KR20030024129A - Detection and identification of helicobacter pylori - Google Patents

Abstract

PURPOSE: A method for detection and identification of Helicobacter pylori is provided, thereby the presence and species of Helicobacter pylori can be easily determined by using PCR(polymerase chain reaction). CONSTITUTION: An oligonucleotide primer for PCR is used for amplifying the rifampicin-resistance related sites of RNA polymerase β-subunit coding gene(rpoB) from species of genus Helicobacter, wherein the oligonucleotide primer contains at least one nucleotide sequence of SEQ ID NOs: 1 and 2. The method for detection and identification of Helicobacter pylori comprises PCR amplifying the cultured cell or stomach biopsy tissue using the oligonucleotide primer of SEQ ID NOs 1 or 2; digesting the PCR product with a restriction enzyme Tru9I or BasFI; and determining the size of digested gene fragments.

Description

How to detect and identify Helicobacter pylori {DETECTION AND IDENTIFICATION OF HELICOBACTER PYLORI}

The present invention relates to a method for the detection and identification of Helicobacter pylori (Helicobacter pylori ), specifically detects the species of the genus of Helicobacter, including H. pylori by PCR, and also to easily identify H. pylori among the species of the genus Helicobacter It's about how you can do it.

Helicobacter pylori (Helicobacter pylori ) is one of the most common microorganisms in human infection, it is known as a major causative factor of gastro-duodenal diseases, especially gastric cancer. Gastric-duodenal ulcer disease is more important in clinical classification than the gastrointestinal disease, as it is known to be an infectious disease caused by H. pylori (Pak Doo-ho. Peptic ulcer in Koreans. Journal of Korean Internal Medicine 55 : 437-). 445, 1998; Park In-seo, Helicobacter pylori infection in Koreans. Journal of Korean Internal Medicine 53 : S455-466, 1997).

H. pylori is a Gram-negative bacterium, and its culture conditions are microaerophilic, catalase-negative, and it has a characteristic urease. Small colonies can be observed by incubating at least _{2 to} 8 days in oxygen partial pressure, 10% in CO ₂ and 3 to 5 days at 37 ° C. In addition, it is difficult to cultivate it because it is killed within 6 hours at room temperature, and it is difficult to study because it can be cultured only by obtaining a biopsy tissue through an endoscope.

H. pylori is known for a variety of bacteria at the genome level. In other words, H. also referred to such an extent that flow diagram arrangement of the dielectric gene is found between the different species pylori strains (quasispecies) of the diversity beyond the concept of the present bacterial species (Lee, Kwang - Ho Helicobacter pylori infection Bacteriological Characteristics of pseudo Journal 40: 1154-1172, 1998; Kersulyte D, Mukhopadhyay AK, Velapatino B, et al. Differences in Genotypes of Helicobacter pylori from different human populations.India.J. Bacteriol. 182 : 3210-3218, 2000; Mukhopadhyay AK, Kersulyte D, Jeong JY, et al . Distinctiveness of genotypes of Helicobacter pylori in Calcutta, India.J . Bacteriol. 182 : 3219-3227, 2000).

Furthermore, H. pylori is similar to the Campylobacter (Campylobacter) over time have been classified as Campylobacter similar species (Campylobacter -like organism), it has also renamed history by a number of microbiological, biochemical features to the relatively recent have. The H. pylori means that there were many deficiencies in the classification or identification process. Due to the genome diversity of H. pylori , not only is it difficult to culture bacteria, but it is also low in sensitivity.

In addition, clinicallyH. pyloriThere are still many unresolved problems related to infectious diseases. Unlike in the West, our country with a lot of gastrointestinal diseases is 60-70% in normal people, 64-95% in patients with gastritis, 75-94% in patients with benign gastric ulcer, and duodenal ulcer patients. 79% to 90% for gastric cancer and 40% to 60% for gastric cancerH. pyloriCarrier rates (Pak Doo-ho. Peptic ulcer in Koreans).Korean Journal of Internal Medicine 55437-445, 1998). Despite the high carrier rate overall, it is not yet clear why different diseases such as gastritis, gastric ulcer, duodenal ulcer and gastric cancer are caused. It is explained by cytokines, oxygen radicals, and apoptosis (Kim Ju-sung, Hyun-chae Jung, Kim Jung-mok, et al.Helicobacter pyloriInterleukin-8 expression of human neutrophils activated by water soluble proteins.Journal of the Korean Society of Digestive Medicine 32: 435-448, 1998; Yoon Hee-sang, Lee Woo-gon, Lighting Festival, and five others.Helicobacter pyloriContent of 8-hydroxydeoxyguanine in gastric mucosal tissues following infection.Korean Journal of Microbiology 29: 411-419, 1994; Shirin H, Moss SF.Helicobacter pyloriinduced apoptosis.Gut 43592 ~ 594, 1998). On one handH. pyloribracket Some believe that genetic differences in strains may be responsible. E.g,H. pyloriofcagA,vacATo explain the pathogenesis of gastrointestinal diseases according to genetic subtypes (Kersulyte D, Mukhopadhyay AK, Velapatino B,et al.Differences in Genotypes ofHelicobacter pylorifrom different human populations.India. J. Bacteriol. 182: 3210-3218, 2000) Differences in East and West have not been demonstrated. In this regard, the genes that enable the classification of bacteria according to diseases can be said to be unknown.

As such, H. pylori has been recognized as an important human pathogenic bacterium due to its diversity of genomes and its association with clinical diseases, especially stomach cancer (Honda S, Fujioka T, Tokieda M, et al . Development of Helicobacter pylori -induced). gastric carcinoma in Mongolian gerbils.Cancer.Res . 58 : 4255-4259, 1998).

There are many ways to diagnose such H. pylori infection, including non-invasive and invasive methods. Typical non-invasive methods are serological tests, and there are various methods such as ELISA, depending on the antigen and method used (Laheij RJ, Straatman H, Jansen JBMJ, et al . Evaulation of commercially available Helicobacter pylori serology kits: a Review J. Clin. Microbiol. 36 : 2803-2809, 1998). This method provides fast results, but it is not suitable for diagnosis because the specificity is low and the antibody does not fall for 6-12 months despite treatment eradication. In addition, the urea breath test (UBT) is also used, using H. pylori urease, which collects and measures the CO ₂ produced by decomposing the isotopic ¹³ C or ¹⁴ C elements in an exhalation. to be. This is useful for confirming eradication after H. pylori treatment, but there is a risk of exposure to radiation because ¹⁴ C is used to measure the amount of CO ₂ .

On the other hand, the invasive method is to collect the tissue by performing an endoscope, and the tissue thus obtained can be cultured, tested for CLO, and PCR. However, this method is not easy to cultivate bacteria due to factors such as disinfectant used for the extraction site or endoscope disinfection, and therefore, there is a problem that the sensitivity of diagnosis is very low compared to other tests, which makes it difficult to use clinically. CLO inspectionH. pyloriIt uses the properties of urease, a method of observing changes in pH by putting the biopsy tissue in a disposable kit. Another test method using the stomach biopsy tissue PCR method,H. pyloriAlthough several methods are used for detection, they are relatively less established than conventional invasive and non-invasive diagnostics. Different genes have different sensitivity and specificity.

To detect and identify H. pylori by PCR, gene amplification methods have been attempted to encode 26 kDa surface antigens of ureA, ureB, ureC , cagA , vacA, and H. pylori (Moore RA, Kureishi A, Wong S). , et al Categorization of Clinical isolates of Helicobacter pylori on the basis of restriction digest analyses of Polymerase chain reaction-amplified ureC genes J. Clin Microbiol 31:.... 1334~1335, 1993; Strobel S, Bereswill S, Balig P, et al . Identification and analysis of a new vac A genotype variant of Helicobacter pylori in different patient groups in germany.J . Clin.Microbiol . 36 : 1285-1289, 1998; Noh Lim Hwan, Dae Jun Lee, Moon Sook Lee, et al. 9, Diagnosis of Helicobacter pylori infection Role of Direct Polymerase Chain Reaction in Korean Journal of Gastroenterology 31 : 290-297, 1998). These PCR methods are preferred because they are tested in a relatively short time and have high sensitivity and specificity.However, they are disadvantageous because these genes are non-specific and cannot be distinguished according to strains for identification of H. pylori. It became.

In the PCR method, the production of H. pylori- specific primers is a prerequisite, and genes reported to date include 16S rRNA gene, ureC ( glmM ), cagA, and others (Chong SKF, Lou Q, Fitzgerald and Lee CH. Evaluation of 16S rRNA). gene PCR with Primer Hp1 and Hp2 for detection of Helicobacter pylori.J . Clin.Microbiol . 34 : 2728-2730, 1996; Ito Y, Azuma T, Ito S, et al . Analysis and typing of the vacA gene from cagA -Positive strains of Helicobacter pylori isolated in Japan.J . Clin.Microbiol . 35 : 1710-1714, 1997; Garner JA, Cover TL.Analysis of Genetic diversity in cytotoxin-producing and non-cytotoxin-producing Helicobacter pylori strains.J. Infect. . Dis 172: 290~293, 1995; Lage A, Godfroid E, Fauconnier A, et al Diagnosis of Helicobacter pylori infection by PCR:... Comparison with other invasive techniques and detection of cagA gene in gastric biopsy specimens J. Clin Microbiol 33: 2752-2756, 1995) is relatively in the sensitivity and specificity of Wu One that is known. Their sensitivity is 92-100%, but the specificity varies from 69-100% (Mapstone NP, Lynch DA, Lewis FA, et al . Identification of Helicobacter pylori DNA in the mouths and stomachs of patients with gastritis using PCR.Clin.Pathol . 46 : 540-543, 1993; Peek RM, Jr., Miller GG, Tham KT, et al . Detection of Helicobacter pylori gene expression in human gastric mucosa.J . Clin.Microbiol . 33 : 28-32, 1995; Westblom TU, Phadnis S, Yang P, et al . Diagnosis of Helicobacter pylori infection by means of a polymerase chain reaction assay for gastric juice aspirates.CID 16 : 367-71, 1993; Wang JT, Lin JT , Sheu JC, et al . Detection of Helicobacter pylori in gastric biopsy tissue by polymerase chain reaction.Eur . J. Clin.Microbiol.Infect.Dis . 12 : 367-371, 1993; Ho S, Hoyle JA, Lewis FA, et al Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals J. Clin Microbiol 29:.... 2543~2549, 1991). Among these genes, ureC ( glmM ) PCR is known to have the highest diagnostic positive rate (Lu JJ, Perng CL, Shyu RY, et al . Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues.J . Clin.Microbiol 37 : 772-774, 1999).

As mentioned above, in order to diagnose H. pylori infection, the isolates must be cultured and identified. To this end, it is the most reliable method to isolate and culture bacteria from gastric mucosal tissue obtained through endoscopy, but due to the failure of culture depending on the biopsy location, the sensitivity of the bacteria is very low. Accordingly, there is a need for development of an identification method using PCR, which complements the problems of conventional H. pylori identification and is advantageous for clinical application.

An object of the present invention is to overcome the problems of H. pylori identification using conventional PCR, and to easily identify the species of the genus Helicobacter including H. pylori by PCR, and to present a gene specific for Helicobacter spp. And specific primers used for DNA amplification of this gene.

In addition, the present invention is to provide a PCR-restriction analysis (PRA) method that can easily identify the H. pylori among the species of the genus Helicobacter (PCR-restriction analysis; PRA), and an analysis apparatus used therein.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a summary of the location of primers for RNA polymerase β-subunit coding gene ( rpoB ) PCR (HF-HR).

Figure 2 is Helicobacter 4 strains Helicobacter specific for 10 strains of other common bacteriarpoBAfter PCR, the result of electrophoresis on 1.2% agarose gel, Figure 2a is a result for Helicobacter 4 strain, Figure 2b is a result for 10 other bacterial species,

3 is a comparison of the nucleotide sequences of regions (363-bp) except for both primer positions in rpoB DNA (458-bp) of Helicobacters amplified by PCR using HF-HR which is a Helicobacter specific primer according to the present invention. 10 strains of isolated H. pylori strains and other species of Helicobacter showed the rpoB DNA sequences (363-bp) of H. cineide and H. mustele .

Figure 4 shows the amino acid sequence inferred from the rpoB DNA nucleotide sequence (363-bp) of some H. pylori (10 weeks), H. cineade , and H. mustele used in the present invention,

FIG. 5 shows the results of electrophoresis on 1.2% agarose gels by cutting each rpoB PCR product with Tru 9I in H. pylori culture and gastric biopsy tissue (PRA), and FIG. 5A shows H. pylori culture. Fungi, Figure 5b is a result for gastric biopsy tissue,

6 is H. pyloriFor culture and gastric biopsy tissue,rpoBPCR productsBsmFigure 6a shows the results of electrophoresis on 1.2% agarose gel by cutting with FI (PRA).H. pyloriCulture, Figure 6b is the result for gastric biopsy tissue.

In order to achieve the above object, in the present invention, amplification of the rifampin resistance-related site of the RNA polymerase β-subunit coding gene ( rpoB ) from the species of genus Helicobacter Provided is an oligonucleotide for identifying Helicobacter , which can be used as a primer for polymerase chain reaction (PCR).

Here, the primers for PCR for amplifying rpoB DNA fragments from the species of Helicobacter may be oligonucleotides of SEQ ID NOs: 1 and 2.

In addition, in the present invention, a DNA fragment obtained from PCR using the primers in culture or gastric biopsy tissue is cut with restriction enzyme Tru 9I or Bsm FI to measure the size of the fragments, Helicobacter pylori (Helicobacter pylori ) provides an analytical device for identification.

Herein, the DNA fragment obtained from the PCR was cut with restriction enzyme Bsm FI to measure the size of the fragments, which can be used as an analysis device for group identification of Helicobacter pylori .

In the present invention, a RNA polymerase β-subunit coding gene (hereinafter abbreviated as rpoB ) was selected as a gene capable of supplementing the limitation of H. pylori identification using conventional PCR. The rpoB is well conserved like the 16S rRNA gene, and the nucleotide sequence of rifampin resistance and related sites can be identified by the short nucleotide sequence (300-400 bp), reflecting the taxonomic relationship between species. Similar or more useful reports of 16S rRNA gene sequencing have been recently published in Enterobactericeae , Mycobacterium , and Borrelia species (Mollet, C., Drancourt, .. M. & Raoult, D. rpoB sequence analysis as a novel basis for bacterial identification Mol Microbiol 26:.. 1005~1011, 1997; Kim BJ, Lee SH, Lyu MA, et al Idenification of mycobacterial species by comparative sequence analysis of the RNA polymerase gene ( rpoB ) .J . Clin.Microbiol . 37 : 1714-1720, 1999; Lee, SH, Kim BJ, Kim JH et al . Differentiation of Borrelia burgdorferi sensu lato on the basis of RNA polymerase gene ( rpoB ) sequences. J. Clin. Microbiol. 38 : 2557-2562, 2000).

Accordingly, in the present inventionH. pyloriGenus Helicobacter genusHelicobacterBelonging to) The site of the speciesrpoBJust amplify the DNArpoBDNA is a specific primer of genus Helicobacter that prevents amplificationHelicobacterspecific primer) was isolated and isolated from normal or normal gastric-duodenal disease patients.H. pyloriFrom 157 strains and 4 strains of the genus Helicobacter, respectivelyrpoBDNA (458-bp) could be amplified.

As a result of analyzing the nucleotide sequence (363-bp) excluding the primer region of the amplified rpoB DNA, H. pylori species-specific nucleotide sequence was identified in two places, one of which was cleaved by the restriction enzyme Tru 9I and H. pylori This site produces DNA fragments (288-bp, 138-bp) that are characteristic of the bay, which can be used to identify H. pylori . The other position, unlike other organisms, is H. pylori , where the _497th amino acid is Alanin ₄₉₇ or Threonin ₄₉₇ , which is not cut when cutting this position with Bsm FI (458-bp, group A) or 248-bp DNA segment. Is generated (T group), which can also be used to identify H. pylori only. As such, according to the present invention, PCR-restriction analysis (PRA) method for easily identifying H. pylori by performing restriction enzyme analysis on rpoB DNA amplified by PCR by a specific primer of Helicobacter spp. Was developed.

Used in the present inventionH. pyloriFor detection-identificationrpoBPCR and PRA were first performed.rpoBDNA has been introduced in mycobacteria as a novel chronometer and a novel mycobacteria species identification method as a diagnostic target (Kim BJ, Lee SH, Lyu MA,et al. Idenification ofMycobacterialspecies by comparative sequence analysis of the RNA polymerase gene (rpoB).J. Clin. Microbiol. 37: 1714-1720, 1999) The base sequences are registered in Korea as patents (Korean Patent No. 0342975, registered date: September 20, 1999). Target sites are sites that are well conserved between gram-positive and gram-negative bacteria and even eukaryotic counterparts of RNA polymerase II on the amino acid primary structure of the RNA polymerase β-subunit. Species specific primers could be prepared.

This specificity is characterized by the fact that rpoB DNA is amplified from H. pylori and other Helicobacter species (e.g., H. cineid, H. mustele, H. hepaticus , etc.) but is commonly isolated from the human body by E. coli . In general bacteria, such as can be easily proved from the result that there is no PCR product. No foreign reports have been reported on the rpoB nucleotide sequence of H. pylori , but there are only phylogenetic analyzes between Helicobacter and Gram-negative bacteria using rpoD ( δ subunit of bacterial RNA polymerase) (Solnick JV, Hansen LM). , and Syvanen M. The major sigma factor ( RpoD ) from Helicobacter pylori and other gram-negative bacteria shows an enhanced rate of divergence.J. Bacteriol. 179 : 6196-6200, 1997).

As a PRA method, after culturing H. pylori , ureC PCR product (820 bp) was used to identify 44 RFLP types using Sau3 A or Hha I (Shortridge VD, Stone GG, Flamm RK, et al . Molecular typing of Helicobacter pylori isolates from a multicenter US Clinical Trial by ure C restriction fragment length polymorphysm. J. Clin. Microbiol. 35 : 471- 473, 1997). In addition, 16S rRNA rapid identification is was possible in the gene part (1,004 bp) and underwent PRA targeted Kam Philo bakteo (Campylobacter), Arco bakteo (Arcobacter), Helicobacter pylori (Helicobacter) species (species) has been reported (Marshall SM, Melito PL, Woodward DL, et al . Rapid identification of Campylobacter , Arcobacter , and Helicobacter isolates by PCR-Restriction fragment length polymorphism analysis of the 16S rRNA gene.J. Clin. Microbiol. 37 : 4158-4160, 1999).

In Korea, the first attempted phylogenetic analysis of H. pylori culture strains has been published (Lee Seung-hyun, Chang-young Lim, Keun-hwa Lee, et al. 6, Helicobacter pylori rpoB gene sequencing. Korean Journal of Microbiology 34 : 401-408, 1999) In addition, rpoB DNA was not amplified in many isolates in Korea. Accordingly, as a result of attempting to increase the target DNA and increase the number of target H. pylori strains by changing the primers in the present invention, not only all strains collected in Korea but also the rpoB DNA of the species belonging to Helicobacter other than H. pylori can be amplified. It is.

The method of the present invention was applied to the culture of the culture and gastric biopsy tissue of gastric-duodenal disease patients, and compared with the conventional H. pylori detection method CLO test and glm M PCR, the positive rate of H. pylori detection was rpoB PCR As 53.8%, the CLO test (50.4%) and the glm M PCR (48.8%) showed a higher aspect.

Hereinafter, the content of the present invention in more detail.

1. Use Strain

Strains used in the experiments of the present invention are H. pylori 157 strains and Helicobacter cine83 ( H. cinaedi, ATCC 35683) belonging to the species Helicobacter ( H. mustelae, ATCC 43772), and Helicobacter hepaticus ( H. hepaticus, ATCC 51448) was used for 1 week each.

2. H. pylori DNA extraction

H. pylori cultured in Brucella agar medium was collected in a 15 ml test tube containing phosphate buffered saline (pH 7.2), centrifuged at 6,000 × g for 10 minutes, and Sucrose Tris buffer (STE; 8% shoe). Cross, 50 mM EDTA, 0.1% Triton X-100, 50 mM Tris-HCl, pH 8.0). DNA was extracted using a bead beater phenol method using a vitreous sphere. That is, 200 µl of bacterial suspension, 200 µl of vitreous spheres (0.1 mm in diameter, Biospec, glass beads 11079-110) suspended in sterilized tertiary distilled water and 200 phenol-chloroform-isoamyl alcohol solution (50: 49: 1) 200 Was added and shaken at 5,000 rpm for 30 seconds with a mini bead beater (Biospec Cat # 3110BX), followed by centrifugation (12,000 rpm) at 4 ° C. for 15 minutes, and the supernatant transferred to a new tube. 10 μl of 3 M sodium acetate and 250 μl of ice-cold ethanol were added and left at −20 ° C. for 10 minutes, followed by centrifugation at 15,000 rpm for 15 minutes. The precipitate was washed with 70% alcohol, dried at room temperature and dissolved and stored in 60 μl of Tris EDTA buffer (TE; pH 8.0).

3. Polymerase Chain Reaction

(1) rpoB PCR

The UK strain, which is a complete sequence registered in the GenBank H. pylori 26695 (Accession no. AE000625), H. pylori J99 (Accession no.AE001540) American strains, and in the other species (Escherichia coli, Bacillus subtilis, Mycobacterium tuberculosis , Borrelia burgdorferi ), and reverse primer (HF: 5 'ACTTTAACGCATGAAGATAT 3', SEQ ID NO: 1) to amplify all rpoB DNA fragments (458-bp) of 4 species belonging to Helicobacter A primer (Reverse primer. HR: 5 'ATATTTTGACCTTCTGGGGT 3', SEQ ID NO: 2) was designed.

1 is a summary position of the primer for rpoB PCR (HF-HR).

As is already known, B. subtilis (B. subtilis) And E. coli (E. coli)ofrpoBIs It is composed of four conserved domains (C1 to C4) and three variable domains (V1 to V3). Associated with rifampin resistance rif ^r Site (codons 507 to 533,E. colithe translocation primer (HF) and inversion primer (HR) are located at the highly conserved site of C2 (HCR5; 444-454, HCR6; 547-577),H. pyloriAs well as other Helicobacter 4 strainsrpoBPrimers were designed to amplify DNA (458-bp).

PCR was performed using AccuPower PCR PreMix (Bioneer, South Korea) comprising Taq DNA polymerase 1 U, each dNTP 250 μM, 50 mM Tris-HCl, pH 8.3, 40 mM KCl, 1.5 mM MgCl ₂ . 50 cycles of H. pylori DNA prepared as a template and 20 pmol of each primer were added to a tube, and the final volume was adjusted to 20 μl with distilled water, followed by 30 cycles of PCR (Perkin-Elmer Cetus Model 9600): first denaturation. ) 95 ° C. 5 min, denaturation 94 ° C. 30 sec, annealing 52 ° C. 30 sec, extension 72 ° C. 45 sec, final extension 72 ° C. 5 min.

In this manner, rpoB PCR was performed using DNA of four strains of Helicobacter sp. 157 strains of H. pylori and H. cineide , which have already been identified by biochemical methods.

As a result, in all species of HelicobacterrpoBIt was observed to produce a segment (458-bp) product. On the other hand, E. coli, which does not belong to Helicobacter and can be isolated from the oral cavity, the nasopharynx, and the airways,Escherichia coli),S. aureus (Staphylococcus aureus), B. subtilis (Bacillus subtilis), M. Fortuitum (Mycobacterium fortuitum), C. diphtheria (Corynebacterium diphtheriae),B. Qatarihalis (Branhamella catarrhalis),H. Influenza (Haemophilus influenzae), N. Sica (Neisseria sicca), S. Picalis (Streptococcus faecalis), And S. Piogenes (Streptococcus pyogenesPCR product was not observed from the culture DNA ofrpoBFor PCR It can be seen that the primer is specific for the species in the genus Helicobacter.

Figure 2 is Helicobacter 4 strains Helicobacter specific for 10 strains of other common bacteriarpoBAs a result of electrophoresis on 1.2% agarose gel after PCR, FIG. 2A shows the results for Helicobacter 4 strains, and FIG. 2B shows the results for 10 common bacterial species. In Figure 2a, M is the molecular weight labelφX174 RF DNA /HaeIII digests; 1 to 7 are isolated from the patientH. pylori; 8 isH. Cinedy(ATCC35683); 9 isH. Mustela(ATCC 43772); And 10 isH. hepaticus(ATCC 51448). In addition, in Figure 2b, M is the molecular weight labelφX174 RF DNA /HaeIII digests; H isH. pylori(Positive control); 1Escherichia coli; 2 isStaphylococcus aureus; 3 isBacillus subtilis; 4 isMycobacterium fortuitum; 5 isCorynebacterium diphtheria; 6 isBranhamella catarrhalis;7 isHaemophilus influenzae; 8 isNeisseria sicca; 9 isStreptococcus faecalis; And 10 isStreptococcus pyogenesIndicates.

As shown here, rpoB DNA (458-bp) was amplified in Helicobacter strains (lanes 1-10 in FIG. 2A and lane H in FIG. 2B), but amplification products in other bacteria (lanes 1-10 in FIG. 2B). You can see that there is no.

(2) glmM PCR

For comparison with rpoB PCR, previously reported as the best method used for H. pylori detection (Lu JJ, Perng CL, Shyu RY, et al . Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues J. Clin. Microbiol. 37 : 772-774, 1999) A primer for amplifying glmM DNA (294-bp) and a reverse primer (5 'AAGCTTTTAGGGGTGTTAGGGGTTT 3', SEQ ID NO: 3) and an inverted primer (5 'AAGCTTACTTTCTAACACTAACGC 3' , PCR was carried out for 30 cycles according to SEQ ID NO: 4 (denatured 93 ° C. for 1 minute, cooled 55 ° C. for 1 minute, extended 72 ° C. for 1 minute).

4. rpoB DNA sequencing and analysis

The rpoB PCR product was subjected to electrophoresis on a 1.2% agarose gel, and then extracted with a QIAEX gel extraction kit (QIAGEN, Hilden, Germany) to determine the sequencing by an automatic sequencing analyzer. The reaction for sequencing was performed by mixing 60 ng of H. pylori template DNA and 3.2 pmol of each primer in distilled water to make 12 μl, followed by mixing 8 μl of BigDye Terminator RR Mix (Perkin-Elmer Applied Biosystems, Part No. 4303153). 25 cycles were performed at 95 ° C. for 15 seconds, 50 ° C. for 10 seconds, and 60 ° C. for 4 minutes. After completion of the reaction, the PCR product was purified using a QIAEX spin column and subjected to electrophoresis (1 × TBE buffer, 40 W) for 12 hours using a 5% acrylamide gel.

Sequences of the sites (363-bp) except for both primer positions in rpoB DNA (458-bp) amplified by PCR were obtained from H. pylori 26695 (Accession no. AE000625), H. pylori , which were already registered in GenBank. The similarity between each base sequence was measured by alignment with the corresponding parts of J99 (Accession no. AE001540) using the computer program DNASTAR, Multialignment Algorithm of the MegAlign package, and the amino acid (deduced amino acid). Sequences were also analyzed.

3 is a comparison of the nucleotide sequences of regions (363-bp) except for both primer positions in rpoB DNA (458-bp) of Helicobacters amplified by PCR using HF-HR which is a Helicobacter specific primer according to the present invention. The 10 strains of isolated H. pylori strains and other strains of Helicobacter, H. cineide and H. mustele , show rpoB DNA sequences (363-bp).

From here, in other Helicobacter species, including H. cine Edie and H. Moose tele a restriction enzyme site Tru 9I, unlike the H. pylori are distinguished in the different positions. In addition, H. pylori strains with restriction enzymes Bsm FI site It is also shown to be divided into one (A group, 5 strains below) and one (T group, 5 strains above). Tru 9I site is 5 'T ↓ TAA 3'; The Bsm FI site is 5 'GGGAC [N] 10 ↓ 3'.

The similarity (similarity) between H. pylori isolated strains (157 strains) is more than 91.5%, there is a diversity of 8 ~ 9% sequence. In addition, the similarity between H. pylori and other species, such as H. cineide, was 68.3% or less, indicating that the rpoB sequence at the target site was well preserved.

5. By PCR-restriction analysis (PRA) H. pylori Sympathy

The restriction enzyme position on the rpoB sequence of each identified strain was confirmed by DNASTAR's program (Mapdraw program), and Tru 9I and Bsm FI were selected as restriction enzymes capable of cleaving only rpoB DNA of H. pylori but not other strains. It was.

Two selected restriction enzymes ( Tru 9I and Bsm FI) were used according to the manufacturer's instructions. That is, 1 μl of enzyme buffer, 1 μl of the corresponding restriction enzyme (10 U / μl), and 3 μl of distilled water were added to 5 μl of the mixture containing the PCR amplified product so that the final volume was 10 μl. The mixture was mixed well, left at 65 ° C. for 1 hour, taken out and observed by electrophoresis on 1.2% agarose gel.

As shown in FIG. 3, a computer program analysis of the restriction enzyme recognition site on the rpoB DNA sequence of H. pylori 157 strain isolated from Korea confirmed that all strains had one Tru 9I site at a specific position. H. pylori can be distinguished from other Helicobacter species.

In addition, the amino acid sequence inferred from the nucleotide sequence is well preserved unchanged up to K ₄₄₈ -H _568. Unlike the other strains of H. pylori , the 497 amino acid is characterized by A (Alanin) or T (Threonin). Therefore, it could be classified into A group and T group for identification of H. pylori species.

Figure 4 shows the amino acid sequence inferred from the rpoB DNA nucleotide sequence (363-bp) of some H. pylori (10 weeks), H. cineide , and H. mustele used in the present invention. Here, the nucleotide sequence change between each H. pylori strain did not lead to an amino acid change, but only one place, the 497th ( H. pylori numbering) amino acid (▲) T (Threonin, above 5 strains) or A (Alanin, below) 5 strains), and accordingly, H. pylori strains were classified into T group and A group, respectively. These two amino acids are characteristic of H. pylori only.

SEQ ID NO: 5 shows the rpoB DNA sequence (363-bp) of H. pylori separation strain-49 belonging to the T group, and SEQ ID NO: 6 shows the rpoB DNA sequence of H. pylori isolation strain-38 belonging to the A group ( 363-bp).

(1) Identification of H. pylori using Tru 9I

The detection of H. pylori by the presence or absence of PCR products can be directly detected by the culture of human gastric biopsy tissue or by the helicobacter rpoB PCR from the biopsy tissue. However, to further identify H. pylori , restriction enzyme analysis (PRA) can be performed with Tru 9I (Promega, # R7011).

As a result of rpoB PRA ( Tru 9I) targeting 157 strains of H. pylori cultures, H. pylori was cut into 4 fragments of 288-bp, 138-bp, 28-bp and 4-bp as expected. Two segments, 288-bp and 138-bp, could be used to identify H. pylori . Meanwhile, H. Moose telephone used as a control is H. pylori and other sizes of the DNA segment 3 (247-bp, 207-bp , and a 4-bp) was produced. The rpoB PRA ( Tru 9I) results of gastric biopsy tissues also confirmed the presence of H. pylori by identifying two rpoB DNA fragments of 288-bp and 138-bp.

FIG. 5 shows the results of electrophoresis on 1.2% agarose gels by cutting each rpoB PCR product with Tru 9I in H. pylori culture and gastric biopsy tissue (PRA), and FIG. 5A shows H. pylori culture. Bacillus, Figure 5b is the result for gastric biopsy tissue. In FIG. 5A, lanes 1 to 5 show 288-bp and 138-bp DNA fragments characteristic as H. pylori cultures, respectively, but different size segments (247-bp and 207-) in H. mustele of lane 6. bp) can be seen. 5b showing the results of the above biopsy tissue, all specimens show 288-bp and 138-bp DNA fragments, it can be easily seen that they are H. pylori . M in FIG. 5 is φ X174 RF DNA / Hae III digest as molecular weight indicator .

(2) Identification of H. pylori using Bsm FI

It can be identified - through the Bsm FI cutting process after the rpoB PCR targets culture and above biopsy simply classify H. pylori.

That is, as a result of PRA using Bsm FI (BioLabs, R0572S) on the culture, as expected on the base sequence, the A group was not cleaved (458-bp), and the T group was 2 or 3 pieces. (248-bp, 210-bp or 248-bp, 116-bp, 94-bp) was cleaved. In some BsmF I PRAs, 248-bp DNA could be a target of identification, although some strains are divided into three segments with one more Bsm FI cleavage site in the 210-bp DNA segment. Among the 157 strains of domestic isolates used, the ratio of A group and T group was 1: 2, and T group was more common.

The direct identification of the H. pylori group was also possible from the direct biopsy tissue.

6 is H. pyloriFor culture and gastric biopsy tissue,rpoBPCR productsBsmFigure 6a shows the results of electrophoresis on 1.2% agarose gel by cutting with FI (PRA).H. pyloriCulture, Figure 6b is the result for gastric biopsy tissue. 6A, as in lanes 1 to 4BsmFungi that are not cleaved with FI are group A, and in two fragments 248-bp and 210-bp, as shown in lanes 5 and 6 Truncated are bacteria belonging to the T group. In addition, as shown in Figure 6b, amplified in the stomach biopsy tissue as in lanes 2 to 6H. pylori rpoBThe DNA is cut into two pieces, both 248-bp and 210-bp, indicating that they belong to the T group. Lane 1 in FIG. 6B is not truncated as a controlH. pylori rpoBRepresent the PCR product. In addition, M is a molecular weight labelφX174 RF DNA /HaeIII is digest.

6. Patient and Biopsy Tissue DNA Extraction

In order to apply rpoB PCR and PRA to clinical specimens, gastric biopsy tissue from 41 gastritis patients, 42 duodenal ulcer patients, 21 benign gastric ulcer patients and 19 gastric cancer patients was used. Tissues were collected from 5 to 6 within a radius of 3 cm around the upper annulus, two for the CLO test, two for the PCR test, and the other two sections were used for the histological test. DNA extraction from gastric mucosal tissue was performed in the same manner as in the above-described H. pylori culture strain.

7. CLO Test (Rapid Urease Test)

The CLO test kit (BALLARD MEDICAL PRODUCTS U.S. Patent No. 4748113) was refrigerated (2-8 ° C.) and warmed to 30-40 ° C. before use. The gastric biopsy tissue was immediately immersed sufficiently in the gel of the kit, and the gel was resealed and positively read when the color of the gel changed from yellow to nacre within 24 hours.

8. Histopathological Examination

Gastric anterior biopsy tissue of each subject was subjected to hematoxylin-eosin staining (HE staining) and read by microscopic observation.

The following Table 1 compares the H. pylori detection results by simultaneously performing CLO test, rpoB PCR, and glmM PCR on biopsy tissue obtained from 123 patients with gastroduodenal disease. Here, the positive rate of rpoB PCR was 53.8%, which was higher than 50.4% of CLO test and 48.8% of glmM PCR. Concordance rate with clinically popular CLO test was 83.0% for rpoB PCR, slightly higher than 81.3% for glmM PCR, and 85.7% for rpoB PCR based on CLO test. 6.3% higher than 79.4% of glmM PCR. On the other hand, the concordance rate between rpoB PCR and glmM PCR was 78.9%.

CLO inspection (+, n = 63) (-, n = 60) rpoB (+) 54 12 (-) 9 48 glmM (+) 50 10 (-) 13 50

As a result of comparing the three test methods for each disease, rpoB PCR positive rates in gastritis, benign ulcer and gastric cancer were higher than those of CLO or glmM PCR, and lower than CLO only in duodenal ulcer. As a result, the detection rate of H. pylori in the rpoB PCR was higher than that of the CLO test or the glmM PCR. However, there was no statistically significant difference due to the small number of patients ( p > 0.05).

Another characteristic point was that the concordance rate of rpoB PCR and CLO tests in patients with gastric cancer (4 early gastric cancers and 15 advanced gastric cancers) was 73.7%, which was 15.8% higher than 57.9% of glmM PCR.

These results indicate that rpoB PCR is a H. pylori detection-identification method that is inferior to the conventional CLO test or glmM PCR.

The following Table 2 compares the results of H. pylori identification according to the aspects of gastroduodenal disease described above. The numbers in parentheses indicate% and p > 0.05.

Examination and Disease gastritis Duodenal ulcer Benign gastric ulcer Stomach cancer sum CLO inspection 16/41 (39.0) 29/42 (69.0) 13/21 (61.9) 4/19 (21.1) 62/123 (50.4) rpoB PCR 18/41 (43.9) 27/42 (64.3) 14/21 (66.7) 7/19 (36.8) 66/123 (53.7) glmM PCR 16/41 (39.0) 27/42 (64.3) 13/21 (61.9) 4/19 (21.1) 60/123 (48.8)

In other words, rpoB PCR according to the present invention shows a higher positive rate than glmM PCR, as shown in the results of the biopsy tissue, it can be said that it is useful as H. pylori- specific detection-identification method.

The advantages of the H. pylori detection-identification rpoB PCR and PRA method using two restriction enzymes according to the present invention are summarized as follows:

(1) Unlike other methods performed only with cultures, By applying the biopsy tissue directly, SpecificH. pyloriIn addition to the detection and identification, it shows that there is a useful advantage in reducing the incubation time and reducing the cost. That is, what can be found in the gastric biopsy tissue of patients with gastroduodenal diseaseH. pyloriBecause it is most likely to beH. pyloriPCR results with specific primersH. pyloriCan be seen as detected. In addition, for PCR amplification productsTru9I andBsmMore accurate identification can be achieved by conducting a FI restriction enzyme assay.

(2) H. pylori detection-identification and differentiation of genotypes common in Korea can be recognized to recognize that H. pylori is clearly divided into two genotype groups, A and T.

(3) The H. pylori identification method by rpoB PCR according to the present invention is performed in the same patient together with the glmM PCR method, which is the most sensitive and high specificity among the methods currently used, and the CLO test, which is the test method most commonly used in the clinic. The positive rate of rpoB PCR was the highest among 3 methods. rpoB PCR and CLO test showed 83% concordance rate, but there is a problem of false positive and false negative of CLO test itself, so we can not expect 100% concordance rate to be accurate, but it is basically the specificity of H. pylori detection of rpoB PCR It is easy to see that the degree is maintained above 80%. On the other hand, the positive rate of rpoB PCR diagnosis according to disease is similar in gastric-duodenal ulcer but higher than CLO test and glmM PCR in gastritis and gastric cancer. Therefore, it is expected to be useful for the determination of H. pylori infection in gastroduodenal diseases.

Claims (6)

Polymerase chain reaction to amplify the rifampin resistance-related site of RNA polymerase β-subunit coding gene ( rpoB ) from genus Helicobacter species Oligonucleotides for identifying Helicobacter , which can be used as primers for PCR. The oligonucleotide according to claim 1, wherein the PCR primer for amplifying the rpoB DNA fragment from the species of Helicobacter comprises at least one of SEQ ID NOs: 1 and 2. Analysis of Helicobacter pylori identification of DNA fragments obtained from PCR using the primers of claim 1 in culture or gastric biopsy tissue with restriction enzyme Tru 9I or Bsm FI to determine the size of the fragments. Device. The method of claim 3, wherein the analysis device for the identification of the group, Helicobacter pylori (Helicobacter pylori), which cuts the DNA fragments obtained from the PCR with restriction enzyme Bsm FI to measure the size of the fragment. RNA polymerase β- subunit encoding gene of Helicobacter pylori (Helicobacter pylori) belonging to the group of SEQ ID NO: 5 T (RNA polymerase β-subunit coding gene ; rpoB) DNA. RNA polymerase β- subunit encoding gene of Helicobacter pylori (Helicobacter pylori) belonging to the A group of SEQ ID NO: 6 (RNA polymerase β-subunit coding gene; rpoB) DNA.