Claims (6)

Supplying a target polynucleotide to a probe; And Hybridization step through periodic heating and cooling, which is performed by cycling at least two times a high temperature hybridization step of hybridizing at a temperature higher than the melting temperature of the hybrid of the probe and the target polynucleotide and a low temperature hybridization step of hybridizing at a temperature lower than the melting temperature. Hybridization method comprising a. The hybridization method of claim 1, wherein the high temperature is at least 20 ° C higher than the melting temperature. The hybridization method of claim 1, wherein the low temperature is at least 5 ° C. lower than the melting temperature. The hybridization method of claim 1, wherein the probe comprises a first probe that is completely complementary to the target polynucleotide and a second probe that is at least one base non-complementary with the target polynucleotide. The hybridization method of claim 1, wherein the transition from the high temperature hybridization step to the low temperature hybridization step occurs during a ramping time such that nonspecific hybridization does not occur. Polynucleotide analysis device using the hybridization method according to any one of claims 1 to 5.