KR20030087784A - Dna chip for detection of infectious bacteria - Google Patents

Abstract

PURPOSE: Provided is a DNA chip for detection of infectious bacteria, thereby rapidly detecting the infectious bacteria, and consequently diagnosing and treating rapidly and accurately. CONSTITUTION: DNA fragments for detection of infectious bacteria are provided, wherein the infectious bacteria include Morganella morganii; and the DNA fragment has the nucleotide sequence of SEQ ID NO: 8; and 23S rRNA and ITS(internal transcribed spacer region) nucleotide sequence of Morganella morganii are determined to design the DNA fragment as a probe. A microarray on which the DNA fragment of SEQ ID NO: 8 is fixed is provided.

Description

DNA chip for detection of infectious diseases

The present invention relates to a DNA chip for identifying the cause of the infectious disease. Specifically, the present invention relates to a DNA chip produced by attaching a specific part of the Morganella morganii bacteria, which are the cause of infectious diseases, with a probe.

Infectious diseases occur when various microorganisms, such as bacteria, fungi and viruses, appear and start to live in the blood, body fluids, and tissues of the human body, which can lead to loss of life if the bacteria are not correctly identified and treated properly. It is a disease. More recently, the misuse of antibiotics has resulted in a reduction in bacterial culture rates, the use of immunosuppressants following transplantation, the increase in drug administration due to chemotherapy, and the causative strains resulting from increased AIDS. Existing methods of diagnosing infectious diseases such as these are increasingly difficult.

There are three strains of Proteeae: Proteus , Morganella and Providentia . Morganella morganii is the main cause of urinary tract infections, a common causative agent of outbreaks of pathogenic urinary tract infections, often occurring when catheters are maintained for more than 30 days. In this case, a biofilm is formed in the catheter and a crust is formed in the catheter, so that the catheter is frequently closed. Urinary tract infections are also established due to the formation of urinary stones and struvite bladder. These stones can act as a major cause of recurrent urinary tract infections and are associated with obstruction of the urinary tract. Morganella morganii is a major strain of infection in organ accommodations in addition to urinary tract infections. In addition, Morganella morganii is another cause of wound infections, soft tissue infections including diabetic ulcers, burn wound infections, pneumonia, respiratory-related pneumonia, vascular device infections, and intraperitoneal infections. Bacteremia can also occur rarely and may be associated with urinary tract infections (Braunwald et al., Harrison's Principles of Internal Medicine, Vol. 1, 15th ed. 2001, p. 959).

In recent years, pathogenic infections are becoming more socially important, and since the frequency of these infections is increasing and hospital infections are becoming a legal problem in the medical field, early diagnosis and prompt treatment without complications are important. Development is the medical technology that the times demand. An important causative agent of pathogenic infectious diseases is Morganella morganii, a gram-negative bacterium. Morganella morganii is a common cause of urinary tract infections. Morganella morganii was most commonly found in patients with pathogenic urinary tract infections, especially those with long-term urethral tracts (Warren JW et al., J. Infect. Dis. , 155, 1151-1158, (1987)) In recent years, resistance has been gradually increasing, so proper antibiotic treatment with early diagnosis is very important. Unsuccessful treatment can cause a number of secondary complications, including pyelonephritis, bacteremia, sepsis, urinary tract obstruction, urinary tract stones, chronic kidney infections, kidney failure, and even bladder cancer.

As described above, in the case of specific bacteria cause a very fatal and serious disease in the human body to diagnose them as soon as possible and to identify the type of causative bacteria occupy a very important position in the treatment. Due to this necessity, diagnostic methods for identifying infectious agents for a long time have been researched and developed.

First is the microbiological method, smear and culture test. It is a method to identify the type of bacteria by selecting the appropriate differentiation medium and culturing. Automated culture instruments for microbial identification have also emerged, including the VITAL Automated System for Blood Culture, the ATB Automated Identification System, and the MicroScan fully automated bacterial test system.

1) VITAL Automated System for Blood Culture

Inject every 2-5 ml of the patient's blood into aerobic Vital AER medium (O ₂ + CO ₂ mixture) or anaerobic Vital ANA medium (N ₂ + CO ₂ mixture) and incubate in VITAL automated blood incubator every 15 minutes It can be determined whether the culture of the microorganism by measuring with. The principle of VITAL automated blood culture medium is a fluorescent material of HFT (Homogeneous Fluorescence Technology) CO ₂ generation, pH changes, redox potential differences (Oxydo-reductant potential) of the medium on the metabolism of when inoculated with the blood in a mixed culture liquid microbial growth changes Etc., the fluorescent substance HFT is reduced. When every 15 minutes, the culture bottle is irradiated with 555 nm wavelength of Excitation light on the culture solution and automatically detects the culture of microorganisms by measuring the wavelength of 600 nm of HFT, the fluorescence reduced according to the growth of microorganisms, by Kinetic method. .

2) ATB Automated Identification System

The ATB Automated Identifier is a device that automatically handles microbial identification and drug susceptibility testing. It consists of three parts: hardware, software and consumables. Hardware components include densitometers, automatic readers, computers, printers, and electronic pipettes. Densitometers standardize the turbidity of microbial suspensions dispensed into strips. An automatic reader is an analysis module that reads sample strips, called expressions, and measures them by colorimetric and turbine ferrometric methods. Colorimetric measurement measures the response color of each cupule by the light transmission. The turbine ferrometric method uses the principle of measuring scattered light scattered at an angle of 30 ° because the amount of transmitted light varies according to bacterial growth. Computers run software such as programs, data entry, data retrieval, and storage. The electronic pipette dispenses a specified amount of bacterial suspension into the cupule of the strip. The strip is used for identification. Gram-positive bacteria suspension is suspended suspension medium and Gram-negative bacteria 0.85% NaCl medium. Samples of the patient are inoculated in a medium such as Blood agar, P agar, Manitol salt agar, Baird Parker, or MacConkey medium. Several pathogenic colonies to be identified are selected and suspended in suspension medium. The reading of the strip shall be read after 5 minutes by adding 1 drop of reaction reagent to the test item corresponding to the "0" column of the strip and shall not exceed 10 minutes. The response color of the strip cupule is read using a reader connected to an ATB system.

3) Microscan Fully Automatic Bacterial Testing System

Microscan Fully Automatic Bacterial Testing System is a fully automatic microbiological testing device that automatically outputs the results of microbial identification and antibiotic susceptibility testing simultaneously. Microscan divides the WalkAway-40 and WalkAway-96 according to the number of microscan panels that can be processed, but the functionality is the same. The system consists of a reader, a computer, a barcode printer, a report printer, Renok, and a consumable. Thermostats for microbial cultivation, eight towers with panels, readers for bar code recognition on panels, dispensers for reagent dispensing on panels, tungsten-halogen lamps for measuring reactions, fiber-optics, photodiode, etc. It consists of an optical device and is connected to a computer. The wavelength used for the measurement uses wavelengths of 405, 440, 505, 560, 590, and 620 nm. After inoculating bacteria on the panel and attaching a barcode, incubation time management, reagents are added to the panel, and the reaction of each well is read by colorimetric method, turbidity method or fluorescence method and the identification results are automatically input to the computer. Microtiter panels of 40/96 wells are used for microbial identification, and the classification of panels is based on commercial / chromogenic panels, rapid chromogenic panels, and rapid flow. Rapid fluorogenic panels. Commercial chromogenic panels have a microorganism identification time of 18 to 24 hours, rapid chromogenic panels have a microorganism identification time of 4 hours, and rapid fluorogenic panels have a Gram-positive and Gram-negative microorganism identification time of 2 hours but are sensitive to drugs. Using a combo panel at the same time, it takes 3 to 7 hours, and 15 hours for some Gram-positive bacteria.

Diagnosis can be made through the cultivation of microorganisms through the selective medium, but the diagnosis rate through the culture method currently used in clinical diagnosis is very low. For example, the probability of detecting bacteria in blood cultures in patients with sepsis is less than 50% (Novis DA et al., Arch Pathol. Lab. Med., 125, 1290-1294, (2001)). In infectious endocarditis, 2.5 to 31% of patients have a negative blood culture diagnosis, and in patients with endocarditis, the result of the culture is also negative in the infected valves (Schled WM et al., Principles and Practive of Infectious Diseases.3rd ed.New York; Churchill Livingstone, 670-706, 1990). In addition to the blood, meningitis, pericarditis, peritonitis, pleurisy, arthritis, and other body fluids also significantly lower the accuracy of the culture diagnosis, the situation is very unlikely to improve the disease through early treatment. In particular, anaerobic bacteria, unlike aerobic bacteria, because when the specimen is in contact with the air, the strain does not survive, there is a lot of difficulties in the method of collecting and transporting the sample, slow growth rate, and provides an anaerobic environment in culture The difficulty in identifying bacteria is very low (Finegold SM et al., A Clinical Guide to Anaerobic Infections.Belmont, Calif., Star, (1992)). Also, among the Gram-negative aerobic bacilli, Pseudomonas spp. And Enterobactericeae spp. All but the microorganisms require special media, making it almost impossible to diagnose them by routine culture tests. These strains have a number of disadvantages in that they fail to grow because of their slow growth and difficult culture conditions (see Holmes B. et al., Manual of Clinical Microbiology 6th ed.Washington, DC .: American Society of Microbiology, 499). -508, (1995)).

Secondly, immunosera are used in clinical trials. Representative immunosera are the bacterial coagulation assay, complement binding assay, enzyme linked immunosorbent assay (ELISA), radioimmunoassay, immunofluorescent test, and immunoassay. Blot (Immunoblot), etc., but generally the ELISA test is the most used. In other words, they can be said to be tested by using the immune response between the antigen and the antibody. Here's how to use it in immunosera:

1) Anti-Streptolysin-O Test

Streptolysin O is a hemolytic factor produced by group A hemolytic straptococci and is useful for identifying β-Hemolytic streptococci infections, diagnosing rheumatic fever or post-streptococcal glomerulonephritis, and identifying rheumatic fever and rheumatoid arthritis in patients with joint pain. Among the antibodies tested against the extracellular components produced by Group A streptococci are currently tested items such as ASO (antistreptolysin O), ASK (antideoxyribonuclease B), antideoxyribonuclease (ADNase), and AH (antihyaluronidae). It also reacts with extracellular components produced by some of the Lance field group C and Grns. An antibody against hemolytic streptococcal itself is an antibody against group A specific polysaccharide (antistreptococcal polyliposaccharide, ASP). If hemolytic streptococcal primary infection is tonsillitis, pharyngitis, dermatitis, scarlet fever and secondary, rheumatic fever and acute nephritis are required. During antibiotic treatment, the response is suppressed and a false positive is observed when the lipoprotein level is elevated. Carerer sometimes has high titer.

2) Anti-Mycoplasma Antibody

Mycoplasma infection test is performed. Of about 200 species of mycoplasma, the most important for humans is Mycoplasma pneumoniae, which causes acute upper respiratory tract and lower respiratory tractitis in humans, with a severe cough that does not accompany fever or sputum. The disease is mainly caused by infections in adults and children and low in morbidity in the elderly (over 60 years). Mycoplasma is also called pleuropneumonia like organism (PPLO). Immediately after onset, antibody levels do not increase, but if antibody levels rise four or more times after 2-3 weeks of onset, it is confirmed. The Complement fixation test measures two types of IgM antibodies that appear early in the infection and IgG antibodies that persist for months after infection. Antibodies rise from 7-10 days after onset, peaking in 3-4 weeks, and then lowering thereafter, but remain high for some months. PHA reactions using sensitized red cells treated with tannic acid are mainly measured for IgM class antibodies.

3) Cold Agglutinins

Primary atypical pneumonia is identified and cold agglutinin disease and lymphoreticular malignancy are identified and compared. Originally applied for the diagnosis of chronic cold agglutinin diseases such as anemia caused by cold agglutinin, the frequency is frequently examined when suspecting Mycoplasma infection. In addition, viral respiratory infections, obesity diseases, bronchitis can be increased because it is used as an indicator of activity of these diseases.

Cold agglutinin is an auto antibody against red blood cell (RBC) membrane antigens. Mycoplasma antigens are cross-reactive with erythrocyte I antigens, resulting in elevated cold aggregate levels during infection. Mycoplasma pneumoniae infection begins to rise from 1 week after onset, reaches peaks at 2-3 weeks, then gradually decreases to become negative at 4-6 weeks. Therefore, it helps to determine the infection in the first 1-2 weeks of infection.

Cause of rise > 32-fold (-256-fold): Mycoplasma infection (observed in case of recovery) (55% of primary atypical pneumonia) antibody: Mycopl; asma infection, obese pancreatic bronchiolitis, chronic airway infection disease, infectious disease, gangrene, congenital syphilis, cirrhosis, old ageat temperature 0-10 ° C.

4) Anti-Epstein Barr Virus (anti EBV) Antibodies

Anti-Epstein-Bar virus antibody tests are performed for the detection of infectious mononucleosis, a heterophile negative (monospottest), and for the antibody status of EBV (in immunosuppressed patients, lymphoproliferative processes).

5) Amoebiasis antibody (Entamoeba histolytica antibody, Serum)

It is a test for detecting antibodies of E. histolytica , the cause of intestinal parasite dysentery amoeba disease. Conventional screening tests confirm cysts or trophozoites, but microscopic negative tests do not. In other words, parasites other than the minister should be checked and tested by other methods. Liver abscess is a non-intestinal infection that cannot be identified by conventional screening tests, ie serologically diagnosed. The assay is performed by indirect hemagglutination or latex agglutination and couterimmunoelectrophoresis.

6) Aspergillus Antibodies, Serum

Immuno-diffusion test detects antibodies from Aspergillus organisms ( A. Flavus, A. Fumigatus, A. niger ). Allergic bronchospasm can also be fatal to immunodeficiency patients. Aspergillus infection is associated with cronchopulmonary disease, endophthamitis, kidney, heart, brain and bone disease. Normal person is negative. There are 1-4 precipitin bands in the serum. Strong bands appear in severe aspergillosis infections and weak bands indicate the early stages of hypersensitivity pneumonitis.

7) Menigitis Antigen, Bacterial

Counter immunoelectrophoresis detects specific antigens in Streptococcus pneumoniae, Neisseria meningitidis, Haemophilus influenzae type B in CSF, urine and serum. In other words, etiologic agents of meningitis are performed with CSF, urine, serum, pleural fluid or joint fluid. Usually CSF and urine are recommended. Normal person is negative. Positive results EMt pediatric infections within 3 months of S. pneumoniae , N. meningitidis , H. influenza , and streptococci group B. This method is affected by antimicrobial therapy but is better than culture. Contamination of samples affects the audit results and aseptic specimen handling is required.

8) Candida Antibody, Serum

Candida albicans is a saprophytic yeast of human flora, which shows pathogenicity when resistance of living organism is weakened. Candidiasis is usually limited to skin or mucosa, which is fatal if developed into a systemic infection. Candidiasis is often susceptible to antibacterial, antimetabolic, corticosteroid therapy and immunologic defects or to pregnancy, obesity, diabetes and delibitating disease. Oral candidiasis is benign in children but may be the first symptom of acquired immunodeficiency syndrome in adults. Candidiasis can be diagnosed by culture or histopathology, but candidida antibody can help diagnose systemic candidiasis. However, some believe that the diagnosis of serological systemic candidiasis is less reliable. This test is positive in 20-25% of normal people, so careful judgment should be made.

9) Cryptococcus Antigen, Serum or CSF

Cryptococcus antigen is a latex agglutination method for detecting antigens in serum or CSF. Cryptococcus neopormans is a yeast like fungus that causes severe infections such as fever, headache, local symptoms, ataxia, drowsiness and cough. Involvement with the central nervous system can be fatal if neglected. However, non-meningitis patients also have a 30% positive response.

10) Cytomegalovirus Antibody Screen, Serum

The presence of cytomegalovirus antibodies indicates past CMV infection. Problems with transfusion or tissue transplantation include passive hemagglutination, latex agglutination, enzyme immunoassay and indirect immunofluorescence. Complement fixation test is 60% more sensitive than other tests and cannot be used as screening test. This test is a qualitative test that checks for past infections with 1: 5 times the serum. Quantitative tests detect the acute infection of CMV by diluting the dilution rate.

11) STS, TPHA & FTA-Abs

For syphilis testing and a comprehensive assessment thereof. The serological response of syphilis is largely divided into lipid antigen and syphilis treponema antigen. The lipid antigen method is generally called STS, and there are methods such as microscopic clumpint (VDRL), macroscopic clumping (RPR), and carbon RPR. Syphilis treponema antigens come in a variety of ways, including TPHA and FTA-Abs. Syphilis is a test for detecting antibodies produced by syphilis and not a syphilis antigen, treponema. The detected antibody is an antibody that reacts with a lipid antigen called cardiolipin, which is highly reactive with syphilis but may be false positive if there is a similar antigen component. Meanwhile, the antibody detected in TPHA and the antibody detected in FTA-Abs may not be the same.

12) Toxoplasmosis

It is an infectious disease caused by Toxoplasma gondii protozoa and is widespread throughout the world. It is useful for differentiating and preventing risk of congenital toxoplasmosis infection in pregnant women, diagnosing toxoplasmosis in immunodeficiency case, congenital toxoplasmosis diagnosis and acquired toxoplasmosis diagnosis.

13) Chlamydia

The purpose of this study is to detect Chlamydia infection, which requires rapid diagnosis due to its conjunctivitis, upper gastritis, pneumonia and urethritis. There are two pathogens, Chlamydia psittaci (CP) and Chlamydia trachomatis (CT), but new Chlamydia are being identified. Mainly urethritis, epididymitis, male counterpart women with CT genital infection, tubalitis, PID, neonatal conjunctivitis, adult conjunctivitis, trachoma, patients suspected of sexually transmitted disease lymphoblastoma, β-lactum invalid airway infection (by contact with algae) Occurs in psittacosis). Detectable diagnostic methods can be divided into direct detection methods and serological diagnostic methods.

A) direct detection method

A. Fluorescent Antibody Method

a) Cultureset: Chlamydia-specific monoclonal antibodies are detected by CT, CP and TWAR methods. It is not possible to discriminate species by obtaining results within an hour of harvesting.

b) Micro track: Only CT can be detected selectively and the result is obtained within about 30 minutes. However, cross reactions with Staphylococcus aureus have been reported and should be noted.

c) Chlamydia TWAR: selectively detects only monoclonal antibody TWAR.

B. Enzyme Antibody Method

As an antigen detection method using Chlamydia-specific antibodies, a large number of samples can be processed, which takes 4 hours.

C. DNA hybridization

B) serological diagnostic methods

In human disease, it is difficult to obtain CP-containing samples from the lesions, and CT infection is difficult to detect after CT treatment. Therefore, the diagnosis has no special method but to refer to the serological diagnostic method.

A. Complement fixation reaction: A test for family specificity. Therefore, CP and CT infections should not be differentiated. It is effective for Chlamydia psittaci disease and groin lymphoma (32 times more in CP and 64 times more in groin lymphoma) that show higher titer with lower sensitivity than fluorescence antibody or enzymatic antibody, but in CT TWAR infection There is difficulty. Four or more times higher antibody levels in interval-sampled samples, or antibody titers at 16-fold dilutions usually lead to suspicion of CP and CT infections.

B. Fluorescent method: Species specificity is obtained using antigens from infectious and non-proliferative bodies called elementary bodies in the Chlamydia proliferation cycle. Since this antigen is a CT serum type specific antigen, the antibody by MIF can know CT serotype specificity similar to the Ig class of an antibody.

C. Microplate immunofluorescence antibody technique: Speciation is a specificity test that allows the identification of CP according to the strength of the antigen. Applications are currently being investigated for TWAR infections.

D. Enzyme Antibody Method: As a test for species specificity, there is an advantage in that a large number of samples can be processed.

14) Febrile Agglutination Tests (Widal and Weil-Felix Reactions)

Salmonella disease should be considered as detection of bacteria, which is antigen detection, and blood cultures in the first week, blood and stool, urine culture in the second week, and urine and stool in the third week. The serological agglutination test continues to test aggregate titers at the beginning of the onset and at 3 weeks after 2 weeks. Typhoid bacteria are used with O, H and Vi antigens. Diagnostic significance is observed at elevated intervals for duplicate titers. Antigens are positive for titers once in a single serum sample at 1:80 to 160 fold and at 20 folds for Vi antigen (80 times or more for para-A and para-B, respectively) (Widal test for salmonella) . Although not specific, one of the most widely used serological tests of rickettsia disease is the Weil-Felix response. It is used for the diagnosis of rash typhus, and it is agglutination reaction using proteus bacteria (OX-19, OX-K, OX-2) as antigen. This diagnostic method is also applied to Tsutsugamus disease.

Third, molecular tests have been proposed. To date, the most widely used laboratory method for diagnosing diseases has been the use of proteins. With the recent development of molecular biology, various proteins have been cloned and their nucleotide sequences have been revealed, which makes it possible to diagnose diseases using DNA or RNA. Representative examples of active use in clinical practice include cancer suppressor genes, drug resistant genes, various infectious diseases, and genetic disease tests, as well as oncogenes with hundreds of known identities. It is widely used in genetic disease, paternity test, and forensic medicine, and the range is expected to progress to gene therapy in the future. The use of this genetic analysis for clinical diagnostics will provide a significant milestone in the medical community. Here, we briefly introduce the southern blot method and PCR (polymerase chain reaction), which are most used for genetic analysis, and introduce the test items that can be used with this method.

1) Diagnosis using Southern blot method

A) Search for DNA Amplification or Reconstitution

DNA is extracted and digested with restriction enzymes, followed by electrophoresis and transfer to a nylon filter to hybridize with a probe with the site to be detected. The amplification and reconstruction are determined by the intensity and size of the bands obtained.

B) Search using RFLPs

When DNA is digested with restriction enzymes, fragment lengths corresponding to specific DNA markers may vary from person to person. This is called Restriction Fragment Length Polymorphi (RFLPs). When the southern blot analysis shows that alleles show bands of different sizes, they are called heterozygotes. Normal cells represent heterozygotes, and tumor cells representing homozygotes are called loss of heterozygosity (LOH). This principle can be used to search for a variety of genes.

2) Diagnosis using PCR

PCR was first reported in 1985 by PK Saiki et al. As a novel method of diagnosing sickle cell disease, a hereditary disease by enzymatically amplifying a specific region using a nucleotide sequence of β-globin gene of chromosomal DNA as a primer. The basic principle of PCR is to conjugate a pair of primers corresponding to both ends of a gene to a gene, and then synthesize between two primers with DNA polymerase, and the synthesized DNA is produced by repeated conjugation and polymerization of the same two primers. It is amplifying exponentially with synthesis. Depending on the number of repetitions, the specific DNA can be amplified by 2 ^{n, and the} DNA amplified to 10 ⁵ -10 ⁹ can be obtained. This can be appropriately used as a method for identifying the presence and type of bacteria through sequencing after amplifying the gene of the causative organism from the sample. The PCR method can amplify hundreds of thousands of DNA regions to be analyzed in a sample, thereby increasing the sensitivity of the analysis and analyzing the sample with a very small amount of sample. These characteristics are used to detect bacterial and viral genes for microbial infections.Polymerase chain reaction (PCR), hot-start PCR, nested PCR, multiplex PCR, and degenerate oligonucleotide primer (DOP) PCR are used for diagnostic PCR. , Reverse Transcriptiase PCR (RT-PCR), Quantitative RT-PCR, Fluorescent In Situ Hybridization (FISH), In Situ PCR. This method is used to isolate and amplify the genes of the causative organisms from the sample, and to identify the type and presence of the bacteria through sequencing. This method amplifies and detects a small amount of DNA. There is an advantage that can be identified only by the presence of the pathogen or the gene of the bacteria. In the PCR detection method, it is very important to select target genes to be amplified. Generally, 16S rRNA, 23S rRNA, and Internal Transcribed Spacer Region (ITS) are used (see P. Wattiau et. al., Appl. Microbiol.Biotechnol. , 56, 816-819, 2001, D, A. Stahlm et al., J. Bacterial ., 172, 116-124, 1990, Boddinghaus.B. et al., J. Clin., Microbiol ., 28, 1751-1759, 1990, T. Rogall et al., J. Gen. Microbiol ., 136, 1915-1920, 1990, and T. Rogall, et al., Int'l J. System. Bacteriol., 40, 323-330 , 1990, K. Rantakokko-Jalava et al, J. Clin., Mirobiol., 38 (1), 32-39, 2000, HY Park et al, J. Clin., Mirobiol ., 38 (11), 4080-4085, 2000, A. Schmalenberger et al, Appl. Microbiol. Biotechnol. , 67 (8), 3557-3563, 2001). However, 16S rRNA has a disadvantage in that there is a small polymorphism, which does not distinguish between species.

Fourth, there is a method of identification by hybridization of oligonucleotide probes. Hybridization is a phenomenon in which a single strand of nucleic acid forms a double helix when it meets with a nucleic acid of another strand of complementary nucleotides under appropriate conditions.

Recently, SJ Hi-Tech Co., Ltd. selected a specific probe of bacteria for genotyping of human pathogenic anaerobic bacteria, and developed a bacterial identification system using DNA chips. However, this study developed a diagnostic method limited to some anaerobic bacteria among bacteria, and selected the bacteria that cause diseases such as acne, not clinically urgent and urgent diseases. Final Report on Technology Development Project, Ministry of Health and Welfare HMP-00-VN-01-31400-0034, 2000). Therefore, there is an urgent need for a system for identifying the bacteria raised in the present invention.

The present invention is to provide a simple, high accuracy and efficient method in consideration of the problems of conventional methods for identifying bacteria and diagnosis of infection.

The microorganisms raised in the present invention are currently clinically identified using a microbial culture method. However, as described above, each bacterium is not only different and difficult to culture, but also takes a long time and takes a lot of time to examine, which is very inappropriate as a method for diagnosing tactile disease.

As a result, efforts have been made to develop a simpler, faster and more accurate method of diagnosing the causative agent of an infectious disease, and have succeeded in making a DNA chip that initially diagnoses the cause and type of the causative organism using bacterial genes. The present invention was completed after confirming that the test meets all three conditions of simplicity, rapidity, and accuracy. That is, an object of the present invention is to provide a method for accurately identifying clinically important anaerobic bacteria and some Gram-negative bacteria, along with the presence or absence of bacteria in a sample by providing a base sequence specific to the bacteria as an identification probe. .

1 is a schematic diagram of a DNA chip prepared by attaching a specific part of the bacteria with a probe.

2 is a test result of the degree of hybridization between the asymmetric polymerase chain reaction product and the probe on the glass substrate. In other words, it is a DNA chip for the amplified part of 23S rRNA and ITS of Morganella morganii (Se-S.epidermidis, Spy-S. Pyrogenes, Bur-Burkholderia, Vcho-Vibrio cholera, Citf) Citrobacter freundii, Hin-H. Influenza, Kpneu-K.pneumoniae, Styp-Salmonella spp., Vvul-Vibrio vulnif icus, Eco-E.coli, Svi-S.viridans, Sflex-S.flexneri, Sm-Strentrophomonas maltophila , Pa-P.aeroginosa, Pm-Proteus mirabilis, Ah-Aeromonas hydrophila, Nm-Nesseria meningitidis, Strepp-S.pneumoniae, Saur-S.aureus, Lm-Listeria monocytogenes, Ente-Enterobacter, Efcium-Enterococcus faecium).

The DNA chip is a molecular biological method that is very precise enough to distinguish even a single base difference. Because of this, it is possible to distinguish subspecies within a single species, which may be useful for diagnosing diseases and identifying strains. In addition, rapid and accurate strain identification is possible without going through a difficult identification process. The advantage of such a DNA chip is very suitable as a method for diagnosing time-consuming diseases. Therefore, the development of DNA chip as a method that can be quickly and accurately diagnosed to identify the strain is urgently needed. Therefore, the development of the DNA chip for infectious disease identification of the present invention can suggest a method for promptly preparing an effective treatment by revealing a kind as well as a method for early diagnosis of a disease.

In the present invention, by utilizing the advantages of the DNA chip, the invention invented a DNA chip for identifying infectious diseases causing bacteria satisfying the following conditions.

First, the high accuracy of the test results was sought by checking whether the infection had a degree of binding between the specific gene of the bacteria immobilized on the solid substrate and the gene of the bacteria extracted from the standard strain.

Second, since several samples can be diagnosed at the same time, the pursuit of promptness was made by greatly reducing the diagnosis time and cost.

Third, the simplicity was pursued by allowing the inspection to be performed through a simple procedure that does not require professional skills.

In the present invention, a more accurate diagnosis is possible by providing a DNA chip in which a specific gene of a specific causative agent of an infectious disease is integrated on a small solid substrate at the same time, and at the same time, a large number of DNA is accumulated on a solid substrate. Simultaneous examination of the specimens provided the minimum cost and time to analyze the results.

In order to enable identification of clinically important strains, including those not previously identified, probes were designed from ITS and 23S rRNA sequences of Morganella morganii . Compared with 16S rRNA, 23S rRNA has a relatively long nucleotide sequence, and a well-preserved portion of the nucleotide sequence is distributed evenly among the portions unique to each germ. There is a much wider choice of common primers that can be amplified with primers and probes specific to each organism. In addition, the ITS moiety is so diverse that it is very easy to use for probes (V. Gurtler et al, 3-16, 1996).

Accordingly, in the present invention, 23S rRNA and ITS nucleotide sequences of Morganella morganii bacteria, which are clinically important and have not yet been identified, were identified. .

There are two ways to get a probe. First, a single stranded probe is obtained. As the most representative example, a deprotection reaction may be performed by synthesizing by using a dimethoxytrityl (DMT) off method in an automatic chemical synthesizer, and then a probe having a desired number of bases may be synthesized. The probe thus prepared can be identified by the presence of a specific nucleic acid by attaching a fluorescent material such as FITC at one end of the strand during synthesis. Alternatively, a single-stranded DNA is used as a template to make a probe having a base sequence complementary thereto. A primer is hybridized to the DNA of the template, and the base to which the Klenow enzyme and the fluorescent substance are attached (dNTP) The probe is synthesized using. Since the fluorescent material is attached to the inside of the DNA, it is possible to synthesize a probe having high sensitivity and specificity. Second, there is a way to get a double stranded probe. Genomic DNA or plasmid DNA can be cut with specific restriction enzymes to obtain probes containing genes or bases of desired parts. Random priming is a method of synthesizing template DNA with six random hexamers and then synthesizing probes of various lengths with fluorescent materials attached. Another method is to use a T4 polynucleotide kinase with ³² P at the 5 'end of DNA. It is also possible to synthesize the probe attached to the fluorescent material by using the DNAase, and to make a cleavage portion on the double-stranded DNA by using DNase I, and then, the DNA polymerase I and the base to which the fluorescent material is attached (dNTP) ) Can be used to synthesize probes. This double-stranded probe is used for hybridization after denaturation to make it single-stranded.

DNA that hybridizes with probes is usually produced in two ways. First, Southern-Blot or Northern-Blot method is used to cut genomic DNA or plasmid DNA with appropriate restriction enzymes, and then electrophores on agarose gel to separate DNA fragments by size. The second method is to amplify and use DNA of a desired portion using a PCR method. At this time, looking at the PCR method used, asymmetric amplification method that can obtain the double strand and single strand at the same time by asymmetrically adding the most common PCR and primer to amplify the forward and reverse primer using the same amount (Asymmetric PCR), Multiplex PCR that can be amplified at the same time by putting various primers, LCR (Ligase Chain Reaction) method to determine the amount of fluorescence by enzyme immunity after amplification using 4 specific primers and Ligase, Hot-start PCR, Nested PCR, Degenerate Oligonucleotide Primer (DOP) PCR, Reverse Transcriptiase PCR (RT-PCR), Semi-quantitative RT-PCR, Real time PCR, Rapid Amplification of cDNA Ends (RACE), Competitive PCR, Short tandem repeats (STR), Single Strand Conformation Polymorphism (SSCP), In Situ Polymerase Chain Reaction (ISCR), and Differential Display Reverse Transcriptase PCR (DDRT-PCR).

Hot start PCR refers to the time it takes for the temperature to rise and starts the PCR at a high temperature at which the DNA begins to denature in consideration of the effect on the PCR process. Or DNA amplification, which doubles the amount of the desired DNA at each step to amplify more than the original DNA, and is used to analyze by electrophoresis. Is heated to 90 ℃ ~ 96 ℃ to separate double-stranded DNA into single-stranded DNA. The higher the temperature, the better the single-stranded DNA. However, if the temperature is too high, Taq DNA polymerase may also lower the activity. The first cycle lasts about 5 minutes for definite denaturation. In the annealing of the primer, it proceeds at 50 ℃ ~ 65 ℃, and the bond between bases is hydrogen bond in three places in case of G and C, and the bond occurs in two places in case of A and T. It is good to change. In fact, making primers should be synthesized considering the annealing temperature. In the polymerization step of DNA, it is carried out at 70 ℃ ~ 74 ℃ and the time is extended when the size of the desired PCR product is large or the concentration of reaction element is low. Taq DNA polymerase can synthesize 2,000 to 4,000 nucleotides per minute, so if you allocate a minute or so of time every 1 kb of PCR product, the reaction will take place. As the cycle continues, enzyme activity may decrease and DNA products are more and more present. Therefore, it is a good idea to increase the reaction time little by little in the latter part of the cycle. To be exercised. Nested PCR Nested PCR uses one set of primers (forward and reverse) in PCR, whereas nested PCR uses two sets of primers. In other words, the first PCR using a primer set of the same type used in normal PCR and then the PCR using the nested primer set is called nested PCR. Nested primer set is a primer set that can amplify the product amplified by the first primer used in nested PCR. It is a primer set that can amplify the inner part of the DNA amplified by the first primer set. Thus, the primary and secondary primer sets (which are nested primers) are on the same DNA, but their positions are different. It must be observed that the primer set must be prepared so that the PCR product amplified by the primary primer set is amplified by the secondary primer set. Because normal PCR amplifies only one set of primers, it is not easy to amplify it with PCR when the template is extremely low. Nested PCR performs PCR using one set of primers first and then performs the primary PCR. Since the amplification is performed again with nested primer sets, even if the amount of the template is extremely low, the desired amplification result can be easily obtained due to the effect of amplifying the template in the primary PCR. Next, DOP (Degenerate Oligonucleotide Primer) PCR is one of the methods for cloning a new gene or gene family. Most genes in the family have structurally similar structures. This is also confirmed by the involvement of protein sequences between analogous proteins. Based on this information, only the information about the amino acid sequence of the protein is used. In order to amplify the DNA to be obtained, the cloning of the conserved protein motif is carried out using a degenerate PCR primer that estimates the sequence of the gene inversely from the amino acid sequence. Can be. Degeneracy is a phenomenon in which one type of amino acid corresponds to a plurality of codons, but it is not possible to determine the nucleotide sequence of a gene encoding a specific amino acid sequence. do. Problems solved by DOP PCR can be found in the evolution of genes when a specific protein is isolated, the amino acid sequence is identified, the relevant gene is cloned, or the human gene is isolated and similar genes are isolated from rats or fruit flies. Used to study gene families when looking at related species. In addition, RT-PCR (Reverse Transcription-PCR) is a technique of synthesizing a corresponding cDNA (complementary DNA) by using RNA of a specific site as a template and then performing PCR amplification using the same. Reverse transcriptase) is used to prepare cDNA from RNA and 2) amplify a specific region using cDNA. 2) process is the same as amplifying a specific gene region from genomic DNA. This method is not only simpler than RNA analysis, which is possible through Northern blot hybridization, but also can be used to study the nucleotide sequence and transcription level of mRNA. In the case of genes with known nucleotide sequences, RT-PCR can not only synthesize and cloning full-length cDNAs, but also increase the sensitivity of RNA testing and analyze nucleotide sequences from small amounts of RNA. Semi-quantitative PCR compares each relative quantity by densitrometer or image analysis program. In the case of semi-quantitative RT-PCR, the amount of each sample is the same. After reverse transcription, PCR is performed. At this time, make and mix a master mix. In PCR, two kinds of primer sets should be used, but it should be noted that the band size detected by each primer set should be about 200bp, so that the effect of PCR can be minimized. The number of PCR cycles is also very important. Increasing the number of cycles can be a limiting factor in some samples, resulting in completely different results than the actual values. After PCR, hang on agarose gel and examine the intensity of two bands, GAPDH (Glyceraldehyde-3-phosphate Dehydrogenase), which is generally used as a positive control, and the intensity of the desired target band. Then, to obtain the same GAPDH band intensity throughout, we can calculate how much of each sample should be taken. According to this calculation, the GAPDH band intensity is the same in all samples, but the intensity of the desired target band is different for each sample. Furthermore, the southern blotting of the target band shows that the DNA is really clear. This will give you a rough idea of the relative amount of target RNA present. Next, the characteristic of real time PCR is that it is possible to accurately quantify the initial amount of nucleic acid after the PCR reaction without analysis. For real-time PCR, fluorescence reporter material or fluorescence labeled oligonucleotide probe can be used to monitor the whole reaction. In this case, it has the advantage of being able to accurately quantify the signal for the desired product. Taq polymerase has a 5 'exonuclease function, which cleaves the fluorescence-attached hybridization probe that is already bound to the target in the PCR extension step. In the fluorescent TaqMan assay, the 5 'end of the probe is labeled with a reporter dye such as fluorescein and the 3' end is labeled with another fluorescent dye such as TAMRA, a quencher material. When the reporter and quencher are attached to both ends of the probe with a length of 20-30bp, when the light is excited from the light source, the fluorescence emitted from the reporter dye is absorbed by the quencher and is not measured. When the Taq polymerase is extended and meets the previously bound probe, the probe is decomposed one by one and the reporter is separated from the quencher, so the fluorescence from the reporter is measured. Next, RACE (Rapid Amplification of cDNA Ends) knows some nucleotide sequences of cDNA, synthesizes gene specific primers in this part and amplifies DNA up to 5 'or 3'-end through PCR reaction. In the 3'-RACE, the poly (A) tail in the 3'-end of the mRNA can be used. Therefore, the oligo- (dT) primer is used as the down stream primer. However, in the case of 5'-RACE, the poly (A) or poly (C) tail must be artificially created using TdT (terminal deoxynucleotidyl transferase) at the end of the 1st single strand cDNA synthesized with a gene specific primer. Next, Competitive PCR uses DNA fragments called "DNA competitor" or "Internal standard". The conditions of this DNA competitor are as follows. The first is that it can be amplified by primers like the target DNA, and the target DNA can be distinguished after PCR amplification. If the DNA competitor and the target DNA are amplified simultaneously with the same primer in the same reaction solution, the amplification of both is caused by competition between the primers, so the ratio of the amount of amplification product reflects the ratio of the template amount. The amount of target DNA can be estimated by comparing with competitors. to the next STR (short tandem repeats) is a tandem repeat sequence in the human chromosome and refers to a hypervariable tandem repeat sequence in which a short unit consisting of 2 to 7 bases is repeated at least once or a few dozen times. The number of repetitions that exist and varies from person to person. This STR polymorphism has a large number of alleles, but its distribution is biased towards the end of the chromosome. Some of these polymorphisms can be amplified by PCR amplification before and after the repeat sequence and detected by the length polymorphism of the PCR product. Since the repetition of this particular base is passed down through generations, it is also used for paternity using genetic identification. Next, SSCP (Single Strand Conformation Polymorphism) means that the speed of movement of some particles in the electric field is affected by the size and shape of the particles. In addition, the single strand DNA forms a secondary structure by intramolecular interactions under non-denaturing conditions. The secondary structure is determined by the DNA sequence. Therefore, the difference in movement distance occurs because the rate of electrophoresis is affected by the change (point mutation, deletion or insertion) of one of the DNA sequences. Based on this principle, SSCP, designed by Orita et al. In 1989, is used as a useful tool for detecting mutations in genes. The first SSCP method cuts genomic DNA with a suitable restriction enzyme, denaturates with alkali, electrophoreses in a non-denaturing polyacrylamide gel, transfers it to a nylon membrane, transfers fragment DNA, and is radiolabeled. By performing autoradiography using RNA or DNA probes, mutations were detected by confirming the difference in the development distance between normal and mutated genes on the X-ray film. However, since then, a method of analyzing a PCR product by SSCP was introduced. As this method is popularized, it is now called as PCR-SSCP. Until recently, PCR-SSCP has been used to obtain the results through autoradiography by directly labeling isotopes on PCR products, but recently, a method of searching for polyacrylamide gel by silver staining has been introduced. have. The silver staining method has the advantage of analyzing PCR products in a much faster time without the use of radioisotopes, and the sensitivity is not much different from the method using radioisotopes. It became. Next, if you look at the In Situ Polymerase Chain Reaction (PCSR), PCR is a method of amplifying the desired DNA in a large amount, and in situ hybidization (ISH) can find a very small amount of DNA and RNA in cells or tissues. It is a way to check the location of genes. ISPCR combines the merits of these two methods and has the specificity of PCR sensitivity and ISH. The experimental principle of ISPCR is the same as the general PCR method, but an apparatus for ISPCR suitable for the use of slide glass is required, and various methods of reacting according to the apparatus used are presented. ISPCR starts the reaction by amplifying the target sequence in the cell. The cell membrane is treated with HCl, protease K or Triton X-100 to easily move various substances (e.g. salt in PCR solution) through the cell membrane. The week must go through the process. Abnormalities in this process can damage or destroy cells, which can cause amplified PCR products to exit the cell after PCR. Therefore, proper selection and use of appropriate detergents is the most important, and there are methods using single primer pair with complementary tail, biotinylated dNTPs, and multiple overlapping primer pairs to prevent PCR products from flowing out of the cells. So far, the efficiency of ISPCR method is not known to be very high. In order to increase specificity, in situ hybridization or Southern blot hybridization using DNA probe is recommended. The recent increase in interest in ISPCR, despite its inefficient method, is expected to be of great help in the early detection of various diseases, and many companies are still producing and selling instruments useful for ISPCR. However, if a better mechanism is developed to improve the efficiency, ISPCR is expected to be more useful. Next, DDRT-PCR (Differential Display Reverse Transcriptase PCR) is used to isolate cDNA by using oligonucleotides linked with 10 T-bases and 2 nonspecific bases to isolate mRNAs that are specifically expressed after separating RNA from different cells. After that, this primer and oligonucleotide having a non-specific sequence are used as primers to compare various PCR products that appear when PCR is used to determine whether there is a difference between PCR products amplified from different cells. Selecting differently amplified PCR products to see whether the amplified DNA is a gene that is characteristically expressed in a particular cell is a simpler method than subtractive hybridization, but the disadvantage is that the sensitivity and specificity of the experiment is low.

In recent years, a technique called Fluorescent in situ hybridization (FISH) has been introduced and studied, which has the advantage of being faster, simpler and faster than conventional techniques (see GJ Jansen et al., J. Clin.Microbiol., 38 (2), 814-817, 2000, and AJ Volkhard et al, J. Clin.Microbiol ., 38 (2), 2000), differences in the degree of cell wall penetration of the probe, low in the cell Since the accuracy of the test result is determined by the amount of ribosomes and the suitability of the target position of the probe, there are still many problems to be performed as a clinical test that needs to obtain stable results. Recent literature has reported that the higher order structure of ribosomes results in a difference in binding force between probe and target position, indicating that one third of 200 probes exhibit low levels of less than 20% of the signal (see MF Berngard). et al., Appl. Environl Microbiol. , 66 (8), 3603-3607, 2000). Ribosome RNA is the most widely used in selecting specific genes to identify the causative agents of infectious diseases (R. Amann et al, FEMS Microbiology Reviews , 24, 555-565, 2000). DNA chips have been reported that can be used to design probes using 23S rRNA to rapidly diagnose infectious diseases (RM Anthony et al, J. Clin. Microbiol ., 38 (2), 781-788, 2000). . In addition, microorganisms have been identified after immobilizing all or more than 100 genes of bacteria into small lengths and immobilized on a solid support (JC Cho et al., Appl. Environl Microbiol. , 67 (8), 3677-3682, 2001, CA Molloff et al, J. Mol. Biol , 312, 1-5, 2001, AE Murray, Proc. Natl. Acad. Sci. USA , 98 (17), 9853-9858, 2001, U Dobrindt, Current opinion in Microbiol , 4, 550-557, 2001).

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are illustrative of the present invention, and the content of the present invention is not limited by the examples.

<Example>

Example 1

23S rRNA, ITS Sequence Determination of Morganella morganii Strains

Morganella morgani standard strain (Morganella morganii,ATCC 25830) was used to extract chromosome DNA using a QIAmp DNA mini kit (QIAGEN, USA). The nucleotide sequence of each known bacterium 16S rRNA was subjected to multiple alignment and BLAST to prepare a nucleotide sequence portion common to all bacteria as a common primer. In addition, consensus primers of 23S rRNAs already known (Anthony. R. M., et al.,J. Clin. Microbiol.38 (2), 781-788, 2000) and PCR using primers (hereinafter PCR) primers were purified and the product was purified and purified by DNA auto sequencer (Perkin Elmer, ABI prism 3700 sequencer). The base sequence was determined (SEQ ID NO: 1).

Example 2

Preparation and Immobilization of DNA Probes for Identification of Infectious Bacteria

In order to confirm the presence and identification of infecting bacteria, a DNA fragment probe to be immobilized on a glass plate was prepared.

After comparing the nucleotide sequences of each site through multiple alignment and BLAST, a probe was prepared by searching for the nucleotide sequences specific to specific bacteria. The probe was constructed to consist of 15 bases.

In order to immobilize the DNA probe, when synthesizing all DNA fragment probes, a base having an amino residue was inserted using an aminolinker column (Aminolinker column, Cruachem, Glasgrow, Scotland) at the 3 'first position, and a glass plate was used. Slide glass was coated with an aldehyde residue (CEL Associates, Inc. Huston, Taxas, USA). The probe was dissolved in 3 × SSC (0.45M NaCl, 15mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0) buffer solution using a microarray made in-house in our laboratory (see Yoon. SH , et al, J. Microbiol.Biotechnol. 10 (1), 21-26, 2000), and then induce a chemical reaction for at least 1 hour at 55% humidity and leave it for at least 6 hours. DNA probes were immobilized. In the bacteria detection probe, a DNA chip was prepared by integrating all the probes in the order of 275 μm at a concentration of 100 μM.

In order to confirm that the reaction between the amine group on the probe and the aldehyde on the glass plate was performed smoothly, it was confirmed by staining with SYBRO green II (Molecular Probe, Inc., Leiden, Netherlands).

Fragment genes were performed by asymmetric PCR (Asymmetric PCR) as a template of the genes extracted from each standard strain. Fragment gene was obtained by one polymerase chain reaction by differentiating the ratio of forward primer and reverse primer to 1: 5. At this time, the primer used is a part of the nucleotide sequence common to bacteria. When PCR was performed, Cy3-dUTP was added to confirm DNA binding with the probe, and the binding was confirmed by fluorescence to determine whether the infection occurred and the type of bacteria.

The primers used for PCR are nucleotide sequences present in 23S rRNA and present in all bacteria (see Pirkko K. et al., Clin. Micorbiol ., 36 (8), 2205-2209). In addition, primers were designed by performing multialignment and BLAST using a bioinformatics method to obtain a portion that cannot be amplified by the primers. Primers used for the PCR reaction are as follows.

Primer 1; Sense (SEQ ID NO: 2)

TTGTACACACCGCCCGTC

Primer 2; Antisense (SEQ ID NO: 3)

TTTCGCCTTTCCCTCACGGTACT

Primer 3; Sense (SEQ ID NO: 4)

TTTGGGACCTTAGCTGG

Primer 4; Antisense (SEQ ID NO: 5)

AGTACCGTGAGGGAAAGG

Primer 5; Sense (SEQ ID NO: 6)

AGGATGTTGGCTTAGAAGCA

Primer 6; Antisense (SEQ ID NO: 7)

CCCGACAAGGAATTTCGCTACCTTA

PCR reaction was performed under the following conditions. Initially, 7 minutes (denaturation) at 94 ℃ was done once. The second denaturation was performed at 94 ° C. for 1 minute, annealing at 48 ° C. for 1 minute, and extension at 72 ° C. for 2 minutes, which was repeated 10 times. Then, the third denaturation was performed at 94 ° C. for 1 minute, annealing at 52 ° C. for 1 minute, and extension at 72 ° C. for 2 minutes, and this was repeated 30 times. Thereafter, the last extension was performed once at 72 ° C. for 7 minutes. The product produced as a result of the PCR reaction was confirmed by agarose gel electrophoresis. It was confirmed that DNA double strands and fragment strands were synthesized at the same time for each bacterium. Thus, when 23S rRNA and ITS were used to identify bacteria, 23S rRNA and ITS of all bacterial species were detected using the primers used in the present invention. It can be seen that it can be amplified.

Example 3

Interaction of probes with analytes and test results

The gene extracted from the cells was amplified by asymmetric amplification and searched using a DNA chip.

15 μl of the gene amplified by Asymmetric PCR in a hybridization buffer (hybridization buffer: 6 × SSPE, 20% (v / v) formamide) is prepared to have a total volume of 200 μl. After dispensing the prepared solution on the glass plate to which the probe is immobilized, cover the probe-clip press-seal incubation chamber (Sigma Co., St. Louis, MO), and react for 6 hours in a 30 ℃ shaking incubator to complement the binding. Induced.

After elapse of time 3 × SSPE (0.45M NaCl, 15 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0), 2 × SSPE (0.3M NaCl, 10 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0), 1 SSPE (0.15 M NaCl, 5 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0) was washed for 5 minutes each.

Scanarray 5000 (GSI Lumonics Inc., Bedford, MA) was used to search and the results were as follows.

In order to confirm the specificity and sensitivity of the selected probes, a total of 13 standard strains of DNA were tested. For some probes, cross hybridization with other organisms occurred. However, most of them were confirmed that the binding occurred specifically for each bacteria. Marked with a red border in Figure 2 means a probe that binds specifically to each bacteria without cross hybridization with other bacteria at all. The yellow border indicates the bacteria specific probe. Therefore, by using the probe designed in the present invention, it is possible to confirm which bacteria are infected with the presence of bacteria in clinical specimens.

The position and base sequence of the probe identified in the present invention are as follows.

Identification strain Probe designation location Sequence SEQ ID NO: Morganella morganii atcc 25830 Mor2 ITS AAGAACACTCACAGA 8

According to the present invention, the DNA chip for identifying an infectious disease cause bacterium having specific probes attached to each cell can accurately and quickly detect Morganella morganii bacteria.

Claims (3)

DNA fragment having a nucleotide sequence of SEQ ID NO: 8. According to claim 1, wherein the DNA fragment is characterized in that the DNA fragment for the detection of Morganella morganii bacteria. Microarray attached to the DNA fragment of claim 1.