KR100874744B1 - Deoxyribonucleic Acid Segments of Ribonucleic Acid Polymerase Beta Subunits of Legionella Bacillus, and Primers Selective to the Legionella Bacillus - Google Patents

Abstract

The present invention relates to a segment of Legionella (Legionella) species of RNA polymerase beta subunit (RNA polymeraseβ-subunit (rpoB) ) gene, more particularly, which is used to selectively amplify a specific part of the rpoB gene of Legionella species The present invention relates to a method for discriminating each species of Legionella using primers, rpoB DNA segments of each species having base sequences distinct from each Legionella species, and fragments of such rpoB DNA and their restriction enzyme recognition sites.

In addition, the present invention relates to a primer for selectively amplifying only rpoB DNA of pathogenic Legionella pneumophila and Legionella pneumophila, and to a method for identifying and identifying Legionella pneumophila.

Legionella

Description

DNA fragments which encode RNA polymerase beta-subunit gene of Legionella species, rpoB specific primer and method for the deoxyribonucleic acid fragment of the ribonucleic acid polymerase beta subunit of the Legionella species and selective primers thereof discrimination with them}

1 is a summary position diagram of primers used for Legionella rpoB gene amplification.

Figure 2 shows the PCR results of the rpoB gene segments performed on the species of the genus Legionella and other strains.

3 shows a comparison of pairwise distances between rpoB, 16S rRNA gene, and mip gene.

Figure 4 is a table showing the lineage relationship between Legionella species prepared based on the rpoB base sequence.

Figure 5 is a phylogenetic tree showing the rpoB base sequence of strains Kp1, Kp2, and Kp3 isolated from the patient with the nucleotide sequences of the standard strains.

FIG. 6 shows the results of PCR with primers selective for Legionella pneumophila against Legionella pneumophila and other species of Legionella.

Figure 7 is a result of cleavage with Bam HI after PCR with primers selective to Legionella pneumophila standard strains Legionella pneumophila.

The present invention relates to a segment of RNA polymerase β-subunit (rpoB) DNA of Legionella species, and more particularly, a primer used to selectively amplify a specific site of rpoB DNA of Legionella species, RpoB DNA fragments of each species having base sequences distinct from each other according to each Legionella species, and a method for determining each species of Legionella using these rpoB DNA segments and their restriction enzyme recognition sites.

In addition, the present invention relates to a method for selective discrimination of Legionella pneumophila, and more particularly, to a method for discriminating and identifying a primer and Legionella pneumophila, which selectively amplifies only the rpoB gene of Legionella pneumophila.

Legionella is not only used in artificial environments such as hot water facilities, showers, cooling towers in cooling facilities such as air conditioners, evaporative condensers, humidifiers, therapeutic sprayers, whirlpool spas, respiratory treatment units, decorative fountains, waterworks, It is also detected in natural environments such as rivers, lakes and soils.

Legionella is a gram-negative bacillus without spores and capillaries and is an aerobic bacterium and grows well in BCYE-α medium containing L-cysteine in a 5% CO ₂ incubator. Usually positive for oxidative enzymes and catalase, positive for gelatinase and motility (Winn, WC Legionella , p. 572-582. In Murray, PR (ed.), Mannual of clinical microbiology, 7th ed.American Society for Microbiology, Washington, DC, 1999.). It is also known that mutations in specific regions of these rpoB genes result in rifampin resistance (Severinov, K., Soushko, M., Goldfarb, A. and Nikiforov, V. Rifampicin region revisited. J Biol Chem 268 , 14820-14825, 1993.).

To date, 42 species and more than 60 serotypes are known (Hookey, J. V., Sauders, N. A., Fry, N. K., Birtles, R. J. and Harrison, T. G. Phylogeny of

Legionellaceae based on small-subunit ribosomal DNA sequences and proposal of Legionella lytica comb. nov. for Legionella -like amoebal pathogens. Int J Syst Bacteriol 46, 526-531, 1996 .; Lo Presti, F., Riffard, S., Meugnier, H., Reyrolle, M., Lasne, Y., Grimont, PAD, Grimont, F. Vandenesch, F., Etienne, J., Fleurette, J. and Freney , J. Legionella taurinensis sp. nov., a new species antigenically similar to Legionella spiritensis . Int J Syst Bacteriol 49, 397-403, 1999 .; Swanson, MS and Hammer, BK Legionella pneumophila pathogenesis: a fateful journey from amoebae to macrophages. Annu Rev Microbiol 54, 567-613, 2000 .; Winn, WC Legionella , p. 572-582. In Murray, PR (ed.), Mannual of clinical microbiology, 7th ed. American Society for Microbiology, Washington, DC, 1999.), 21 of which were isolated from patients undergoing immunosuppressive therapy with pneumonia (Fang, GD, Yu, VL and Vickers, RM Disease due to the Legionellaceae (other than Legionella pneumophila). Historical, microbiological, clinical, and epidemiological review. Medicine 68, 116-132, 1989 .; Miyamoto, H., Yamamoto, H., Arima, K., Fujii, J., Maruta, K., Izu , K., Shiomori, T. and Yoshida, S.-I. Development of a new seminested PCR method for detection of Legionella species and its application to surveillance of legionellae in hospital cooling tower water.Appl Environ Microbiol 63, 2489-2494, 1997.).

These Legionella bacteria are known to adhere to mist and enter the alveoli through the human respiratory tract and cause disease. Among them, Legionella pneumophila is the most common and representative cause of Legionellosis. Legionnaires' disease in the case of the United States, accounting for 2-15% of infectious pneumonia requiring hospitalization (Marston, BJ, Lipman, HB and Breiman, RF Surveillance for Legionnairess disease. Arch

Intern Med 154, 2417-2422, 1994 .; Swanson, MS and Hammer, BK Legionella pneumophila pathogenesis: a fateful journey from amoebae to macrophages. Annu Rev Microbiol 54, 567-613, 2000.).

There are several known ways to distinguish these species from the genus Legionella. Different species can be distinguished by differences in fatty acid and ubiquinone components of the cell wall of Legionella bacteria (Waterer, GW, Baselski, VS and Wunderink, RG Legionella and community-acquired).

pneumonia: a review of current diagnostic tests from a clinicians viewpoint. Amer. J. Med. 110: 41-48. 2001 .; Winn, WC Legionella , p. 572-582. In Murray, PR (ed.), Mannual of clinical microbiology, 7th ed. American Society for Microbiology, Washington, DC, 1999).

Biochemical assays to identify species are sometimes used as oxidase, catalase, hippurate hydrolysis, autofluorescent test, or urease test. , KF & Brown, A. Application of numerical systematics to the phenotypic differentiation of Legionellae.J Clin Microbiol 17, 1952-1955. 1999 .; Orrison, LH, Cherry, WB, Fliermans, CB, McDougal, LK & Dodd, DJ Characteristics of environmental isolates of Legionella pneumophila.Appl Environ Microbiol 42, 109-115. 1981 .; Pine, L., Hoffman, PS, Malcom, GB, Benson, RF & Gorman, GW Whole-cell peroxidase test for identification of Legionella pneumophila. J Clin Microbiol 19, 286-290. 1984.

; Weaver, R. E. & Feeley, J. C. Cultural and biochemical characterization of Legionnaires disease bacterium. p.20-25. In G. L. Jones and G. A. Hebert (ed.), Legionnaires, the disease, the bacterium, and methodology. Centers for Disease Control, Atlanta. 1979.). Antisera is also used to identify species and serogroups, which are used by the Centers for Disease Control (CDC) in the United States and the National Institutes of Health in Korea.

However, even in the same species, the changes are not so clear that they are not a definite criterion for distinguishing the species. Even when using rabbit immune serum or using commercially available antiserum (Denka), L. pneumophila serogroup 1-6, L. Only a few species, including dumoffii, L. gormanii and L. micdadei , are known to be identified (Winn, WC Legionella , p. 572-582. In Murray, PR (ed.), Mannual of clinical microbiology, 7th ed. American Society for Microbiology, Washington, DC, 1999.).

Therefore, efforts have been made to solve the problems of the prior art for identifying such species by a new method by genetic analysis. To date, 16S rRNA genes are most commonly used as molecular markers to identify species of bacteria (Woese, CR Bacterial evolution. Microbiol Rev 51, 221-271, 1987 .; Woese, CR, Kandler, O. and Wheelis , ML Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya.Proc Natl Acad Sci USA 87, 4576-4579, 1990.).

However, the heterogeneity of the markers is known to be limited (Wang, Y., Zhang, Z. and Ramanan, N. The Actinomycete Thermobispora contains two distinct types of transcriptionally active 16S rRNA genes.J Bacteriol 179, 3270 -3276, 1997 .; Fogel, GB, Collins, CR, Li, J. and Brunk, CF Prokaryotic genome size and SSU rDNA copy number: estimation of microbial relative abundance from a mixed population.Microb Ecol 38, 93-113, 1999 Ueda, K., Seki, T., Kudo, T., Yoshida, T. and Kataoka, M. Two distinct mechanisms cause heterogeneity of 16S rRNA.J Bacteriol 181, 78-82, 1999 .; Dahllof, I. , Baillie, H. and Kjelleberg, S. rpoB -bas ed microbial community analysis avoids limitations inherent in 16S rDNA gene intraspecies heterogeneity.Appl Environ Microbiol 66, 3376-3380, 2000.). 16S rRNA genes (Fry, NK, Warwick, S., Saunders, NA and Embley, TM The use of 16S ribosomal RNA analyses to investigate the phylogeny of the family Legionellaceae.J Gen Microbiol 137, 1215-1222, 1991 .; Birtles, RJ, Rowbotham, TJ, Raoult, D. and Harrison, TG Phylogenetic diversity of intra-amoebal legionellae as revealed by 16S rRNA gene sequence comparison. Microbiology 142, 3525-3530, 1996 .; Hookey, JV, Sauders , NA, Fry, NK, Birtles, RJ and Harrison, TG Phylogeny of

Legionellaceae based on small-subunit ribosomal DNA sequences and proposal of Legionella lytica comb. nov. for Legionella -like amoebal pathogens. Int J Syst Bacteriol 46, 526-531, 1996.) or mip sequence (Ratcliff, RM, Lanser, JA, Manning, PA and Heuzenroeder, MW Sequence-based classification scheme for the genus Legionella targeting the mip gene.J Clin Microbiol 36, 1560-1567, 1998 .; Ratcliff, RM, Donnelan, SC, Lanser, JA, Manning, PA and Heuzenroeder, MW Interspecies sequence differences in the Mip protein from the genus Legionella : implication for function and evolutionary relatedness.Mol Microbiol 25 , 1149-1158, 1997.) has been attempted to classify by species classification, but even when the species is identified using these genes, there is a known inconsistency (Hookey, JV, Sauders, NA, Fry). , NK, Birtles, RJ and Harrison, TG Phylogeny of Legionellaceae based on small-subunit ribosomal DNA sequences and proposal of Legionella lytica comb.nov.for Legionella -like amoebal pathogens.Int J Syst Bacteriol 46, 526-531, 1996 .; Ratcliff, RM, Donnelan, SC, Lanser, JA, Manning, PA a nd Heuzenroeder, MW Interspecies sequence differences in the Mip protein from the genus Legionella : implication for function and evolutionary relatedness. Mol Microbiol 25, 1149-1158, 1997.). This means that using only one of these genes to determine the lineage of a particular species can lead to a frustrating and erroneous conclusion (Woese, CR Reconstructing bacterial evolution with rRNA, p. 1-24. In Selander, RK, Clark, AG and Whittman, TS (eds.) Evolution at the Molecular Level.Sunderland, MA: Sinauer Associates, 1991 .; Ratcliff, RM, Donnelan, SC, Lanser, JA, Manning, PA and Heuzenroeder, MW Interspecies sequence differences in the Mip protein from the genus Legionella : implication for function and evolutionary relatedness.Mol Microbiol 25, 1149-1158, 1997.).

Among the more than 44 Legionella species known to date, several have been reported to be pathogenic, but the most threatening pathogen is Legionella pneumophila, which has been reported to cause pneumonia. Legionella pneumophila is known to have 15 serogroups, of which Legionella pneumophila serogroup 1 is the most common cause of pneumonia. In addition, L. micdadei, L. bozemanii and L. longbeachae have been reported to cause pneumonia mainly in immunosuppressors.

The most representative disease caused by them is Legionella pneumonia. Legionella pneumonia begins with loss of appetite, malaise, myalgia or headache, and fever up to 39 ~ 40.5 ℃ during the day with chills. A dry cough develops, diarrhea, nausea, vomiting or abdominal pain occurs around 3 days and changes in chest X-rays begin to occur. Initially, local or phacoinvasion occurs, which gradually progresses to both lungs, and respiratory failure develops and becomes fatal. Hypotension is also seen in 17% of locally acquired Legionella pneumonia. Mortality rates are low in community-acquired pneumonia in healthy people but up to 50% in hospital infections. Because chest X-ray findings do not necessarily coincide with clinical symptoms, X-ray pneumonia may continue to worsen even if antimicrobials work. Thoracic X-ray findings may take 1 to 2 months, sometimes 3 to 4 months after symptoms improve. Symptoms other than pneumonia may also occur after heart surgery, including endocarditis, myocarditis, epicarditis, sinusitis, sinusitis, peritonitis, and pyelonephritis.

Therefore, in the art, it is possible to more quickly perform the determination of species through analysis of nucleotide sequences distinguished from each other by Legionella species, and to develop a method capable of accurately examining the presence of an infection and the species in the early stages of infection, and in particular, infection. In order to quickly diagnose infection by Legionella pneumophila, we can detect Legionella pneumophila species from other Legionella species through analysis of nucleotide sequences specific to Legionella pneumophila species, and among Legionella pneumophila species. There has been an urgent need to develop a method for identifying and identifying Legionella pneumophila serogroup1.

Accordingly, an object of the present invention is to provide RNA polymerase β-subunit (rpoB) gene segments which are distinguished from each other according to Legionella species in order to solve the above problems.

Another object of the present invention is to amplify the rpoB gene segment; Determining the base sequence of the amplified gene segment; And, it provides a Legionella species identification method comprising the step of contrasting the base sequence.

Another object of the present invention is to amplify the rpoB gene segment; Adding a restriction enzyme to said gene segment to identify cleavage of specific restriction enzyme recognition sites present in the amplified gene segment; It is to provide a Legionella species discrimination method comprising the step of analyzing the cleavage of the gene segment by the specific restriction enzyme.

Still another object of the present invention is to provide a primer for selectively amplifying a portion of the rpoB gene of Legionella species and a method for identifying and identifying Legionella species using the same.                         

It is still another object of the present invention to provide a primer for selectively amplifying only rpoB DNA of Legionella pneumophila species and a method for identifying and identifying Legionella pneumophila species.

An object of the present invention is the step of selectively amplifying a portion of the rpoB gene of the DNA of Legionella genus 38 species using a primer pair capable of selectively amplifying a portion of the rpoB DNA of Legionella species; Determining the base sequence of the amplified rpoB DNA fragment; It is achieved by providing a method comprising the step of determining each species of Legionella genus in contrast to the base sequence determined above.

In the step of selectively amplifying a part of the rpoB gene of Legionella preferably SEQ ID NO: 43 of the forward primer ^{(5 'GATGATATCGATCAYCTDGG 3')} and SEQ ID NO: reverse primer ^{(5 'CACCNGATACNGGRTTHA 3')} of claim 44 or SEQ ID No. 47 reverse primers ( ^{5 '} TTCVGGCGTTCAATNGGAC ^3' ) can be used. These primers are also used in reactions to analyze the sequencing of fragments of the selectively amplified rpoB gene. In these sequencing reactions, these forward primers and reverse primers are mixed and used.

By judging the base sequence information of each segment obtained by this method with the base sequences of SEQ ID NOs: 1 to 42 of the present specification, it is possible to determine which species the Legionella bacteria to be analyzed belong to. In particular, the primer pairs of SEQ ID NOs: 43 and 44 can be used to determine the genus Legionella species that frequently cause human infection.

Another object of the present invention is to provide a diagnostic reagent for selectively determining the genus Legionella, characterized in that it comprises a primer pair having a nucleotide sequence of SEQ ID NO: 43 and 44, or SEQ ID NO: 43 and 47 will be. In particular, reagents comprising primer pairs of SEQ ID NOs: 43 and 44 can be used to determine Legionella spp. That commonly cause human infection.

Another object of the present invention is achieved by providing the nucleotide sequence of SEQ ID NO: 1 to 42.

One) Legionella adelaidensis (UOEH 13562)

AGTGTTGGTAAAATGGCAGAAAATCAATTCCGTGTTGGGCTTGTTCGTGTTGAAAGAGCGGTAAAAGAGCGCTTGAGTCTTGCTGAATCCGAAAACTTGATGCCACAAGATTTAATTAATGCTAAACCCGTATCTGCTGCTATTAAAGAATTCTTTGGTTCAAGTCAGCTTTCCCAATTTATGGATCAAGTGAATCCTCTATCAGGTGTCACACATAAACGCCGTGTTTCGGCATTGGGGCCAGGTGGACTAACACGTGAAAGAGCAGGATTTGAAGTTCGCGACGTACATACTACCCAC

2) Legionella anisa (ATCC 35292)

AGAGTTGGTGAAATGACAGAAAACCAATTTAGGGTCGGTCTTGTACGTGTTGAACGAGCTGTTAAAGAACGCTTAAGTTTGGTTGAATCTGAAAATCTGATGCCACAAGATTTAATCAATGCAAAACCCGTCTCTGCTGCGATTAAAGAATTCTTTGGCTCAAGCCAGTTATCACAGTTTATGGATCAAGTTAATCCATTATCCGGTGTAACTCACAAACGTAGTGTTTCAGCACTGGGTCCAGGTGGTTTAACACGTGAGCGAGCTGGTTTTGAAGTTCGTGACGTTCACACCACTCAC

3) Legionella birminghamensis  (UOEH 11749)

AGTGTTGGTGAAATGGCTGAAAACCAATTCCGGGTAGGGCTGGTGCGTGTTGAACGCGCAGTGAAGGAACGTCTTAG TCTGGTTGAGTCTGAAAATCTGATGCCTCAGGATCTGATCAATGCCAAGCCTGTGTCAGCTGCAATCAAGGAGTTCTTCGGTTCAAGTCAGTTGTCTCAGTTCATGGATCAGGTCAATCCATTATCTGGTGTAACCCATAAGCGCCGTGTTTCAGCATTAGGCCCAGGTGGATTGACACGTGAAAGAGCTGGATTTGAGGTGCGCGACGTTCACACAACCCAT

4) Legionella bozemanii serogroup 1 (ATCC 33217)

AGTGTTGGTGAAATGACAGAAAACCAATTTAGAGTCGGTCTTGTACGTGTTAAAAGAGCAGTTAAAGAACGTTTAAGTTTGGTTGAATCTGAAAATTTGATGCCTCAAGATTTAATCAATGCAAAACCAGTTTCTGCTGCAATTAAAGAATTTTTTGGCTCAAGCCAGTTATCACAATTTATGGACCAAGTTAATCCATTATCAGGTGTGACACACAAACGTAGGGTTTCTGCATTGGGCCCAGGTGGTTTAACACGTGAACGAGCAGGTTTTGAAGTTCGTGACGTTCATACCACACAC

5) Legionella bozemanii serogroup 2 (ATCC 35545)

AGTGTTGGTGAAATGACAGAAAACCAATTTAGAGTCGGtCTTGTACGTGTTGAAAGAGCGGTTAAAGAACGTTTAAGTTTGGTTGAATCTGAAAATCTGATGCCACAAGATTTAATCAATGCAAAACCAGTTTCTGCTGCGATTAAAGAATTTTTTGGCTCAAGCCAGTTATCACAATTTATGGATCAAGTTAATCCGTTATCGGGTGTAACACACAAACGTAGGGTTTCTGCATTAGGCCCAGGTGGTTTAACGCGTGAACGTGCAGGATTTGAAGTTCGtGACGTCCATACCACACAC

6)  Legionella brunensis  (UOEH 12655)

AGTGTTGGTGAAATGGCAGAAAACCAATTCCGTGTAGGTTTGGTAAGAGTTGAGCGTGCGGTTAAAGAGCGTTTGAGTCTTGTTGAGTCTGAAAATCTAATGCCACAAGATTTAATTAATGCAAAACCTGTTTCTGCTGCTGTGAAAGAATTTTTCGGCTCAAGCCAATTGTCACAATTTATGGATCAGGTTAATCCTCTTTCAGGGGTTACTCATAAGCGTCGTGTTTCA GCTCTTGGCCCAGGTGGTTTGACAAGAGAACGAGCAGGATTTGAGGTGCGTGACGTTCATACGACTCAC

7) Legionella cherrii (UOEH 10742)

AGTGTTGGTAAAATGACTGAAAACCAATTCAGAGTTGGGCTTGTACGTGTAGAACGAGCTGTTAAGGAGCGCTTGAGTTTAGTTGAATCAGAAAATCTTATGCCACAAGATTTAATTAATGCAAAACCTGTTTCAGCTGCAATTAAAGAGTTCTTTGGTTCAAGCCAGTTATCACAATTTATGGATCAGGTTAACCCCTTATCTGGCGTTACCCATAAGCGAAGAGTTTCAGCATTAGGCCCAGGTGGTTTAACACGTGAACGTGCAGGGTTTGAGGTACGTGACGTACATACCACACAC

8) Legionella cincinnatiensis (UOEH 12201)

AGTGTTGGAGAAATGACTGAAAACCAATTTAGGGTTGGTCTTGTTCGCGTTGAAAGAGCAGTTAAAGAACGATTAAGTTTAGTTGAGTCTGAAAATTTAATGCCACAGGATTTAATTAATGCAAAACCTGTTTCTGCTGCAATTAAAGAGTTTTTTGGTTCAAGTCAGTTGTCTCAATTTATGGATCAGGTAAATCCATTATCAGGAGTAACTCATAAGCGAAGAGTATCCGCTTTGGGCCCAGGTGGATTAACTCGTGAACGCGCTGGCTTTGAAGTCCGTGACGTACATACAACACAT

9)  Legionella dumoffii  (ATCC 33279)

AGTGTTGGTGAAATGACCGAAAACCAATTCAGAGTGGGGCTCGTGCGCGTTGAGCGCGCTGTCAAAGAGCGCTTGAGCCTGGTGGAATCTGAAAATTTGATGCCACAAGATTTAATTAATGCGAAACCTGTTTCGGCTGCAATTAAAGAATTCTTCGGTTCCAGTCAGTTATCGCAATTCATGGATCAGGTTAATCCATTATCTGGTGTTACCCATAAGCGCAGGGTTTCTGCATTAGGCCCAGGCGGATTGACACGTGAACGCGCAGGATTTGAGGTTCGTGACGTACATACCACACAC

10) Legionella erythra (ATCC 35303)

AGTGTCGGCGAGATGACAGAAAACCAGTTTCGTGTCGGCTTGGTCCGTGTTGAGCGAGCGGTCAAAGAGCGTTTAAGCCTGGTTGAATCTGAAAATCTGATGCCCCAGGATTTGATTAACGCCAAACCTGTTTCTGCAGCAATCAAAGAGTTTTTTGGTTCTAGCCAGTTATCTCAGTTTATGGATCAGGTTAATCCGCTTTCTGGTGTTACACACAAGCGCCGTGTTTCGGCACTTGGCCCAGGCGGTTTGACTCGTGAACGTGCAGGATTTGAGGTCCGCGACGTTCATACCACTCAT

11) Legionella fairfieldensis  (UOEH 13563)

TCAGTAGGTGAAATGACAGAAAATCAATTTCGCGTGGGGTTGGTTCGAGTTGAGCGTGCTGTAAAAGAACGCCTAAGTCTTGTTGAGTCAGAAAATCTTATGCCGCAAGATTTAATTAACGCCAAGCCTGTGTCTGCAGCTGTGAAAGAATTTTTTGGTTCTAGCCAGTTATCTCAGTTTATGGATCAAGTTAATCCTCTATCAGGTGTTACCCATAAACGCCGCGTTTCGGCCCTTGGTCCAGGTGGTTTAACCAGAGAAAGGGCTGGTTTTGAAGTACGTGACGTTCATACTACTCAT

12)  Legionella feeleii serogroup 1 (ATCC 35072)

AGCGTTGGTGAAATGGCTGAAAACCAATTTCGAGTTGGTTTGGTTCGTGTGGAACGTGCAGTTAAAGAACGTTTGAGTTTAGTCGAATCAGAAAATTTGATGCCGCAGGATCTGATTAATGCTAAACCAGTCTCTGCCGCGATCAAAGAGTTCTTTGGTTCTAGCCAATTATCACAGTTTATGGATCAAGTTAACCCGCTGTCAGGTGTTACTCACAAGCGCCGTGTTTCAGCTCTTGGCCCAGGCGGCTTAACCCGTGAGCGTGCCGGTTTTGAGGTTCGTGACGTTCATACAACGCAT

13) Legionella feeleii serogroup 2 (UOEH 10744)

AGCGTTGGTGAAATGGCTGAAAACCAATTTCGAGTTGGTTTGGTTCGTGTGGAACGTGCAGTTAAAGAACGTTTGAG TTTAGTCGAATCAGAAAATTTGATGCCGCAGGATCTGATTAATGCTAAACCAGTCTCTGCCGCGATCAAAGAGTTCTTTGGTTCTAGCCAATTATCACAGTTTATGGATCAAGTTAACCCACTGTCAGGTGTTACTCACAAGCGCCGTGTTTCGGCTCTTGGCCCAGGCGGCTTAACCCGCGAGCGTGCCGGTTTTGAGGTTCGTGACGTTCATACAACGCAT

14) Legionella geestiana  (ATCC 49504)

AGTGTTGGTGAAATGGCCGAAAACCAGTTCCGCGTGGGCCTTGTACGCGTTGAGCGAGCTGTTAAGGAGCGGCTAAGTCTTGCAGAATCCGAGAATCTGATGCCACAGGATCTCGTTAACGCAAAACCCGTTTCTGCAGCTGTTAAGGAATTTTTTGGTTCAAGCCAGCTGTCGCAATTTATGGATCAGGTGAACCCTCTGTCAGGTGTAACGCATAAACGACGCGTCTCAGCACTTGGACCAGGCGGTCTTACCCGTGAGCGTGCAGGTTTTGAGGTACGGGACGTTCACACTACACAC

15) Legionella gormanii  (ATCC 33297)

AGCGTTGGTGAAATGACTGAAAACCAGTTTAGAGTAGGCCTTGTTCGTGTTGAAAGAGCTGTTAAAGAGCGTTTAAGTTTGGTTGAGTCTGAAAATCTGATGCCTCAAGATTTAATTAACGCAAAACCAGTATCTGCAGCGATTAAAGAGTTTTTTGGTTCCAGCCAGTTGTCACAGTTTATGGATCAAGTAAACCCCTTATCAGGTGTTACCCATAAACGAAGTGTTTCTGCATTAGGCCCAGGTGGTTTAACTCGTGAGCGTGCAGGGTTTGAAGTACGTGACGTACATACAACTCAC

16) Legionella gratiana  (ATCC 49413)

AGCGTCGGTGAAATGACCGAAAATCAATTTAGGGTTGGTTTGGTTCGTGTTGAAAGAGCTGTTAAAGAACGATTAAGCTTAGTAGAGTCCGAAAATCTAATGCCACAGGATTTAATTAATGCTAAACCTGTGTCTGCTGCGATTAAAGAGTTTTTTGGCTCAAGCCAACTATCCCAATTTATGGATCAAGTAAATCCACTATCAGGAGTAACTCATAAACGAAGAGTTTCA GCTTTAGGACCAGGCGGTTTAACTCGTGAGCGTGCTGGCTTTGAAGTTCGTGACGTCCATACTACACAC

17) Legionella hackeliae  serogroup 1 (ATCC 35250)

AGCGTTGGCGAGATGGCTGAAAACCAATTCCGCGTTGGTCTTGTTCGCGTTGAGCGAGCTGTTAAAGAGCGTTTAAGTTTGGTTGAGTCTGAAAACTTAATGCCACAAGATTTAATTAACGCAAAACCAGTTTCGGCTGCGGTGAAAGAATTCTTCGGCTCAAGCCAATTGTCACAATTTATGGATCAAGTAAATCCACTATCCGGGGTAACTCATAAACGTCGTGTTTCAGCGCTTGGCCCAGGTGGTTTAACTAGAGAGCGTGCAGGTTTTGAGGTGCGTGACGTACATACTACTCAC

18) Legionella hackeliae  serogroup 2 (UOEH 11368)

AGCGTTGGCGAGATGGCTGAAAACCAATTCCGCGTTGGTCTTGTTCGCGTTGAGCGAGCTGTTAAAGAGCGTTTAAGTTTGGTTGAGTCTGAAAACTTAATGCCACAAGATTTAATTAACGCAAAACCAGTTTCGGCTGCGGTGAAAGAATTCTTCGGCTCAAGCCAATTGTCACAATTTATGGATCAAGTAAATCCACTATCCGGGGTAACTCATAAACGTCGTGTTTCAGCGCTTGGCCCAGGTGGTTTAACTAGAGAGCGTGCAGGTTTTGAGGTGCGTGACGTACATACTACTCAC

19) Legionella israelensis  (ATCC 43119)

AGCGTTGGTGAAATGACCGAAAATCAGTTTCGTGTGGGATTGGTTCGTGTTGAACGGGCTGTTAAAGAGCGATTGAGTCTTGTGGAATCTGAAAATTTAATGCCACAGGATTTAATTAACGCAAAACCTGTTTCTGCAGCNATAAAAGAATTCTTTGGTTCCAGTCAATTGTCTCAGTTTATGGACCAGGTCAATCCATTATCCGGCGTTACTCATAAACGTAGGGTTTCAGCACTTGGACCAGGAGGTTTAACAAGAGAGCGTGCAGGTTTTGAAGTTCGTGACGTACACACTACCCAT

20) Legionella jamestownensis (ATCC 35298)

AGTGTTGGTGAAATGACTGAGAATCAATTCCGCGTGGGATTGGTAAGAGTTGAACGTGCGGTGAAAGAAAGGTTAAGCCTGGCTGAATCAGAAAGCCTGATGCCGCAGGATTTAATTAACGCCAAGCCTGTATCTGCTGCCATCAAAGAATTTTTTGGCTCAAGTCAGCTTTCCCAGTTTATGGATCAGGTTAATCCCCTGTCAGGTGTCACCCATAAGCGCAGGGTTTCCGCGCTTGGTCCTGGTGGATTGACTCGAGAGCGAGCAGGGTTTGAAGTACGGGACGTACACACTACCCAC

21) Legionella jordanis  (HM 7000)

AGCGTAGGTGAAATGGCTGAAAACCAATACCGCGTGGGTTTAGTCCGTGTGGAAAGAGCGGTCAAAGAACGCTTAAGTCTTGTTGAATCTGAAAATCTTATGCCACAAGATTTAATTAATGCAAAACCCGTTTCAGCGGCAATCAAAGAGTTCTTTGGTTCAAGTCAGCTTTCCCAATTTATGGATCAGGTTAATCCACTATCTGGAGTAACCCATAAACGCCGTGTATCAGCTCTTGGTCCAGGCGGATTAACGCGTGAACGTGCTGGATTTGAAGTTCGTGACGTTCATACCACTCAC

22) Legionella lansingensis  (ATCC 49751)

AGTGTAGGTGAAATGGCGGAAAACCAATTCCGGGTTGGCCTTGTAAGGGTTGAACGAGCTGTCAAGGAACGTTTAAGCTTGGTGGAATCCGAAAATTTGATACCGCAAGATTTAATCAACGCAAAACCTGTTTCTGCTGCAGTAAAAGAATTCTTTGGTTCAAGTCAATTGTCGCAATTTATGGATCAAGTTAACCCCTTATCAGGTGTTACACACAAGCGACGTGTTTCTGCTCTTGGTCCAGGTGGATTGACAAGAGAGCGAGCTGGATTTGAGGTTCGTGACGTACACACGACTCTC

23) Legionella londiniensis  (ATCC 49505)

AGTGTTGGTGAAATGACTGAGAATCAATTCCGCGTGGGATTGGTAAGAGTTGAACGTGCGGTGAAAGAAAGGTTAAG CCTGGCTGAATCAGAAAGCCTGATGCCGCAGGATTTAATTAACGCCAAGCCTGTATCTGCTGCCATTAAGGAATTTTTTGGCTCAAGTCAGCTTTCCCAGTTTATGGATCAGGTTAATCCCCTGTCAGGTGTCACCCATAAGCGCAGGGTTTCCGCGCTTGGTCCTGGTGGATTGACGCGAGAGCGAGCAGGGTTTGAAGTACGGGATGTACACACTACCCAC

24) Legionella longbeachae  serogroup 1 (ATCC 33462)

AGCGTTGGTGAAATGACTGAAAACCAATTTAGAGTTGGTCTTGTACGCGTTGAAAGAGCAGTTAAAGAGCGATTGAGTTTAGTTGAATCTGAAAATTTAATGCCTCAAGATTTAATTAATGCAAAACCGGTTTCTGCTGCGATTAAGGAATTTTTTGGTTCAAGTCAGTTATCTCAATTTATGGATCAAGTAAATCCACTATCAGGTGTAACGCATAAGCGCAGGGTATCAGCTTTGGGCCCAGGTGGATTGACTCGAGAGCGTGCTGGCTTTGAAGTCCGTGACGTACATACCACCCAC

25) Legionella longbeachae  serogroup 2 (ATCC 33484)

AGCGTTGGTGAAATGACTGAAAACCAATTTAGAGTTGGTCTTGTACGCGTTGAAAGAGCAGTTAAAGAGCGATTGAGTTTAGTTGAATCTGAAAATTTAATGCCTCAAGATTTAATTAATGCAAAACCGGTTTCTGCTGCGATTAAGGAATTTTTTGGTTCAAGTCAGTTATCTCAATTTATGGATCAAGTAAATCCACTATCAGGTGTAACGCATAAGCGCAGGGTATCAGCTTTGGGCCCAGGTGGATTGACTCGAGAGCGTGCTGGCTTTGAAGTCCGTGACGTACATACCACCCAC

26) Legionella maceachernii (ATCC 35300)

TCTGTAGGTGAGATGGCTGAAAATCAATTTCGGGTTGGATTGGTGAGAGTTGAGCGCGCCGTTAAAGAGCGGTTAAGTCTTGTAGAGTCTGAAAATTTAATGCCTCAGGATTTAATTAATGCCAAACCAGTCTCTGCCGCAGTGAAAGAGTTCTTTGGATCTAGCCAGTTATCGCAGTTTATGGATCAAGTTAACCCACTTTCTGGAGTCACTCATAAACGACGTGTTTCT GCACTTGGCCCAGGTGGCTTAACCCGAGAACGTGCTGGCTTTGAAGTGCGTGACGTGCATACGACACAC

27) Legionella micdadei  (ATCC 33218)

tCAGTTGGTGAAATGGCTGAAAACCAGTTTCGAGTCGGATTAGTCAGGGTTGAGCGCGCTGTTAAGGAACGTTTAAGTCTAGTAGAGTCCGAAAACTTGATGCCTCAAGATCTAATAAACGCTAAACCAGTTTCAGCTGCAGTGAAAGAGTTTTTCGGGTCCAGTCAGCTATCACAATTCATGGACCAAGTTAACCCACTATCCGGCGTCACTCACAAACGGCGCGTTTCTGCACTGGGCCCAGGCGGTTTAACTCGAGAGCGAGCGGGTTTTGAAGTGCGTGACGTGCATACTACCCAT

28) Legionella moravica  (ATCC 43877)

AGTGTTGGCGAGATGGCTGAAAATCAATTCAGAGTTGGTTTGGTGCGCGTTGAACGAGCAGTCAAAGAACGTTTGAGCCTTGTAGAATCTGAAAATCTGATGCCACAAGACCTAATCAATGCCAAGCCAGTATCTGCAGCAGTAAAAGAGTTTTTTGGATCCAGCCAATTATCGCAGTTTATGGATCAGGTAAATCCTCTATCAGGAGTTACTCATAAACGACGTGTTTCTGCACTAGGCCCAGGTGGATTGACCAGAGAGCGAGCTGGTTTTGAAGTACGTGACGTACATACCACTCAC

29) Legionella nautarum  (ATCC 49506)

TCAGTAGGAGAAATGGCAGAAAACCAATTCCGAGTTGGTTTAGTAAGAGTGGAACGAGCTGTGAAAGAGCGTTTAAGTCTTGTCGAGTCAGAAAATTTGATGCCTCAAGATTTAATTAACGCTAAACCAGTTTCTGCAGCTGTAAAAGAATTTTTCGGCTCTAGCCAGTTATCACAGTTTATGGATCAGGTTAATCCACTCTCTGGAGTAACTCACAAACGCCGTGTTTCAGCACTTGGCCCCGGTGGTTTAACTCGCGAACGCGCTGGTTTTGAAGTGCGTGACGTTCATACTACCCAC

30) Legionella oakridgensis  (HM 7002)

AGTGTTGGTGAAATGACCGAAAACCAATTTAGAGTTGGTCTTGTTCGTGTTGAACGGGCTGTAAAAGAACGCTTAAGCTTGGTTGAATCTGAAAATCTGATGCCACAGGACTTAATTAACGCAAAACCAGTTTCTGCCGCAATTAAAGAATTTTTTGGTTCCAGTCAATTATCCCAATTTATGGACCAAGTGAATCCATTATCTGGTGTCACACACAAACGACGGGTTTCAGCGCTGGGTCCAGGTGGTTTAACACGTGAACGGGCTGGCTTTGAAGTTCGTGACGTTCATACCACGCAC

31) Legionella parisiensis  (UOEH 11745)

AGTGTTGGTGAAATGACAGAAAACCAATTTAGAGTCGGACTTGTACGTGTTGAAAGAGCGGTTAAAGAACGTTTAAGTTTGGTTGAATCTGAAAATCTGATGCCACAAGATTTAATCAATGCAAAACCAGTTTCTGCTGCGATTAAAGAATTTTTTGGCTCAAGCCAGTTATCACAATTTATGGATCAAGTTAATCCGTTATCGGGTGTAACACACAAACGTAGGGTTTCTGCATTAGGCCCAGGTGGTTTAACGCGTGAACGTGCAGGATTTGAAGTTCGCGACGTTCATACCACACAC

32) Legionella pneumophila  serogroup 1 (ATCC 33152)

AGTGTTGGCGAAATGACCGAAAATCAGTTTAGAGTAGGTCTTGTTCGAGTTGAACGTGCTGTTAAAGAGCGCTTAAGTTTGGTTGAATCTGAAAATCTGATGCCACAGGACTTAATTAACGCAAAACCAGTATCCGCCGCAATTAAAGAGTTTTTTGGATCCAGTCAGTTATCACAGTTTATGGATCAAGTGAATCCATTATCTGGTGTTACGCATAAAAGACGTGTATCAGCTCTTGGGCCAGGTGGTTTAACACGTGAGCGGGCTGGATTTGAAGTCCGTGACGTACATACAACTCAC

33) Legionella quinlivanii (ATCC 43830)

AGAGTTGGTGAAATGACCGAAAATCAGTTTAGAGTTGGTTTGGTTCGTGTTGAACGAGCTGTTAAAGAGCGTTTAAG CCTGGTTGAATCTGAAAATCTGATGCCTCAGAACTTGATTAATGCCAAGCCTGTATCTGCGGCTATTAAAGAATTTTTCGGATCCAGTCAGTTATCGCAATTTATGGATCAGGTTAACCCTTTATCGGGAGTGACCCATAAACGCCGTGTTTCAGCACTTGGCCCAGGTGGACTCACCCGTGAACGAGCCGGCTTTGAAGTCCGTGACGTTCACACTACTCAT

34) Legionella rubrilucens  (ATCC 35304)

AGCGTGGGTGAAATGACGGAAAACCAGTTCCGTGTTGGTTTAGTTCGTGTTGAGCGTGCGGTCAAAGAGCGTTTAAGCCTGGTTGAATCTGAAAATCTGATGCCCCAGGATTTGATAAACGCAAAGCCTGTTTCTGCCGCAATCAAAGAATTTTTTGGCTCAAGCCAGTTATCGCAGTTTATGGATCAGGTTAACCCGCTTTCCGGAGTGACTCACAAAGCGCGTGTTTCAGCCCTTGGGCCAGGCGGGTTAACTCGAGAACGCGCAGGATTTGAAGTCCGTGACGTTCACACCACTCat

35) Legionella sainthelensi  (ATCC 35248)

AGTGTCGGTGAAATGACTGAAAATCAATTTAGGGTAGGACTTGTTCGTGTTGAAAGAGCAGTTAAAGAGCGACTAAGTTTAGTTGAATCTGAAAATTTAATGCCGCAAGATTTAATAAATGCAAAACCGGTTTCAGCAGCGATTAAAGAATTTTTTGGTTCAAGTCAGTTATCTCAATTTATGGATCAAGTAAACCCATTATCAGGGGTAACTCATAAACGCAGAGTCTCTGCTTTGGGACCAGGCGGTTTGACACGTGAACGTGCTGGCTTTGAAGTCCGTGACGTCCATACCACACAC

36) Legionella santicrucis  (UOEH 11746)

AGTGTTGGTGAAATGACAGAAAACCAATTTAGGGTTGGTCTTGTTCGCGTTGAAAGAGCAGTTAAAGAGCGACTAAGTTTAGTTGAATCTGAAAACTTAATGCCACAAGATTTAATTAATGCAAAGCCTGTTTCTGCTGCAATTAAAGAGTTTTTTGGTTCAAGTCAGTTATCCCAATTTATGGATCAAGTAAATCCATTATCAGGTGTAACCCATAAGCGAAGAGTATCT GCTTTAGGCCCAGGCGGATTAACTCGTGAACGCGCTGGCTTTGAAGTCCGTGACGTACATACAACGCAT

37) Legionella shakespearei  (ATCC 49655)

AGTGTTGGCGAAATGGCAGAAAACCAGTTCAGAGTTGGTTTGGTACGTGTTGAGCGTGCTGTTAAGGAGCGTCTGAGTCTGGTTGAGTCCGAAAATCTGATGCCTCAGAATTTGATCAATGCCAAACCTGTATCTGCTGCTGTTAAAGAGTTCTTTGGTTCGAGCCAGTTATCACAATTTATGGATCAGGTTAATCCTTTATCAGGTGTGACACACAAGCGAAGAGTTTCAGCATTAGGCCCAGGTGGTTTGACACGTGAGCGTGCCGGATTTGAAGTTCGTGACGTACATACAACTCAC

38) Legionella spiritensis  (UOEH 11199)

AGCGTTGGCGAGATGACTGAAAATCAATTCAGAGTCGGGTTGGTAAGAGTCGAGCGCGCCGTAAAAGAACGGTTAAGTCTGGTAGAGTCCGAAAATTTAATGCCTCAGGACTTGATCAATGCCAAGCCGGTCTCCGCCGCTATCAAGGAATTTTTTGGCTCAAGCCAGCTCTCGCAATTTATGGATCAAGTTAATCCATTGTCCGGGGTTACTCATAAGCGACGGGTTTCAGCGCTTGGCCCGGGTGGCTTGACTCGTGAACGGGCCGGATTCGAAGTTCGGGATGTGCATACCACTCAC

39) Legionella steigerwaltii  (UOEH 11747)

AGCGTTGGTGAAATGACTGAAAACCAATTCAGAGTCGGCCTTGTACGTGTTGAAAGAGCGGTAAAAGAGCGGTTGAGTCTGGTTGAATCTGAAAATCTTATGCCACAAGATTTAATTAATGCCAAACCGGTTTCTGCTGCTATTAAAGAGTTTTTTGGTTCAAGCCAATTATCACAATTTATGGATCAGGTTAACCCATTATCTGGTGTTACCCATAAAAGAAGGGTTTCTGCATTAGGCCCAGGTGGTTTAACACGAGAACGTGCAGGATTTGAGGTTCGTGACGTACATACAACACAC

40) Legionella tucsonensis ( ATCC 49180)

AGTGTTGGTGAAATGACAGAAAACCAATTTAGAGTTGGTCTTGTACGTGTTGAAAGGGCTGTAAAAGAACGTCTAAGCTTGGTTGAGTCTGAAAATCTGATGCCACAGGATTTAATTAATGCAAAACCAGTTTCTGCTGCAATTAAAGAATTTTTTGGTTCAAGTCAATTATCCCAATTTATGGACCAAGTTAATCCATTATCTGGTGTCACACACAAACGTCGGGTTTCAGCGTTGGGTCCAGGTGGTTTAACACGTGAACGGGCTGGCTTTGAAGTTCGTGACGTTCATACCACACAC

41) Legionella wadsworthii  (ATCC 33877)

AGCGTAGGTGAAATGACTGAAAACCAATTCCGAGTTGGTTTGGTGCGTGTTGAAAGAGCTGTGAAGGAACGTTTAAGTCTTGTCGAATCAGAAAATTTAATGCCTCAAGATTTAATTAACGCCAAGCCTGTTTCTGCTGCAATTAAAGAGTTTTTTGGCTCTAGCCAACTGTCCCAATTCATGGATCAGGTAAATCCCTTATCCGGTGTGACACATAAGCGCAGAGTATCCGCTTTAGGCCCAGGTGGATTAACAAGAGAGCGCGCAGGCTTCGAAGTACGCGACGTTCATACAACCCAT

42) Legionella worsleiensis  (ATCC 49508)

AGTGTTGGCAAGATGACAGAAAACCAGTTCAGAGTTGGTTTAGTTCGAGTTGAACGTGCTGTTAAAGAACGCTTGAGTCTTGTTGAGTCTGAAAACTTGATGCCACAGGATCTCATTAATGCCAAACCTGTTTCGGCTGCAGTTAAAGAGTTTTTTGGTTCCAGTCAGTTATCCCAGTTTATGGATCAGGTTAATCCATTATCCGGTGTAACTCATAAACGACGTGTTTCTGCATTAGGCCCAGGCGGTCTGACTCGTGAGCGAGCAGGGTTTGAGGTTCGTGACGTTCACACAACACAC

The base sequences of SEQ ID NOs: 1 to 42 are composed of 34 partial segments of the rpoB gene of 34 species of Legionella and 8 partial segments of the rpoB gene of each of two subspecies of 4 other strains of Legionella. Based on these 42 base sequences, the lineage relationship of the Legionella species to be analyzed can be analyzed (see FIG. 4).

Still another object of the present invention is to prepare a rpoB DNA segment of Legionella by amplifying a portion of Legionella rpoB DNA; It is achieved by providing a bacterial species discrimination method comprising the step of treating the rpoB DNA fragment by the specific restriction enzyme by treating a specific restriction enzyme to the gene fragment prepared above.

Also in this type of species determination method, a portion of the legionella bacterium rpoB DNA to be judged is mixed with a forward primer of SEQ ID NO: 43 and a reverse primer of 44 or 47, and the fragment is amplified. A restriction enzyme specified according to the present invention is added to determine whether or not a site to be cleaved by the restriction enzyme exists to determine which species the Legionella bacterium to be analyzed belongs to.

For each Legionella species, the cleavage and site of restriction enzymes were different, so the amplified fragments were treated with a specific restriction enzyme (RFLP-Restriction Fragment Length Polymorphism), and the treated mixture was subjected to electrophoresis. The species of Legionella can be determined according to the size of the cut segment and the number of separated bands. In particular, the method of treating fragments amplified using the primers of SEQ ID NO: 43 and SEQ ID NO: 44 with restriction enzymes can be used to determine Legionella bacteria that commonly cause human infection.

Another object of the present invention is achieved by providing a primer pair having the nucleotide sequences of SEQ ID NOs: 45 and 46 which selectively amplify only rpoB DNA of Legionella pneumophila species.

^{5 '} TCAGTTTAGAGTAGGTCTT ^3' , ^{5 '} CCCAAGRGCCGATACACG ^3'

Primer pairs having the nucleotide sequences of SEQ ID NOs 45 and 46 that selectively amplify only rpoB DNA of Legionella pneumophila species identified their characteristic base sequences from the base sequences of Legionella pneumophila of SEQ ID NO: 32, resulting in Legionella pneumo Primer pairs were prepared to selectively amplify some segments of the rpoB gene of Philae species.

It is another object of the present invention to provide a diagnostic reagent for selectively discriminating Legionella pneumophila, comprising primer pairs having the nucleotide sequences of SEQ ID NOs: 45 and 46.

Another object of the present invention is achieved by providing a method for detecting and identifying Legionella pneumophila species comprising amplifying an rpoB DNA segment of Legionella pneumophila species.

In this case, in the step of selectively amplifying a portion of the rpoB DNA of Legionella pneumophila species, the forward primers ( ^{5 '} TCAGTTTAGAGTAGGTCTT ^3' ) and the reverse primers ( ^{5 '} CCCAAGRGCCGATACACG ^3' ) of SEQ ID NOs: 45 and 46 are used. Can be.

Since the primer selectively amplifies only a portion of the rpoB gene of Legionella pneumophila species, it is possible to selectively detect and identify Legionella pneumophila species from other species of Legionella. By performing PCR using the primer pairs described above, only rpoB DNA fragment (217-bp) of Legionella pneumophila is amplified and other Legionella species can selectively detect and identify Legionella pneumophila.

Another object of the present invention is to amplify the rpoB DNA segment of Legionella pneumophila species; Adding a specific restriction enzyme to said gene segment to identify cleavage of the specific restriction enzyme recognition site present in the rpoB DNA segment of the amplified Legionella pneumophila species; It is achieved by providing a Legionella pneumophila subspecies discrimination method comprising analyzing whether the gene segment is cleaved by the specific restriction enzyme.

delete

Since Legionella pneumophila species have different recognition sites for specific restriction enzymes present in rpoB DNA fragments, they were added to the amplified rpoB DNA fragments (RFLP-Restriction Fragment Length Polymorphism). Subspecies can be determined.

PCR with the primers selective for Legionella pneumophila amplified the 217-bp rpoB DNA fragment, followed by cleavage by Bam HI restriction enzyme, all other strains were cut to 136-bp and 81-bp DNA. Intercepts are shown, but only serogroups 4, 5, and 15 remain uncut. Through these three strains, subsp. fraseri and the rest are subsp. It can be determined that the strains belong to pneumophila .

Hereinafter, the configuration of the present invention will be described in more detail with reference to Examples, but the scope of the present invention is not limited to the following Examples.

Example 1 : Strains Used

A total of 38 strains of Legionella related strains were used (see Table 1). GenBank-registered 16S rRNA gene and mip sequence were used to compare strains between strains. Isolates were used as biochemical assays as strains isolated from Korean patients (3 weeks; Kp1, Kp2, Kp3) or in the environment (76 weeks). Control species for testing the specificity of PCR include, as Legionella strains, Bacillus subtilis , Bacteroides fragilis , Branhamella catarrhalis , Corynebacterium diphtheriae , Escherichia coli , Haemophilus influenzer pylori , Helicobacter spp . , Mycobacterium fortuitum , Neisseria sicca , Staphylococcus aureus , Streptococcus faecalis , Streptococcus pyogenes ).

Example 2:   DNA extraction from each species

DNA extraction was performed using a bead beater phenol extraction method (Kim et al ., 1999). 100 μl of bacterial suspension is placed in a 2.0 ml screw-capped microcentrifuge tube and 100 μl of phenol-chloroform-isopropyl alcohol (50: 49: 1) and 100 μl (packed volume) of Glass beads were added and the tube was shaken (5,000 rpm) for 30 seconds on a mini bead beater to disrupt bacteria. The tube was again centrifuged for 10 minutes at 15,000 rpm and the supernatant was transferred to a new tube. DNA was precipitated with the same volume of isopropyl alcohol, dissolved in 60 μl of distilled water, and used for PCR.

Example 3 : Amplification by PCR of rpoB gene

Rifampin resistance ( rif ^r ) region (Severinov et al ., 1993; Kim et al . From the rpoB sequences such as Escherichia coli (Acession no. V00340), Coxiella burnetii (U86688), and L. pneumophila (AF087812) registered in GenBank. ., 1999;. Nielsen et al , 2000) DNA (369-bp) segment is selected Legionella to amplification of SEQ ID No. 43 and the primer of claim ^{47 (5 'GATGATATCGATCAYCTDGG 3',} 5 'TTCVGGCGTTCAATNGGAC 3' containing a) Was produced.

As is already known, rpoB of B. subtilis and E. coli It consists of four conserved domains (C1 to C4) and three variable domains (V1 to V3). Forward primer and reverse in the highly conserved region of C2 , including the rif ^r site associated with rifampin resistance (codons 507-533, E. coli numbering) ( HCR5 ; 444-454, HCR6; 547-577) The primer was placed (see Figure 1).

PCR consists of 50 ng of template DNA and 20 pmol of each primer, 1 unit of Taq DNA polymerase, 250 μM of each deoxynucleoside triphosphate, 50 mM of Tris-HCl (pH 8.3), KCl 40 mM, MgCl ₂ Put in a vessel containing the PCR reaction mixture containing 1.5 mM, and gel loading dye (AccuPower PCR PreMix; Bioneer, Korea) to distilled water to a final volume of 20 μl, using a 9700 Thermocycler (Perkin-Elmer Cetus) Thirty cycles were performed (denaturation 95 ° C. 30 sec, annealing 55 ° C. 30 sec, extension 72 ° C. 1 min, final extension 72 ° C. 5 min).

Amplification products were identified by electrophoresis on 1.5% agarose gel and purified by QIAEX II gel extraction kit (QIAGEN, Hilden, Germany) for sequencing.

Example 4 : Base Sequence Determination of rpoB Gene

   Purified PCR products were directly determined by forward and reverse primers using Applied Biosystems model 377 automated sequencer and BigDye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems, Warrington, United Kingdom). Sequencing reactions were mixed with 30 ng of purified PCR product, 2.5 pmol of each primer, and 4 μl of BigDye Terminator RR mix (Perkin-Elmer Applied Biosystems; part no. 4303153) and the final volume was 10 μl with distilled water. The reaction was carried out for 30 cycles with 5% (vol / vol) dimethyl sulfoxide in one cycle of 95 ℃ 15 seconds, 50 ℃ 5 seconds, and 60 ℃ 4 minutes.

The rpoB DNA sequence homology between Legionella hepatic species ranged from 71.0% (L.geestiana-L. Spiritensis) to 98.7% (L. jametownensis-L. Londiniensis). The rpoB sequence shows the systematic relationship between each species, so that in order to be useful for identification, that is, discrimination of species, each sequence must be well maintained and there must be little change according to the species. Therefore, the pairwise distance was examined by comparing the divergence of rpoB DNA with the 16S rRNA gene and mip sequence previously used (see FIG. 3). The rpoB sequence divergence was 3.5 times larger than that of the 16S rRNA gene, which means that the rpoB had a little change, and that the mip sequence was 1.5 times larger than that of rpoB, indicating that the rpoB sequence had the proper discrimination ability for Legionella species discrimination. It can be seen that.

The strains used were identified by biochemical tests, but the amplification and sequencing of 400-bp of 3 'end of 16S rRNA gene by PCR was confirmed to be Legionella species compared with the nucleotide sequences registered in GenBank (Hookey et al. ., 1996). The determined sequences are shown in SEQ ID NOs: 1-42.

Example 5 : Systematic Analysis

rpoB In order to show that the nucleotide sequence is useful for classifying and identifying Legionella species, the lineage of Legionella strains was analyzed by the nucleotide sequence corresponding to 300-bp among 369-bp rpoB DNA fragments amplified by PCR. These sequences were registered in GenBank (see Table 1).

These sequences were sequenced by CLUSTAL X (Thompson et al ., 1997), a multi-alignment program, and the tree tree by the neighbor-joining (NJ) method (Saitou & Nei, 1987) and parsimony method (Swofford, 1999) of the PAUP program. phylogenetic tree). In the NJ method, the pairwise distance was calculated as the maximum likelihood option and heuristic search was performed in the parsiomony analysis. The tree bisection reconstruction (TBR) branch swapping option was selected. Coxiella burnetii , the causative agent of Q fever, was used as an out-group and branch supporting value was obtained by 1000 bootstrap replication (Felsenstein, 1985; Hillis & Bull, 1993). Each species was well branched, and similar species were clustered closer to each other in comparison with conventional phenotypes such as autofuorescence, fatty acid components of cell walls, and ubiquinone groups (see FIG. 4). The bottom ruler of FIG. 4 is the number of inferred substitutions per site. The autofluorescence of each species (BW, brown-white; YG, yellow-green; R, red), ubiquinone group (A to F), and fatty acid group (I to IV) are indicated to the right of the corresponding Legionella species.

RpoB of Kp1, Kp2, and Kp3 isolates from Korean patients All of the base sequences were L. pneumophila subsp. It can be seen that the pneumophila clusters with these strains so that the strains are easily isolated from L. pneumophila subsp. pneumophila was identified (see FIG. 5).

We also compared rpoB, 16S rRNA gene, and mip data sets with each other. In FIG. 3, the points on the graph represent pairwise distances of each Legionella species and Coxiella burnetii used as an out-group. (A) rpoB and 16S rRNA gene, (B) mip and 16S rRNA gene, and (C) rpoB and mip were compared. The mip and 16S rRNA genes (B) show a linear relationship, whereas the rpoB and 16S rRNA genes (A) and rpoB and mip (B) show a nonlinear relationship. This means that rpoB has frequently undergone similar variations at the DNA level. The pairwise distance was calculated using the maximum likelihood option of PAUP (Swofford, 1999), and this analysis was performed using the PAUP program (Swofford, 1999).

Legionella standard strains used in the present invention      Species Abbreviation       Serogroup        Strain L. pneumophila pn ^§         sg-1 ATCC 33152 (Philadelphia 1)         sg-1 ATCC 33153 (Knoxville 1)         sg-1 SF9         sg-1 ATCC 43109 (OLDA)         sg-2 ATCC 33154 (Togus 1)         sg-3 ATCC 33155 (Bloomington 2)         sg-4 ATCC 33156 (Los Angeles 1)         sg-5 ATCC 33216 (Dallas 1E)         sg-6 ATCC 33215 (Chicago 2)         sg-7 ATCC 33823 (Chicago 8)         sg-8 ATCC 35096 (Concord 3)         sg-9 ATCC 35289 (International 23)         sg-10 ATCC 43283 (Leiden 1)         sg-11 ATCC 43130 (797-PA-H)         sg-12 ATCC 43290 (570-CO-H)         sg-13 ATCC 43736 (82A3105)         sg-14 ATCC 43703 (1169-MN-H)         sg-15 ATCC 35351 (Lansing 3) L. adelaidensis          ad UOEH 13562 (1762-AUS-E) L. anisa *          an ATCC 35292 (WA-316-C3) L. birminghamensis *          bi UOEH 11749 (1407-AL-H) L. bozemanii *          bo         sg-1 ATCC 33217 (WIGA)         sg-2 ATCC 35545 (Toronto 3) L. brunensis          br UOEH 12655 (444-1) L. cherrii *          ch UOEH 10742 (ORW) L. cincinnatiensis *          ci UOEH 12201 (72-OH-H) L. dumoffi *          du ATCC 33279 (NY-23) L. erythra          er         sg-1 ATCC 35303 (SE-32-A-C8) L. fairfieldensis          fa UOEH 13563 (1725-AUS-E) L. feeleii *          fe         sg-1 ATCC 35072 (OW-44C)         sg-2 UOEH 10744 (691-WI-H) L. geestiana          ge ATCC 49504 (1308) L. gormanii *          go ATCC 33297 (LS-13) L. gratiana          gr ATCC 49413 (Lyon 8420412) L. hackeliae *          ha         sg-1 ATCC 35250 (Lansing 2)         sg-2 UOEH 11368 (798-PA-H) L. israelensis *          is ATCC 43119 (Bercovier 4) L. jametowniensis          ja ATCC 35298 (JA-26-Gi-E2)

L. jordanis *          jo HM 7000 (BL-540) L. lansingensis *          la ATCC 49751 (167-MI-H) L. londiniensis          ld ATCC 49505 (1477) L. longbeachae *          lo         sg-1                                          ATCC 33462 (Long Beach 4)         sg-2                                          ATCC 33484 (Tucker 1) L. maceachernii *          ma ATCC 35300 (PX-1-G2-E2) L. micdadei *          mi ATCC 33218 (TATLOCK) L. moravica          mo ATCC 43877 (316-36) L. nautarium          na ATCC 49506 (1224) L. oakridgensis *          oa Oak Ridge 10 L. parisiensis * pa UOEH 11745 (PF-209C-C2) L. quinlivanii qu         sg-1 ATCC 43830 (1442-AUS-E) L. rubrilucens ru ATCC 35304 (WA-270-C2) L. sainthelensi * sa         sg-1 ATCC 35248 (Mt St Helens) L. santicrucis sc UOEH 11746 (SC-63-C7) L. shakespearei sh ATCC 49655 (214) L. spiritensis sp         sg-1 UOEH 11199 (Mt St Helens 9) L. steigerwaltii st UOEH 11199 (Mt St Helens 9) L. tucsonensis * tu ATCC 49180 (1087-AZ-H) L. wadsworthii * wa ATCC 33877 (81-716A) L. worsleiensis wo ATCC 49508 (1347)

  * Human pathogenicity

L.pneumophila subsp. pnemophila is Lpn -p, subsp. fraseri is represented by Lpn-f.

Example 6: Selective Primer and Polymerase Chain Reaction for Legionella Species

It is important to note that the nucleotide sequences of Example 4 are not only able to determine the species by comparing the homogeneity of the nucleotide sequences themselves as shown above, but also due to the characteristic nucleotide sequences unique to each species, PCR-restriction for species identification. Probes for analysis, PCR, or hybridization can be constructed. Unique nucleotide sequences that could be used for these purposes were identified (see Table 2). That is, from the Legionella rpoB sequences, we found the signature nucleotides of the species that commonly cause human infection, including Legionella pneumophila, and based on these, primers of SEQ ID NO: 43 capable of selectively amplifying Legionella strains ( ^{5). '} GATGATATCGATCAYCTDGG ^3' ) and primers of SEQ ID NO: 44 ( ^{5 '} CACCNGATACNGGRTTHA ^3' ) were prepared and PCR (30 cycles; denaturation 95 ℃ 30 seconds, annealing 58 ℃ 30 seconds, extension 72 ℃ 30 seconds, final extension 72 ℃ 5 minute).

Electrophoresis on 3% agarose gel showed 374 bp PCR amplification products from Legionella spp. (See A of FIG. 2), but no amplification products in other general bacteria (see FIG. 2B). In Figure 2 A, M1 , 100 bp DNA ladder; M2 , ΦX174 RF DNA / Hae III marker. pn , L. pneumophila ; an , L. anisa ; bi , L. birminghamensis ; ci , L. cincinnatiensis ; du , L. dumoffii ; go , L. gormanii ; is , L. israelensis ; jo , L. jordanis ; la , L. lansingensis ; lo , L. longbeachae ; mi , L. micdadei ; pa , L. parisiensis ; sa , L. saint helensi ; tu , L. tucsonensis , M in Figure 2, 100 bp DNA ladder; 1 , L. pneumophila ; 2 , L. longbeachae ; 3 , S. aureus ; 4 , E. coli ; 5 , B. subtilis ; 6 , C. diphtheriae ; 7 , M. fortuitum ; 8 , N. sicca ; 9 , B. catahalis ; 10 , S. feacalis ; 11 , H. influenzae ; 12 , S. pyogens ; 13 , B. fragilis ; 14 , Norcardia sp .; 15 , H. pylori .

Unique nucleotide of rpoB of Legionella strains with common human infections.         Species          Position        Nucleotides L. pneumophila subsp. pneumophila Serogroup 1, 2, 3, 6, 7, 8, 9, 10, 11, 12, 13,14             36 159 192 213 220             A A G (Lpn9, C) G A L. pneumophila subsp. fraseri Serogroup 4, 5, 15              6 45 66 105 246                                                  258             C C G C T C L. micdadei             42 48 57 117 159 180 222 267             A G C A G C G G L. longbeachae            129                                                  213             G G

Example 7: Selective primers to Legionella pneumophila

Due to the unique nucleotide sequence of each species, PCR-restriction analysis or PCR or hybridization probe for species identification was made. Characteristic nucleotide sequences that can be used for these purposes were identified (see Table 1). That is, the characteristic sequence region was found from the Legionella pneumophila rpoB sequences, and based on these, the forward primer of SEQ ID No. 45 ( ^{5 '} TCAGTTTAGAGTAGGTCTT ³⁾ capable of selectively amplifying only Legionella pneumophila having the largest clinical significance was used. ^' And a reverse primer of SEQ ID NO: 46 ( ^5' CCCAAGRGCCGATACACG ^{3 '} ) were prepared.

Example 8:  Legionella Pneumophila Selective Detection Method

Legionella pneumophila and other species of Legionella were subjected to PCR using primers based on the characteristic nucleotides of Legionella pneumophila (30 cycles; denaturation 95 ° C 30 seconds, annealing 58 ° C 30 seconds, extension 72 ° C 30 seconds, final extension). 72 ° C. 5 minutes).

In the step of selectively amplifying a portion of the rpoB DNA of the Legionella pneumophila species, a forward primer of SEQ ID NO: 45 ( ^{5 '} TCAGTTTAGAGTAGGTCTT ^3' ) and a reverse primer of SEQ ID NO: 46 ( ^{5 '} CCCAAGRGCCGATACACG ^3' ) were used. .

At this time, Legionella pneumophila only (lanes 1, 2, 5, 6, 15) rpoB DNA segment (217-bp) is amplified and in other Legionella species (lanes bo, du, go, jo, lo, mi, pa) There was no amplification product (see FIG. 1).

Three isolates (Kp1, Kp2, Kp3) isolated from Korean patients also had the same amplification products, indicating that they are Legionella pneumophila. Legionella strains not included in the photograph also had no amplification products (see FIG. 1: M1 , 100-bp DNA ladder; M2 , ΦX174 RF DNA / Hae III digest; Lanes ( 1, 2, 5, 6, 15 ), L. pneumophila serogroup 1, 2, 5, 6, 15; bo , L. bozemanii ; du , L. dumoffii ; go , L. gormanii ; jo , L. jordanis ; lo , L. longbeachae ; mi , L. micdadei ; pa , L. parisiensis ; Kp1 , Kp2 , And Kp3 , isolates of Korean patients).

Example 9: Legionella Pneumophila Discrimination of subspecies

Subspecies of Legionella pneumophila was identified using the restriction enzyme Bam HI corresponding to the restriction site found by the MapDraw program on the nucleotide sequence.

217-bp DNA amplified using primers selective for Legionella pneumophila was digested with Bam HI. Legionella pneumophila standard strains were subjected to specific PCR for Legionella pneumophila and cleaved with Bam HI to amplify the 217-bp rpoB DNA segment in all standard strains by PCR based on the characteristic nucleotides of Legionella pneumophila. Following Bam HI cleavage, all other strains were cleaved to show 136-bp and 81-bp DNA fragments, but only serogroups 4, 5, and 15 remained uncut. These three strains were subsp. fraseri and the rest are subsp. are strains belonging to pneumophila (see Fig. 7: M1, 100-bp DNA ladder ; M2, ΦX174 RF DNA / Hae III digest; Lanes 1~15, L. pneumophila serogroup 1 ~1 5).

Through the method of the present invention, rpoB sequences of each species of Legionella were obtained as primers for rpoB DNA fragments, and thus, selective primers were prepared for Legionella rpoB DNA fragments, and the amplified rpoB DNA fragments thereby provide a method for discriminating species. do. This provides a Legionella species determination method using RFLP.

In addition, a selective primer is prepared for the Legionella pneumophila rpoB DNA segment through the method of the present invention, and the selective amplification of the rpoB DNA of the Legionella pneumophila species enables selective detection and identification of the Legionella pneumophila species. In addition, subtypes of Legionella pneumophila serogroup1, which are the most representative pathogenic bacteria among Legionella pneumophila species, are accurately identified through RFLP analysis.

Therefore, when unknown bacteria suspected to be Legionella are isolated from pneumonia patients or the surrounding environment, the method of determining the species by comparing the nucleotide sequences of the standard strains already obtained and comparing them with the standard strains is more accurate than the conventional species identification method. This can be used to quickly determine the course of treatment for patients infected with Legionella.

Furthermore, when Legionella is isolated, the use of selective primers on the Legionella pneumophila rpoB gene segment can be used to more accurately detect and identify Legionella pneumophila from other Legionella strains, thus improving the treatment of patients infected with Legionella pneumophila. Determination of Legionella pneumophila subspecies has become possible in a simple manner.

<110> BIONEER CORPORATION <120> DNA fragments which encode RNA polymerase beta-subunit gene of          Legionella species, rpoB specific primer and method for          discrimination with them <160> 47 <170> KopatentIn 1.71 <210> 1 <211> 300 <212> DNA <213> Legionella adelaidensis <400> 1 agtgttggta aaatggcaga aaatcaattc cgtgttgggc ttgttcgtgt tgaaagagcg 60 gtaaaagagc gcttgagtct tgctgaatcc gaaaacttga tgccacaaga tttaattaat 120 gctaaacccg tatctgctgc tattaaagaa ttctttggtt caagtcagct ttcccaattt 180 atggatcaag tgaatcctct atcaggtgtc acacataaac gccgtgtttc ggcattgggg 240 ccaggtggac taacacgtga aagagcagga tttgaagttc gcgacgtaca tactacccac 300 300 <210> 2 <211> 300 <212> DNA <213> Legionella anisa <400> 2 agagttggtg aaatgacaga aaaccaattt agggtcggtc ttgtacgtgt tgaacgagct 60 gttaaagaac gcttaagttt ggttgaatct gaaaatctga tgccacaaga tttaatcaat 120 gcaaaacccg tctctgctgc gattaaagaa ttctttggct caagccagtt atcacagttt 180 atggatcaag ttaatccatt atccggtgta actcacaaac gtagtgtttc agcactgggt 240 ccaggtggtt taacacgtga gcgagctggt tttgaagttc gtgacgttca caccactcac 300 300 <210> 3 <211> 300 <212> DNA <213> Legionella birminghamensis <400> 3 agtgttggtg aaatggctga aaaccaattc cgggtagggc tggtgcgtgt tgaacgcgca 60 gtgaaggaac gtcttagtct ggttgagtct gaaaatctga tgcctcagga tctgatcaat 120 gccaagcctg tgtcagctgc aatcaaggag ttcttcggtt caagtcagtt gtctcagttc 180 atggatcagg tcaatccatt atctggtgta acccataagc gccgtgtttc agcattaggc 240 ccaggtggat tgacacgtga aagagctgga tttgaggtgc gcgacgttca cacaacccat 300 300 <210> 4 <211> 300 <212> DNA <213> Legionella bozemanii serogroup 1 <400> 4 agtgttggtg aaatgacaga aaaccaattt agagtcggtc ttgtacgtgt taaaagagca 60 gttaaagaac gtttaagttt ggttgaatct gaaaatttga tgcctcaaga tttaatcaat 120 gcaaaaccag tttctgctgc aattaaagaa ttttttggct caagccagtt atcacaattt 180 atggaccaag ttaatccatt atcaggtgtg acacacaaac gtagggtttc tgcattgggc 240 ccaggtggtt taacacgtga acgagcaggt tttgaagttc gtgacgttca taccacacac 300 300 <210> 5 <211> 300 <212> DNA <213> Legionella bozemanii serogroup2 <400> 5 agtgttggtg aaatgacaga aaaccaattt agagtcggtc ttgtacgtgt tgaaagagcg 60 gttaaagaac gtttaagttt ggttgaatct gaaaatctga tgccacaaga tttaatcaat 120 gcaaaaccag tttctgctgc gattaaagaa ttttttggct caagccagtt atcacaattt 180 atggatcaag ttaatccgtt atcgggtgta acacacaaac gtagggtttc tgcattaggc 240 ccaggtggtt taacgcgtga acgtgcagga tttgaagttc gtgacgtcca taccacacac 300 300 <210> 6 <211> 300 <212> DNA <213> Legionella brunensis <400> 6 agtgttggtg aaatggcaga aaaccaattc cgtgtaggtt tggtaagagt tgagcgtgcg 60 gttaaagagc gtttgagtct tgttgagtct gaaaatctaa tgccacaaga tttaattaat 120 gcaaaacctg tttctgctgc tgtgaaagaa tttttcggct caagccaatt gtcacaattt 180 atggatcagg ttaatcctct ttcaggggtt actcataagc gtcgtgtttc agctcttggc 240 ccaggtggtt tgacaagaga acgagcagga tttgaggtgc gtgacgttca tacgactcac 300 300 <210> 7 <211> 300 <212> DNA <213> Legionella cherrii <400> 7 agtgttggta aaatgactga aaaccaattc agagttgggc ttgtacgtgt agaacgagct 60 gttaaggagc gcttgagttt agttgaatca gaaaatctta tgccacaaga tttaattaat 120 gcaaaacctg tttcagctgc aattaaagag ttctttggtt caagccagtt atcacaattt 180 atggatcagg ttaacccctt atctggcgtt acccataagc gaagagtttc agcattaggc 240 ccaggtggtt taacacgtga acgtgcaggg tttgaggtac gtgacgtaca taccacacac 300 300 <210> 8 <211> 300 <212> DNA Legionella cincinnatiensis <400> 8 agtgttggag aaatgactga aaaccaattt agggttggtc ttgttcgcgt tgaaagagca 60 gttaaagaac gattaagttt agttgagtct gaaaatttaa tgccacagga tttaattaat 120 gcaaaacctg tttctgctgc aattaaagag ttttttggtt caagtcagtt gtctcaattt 180 atggatcagg taaatccatt atcaggagta actcataagc gaagagtatc cgctttgggc 240 ccaggtggat taactcgtga acgcgctggc tttgaagtcc gtgacgtaca tacaacacat 300 300 <210> 9 <211> 300 <212> DNA <213> Legionella dumoffii <400> 9 agtgttggtg aaatgaccga aaaccaattc agagtggggc tcgtgcgcgt tgagcgcgct 60 gtcaaagagc gcttgagcct ggtggaatct gaaaatttga tgccacaaga tttaattaat 120 gcgaaacctg tttcggctgc aattaaagaa ttcttcggtt ccagtcagtt atcgcaattc 180 atggatcagg ttaatccatt atctggtgtt acccataagc gcagggtttc tgcattaggc 240 ccaggcggat tgacacgtga acgcgcagga tttgaggttc gtgacgtaca taccacacac 300 300 <210> 10 <211> 300 <212> DNA <213> Legionella erythra <400> 10 agtgtcggcg agatgacaga aaaccagttt cgtgtcggct tggtccgtgt tgagcgagcg 60 gtcaaagagc gtttaagcct ggttgaatct gaaaatctga tgccccagga tttgattaac 120 gccaaacctg tttctgcagc aatcaaagag ttttttggtt ctagccagtt atctcagttt 180 atggatcagg ttaatccgct ttctggtgtt acacacaagc gccgtgtttc ggcacttggc 240 ccaggcggtt tgactcgtga acgtgcagga tttgaggtcc gcgacgttca taccactcat 300 300 <210> 11 <211> 300 <212> DNA <213> Legionella fairfieldensis <400> 11 tcagtaggtg aaatgacaga aaatcaattt cgcgtggggt tggttcgagt tgagcgtgct 60 gtaaaagaac gcctaagtct tgttgagtca gaaaatctta tgccgcaaga tttaattaac 120 gccaagcctg tgtctgcagc tgtgaaagaa ttttttggtt ctagccagtt atctcagttt 180 atggatcaag ttaatcctct atcaggtgtt acccataaac gccgcgtttc ggcccttggt 240 ccaggtggtt taaccagaga aagggctggt tttgaagtac gtgacgttca tactactcat 300 300 <210> 12 <211> 300 <212> DNA <213> Legionella feeleii serogroup 1 <400> 12 agcgttggtg aaatggctga aaaccaattt cgagttggtt tggttcgtgt ggaacgtgca 60 gttaaagaac gtttgagttt agtcgaatca gaaaatttga tgccgcagga tctgattaat 120 gctaaaccag tctctgccgc gatcaaagag ttctttggtt ctagccaatt atcacagttt 180 atggatcaag ttaacccgct gtcaggtgtt actcacaagc gccgtgtttc agctcttggc 240 ccaggcggct taacccgtga gcgtgccggt tttgaggttc gtgacgttca tacaacgcat 300 300 <210> 13 <211> 300 <212> DNA <213> Legionella feeleii serogroup2 <400> 13 agcgttggtg aaatggctga aaaccaattt cgagttggtt tggttcgtgt ggaacgtgca 60 gttaaagaac gtttgagttt agtcgaatca gaaaatttga tgccgcagga tctgattaat 120 gctaaaccag tctctgccgc gatcaaagag ttctttggtt ctagccaatt atcacagttt 180 atggatcaag ttaacccact gtcaggtgtt actcacaagc gccgtgtttc ggctcttggc 240 ccaggcggct taacccgcga gcgtgccggt tttgaggttc gtgacgttca tacaacgcat 300 300 <210> 14 <211> 300 <212> DNA <213> Legionella geestiana <400> 14 agtgttggtg aaatggccga aaaccagttc cgcgtgggcc ttgtacgcgt tgagcgagct 60 gttaaggagc ggctaagtct tgcagaatcc gagaatctga tgccacagga tctcgttaac 120 gcaaaacccg tttctgcagc tgttaaggaa ttttttggtt caagccagct gtcgcaattt 180 atggatcagg tgaaccctct gtcaggtgta acgcataaac gacgcgtctc agcacttgga 240 ccaggcggtc ttacccgtga gcgtgcaggt tttgaggtac gggacgttca cactacacac 300 300 <210> 15 <211> 300 <212> DNA <213> Legionella gormanii <400> 15 agcgttggtg aaatgactga aaaccagttt agagtaggcc ttgttcgtgt tgaaagagct 60 gttaaagagc gtttaagttt ggttgagtct gaaaatctga tgcctcaaga tttaattaac 120 gcaaaaccag tatctgcagc gattaaagag ttttttggtt ccagccagtt gtcacagttt 180 atggatcaag taaacccctt atcaggtgtt acccataaac gaagtgtttc tgcattaggc 240 ccaggtggtt taactcgtga gcgtgcaggg tttgaagtac gtgacgtaca tacaactcac 300 300 <210> 16 <211> 300 <212> DNA <213> Legionella gratiana <400> 16 agcgtcggtg aaatgaccga aaatcaattt agggttggtt tggttcgtgt tgaaagagct 60 gttaaagaac gattaagctt agtagagtcc gaaaatctaa tgccacagga tttaattaat 120 gctaaacctg tgtctgctgc gattaaagag ttttttggct caagccaact atcccaattt 180 atggatcaag taaatccact atcaggagta actcataaac gaagagtttc agctttagga 240 ccaggcggtt taactcgtga gcgtgctggc tttgaagttc gtgacgtcca tactacacac 300 300 <210> 17 <211> 300 <212> DNA <213> Legionella hackeliae serogroup1 <400> 17 agcgttggcg agatggctga aaaccaattc cgcgttggtc ttgttcgcgt tgagcgagct 60 gttaaagagc gtttaagttt ggttgagtct gaaaacttaa tgccacaaga tttaattaac 120 gcaaaaccag tttcggctgc ggtgaaagaa ttcttcggct caagccaatt gtcacaattt 180 atggatcaag taaatccact atccggggta actcataaac gtcgtgtttc agcgcttggc 240 ccaggtggtt taactagaga gcgtgcaggt tttgaggtgc gtgacgtaca tactactcac 300 300 <210> 18 <211> 300 <212> DNA <213> Legionella hackeliae serogroup2 <400> 18 agcgttggcg agatggctga aaaccaattc cgcgttggtc ttgttcgcgt tgagcgagct 60 gttaaagagc gtttaagttt ggttgagtct gaaaacttaa tgccacaaga tttaattaac 120 gcaaaaccag tttcggctgc ggtgaaagaa ttcttcggct caagccaatt gtcacaattt 180 atggatcaag taaatccact atccggggta actcataaac gtcgtgtttc agcgcttggc 240 ccaggtggtt taactagaga gcgtgcaggt tttgaggtgc gtgacgtaca tactactcac 300 300 <210> 19 <211> 300 <212> DNA <213> Legionella israelensis <400> 19 agcgttggtg aaatgaccga aaatcagttt cgtgtgggat tggttcgtgt tgaacgggct 60 gttaaagagc gattgagtct tgtggaatct gaaaatttaa tgccacagga tttaattaac 120 gcaaaacctg tttctgcagc nataaaagaa ttctttggtt ccagtcaatt gtctcagttt 180 atggaccagg tcaatccatt atccggcgtt actcataaac gtagggtttc agcacttgga 240 ccaggaggtt taacaagaga gcgtgcaggt tttgaagttc gtgacgtaca cactacccat 300 300 <210> 20 <211> 300 <212> DNA <213> Legionella jamestowniensis <400> 20 agtgttggtg aaatgactga gaatcaattc cgcgtgggat tggtaagagt tgaacgtgcg 60 gtgaaagaaa ggttaagcct ggctgaatca gaaagcctga tgccgcagga tttaattaac 120 gccaagcctg tatctgctgc catcaaagaa ttttttggct caagtcagct ttcccagttt 180 atggatcagg ttaatcccct gtcaggtgtc acccataagc gcagggtttc cgcgcttggt 240 cctggtggat tgactcgaga gcgagcaggg tttgaagtac gggacgtaca cactacccac 300 300 <210> 21 <211> 300 <212> DNA <213> Legionella jordanis <400> 21 agcgtaggtg aaatggctga aaaccaatac cgcgtgggtt tagtccgtgt ggaaagagcg 60 gtcaaagaac gcttaagtct tgttgaatct gaaaatctta tgccacaaga tttaattaat 120 gcaaaacccg tttcagcggc aatcaaagag ttctttggtt caagtcagct ttcccaattt 180 atggatcagg ttaatccact atctggagta acccataaac gccgtgtatc agctcttggt 240 ccaggcggat taacgcgtga acgtgctgga tttgaagttc gtgacgttca taccactcac 300 300 <210> 22 <211> 300 <212> DNA <213> Legionella lansingensis <400> 22 agtgtaggtg aaatggcgga aaaccaattc cgggttggcc ttgtaagggt tgaacgagct 60 gtcaaggaac gtttaagctt ggtggaatcc gaaaatttga taccgcaaga tttaatcaac 120 gcaaaacctg tttctgctgc agtaaaagaa ttctttggtt caagtcaatt gtcgcaattt 180 atggatcaag ttaacccctt atcaggtgtt acacacaagc gacgtgtttc tgctcttggt 240 ccaggtggat tgacaagaga gcgagctgga tttgaggttc gtgacgtaca cacgactctc 300 300 <210> 23 <211> 300 <212> DNA <213> Legionella londiniensis <400> 23 agtgttggtg aaatgactga gaatcaattc cgcgtgggat tggtaagagt tgaacgtgcg 60 gtgaaagaaa ggttaagcct ggctgaatca gaaagcctga tgccgcagga tttaattaac 120 gccaagcctg tatctgctgc cattaaggaa ttttttggct caagtcagct ttcccagttt 180 atggatcagg ttaatcccct gtcaggtgtc acccataagc gcagggtttc cgcgcttggt 240 cctggtggat tgacgcgaga gcgagcaggg tttgaagtac gggatgtaca cactacccac 300 300 <210> 24 <211> 300 <212> DNA <213> Legionella longbeachae serogroup 1 <400> 24 agcgttggtg aaatgactga aaaccaattt agagttggtc ttgtacgcgt tgaaagagca 60 gttaaagagc gattgagttt agttgaatct gaaaatttaa tgcctcaaga tttaattaat 120 gcaaaaccgg tttctgctgc gattaaggaa ttttttggtt caagtcagtt atctcaattt 180 atggatcaag taaatccact atcaggtgta acgcataagc gcagggtatc agctttgggc 240 ccaggtggat tgactcgaga gcgtgctggc tttgaagtcc gtgacgtaca taccacccac 300 300 <210> 25 <211> 300 <212> DNA <213> Legionella longbeachae serogroup 2 <400> 25 agcgttggtg aaatgactga aaaccaattt agagttggtc ttgtacgcgt tgaaagagca 60 gttaaagagc gattgagttt agttgaatct gaaaatttaa tgcctcaaga tttaattaat 120 gcaaaaccgg tttctgctgc gattaaggaa ttttttggtt caagtcagtt atctcaattt 180 atggatcaag taaatccact atcaggtgta acgcataagc gcagggtatc agctttgggc 240 ccaggtggat tgactcgaga gcgtgctggc tttgaagtcc gtgacgtaca taccacccac 300 300 <210> 26 <211> 300 <212> DNA <213> Legionella maceachernii <400> 26 tctgtaggtg agatggctga aaatcaattt cgggttggat tggtgagagt tgagcgcgcc 60 gttaaagagc ggttaagtct tgtagagtct gaaaatttaa tgcctcagga tttaattaat 120 gccaaaccag tctctgccgc agtgaaagag ttctttggat ctagccagtt atcgcagttt 180 atggatcaag ttaacccact ttctggagtc actcataaac gacgtgtttc tgcacttggc 240 ccaggtggct taacccgaga acgtgctggc tttgaagtgc gtgacgtgca tacgacacac 300 300 <210> 27 <211> 300 <212> DNA <213> Legionella micdadei <400> 27 tcagttggtg aaatggctga aaaccagttt cgagtcggat tagtcagggt tgagcgcgct 60 gttaaggaac gtttaagtct agtagagtcc gaaaacttga tgcctcaaga tctaataaac 120 gctaaaccag tttcagctgc agtgaaagag tttttcgggt ccagtcagct atcacaattc 180 atggaccaag ttaacccact atccggcgtc actcacaaac ggcgcgtttc tgcactgggc 240 ccaggcggtt taactcgaga gcgagcgggt tttgaagtgc gtgacgtgca tactacccat 300 300 <210> 28 <211> 300 <212> DNA <213> Legionella moravica <400> 28 agtgttggcg agatggctga aaatcaattc agagttggtt tggtgcgcgt tgaacgagca 60 gtcaaagaac gtttgagcct tgtagaatct gaaaatctga tgccacaaga cctaatcaat 120 gccaagccag tatctgcagc agtaaaagag ttttttggat ccagccaatt atcgcagttt 180 atggatcagg taaatcctct atcaggagtt actcataaac gacgtgtttc tgcactaggc 240 ccaggtggat tgaccagaga gcgagctggt tttgaagtac gtgacgtaca taccactcac 300 300 <210> 29 <211> 300 <212> DNA <213> Legionella nautarum <400> 29 tcagtaggag aaatggcaga aaaccaattc cgagttggtt tagtaagagt ggaacgagct 60 gtgaaagagc gtttaagtct tgtcgagtca gaaaatttga tgcctcaaga tttaattaac 120 gctaaaccag tttctgcagc tgtaaaagaa tttttcggct ctagccagtt atcacagttt 180 atggatcagg ttaatccact ctctggagta actcacaaac gccgtgtttc agcacttggc 240 cccggtggtt taactcgcga acgcgctggt tttgaagtgc gtgacgttca tactacccac 300 300 <210> 30 <211> 300 <212> DNA <213> Legionella oakridgensis <400> 30 agtgttggtg aaatgaccga aaaccaattt agagttggtc ttgttcgtgt tgaacgggct 60 gtaaaagaac gcttaagctt ggttgaatct gaaaatctga tgccacagga cttaattaac 120 gcaaaaccag tttctgccgc aattaaagaa ttttttggtt ccagtcaatt atcccaattt 180 atggaccaag tgaatccatt atctggtgtc acacacaaac gacgggtttc agcgctgggt 240 ccaggtggtt taacacgtga acgggctggc tttgaagttc gtgacgttca taccacgcac 300 300 <210> 31 <211> 300 <212> DNA <213> Legionella parisiensis <400> 31 agtgttggtg aaatgacaga aaaccaattt agagtcggac ttgtacgtgt tgaaagagcg 60 gttaaagaac gtttaagttt ggttgaatct gaaaatctga tgccacaaga tttaatcaat 120 gcaaaaccag tttctgctgc gattaaagaa ttttttggct caagccagtt atcacaattt 180 atggatcaag ttaatccgtt atcgggtgta acacacaaac gtagggtttc tgcattaggc 240 ccaggtggtt taacgcgtga acgtgcagga tttgaagttc gcgacgttca taccacacac 300 300 <210> 32 <211> 300 <212> DNA <213> Legionella pneumophila serogroup 1 <400> 32 agtgttggcg aaatgaccga aaatcagttt agagtaggtc ttgttcgagt tgaacgtgct 60 gttaaagagc gcttaagttt ggttgaatct gaaaatctga tgccacagga cttaattaac 120 gcaaaaccag tatccgccgc aattaaagag ttttttggat ccagtcagtt atcacagttt 180 atggatcaag tgaatccatt atctggtgtt acgcataaaa gacgtgtatc agctcttggg 240 ccaggtggtt taacacgtga gcgggctgga tttgaagtcc gtgacgtaca tacaactcac 300 300 <210> 33 <211> 300 <212> DNA <213> Legionella quinlivanii <400> 33 agagttggtg aaatgaccga aaatcagttt agagttggtt tggttcgtgt tgaacgagct 60 gttaaagagc gtttaagcct ggttgaatct gaaaatctga tgcctcagaa cttgattaat 120 gccaagcctg tatctgcggc tattaaagaa tttttcggat ccagtcagtt atcgcaattt 180 atggatcagg ttaacccttt atcgggagtg acccataaac gccgtgtttc agcacttggc 240 ccaggtggac tcacccgtga acgagccggc tttgaagtcc gtgacgttca cactactcat 300 300 <210> 34 <211> 300 <212> DNA <213> Legionella rubrilucens <400> 34 agcgtgggtg aaatgacgga aaaccagttc cgtgttggtt tagttcgtgt tgagcgtgcg 60 gtcaaagagc gtttaagcct ggttgaatct gaaaatctga tgccccagga tttgataaac 120 gcaaagcctg tttctgccgc aatcaaagaa ttttttggct caagccagtt atcgcagttt 180 atggatcagg ttaacccgct ttccggagtg actcacaaag cgcgtgtttc agcccttggg 240 ccaggcgggt taactcgaga acgcgcagga tttgaagtcc gtgacgttca caccactcat 300 300 <210> 35 <211> 300 <212> DNA <213> Legionella sainthelensi <400> 35 agtgtcggtg aaatgactga aaatcaattt agggtaggac ttgttcgtgt tgaaagagca 60 gttaaagagc gactaagttt agttgaatct gaaaatttaa tgccgcaaga tttaataaat 120 gcaaaaccgg tttcagcagc gattaaagaa ttttttggtt caagtcagtt atctcaattt 180 atggatcaag taaacccatt atcaggggta actcataaac gcagagtctc tgctttggga 240 ccaggcggtt tgacacgtga acgtgctggc tttgaagtcc gtgacgtcca taccacacac 300 300 <210> 36 <211> 300 <212> DNA <213> Legionella santicrucis <400> 36 agtgttggtg aaatgacaga aaaccaattt agggttggtc ttgttcgcgt tgaaagagca 60 gttaaagagc gactaagttt agttgaatct gaaaacttaa tgccacaaga tttaattaat 120 gcaaagcctg tttctgctgc aattaaagag ttttttggtt caagtcagtt atcccaattt 180 atggatcaag taaatccatt atcaggtgta acccataagc gaagagtatc tgctttaggc 240 ccaggcggat taactcgtga acgcgctggc tttgaagtcc gtgacgtaca tacaacgcat 300 300 <210> 37 <211> 300 <212> DNA <213> Legionella shakespearei <400> 37 agtgttggcg aaatggcaga aaaccagttc agagttggtt tggtacgtgt tgagcgtgct 60 gttaaggagc gtctgagtct ggttgagtcc gaaaatctga tgcctcagaa tttgatcaat 120 gccaaacctg tatctgctgc tgttaaagag ttctttggtt cgagccagtt atcacaattt 180 atggatcagg ttaatccttt atcaggtgtg acacacaagc gaagagtttc agcattaggc 240 ccaggtggtt tgacacgtga gcgtgccgga tttgaagttc gtgacgtaca tacaactcac 300 300 <210> 38 <211> 300 <212> DNA <213> Legionella spiritensis <400> 38 agcgttggcg agatgactga aaatcaattc agagtcgggt tggtaagagt cgagcgcgcc 60 gtaaaagaac ggttaagtct ggtagagtcc gaaaatttaa tgcctcagga cttgatcaat 120 gccaagccgg tctccgccgc tatcaaggaa ttttttggct caagccagct ctcgcaattt 180 atggatcaag ttaatccatt gtccggggtt actcataagc gacgggtttc agcgcttggc 240 ccgggtggct tgactcgtga acgggccgga ttcgaagttc gggatgtgca taccactcac 300 300 <210> 39 <211> 300 <212> DNA <213> Legionella steigerwaltii <400> 39 agcgttggtg aaatgactga aaaccaattc agagtcggcc ttgtacgtgt tgaaagagcg 60 gtaaaagagc ggttgagtct ggttgaatct gaaaatctta tgccacaaga tttaattaat 120 gccaaaccgg tttctgctgc tattaaagag ttttttggtt caagccaatt atcacaattt 180 atggatcagg ttaacccatt atctggtgtt acccataaaa gaagggtttc tgcattaggc 240 ccaggtggtt taacacgaga acgtgcagga tttgaggttc gtgacgtaca tacaacacac 300 300 <210> 40 <211> 300 <212> DNA <213> Legionella tucsonensis <400> 40 agtgttggtg aaatgacaga aaaccaattt agagttggtc ttgtacgtgt tgaaagggct 60 gtaaaagaac gtctaagctt ggttgagtct gaaaatctga tgccacagga tttaattaat 120 gcaaaaccag tttctgctgc aattaaagaa ttttttggtt caagtcaatt atcccaattt 180 atggaccaag ttaatccatt atctggtgtc acacacaaac gtcgggtttc agcgttgggt 240 ccaggtggtt taacacgtga acgggctggc tttgaagttc gtgacgttca taccacacac 300 300 <210> 41 <211> 300 <212> DNA <213> Legionella wadsworthii <400> 41 agcgtaggtg aaatgactga aaaccaattc cgagttggtt tggtgcgtgt tgaaagagct 60 gtgaaggaac gtttaagtct tgtcgaatca gaaaatttaa tgcctcaaga tttaattaac 120 gccaagcctg tttctgctgc aattaaagag ttttttggct ctagccaact gtcccaattc 180 atggatcagg taaatccctt atccggtgtg acacataagc gcagagtatc cgctttaggc 240 ccaggtggat taacaagaga gcgcgcaggc ttcgaagtac gcgacgttca tacaacccat 300 300 <210> 42 <211> 300 <212> DNA <213> Legionella worsleiensis <400> 42 agtgttggca agatgacaga aaaccagttc agagttggtt tagttcgagt tgaacgtgct 60 gttaaagaac gcttgagtct tgttgagtct gaaaacttga tgccacagga tctcattaat 120 gccaaacctg tttcggctgc agttaaagag ttttttggtt ccagtcagtt atcccagttt 180 atggatcagg ttaatccatt atccggtgta actcataaac gacgtgtttc tgcattaggc 240 ccaggcggtc tgactcgtga gcgagcaggg tttgaggttc gtgacgttca cacaacacac 300 300 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 gatgatatcg atcayctdgg 20 <210> 44 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 caccngatac nggrttha 18 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 tcagtttaga gtaggtctt 19 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 cccaagrgcc gatacacg 18 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 ttcvggcgtt caatnggac 19

Claims (59)

The rpoB gene segment of a genus of Legionella microorganisms selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 42. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete A primer pair having the nucleotide sequences of SEQ ID NOs: 43 and 44, or SEQ ID NOs: 43 and 47, for selectively amplifying a portion of the Legionella genus rpoB gene. A diagnostic reagent for specifically amplifying and discriminating a Legionella genus, comprising a primer pair having a nucleotide sequence of SEQ ID NOs: 43 and 44, or SEQ ID NOs: 43 and 47. Rif ^r of the rpoB gene of Legionella Amplifying the highly conserved region of C2 containing the site to prepare rpoB gene segments of Legionella spp .; Analyzing the nucleotide sequence of the amplified gene segment; Method for determining the species of Legionella bacteria comprising the step of comparing the nucleotide sequence of the segment analyzed above with the nucleotide sequence of SEQ ID NO: 1 to 42. 46. The method of claim 45, which is a forward primer A method for determining the species of Legionella, comprising amplifying the conserved region using the nucleotide sequence of SEQ ID NO: 43 and the base sequence of SEQ ID NO: 44 or SEQ ID NO: 47 to prepare an rpoB gene segment of the Legionella species. Rif ^r of the rpoB gene of Legionella spp ^. Amplifying the highly conserved region of C2 containing the site to prepare rpoB gene segments of Legionella spp .; Process for determining the species of Legionella bacteria comprising the step of processing the restriction enzyme to the gene fragment prepared by the step of determining whether the gene fragment by the restriction enzyme. 48. The method of claim 47, which is a forward primer A method for determining the species of Legionella, comprising amplifying the conserved region using the nucleotide sequence of SEQ ID NO: 43 and the base sequence of SEQ ID NO: 44 or SEQ ID NO: 47 to prepare an rpoB DNA segment of the Legionella species. delete 48. The method for discriminating Legionella bacteria according to claim 47, wherein the restriction enzyme is Bam HI. A primer pair having the nucleotide sequences of SEQ ID NOs: 45 and 46, for selectively amplifying a portion of the rpoB gene of Legionella pneumophila. A diagnostic reagent for selectively amplifying and discriminating Legionella pneumophila, comprising primer pairs having the nucleotide sequences of SEQ ID NOs: 45 and 46. Rif ^r of the rpoB gene of Legionella spp ^. A method for selectively detecting and identifying Legionella pneumophila species, comprising selectively amplifying a highly conserved region of C2 containing a site. 55. The method of claim 53, wherein the conserved region is amplified using a primer pair having the nucleotide sequences of SEQ ID NOs: 45 and 46. 54. A method for selective detection and identification of Legionella pneumophila species. Rif ^r of the rpoB gene of Legionella spp ^. Amplifying the highly conserved region of C2 containing the site; Legionella pneumophila subspecies discrimination method comprising the step of adding a restriction enzyme to the rpoB gene segment of the amplified Legionella pneumophila species. The method of claim 55, wherein the conserved region is amplified using a primer pair having the nucleotide sequences of SEQ ID NOs: 45 and 46. The method of claim 55, wherein said restriction enzyme is Bam HI. 44. The primer pair of claim 43, having the nucleotide sequences of SEQ ID NOs: 43 and 44. 45. The diagnostic reagent of claim 44, comprising a primer pair having the nucleotide sequences of SEQ ID NOs: 43 and 44.

Images