KR20030015163A - New biopesticide using gene from Erwinia pyrifoliae WT#3, novel pathogen that affects Asian pear trees - Google Patents

Abstract

PURPOSE: A biopesticide using gene derived from Erwinia pyrifoliae WT#3, pathogen that affects Asian pear trees is provided. The biopesticide has more improved plant disease resistance and plant growth facilitating effect than the prior biopesticide. CONSTITUTION: A gene, which codes a plant hypersensitivity reaction(HR) or resistance inducing polypeptide or protein and is derived from Erwinia pyrifoliae WT#3(KCCM 10283), comprises the nucleotide sequence of SEQ ID NO: 5. The plant hypersensitivity reaction(HR) or resistance inducing polypeptide or protein has the amino acid sequence of SEQ ID NO: 6. A recombinant plasmid pKEP3 contains the gene of SEQ ID NO: 1. A transformant E. coli/pKEP3(KCCM 10282) is produced by transformation with the recombinant plasmid pKEP3. The plant hypersensitivity reaction(HR) inducing polypeptide or protein is mass produced by culturing the transformant E. coli/pKEP3(KCCM 10282); and extracting and purifying the plant hypersensitivity reaction(HR) inducing polypeptide or protein.

Description

New biopesticide using gene from Erwinia pyrifoliae ＷＴ ＃ ３, novel pathogen that affects Asian pear trees}

The present invention relates to a new biochemical pesticide using a novel plant phytopathogen-derived gene, and more specifically, to isolate and identify a novel black eggplant pathogen WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283] that exists only in Korea. Biochemical pesticides and fertilizers such as biological plant disease control agents and plant growth promoters have been discovered by discovering new derivatives with higher plant disease resistance and plant growth promoting effects than plant hypersensitivity protein (HrpN) isolated from the existing burn pathogen ( Erwinia amylovora ATCC15580). The novel eggplant black bacterium WT # 3 (KCCM 10283) which can be used for the manufacture etc. is related.

Among the problems facing humanity, the food shortage is an aspect that the world recognizes the seriousness of the problem. However, crops grown for food growth have been pointed out as a serious problem because their yield is greatly reduced by pests. Currently, as a method for controlling pests, chemical control that directly prevents or kills the spread of pests by spraying fungicides and insecticides is most widely used. In the case of such fungicides or insecticides, the pests are directly killed, so that the edible effects appear quickly and are easy to use, but due to continuous overuse, drug resistance of various pests is induced. In addition, the drug with excellent effect is highly toxic and social anxiety is created due to environmental damage such as soil pollution and water pollution. Therefore, there is an urgent need for the development of biological control agents that are environmentally friendly and effective in controlling pests without fear of inducing drug resistance.

The most common biological control agent was to obtain a disease control effect by spraying microorganisms on the plant itself, but this method did not reach the level desired by humans in terms of efficacy. Therefore, in recent years, research has been conducted toward controlling pests by stimulating a plant's own defense system using materials produced by microorganisms rather than spraying microorganisms themselves. In other words, by treating the plant with a microorganism-derived material to activate the immune function of the plant itself to prevent the occurrence and spread of pests.

Plant disease resistance primarily consists of saponins or lectins that are secreted by the plant even when structural barriers and pathogens invade the plant cells, such as the cuticle of the epidermal cells, the shape of the wax layer and the pores. The same variety of chemicals are made by primary defense systems that prevent the spread of invading pathogens [Agrios, GN 1997. Plant Pathology. 4th ed. Academic Press, New York; Dong, X. 1998. SA. JA, ethylene, and disease resistance in plants. Curr. Opin. Plant. Biol. 1: 316-323; Feys, B. J. & Parker, J. E. 2000. Interplay of signaling pathways in plant disease resistance. Trends Genet. 16: 339-455.

More aggressive plant disease resistance, however, refers to the spread of pathogens to small areas within the site of infection by plant-resistant substances that activate the immune function of the plant itself, which is induced by a hypersensitive response [HR]. Richberg, MH, Aviv, DH & Dangl, JL 1998. Dead cells do tell tales. Curr. Poin. Plant Biol. 1: 480-485]. Plant disease resistance method by plant hypersensitivity reaction is the first to activate the early warning system for the cells around the pathogen invasion path, the surrounding cells also increase the ability to resist pathogens. It is called. On the other hand, the second method is to activate the defense system even in the uninfected part of the plant, so that a stronger defense system works throughout the plant against secondary infection. This defense system is called systemic acquired resistance, which can be maintained for several weeks or more and is often resistant to other unrelated pathogens [Hunt, MD, Neuenschwander, UH, Delaney, TP, Weymann, KB, Friedrich, LB, Lawton, KA, Steiner, HY and Ryals, JA 1996. Recent advances in systemic acquired resistance research-a review. Gene 179: 89-95. In addition, other forms of plant resistance have been reported, including induced systemic resistance (IRS) and wound response to pests (Pieterse, CM, van Wees, SC, van Pelt, JA, Knoester, M., Laan, R., Gerrits, H., Weisbeek, PJ and van Loon, LC 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis . Plant Cell 10: 1571-1580; Ryan, CA and Pearce, G. 1998. SYSTEMIN: a polypeptide signal for plant defensive genes. Annu. Rev. Cell Dev. Biol. 14: 1-17.

These plant disease resistance mechanisms are all caused by inducers that induce plant defense systems [Kessmann, H., Staub, T., Hofmann, C., Maetzke, T ., Herzog, J., Ward, E., Uknes, S. and Ryals, J. 1994. Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol. 32: 439-459. In the case of SAR, phenolic signaling material (SA), salicylic acid, and elicitin and harpin isolated from pathogens are representative inducers [Ponchet, M., Panabieres, F]. ., Milat, ML, Mikes, V., Montillet, JL, Suty, L., Triantaphylides, C., Tirilly, Y. and Blein, JP 1999. Are elicitins cryptograms in plant-oomycete communications. Cell Mol. Life Sci. 56: 1020-1047]. In particular, harpin is a protein (HrpN) produced from the hrpN gene located in the hrp gene group of about 40 kb of Erwinia amylovora , which acts as a pathogenic factor that causes burn disease when inoculated into host plants. When treated on plants, they are recognized as external invaders and trigger a hypersensitivity (HR) resistance mechanism. The HrpN protein is acidic, stable to heat (100 ° C.), and electrophoresed on 44 kD [which is electrophoresed on acrylamide gels, then stained with 0.025% Coomassie Blue R-250 to produce Molecular Weight Standard (Catalog # 161-0305). , Bio-Rad Laboratories, 2000 Alfred Nobel Drive Hercules, CA 94547, USA), and had a high molecular weight of glycine but no cysteine [Zhong-Min, W., Laby, RJ, Zumoff, CH, Bauer, DW, He, SY, Collmer, A. and Beer, SV 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora . Science 257: 85-88; US Patent No. 6,001,959; US Patent No. 5,850,015; US Patent No. 6,172,184, B1; US Patent No. 6,174,717 B1; US Patent No. 5,849,868; US Patent No. 6,977,060; US Patent No. 5,859,324; US Patent No. 5,776,889; Korean Patent Publication No. 1999-022577; Korean Patent Publication No. 2000-075771; Korean Patent Publication No. 2000-070495; Korean Patent Publication No. 2000-057395].

Substances that induce these plant biologic defense systems are currently available in the form of various agents. In other words, after it is revealed that SAR is induced by SA, INA (2,6-dichloroisonicotinic acid) and BTH (benzothiadiazole), which are similar in structure to SA, are also found to induce SAR. ^TM and BION As a plant protection agent against diseases of houseplants, tomatoes and tobacco under the name, it is sold in the United States and Europe. Also, in Japan, PBZ (probenazole) is Oryzemate It is used as a control agent for rice blast and leaf blight [Yoshioka, K., Nakashita, H., Klessig, DF and yamaguchi, I. 2001. Probenazole induces systemic acquired resistance in Arabidopsis with a novel type of action. Plant J. 25: 149-157.

In particular, in the case of Harpin, which was first identified in Gram-negative bacteria Erwinia amylovora , it is a non-chemical protein that induces SAR when sprayed directly on plants, causing various plant diseases and several insects, mites, It has the effect of insect repellent against nematodes, and has been reported to have a plant growth prompting (PGP) effect that promotes photosynthesis and nutrient absorption to promote nutrient and reproductive growth of plants [Dong, HS, Delaney, TP, Bauer, DW and Beer, SV 1999. Harpin induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene. Plant J. 20: 207-215. In addition, harpin (HrpN) protein is almost non-toxic, and because it is a protein, it decomposes quickly after use, so there is no concern of environmental pollution, and it is not destroyed even at high temperature (100 ° C). [Zhong-Min, W., Laby, RJ, Zumoff, CH, Bauer, DW, He, SY, Collmer, A. and Beer, SV 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora . Science 257: 85-88.

Therefore, Eden Bioscience, a new US startup, is using Messenger for HrpN protein, a plant hypersensitivity-inducing protein derived from burn pathogens. Since 2000, it has been marketed in the United States for crops such as cotton, tomato, tobacco, pepper, cucumber, strawberry, and wheat. That is, it is recognized as a biopesticide as a fungicide, a bacterium, a virus, an insect repellent, and a plant growth promoter [US Pat. No. 6,174,717 B1; US Patent No. 5,849,868; US Patent No. 6,977,060; US Patent No. 5,859,324; US Patent No. 5,776,889; Korean Patent Publication No. 1999-022577; Korean Patent Publication No. 2000-075771; Korean Patent Publication No. 2000-070495; Korean Patent Publication No. 2000-057395].

Accordingly, the present inventors have isolated and identified pathogens from diseased tissues showing dryness on the branches of apples and pears cultivated in Korea. As a result, known burn pathogens and recently reported eggplant black blight pathogens in Germany We found that the morphologically different novel eggplant black bacterium WT # 3 (KCCM 10283) and extracted genes and inducible proteins encoding plant hypersensitivity from this strain were excellent for plant disease resistance and plant growth promoting effect. The present invention has been completed by revealing.

Accordingly, an object of the present invention is to provide a novel black eggplant pathogen WT # 3 (KCCM 10283) and biochemical pesticides and fertilizers using the same.

1 is a black bung pathogen WT # 3 ( E. pyrifoliae WT # 3) [KCCM 10283] and domestic bough pathogens ( E. pyrifoliae Ep16 ^T ) and burn pathogens ( E. amylovora ATCC 15580 ^T ) TEM The picture is shown.

2 is eggplant black blight pathogen It shows the growth according to the temperature of WT # 3 and burn pathogen ATCC15580.

3 is eggplant black blight pathogen It shows the growth according to the acidity of WT # 3 and burn pathogen ATCC15580.

Figure 4 is a biolog system using the branched black blight pathogen WT # 3 (KCCM 10283) according to the present invention.

Figure 5 shows the phylogenetic location by analyzing the 16S rRNA gene of the branched black blight pathogen WT # 3 (KCCM 10283) according to the present invention.

Figure 6 shows the results of analyzing the region encoding the tRNAAla of the ITS region of the eggplant black blight pathogen WT # 3 (KCCM 10283) according to the present invention.

Figure 7 shows the results of analyzing the region encoding the tRNAGlu of the ITS region of the branched black blight pathogen WT # 3 (KCCM 10283) according to the present invention.

Figure 8 shows the results of plasmid profile analysis of black blight pathogens (WT # 3, Ep1, Ep16) and burn pathogens (ATCC15580, LMG1877, LMG1946) [Lanes 1: 1kb ladder, 2: E. pyrifoliae Ep1, 3: E. pyrifoliae Ep16 ^T , 4: E. pyrifoliae WT # 3, 5: E. amylovora ATCC15580 ^T , 6: E. amylovora LMG1877, 7: E. amylovora LMG1946].

Figure 9 shows the hypersensitivity reaction (HR) after 24 hours by inoculating the genomic DNA library clones of the branched black pathogen WT # 3 (KCCM 10283) on tobacco leaves [B-MES Buffer; Plant hypersensitivity protein (HrpN) derived from C-burn pathogen ATCC 15580; Plant hypersensitivity inducing proteins derived from 1-clone 1; 2-clonal-derived plant hypersensitivity inducing protein; 3-pCEP33 derived plant hypersensitivity inducing protein; 4-clonal-derived plant hypersensitivity inducing protein; NC-pLAFR3 vector derived protein].

FIG. 10 shows a genetic map of the region encoding the plant hypersensitivity inducing gene from the clone (pCEP33) in which hypersensitivity (HR) appears.

Figure 11 is a comparison of the gene encoding the plant hypersensitivity induction protein of the eggplant black blight pathogen WT # 3 (KCCM 10283) according to the present invention and the induction gene ( hrpN ) derived from the pathogen ACC15CC [A: black blight pathogen WT Plant hypersensitivity induction gene derived from # 3, B: plant hypersensitivity induction gene ( hrpN ) derived from burn pathogen ATCC15580].

FIG. 12 shows a plant hypersensitivity inducing protein (hereinafter referred to as “Pioneer”) expressed in the plant hypersensitivity inducing gene derived from the black blight pathogen WT # 3 cloned into pKEP3 [M: protein size marker, 1 : Pioneer-41.1 kD, 2: HrpN-39.7 kD, 3: pET15b vector].

13 is a comparison of the plant hypersensitivity induction protein (Pioneer) derived from the branched black blight pathogen WT # 3 (KCCM 10283) and the plant hypersensitivity induction protein (HrpN) derived from the burn pathogen ATCC15580 according to the present invention [A: Pioneer, B : HrpN].

14 shows plant hypersensitivity reactions inoculated by plant concentration hypersensitivity-inducing protein (HrpN) derived from burn pathogen ATCC15580 as a control plant and plant control hypersensitivity-derived protein WT # 3 (KCCM 10283) derived from tobacco leaf veins Will represent

15 is a control group treated only with a buffer on the surface of young pear fruit and eggplant black blight pathogens according to the present invention WT # 3-derived plant hypersensitivity induction protein (Pioneer) after treatment, showing the symptoms.

The present invention relates to a non-infectious form of a polypeptide or protein derived from an Erwinia pyrifoliae bacterium in which plant cells induce hypersensitivity or resistance to a pathogen, and genes encoding the same. It features.

In another aspect, the present invention is characterized by a transformant containing a gene encoding a non-infectious form of a polypeptide or a protein derived from Erwinia pyrifoliae WT # 3 [KCCM 10283]. .

In another aspect, the present invention is characterized by a biochemical pesticide composition, characterized in that it contains the polypeptide or protein and a carrier.

In addition, the composition includes the use as a plant disease control agent, plant growth promoter, seed treatment agent, pest repellent, fertilizers and the like.

In addition, the present invention is to isolate and purify the hypersensitivity or resistant derivative polypeptide or protein from the culture of the eggplant black rot pathogen WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM10283], a large amount of hypersensitivity or resistant derivative polypeptide or protein The production method is another feature.

The present invention will be described in detail as follows.

Erwinia pyrifoliae WT # 3 [KCCM 10283] according to the present invention was isolated and identified as a pathogen from the diseased tissue showing dryness on the branches of apple, pear cultivation complex in Chuncheon, Erwinia Although the genus was identified as the new species belonging to the genus (Apple embryo blight; Erwinia pyrifoliae , reported by the German team in 1999), the burn pathogens and the branch blight pathogen reported by the German team are the main embryos with multiple flagella. , The new black blight pathogen WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283] is a non-flagella that does not have flagella, and is also in the form of a black blight pathogen that exists only in Korea. It shows a big difference. The new strain was named as eggplant black blight pathogen WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283], and was deposited with the Korea Microorganism Conservation Center on June 11, 2001, accession number is KCCM 10283.

Especially, eggplant black blight pathogen Genes encoding plant-sensitive derivatives (inducers) from WT # 3 were isolated and analyzed by Harpin, a product found by Cornell University in the United States and commercially available from Eden Biosciences.hrpNA new kind of gene with low similarity to the gene was found. In particular, the plant hypersensitivity induction genes derived from WT # 3hrpNNucleotied sequence fragments that are not present in the gene are insertedhrpNThe gene of the structure different from the gene was shown. That is, the above fragments were inserted at positions 222 to 230 bp, 249 to 263 bp, 348 to 371 bp, and 397 to 411 bp. Therefore, the polypeptide or protein produced from this gene not only had an amino acid sequence different from that of the HrpN peptide, but also differed in molecular weight.

Meanwhile, pKEP3, which is an expression vector containing the gene derived from the strain, was prepared and transformed into E. coli, and the transformant was deposited on Korean microorganisms as of June 11, 2001, and an accession number is KCCM 10282.

By using the transformant containing the expression vector, it is possible to mass-produce a plant hypersensitivity inducing polypeptide or protein having better plant disease resistance and plant growth prompting effect than conventional harpins. .

Therefore, as a result of assaying the bioactive effect of the plant-induced hypersensitivity polypeptide or protein, plant disease resistance by induction resistance to cucumber powdery mildew, pepper blight, pepper anthracnose, melon germ disease, bell pepper blight, and rice leaf blight (plant disease) The resistance effect was higher than that of the plant-derived protein (HrpN) derived from the pathogen, and it was also observed that the protein was superior to the HrpN protein in the yield increase experiments of cucumber, pepper, bell pepper and strawberry. In addition, it was demonstrated that the novel eggplant black rot fungus WT # 3-derived plant hypersensitivity polypeptide or protein was also excellent in photosynthesis and chlorophyll content of cucumber and red pepper. Therefore, the polypeptide or protein can be used as a plant disease control agent, plant growth promoter and fertilizer.

In addition, the eggplant-derived WT # 3-derived plant hypersensitivity polypeptide or protein is excellent in the insect repelling effect against aphids and can be used as a pest repellent by conventional foliage treatment. The effect of increasing the elongation rate by seed immersion treatment can be used as a seed treatment agent which can be used by conventional seed immersion methods.

Hereinafter, the present invention will be described in more detail based on Examples, but the present invention is not limited to the following Examples.

Example 1: Isolation and Identification of Mycobacteria

1) Physiological and biochemical experiments according to Schaad's guidelines and Bergey's manual

Schaad's guidelines for the isolation and identification of pathogens from diseased tissues that exhibit dryness on branches in Chuncheon cultivated fields [Schaad, NW 1988. Initial identification of common genera. In: Laboratory Guide for Identification of Plant Pathogenic Bacteria , ed. by NW Schaad. American Phytopathological Society., Minnesot. pp. 44-59 and Bergey's manual [Lelliott, RA and Dickey, RS 1984. Genus Erwinia . In: Bergey's Manual of Systemic Bacteriology. vol. 1, pp. 469-476, Williams and Willkins Co., Baltimore / London], the results of the physiological and biochemical experiments of the genus Erwinia containing the pathogen, as shown in Table 1 below.

The isolated strains were in good agreement with E. pyrifoliae , which is generally recognized as a branched black pathogen in physiological experiments such as gelatin liquefaction, motility in 3% agar and pectate degradation.

On the other hand, biochemical demand experiments for the utilization of carbon sources showed different results in Trehalose and L-arabinose. In other words, this isolate was found to have different physiological and biochemical characteristics from the certified eggplant pathogen.

2) Morphological characteristics of separated strains

As a result of observing the morphological characteristics of the isolated strain which is separated into the same group as the recently recognized domestic eggplant pathogen ( E. pyrifoliae ) among the eggplant pathogens isolated in this laboratory by using a TEM (transmitted electro microscope) Different forms were identified with the pathogens [FIG. 1].

In other words, the genus Erwinia , which belongs to the dry blight and burn pathogens, is generally a hepatitis of the peritrichous flagella with a large number of flagella. However, in the case of the isolated strain, it did not have flagella and had a slightly elliptical form.

3) Characteristics of the isolate strains according to the growth temperature range

Turbidity was measured using Bioscreen C to determine the growth of physiological and biochemical characteristics of Erwinia pyrifoliae WT # 3 strain according to different temperature ranges. The temperature range was measured at 3 ℃ interval from 12 ℃ to 39 ℃, the difference between eggplant black dry pathogen WT # 3 and burn pathogen ATCC15580 was expressed by the growth time (doubling time) and specific growth rate (specific growth rate) [Fig. ].

As a result, the branched black blight pathogen WT # 3 grew fastest at 27-30 ℃, and the optimum temperature was 27 ℃. In particular, it grew much faster than the burn pathogen ATCC15580 at a low temperature below 20 ℃. This is due to the fact that the branched black blight pathogen WT # 3 adapts to the Chuncheon suburb, which is a lower temperature area than the other areas in winter. It is thought to have a different ecological behavior than ATCC15580.

4) Characteristics of the isolate strains according to acidity

Turbidity was measured using Bioscreen C to determine the growth according to acidity among the physiological and biochemical characteristics of eggplant black W. # 3 strain. The acidity range was measured at intervals of 0.5 from pH 5.5 to pH 9.5, and the difference between eggplant black rot pathogen WT # 3 and burn pathogen ATCC15580 was expressed as the growth time and specific growth rate at each acidity [FIG. 3].

As a result, the optimum acidity range of the eggplant black dry pathogen WT # 3 ranged from pH 7.0 to pH8.0, and the growth rate was faster at pH 7.5 or higher than the alkaline condition ATCC15580.

5) Characteristics of Isolated Strains Using Biolog System

The biolog system [BIOLOG, Hayward, CA 94545, USA] was used to examine the use of 96 different carbon and nitrogen sources in order to examine the biochemical properties of the isolates in detail. First, cells incubated at 28 ° C. for 24 hours in TSA (triptic soy agar) medium were suspended with 63% suspension in 0.4% sodium chloride, 0.03% Pluronic F-68, and 0.01% Gellan Gum solution. After incubation, it was subjected to wells containing 96 carbon and nitrogen sources. Thereafter, the cells were incubated for 24 hours in a 35-37 ° C. incubator to indicate the use of carbon and nitrogen sources that turned purple using a reader, and the values were classified by hydraulic classification.

As shown in Figure 4, only the ATCC15580, LMG2068, LMG1877, LMG1946 and ea246 (US) strains of the burn pathogens appeared in the same group. On the other hand, the isolated strain was found in the same group as the eggplant black blight pathogens (Ep4, Ep8, Ep16). That is, it was found that the isolated strain is a species different from burn hospital.

6) 16S rRNA Gene Analysis of Isolated Strains

In order to determine the phylogenetic location of the isolated strain, we analyzed the nucleotide sequence of 16S rRNA gene which is essential for life phenomena, its nucleotide sequence is relatively well preserved, and is easy to analyze statistically. First, the fD1 primer shown in SEQ ID NO: 1 and the rP2 primer shown in SEQ ID NO: 2 were amplified by PCR. Then, the nucleotide sequence was analyzed by cloning using the pGEM-T vector system.

The analyzed nucleotide sequence is a mega program [Kumar, S., Tamura, K. and Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.0. The Pennsylvania State University, University Park.] Shows that the schematic diagram is shown in Fig. 5, and the similarity of the isolate is higher than that of burn pathogen with 98.9% similarity to the E. pyrifoliae Ep16. Similarly appeared.

The similarity of 16S rRNA gene between each strain is shown in Table 2 below.

In addition, 16s rRNA gene analysis showed that the isolated strains were found in the same group as E. pyrifoliae , while E. amylovora , a burn pathogen, and apple brown leaf spot pathogen ( Enterobacter pyrinus) reported to occur in apple pears in Korea a few years ago . And appeared in a different group.

7) 16S-23S Intergenic Spacer Region Analysis of Isolated Strains

In order to analyze ISR of domestic eggplant pathogens and foreign burn pathogens, R16-1F shown in SEQ ID NO: 3 and R23-1R primers shown in SEQ ID NO: 4 were amplified by PCR. Then, after cloning using the pGEM-T vector system, the base sequence was analyzed. As a result, it was divided into two groups. In other words, E. amylovora had three types of band patterns of about 1215, 970, and 720 bp size, while E. pyrifoliae had two types of band patterns of 970 and 720 bp.

Currently, all strains of these two groups were found to have a tRNAAla region of about 70 bp in size and 970 bp to include a tRNAGlu region, and analyzed the nucleotide sequences of E. amylovora ATCC15580 and isolates. The result of the schematic diagram is as shown in FIG. 6.

As a result of analyzing the sequencing of the 970 bp band encoding the tRNAAla region of the ITS region, the isolated strains were found to be different from those of the burn pathogen group. Appeared. However, the tRNAAla region of Erwinia pyrifoliae , known as the eggplant black blight pathogen, was not registered and could not be compared.

As a result of analyzing the sequence of 720 bp encoding the tRNAGlu region, the isolated strains showed similarity of 85.2-92.7% with the eggplant black blight pathogen ( Erwinia pyrifoliae ) published by the German team [Fig. 7].

8) Analysis of Eggplant Pathogens by Plasmid Profile

As a result of separating and analyzing the plasmids of domestically black blight and foreign burn pathogens, they were separated into two groups [FIG. 8].

Group I-Burn pathogen E. amylovora (ATCC15580, LMG1877, 10296) (> 29 kb)

Group II-Eggplant black blight pathogen E. pyrifoliae (ep1, ep16, WT # 3)

(> 3 within 29 kb, 5 kb, 2-4 kb)

That is, only one plasmid larger than 29 kb exists in the burn pathogen group, but five plasmids exist in the E. pyrifoliae group including the isolated strain.

9) DNA similarity analysis by DNA-DNA hybridization

The overall genome similarity between domestic and black blight and foreign burn pathogens was investigated. In this method, purely isolated whole DNA was quantified at 1 ng / μl, 10 N NaOH was added, and the DNA was boiled at 80 ° C. for 10 minutes to denature the DNA. Then, DNA was used as a probe using a DIG-High Prime system (Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany), followed by prehybridization at 49 ° C. for 3 hours with DNA attached to a nylon membrane. after that induce hybrid die hybridization reaction for 16 hours at the same temperature. The reaction membrane was assayed using DIG cold light detection kit (Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany).

As a result, group I belonged to foreign burn pathogens ( E. amylovora ATCC15580, LMG1877, LMG1946, LMG2068), and group II included branched black pathogens ( E. pyrifoliae Ep16, WT # 3). In other words, foreign burn pathogens were group I and domestic eggplant pathogens were divided into group II. This suggests that, unlike foreign burn hospital strains, domestic branched black pathogen strains are indigenous to Korea. The results are expressed in similarity as shown in Table 3 below.

In summary, the biochemical, physiological and genetic characteristics of the isolated strains were characterized by the physiological and biochemical characteristics according to Schaa's manual and Bergey's manual, temperature and acidity characteristics, biolog system, 16S rRNA gene, 16S- 23S ISR, plasmid profile, and total DNA similarity experiments showed that all of them were in the same group as E. pyrifoliae , which was recently reported only in Korea in 1999, but had some other characteristics. In particular, the characteristics of non-flagella, which do not have a flagella, are considered to be morphologically differentiated from eggplant pathogens. Thus, the isolated strain was named as eggplant black blight pathogen WT # 3 ( Erwinia pyrifoliae WT # 3 ) . It was deposited with the Korea Microorganism Conservation Center on June 11, 2001. The accession number is KCCM 10283.

Example 2 Specific Protein Characteristics and Genes Encoding the Sensitizing Responses of Plant-Derived Responses from Eggplant Black Bacterial Pathogen WT # 3

1) Genetic analysis of plant hypersensitivity reactions from WT # 3

In order to analyze genes encoding specific proteins that induce plant hypersensitivity reactions, the whole DNA of WT # 3 in black blight pathogen was incubated at 37 ° C. to be partially digested with Sau 3AI enzyme. After that, 1 μl electrophoresis was performed every hour, and the degree of DNA degradation was examined. The whole DNA thus prepared was prepared as insert DNA, and the ligation was induced by incubating the pLAFR3 cloning vector digested with Bam HI enzyme with DNA ligase at 14 ° C. for 12 hours. One complete plasmid DNA with the inserted DNA and the vector was transferred into bacteria by chemical transformation method to HB101 ( E. coli ). Thereafter, 2,000 colonies formed by incubating for 24 hours at 37 ° C. in Luria agar medium containing tetracycline (30 mg / ml) were selected to prepare a genomic DNA library.

In order to select clones encoding the plant hypersensitivity response specific proteins from the genetic library of the selected branched black pathogen WT # 3, the whole protein was extracted from each clone. As a method, 5 mM MES buffer and 0.1 mM PMSF solution were added to the pellet obtained by centrifuging the culture solution incubated in LB medium for 12 hours, and then ultrasonically pulverized and boiled at 100 ° C. for 10 minutes. Subsequently, only the supernatant obtained by centrifugation was injected into the back vein of the leaf ( Nicotiana tabacum L. Samsun) leaf whose leaf size was 4 or more leaves and over 15 cm in diameter. After 24 hours, the necrosis appearing on the tobacco leaf was irradiated with hypersensitivity (HR) to select a clone [FIG. 9].

After cloning the 8.5 kb DNA fragment containing the gene that induces plant hypersensitivity from the selected clones into the pUC19 vector, a gene map was generated using restriction enzymes [FIG. 10].

In addition, the result of comparing the similarity with the hrpN gene of the image pathogen ( E. amylovora ATCC15580) by analyzing the nucleotide sequence of the selected gene is shown in FIG.

As a result of analyzing the gene encoding the plant sensitization response inducing protein from the eggplant black blight pathogen WT # 3 according to the present invention, a size of 1287 bp was obtained. The 1287 bp was named "WT # 3-derived plant hypersensitivity induction gene" to investigate the similarity with the hrpN gene (1212 bp) of the E. amylovora ATCC15580. As a result, the plant hypersensitivity inducing genes of WT # 3 were 222 to 230 bp (TTTAACGGG), 249 to 263 bp (TGGCGGCGGTCTGCT), 327 to 333 bp (TCTGGGT), 348 to 371 bp (CGGCATTGGCGGCGGCATTGGTGG), and 397 to 411 bp The fragments were inserted at the (ACCGTGGGGACCTCT) position, indicating that the gene size was increased. On the other hand, the similarity with the hrpN gene of burn pathogen was 83.2%. Therefore, the gene encoding the plant hypersensitivity induction protein of the branched black pathogen WT # 3 not only has a different nucleotide sequence from that of the existing burn pathogen, but also contains several new nucleotide sequence fragments. It clearly had a new gene structure that could not be found in the hrpN gene. The base sequence of the gene encoding the plant hypersensitivity reaction protein of the eggplant black rye pathogen WT # 3 is as shown in SEQ ID NO: 5.

2) Preparation of plant hypersensitivity reaction protein expression vector of eggplant black blight pathogen WT # 3

The selected branch black pKEP3 expression gene containing the selected gene was extracted as follows to extract and purify a large amount of plant hypersensitivity protein from the gene encoding the plant hypersensitivity induction protein of Bacterial pathogen WT # 3.

E. coli recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) was used to prepare the expression vector pKEP3. The system is derived from the pBR322 plasmid, where an operator can be attached to the T7 promoter and lac repressor before the external gene insertion site. This facilitates the expression of an external insertion gene to be expressed in large amounts by T7 RNA polymerase produced in the genome of Escherichia coli used as a host. In particular, when IPTG, which is used as a substrate, is added after 3 hours of culture, a large amount of protein is synthesized because the lac repressor generated from the lacI gene and the IPTG do not control the role of the T7 polymerase. In addition, ampicillin resistance genes are included to distinguish those that are not ligation or untransformed into E. coli, which are selected markers by adding ampicillin to the medium when selecting completed transformants. Can be used as

Genes encoding plant hypersensitivity reaction protein derived from black blight pathogen WT # 3 and the plasmids of the recombinant E. coli recombinant protein system were incubated for 12 hours at 37 ° C with restriction enzymes Nde I and Bam HI and the 5 'and 3' ends of DNA This was formed in the same form. After that, the DNA ligase was incubated at 14 ° C. for 16 hours to induce ligation, and transferred into E. coli by chemical transformation.

The pKEP3 has an ampicillin resistance gene and is used as a selective marker, and has a His tag, which is easy to purify, and has a strong T7 lac promoter, so that a large amount of protein can be produced from the inserted DNA.

E. coli (pKEP3) transformed by introducing the expression vector into Escherichia coli was deposited with the Korea Microorganism Conservation Center on June 11, 2001. The accession number is KCCM 10282.

On the other hand, as a control for the bioactivity test of pKEP3, hrpN gene of E. amylovora ATCC15580 was cloned into the same E. coli recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) and used in this study.

3) Plant hypersensitivity induction protein expression

To produce large amounts of protein from transformed Escherichia coli (pKEP3; KCCM 10282), chloramphnicol as a selective marker to inhibit the synthesis of ampicillin (50 μg / ml) and other proteins made in the genome of E. coli itself (33 g / ml) was inoculated with the transformant (KCC 10282) to the LB medium added to the secondary culture (subculture) for 12 hours at 37 ℃, and then cultured for 7 hours at 30 ℃. At this time, when the OD value of the transformant was about 0.6 hours after 3 hours, IPTG 0.4 mM was added, and the temperature was lowered to 30 ° C. and incubated for 4 hours. After incubation for 7 hours in total, centrifugation (6,000 rpm, 15 minutes) was performed, and the supernatant was discarded. Only pellets were mixed with 5 mM MES buffer and 0.1 mM PMSF. The mixed transformant (KCCM 10282) was ultrasonically sonicated until the mixed solution became clear and boiled at 100 ° C. for 10 minutes. Thereafter, centrifugation was performed at 15,000 rpm for 10 minutes, and only the supernatant was added with a protein inhibitory cocktail at a ratio of 1 / 1,000, filtered through a 0.45 μm filter, and the amount of extracted protein was quantified.

Produced from transformants containing pKEP3 plasmid containing a gene encoding a plant hypersensitivity inducing protein derived from eggplant black E. pyrifoliae WT # 3; KCCM 10283 produced through the above process (KCCM 10282) The plant hypersensitivity inducing protein was named Pioneer.

On the other hand, as a control protein for the bioactivity test of pioneer, the HrpN protein expressed by cloning the same E. coli recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) using the hrpN gene of E. amylovora ATCC15580 for pKEP3 was used. It was used for the experiment under the same conditions.

As a result, as shown in Fig. 12, both genes encoding the plant sensitization-inducing protein of E. amylovora ATCC15580 cloned into the expression vector pKEP3 and the eggplant black blight pathogen WT # 3 according to the present invention It was confirmed that the plant-sensitive protein of.

4) Analysis of plant hypersensitivity reaction protein similarity of WT # 3

The amino acid sequence of the purified plant hypersensitivity inducing protein was analyzed and its similarity was compared with that of the plant hypersensitivity protein of E. amylovora ATCC15580 [FIG. 13].

As a result, the protein is 76-79 (Thr-Gly-Leu-Leu), 88-92 (Leu-Gly-Gly-Gly-Ser), 102-113 (Gly-Leu-Gly-Gly-) from the N-terminal. It was found that new protein structures were made at the Leu-Gly-Gly-Asp-Leu-Gly-Ser-Thr) and 131-137 (Gly-Ala-Thr-Val-Gly-Thr-Ser) positions. In addition, it showed a low similarity with HrpN protein of 85.9%, and the molecular weight was 41.1 kD for pioneer, while HrpN protein was 39.7 kD [this was not compared with molecular weight standard on acrylamide gel, but compared with the gene base sequence. From the molecular weight of each deduced amino acid using the Winstar program.

Therefore, the new protein was formed by the insertion of new nucleotide sequence fragments, and this change is thought to have a superior effect on bioactivity than the HrpN protein.

5) Hypersensitivity of plant-induced reaction protein (HR)

To date, plant hypersensitivity inducing protein acts as a pathogenic factor in host plants, and is known to induce HR in non-host plants. In other words, hypersensitivity induction can be indirectly interpreted as having pathogenicity in host plants. Therefore, the plant hypersensitivity induction protein (Pioneer) derived from the eggplant black E. pyrifoliae WT # 3, plant hypersensitivity protein (HrpN) derived from the burn pathogen ( E. amylovora ATCC15580), and MES buffer as a protein lysis buffer as a control Tobacco leaf veins as a stock was inoculated using a syringe [Fig. 14].

As shown in FIG. 14, in the case of pione, which is an inducer of the branched black pathogen WT # 3, HR response was clearly observed at the level of 10 ㎍ / ml on the front side of the tobacco leaf, whereas the plant hypersensitivity protein of the burn pathogen ATCC15580 was In the case of HrpN, the HR response was specifically observed at the 20 ㎍ / ㎖ level. On the back of the same leaf, the HR response was clearly observed at the pioneer level at 5 ㎍ / ㎖, and the HR response was observed up to 10 ㎍ / ㎖ at HrpN protein. In other words, pioneer was observed to induce an HR response at a lower concentration and faster than HrpN protein.

On the other hand, as shown in Table 4, in the case of pioneer, as shown in Table 4, HR responses were clearly observed at 5 ㎍ / ml and 10 ㎍ / ml levels after 24 and 14 hours of inoculation respectively, and 48 hours at the same concentration for HrpN protein, respectively. After 18 hours, HR response was observed. In other words, the pioneer showed an HR response that was 24 hours faster than the HrpN protein at the concentration of 5 μg / ml, and 4 hours faster at the concentration of 10 μg / ml.

This experiment was repeated three times, indicating that pioneer induces the plant's immune system faster and at a lower concentration than the HrpN protein.

6) Pathogenicity test of embryos of plant hypersensitivity reaction protein (Pioneer) derived from eggplant black blight pathogen

Purified pioneer was inoculated with a groove of fruit diameter of 0.5 mm and a depth of 10 mm on the surface of young embryos at a concentration of 500 µg / ml.

As shown in FIG. 15, it was observed that the young flesh became black after 4 days compared to the control treated with the buffer only. In other words, host plants have demonstrated strong pathogenicity.

To summarize the characteristics of the pioneer and the gene encoding the above, the gene encoding the plant hypersensitivity inducing protein of the branched black pathogen WT # 3 is inserted at several sites that cannot be found in the hrpN gene. In comparison, the hrpN gene was 1,212 bp in size, whereas the present gene was largely 1,287 bp. In many parts of the protein structure, HrpN protein was 39.7 kD, whereas the pioneer increased its molecular weight to 41.1 kD by forming a new type of peptide [this was not compared to the molecular weight standard on acrylamide gels, but from the Wins program. To represent the molecular weight of each deduced amino acid]. In particular, the HR response to tobacco was observed to induce the plant's immune system faster and at lower concentrations than the HrpN protein. The plant hypersensitivity-induced protein of WT # 3 in black blight pathogen is considered to be suitable for the development of plant-induced biochemical pesticides superior to the burn-derived protein.

Example 3 Bioactivity Study of Plant Hypersensitivity Induction Protein (Pioneer) of Eggplant Black Bacterial Pathogen WT # 3

1) Cucumber powdery mildew ( Sphaerotheca fuliginea Control effect test

In order to test the control effect of the plant hypersensitivity induction protein (Pioneer) from the black blight pathogen against cucumber powdery mildew, the gene encoding the plant hypersensitivity induction protein was cloned into pKEP3 vector to purify the protein.

Cucumber packaging was rain-cultivated according to the farming practices cultivation method, and test plots were placed in accordance with three repetition of the egg mass method. The treatment concentration of the induced protein was foliage treatment at 20 ㎍ / ㎖ concentration recorded as the optimal concentration of cucumber by EDEN Bioscience.

Messenger, a formulation from EDEN Bioscience, as a control Was treated at the same concentration. In addition, panari (chemical pesticide), which is already registered as a cucumber powdery mildew medicine in Korea, was treated to the foliage according to the instructions for use.

The treatment method is as follows;

① 3 times treatment group-Meal, Pioneer and EDEN Bioscience's Messenger, every 10 days at the onset of cucumber powdery mildew Fena, a chemical pesticide, was treated three times each.

② 4 times treatment group-Messenger, Pioneer and EDEN Bioscience's formulation after 7, 21, 35 and 49 days Fena, a chemical pesticide, was treated three times each.

The incidence index of cucumber powdery mildew naturally occurring in cucumbers treated as described above was determined from their upper 8 to lower 3 lobes (0: onset, 1: 1 to 5%, 2: 5.1 to 20%, 3: 20.1). -40%, 4: 40% or more) after 7 days of the final drug treatment.

As shown in Table 5, Pioneer is a messenger of EDEN Bioscience Co., Ltd. It is expected to use 122.6% and 187.0% control effect in both 3 and 4 treatment groups, respectively.

2) Cucumber yield increase test

To investigate the yield increase of cucumbers by pioneer treatment, Pioneer was treated with five leaves at 20 ㎍ / mL concentration five times at intervals of 14 days before the formulation. Also, as a control, the protein (HrpN) derived from the burn pathogen ( Erwinia amylovora ATCC15580) was foliage-treated at the same concentration.

The survey period was harvested at 8, 10, 12, 14, 16, 18, 21, 23, 25, 30 days after the establishment. Judging that the length of the harvested cucumber is 20 cm or more can be commercialized and expressed as a commodity rate.

As a result, Pioneer increased its product yield by 8.1% compared to untreated and 4.6% compared to HrpN protein. It is believed that the composition (Pioneer) can be used as a plant growth promoter and fertilizer.

3) Cucumber photosynthesis and chlorophyll content increase assay

To investigate the changes in physiological responses of cucumbers by pioneer, that is, increase in photosynthesis and chlorophyll content, Pioneer was treated with five leaves at 20 ㎍ / ml at 7 days before the formulation. As a control, HrpN protein was also foliage treated at the same concentration.

The irradiation period was 34, 42 and 56 days after the establishment by using a portable photosynthesis measuring instrument (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1500 μmole) and chlorophyll meter SPAD-502, Minolta, Japan. Investigate.

Pioneer treatment of cucumber showed that the photosynthetic and chlorophyll contents were 16.2% and 5.4% higher than untreated and 9.8% and 2.0% higher than HrpN protein, respectively. Therefore, Pioneer can be used as a plant growth promoter and fertilizer.

4) pepper blight Phytophthora capsici Control effect test

To test Pioneer's control against pepper blight, the gene encoding plant hypersensitivity induction protein was cloned into pKEP3 vector to purify the protein.

The red pepper packaging was carried out in the open field according to the farming practices cultivation method, and the treatment concentration was the foliage treatment of Pioneer at 40, 20, 10 ㎍ / ml. In addition, the control was compared by treating the HrpN protein at the same concentration.

The treatment method is as follows;

① After planting, the leaves were treated with Pioneer and HrpN protein at 8 and 12 days.

After inoculating 2 × 10 ⁶ cells / ml of pepper blight bacteria into the pepper treated as described above, the onset index was displayed after 63 days.

As shown in Table 8, the control value of 10 μg / ml of Pioneer was higher than the 40 μg / ml of HrpN protein. It is thought that Pioneer can be used as a plant disease control agent that can show better control effect than HrpN protein even at low concentration.

5) pepper anthrax ( Colletotrichum orbiculare Control effect test

To test Pioneer's control effect on pepper anthrax, the genes encoding plant hypersensitivity-induced protein were cloned into pKEP3 vector to purify the protein.

The red pepper packaging was carried out in the open field according to the farming practices cultivation method, and the treatment concentration was the foliage treatment of Pioneer at 40, 20, 10 ㎍ / ml. In addition, the control was compared by treating the HrpN protein at the same concentration.

The treatment method is as follows;

① After planting, the leaves were treated with Pioneer and HrpN protein at 8 and 12 days.

Fruits implanted after 20, 27, 34, and 40 in peppers treated as described above were represented by two fruits and healthy fruit, and represented by two fruits.

As a result, Pioneer showed 14.3% higher control value than HrpN protein in pepper anthracnose, which is expected to be used as a plant disease control agent.

6) Pepper yield increase test

To investigate the yield increase of red pepper by Pioneer treatment, Pioneer was treated at 10 µg / ml after 8 and 12 days. As a control, HrpN protein was also foliage treated at the same concentration.

The treatment method is as follows;

① Soaking + spraying method: Pioneer and HrpN proteins were diluted in MES buffer at 10 ㎍ / ml, soaked at 28 ℃ for 24 hours, sown in pots containing soil and grown for 46 days. Then, 8 and 12 days later, Pioneer and HrpN protein were treated with leaves.

The survey period was harvested at 18, 25, 32, 39 and 46 days after the establishment.

As a result, it was found that Pioneer increased the control effect of 22.7% over HrpN protein. It is expected that Pioneer can be used as plant growth promoter and fertilizer.

7) Red pepper photosynthesis and chlorophyll content increase assay

To investigate the changes in physiological response, ie photosynthesis and chlorophyll content of red pepper by Pioneer, Pioneer was treated with five leaves at 20 ㎍ / ml at regular intervals of 7 days before 14 days. As a control, HrpN protein was also foliage treated at the same concentration.

Irradiation time was measured at 34, 42 and 56 days using a photosynthesis measuring instrument (LCA-4 system, ADCBioScientific Ltd., UNK; light source: 1,500 μmole) and chlorophyll meter SPAD-502, Minolta, Japan. .

After the Pioneer treatment of red pepper, photosynthesis and chlorophyll content were measured, which were 16.0% and 6.7% higher than untreated and 7.5% and 4.9% higher than HrpN protein, respectively. Therefore, Pioneer is expected to be used as a plant growth promoter and a fertilizer.

8) Melon fungal disease ( Pseudoperonospora cubensis Control effect test

In order to test Pioneer's control against melon fungal disease, the genes encoding plant hypersensitivity inducing protein were cloned into pKEP3 vector to purify the protein.

Treatment concentrations were treated with 40 ㎍ / ㎖ Pioneer concentration, and compared to the control was treated with the same concentration of HrpN protein.

The treatment method is as follows;

① Soaking + spraying method: Pioneer and HrpN protein was diluted in MES buffer, soaked melon seeds for 24 hours at 28 ℃ and planted in pots, 17 days, 28 days later, the leaves were treated with Pioneer and HrpN protein.

② spraying method: After planting, 17 days and 28 days after pioneer and HrpN protein was foliage treatment.

The incidence index of naturally occurring melon fungal disease in addition to the melon treated as described above was displayed after 55 days.

As shown in Table 12, Pioneer is expected to be used as a plant disease control agent by increasing the control effect of 96.0% in the spray sphere, 44.6% in the immersion + spray sphere compared to the HrpN protein.

9) green pepper plague ( Phytophthora capsici Control effect test

In order to examine Pioneer's control effect against green pepper plague, genes encoding plant hypersensitivity inducing proteins were cloned into pKEP3 vector to purify the protein.

Green pepper cultivation was carried out in a pot of 25 cm in diameter to cultivate the pest control effect in the greenhouse, and the treatment concentration was foliage treatment at 20 ㎍ / ㎖ recorded as the appropriate concentration of eggplant crops by EDEN Biosciences. In addition, the control was compared by treating the HrpN protein at the same concentration.

The treatment method is as follows;

① After planting, the leaves were treated with Pioneer and HrpN protein at 8 days.

After inoculating 2 x 10 ⁶ cells / ml of green pepper disease bacteria into the green peppers treated as above, the onset index was displayed after 45 days.

As shown in Table 13, Pioneer shows an excellent control increase rate of 87.1% compared to the HrpN protein is expected to be used as a plant disease control agent.

10) Test for Bell Pepper Yield

To investigate the increase in yield of green pepper by pioneer, Pioneer was treated with leaves at 40 ㎍ / ml after 8 days. As a control, HrpN protein was also foliage treated at the same concentration. Cultivation was planted in a 25 cm diameter pot and grown in a glass greenhouse.

The irradiation time of the green peppers treated as above was examined 41 and 45 days after the establishment.

Pioneer showed a 21.6% yield increase over HrpN protein. Therefore, Pioneer could be used as a plant growth promoter and fertilizer.

11) Strawberry yield increase test

To investigate the increase in the yield of strawberries by pioneer treatment, the leaves were grown in a plastic house at 20 ㎍ / ml Pioneer. In addition, as a control, HrpN protein was foliage treated at the same concentration.

In order to determine the increase in yield of the strawberry treated as described above, after harvesting, 30, 33, 38, 41, 48, 55 days after harvesting was expressed as the total weight value (g).

As a result, Pioneer showed 13.8% higher yield than HrpN protein. This indicates that Pioneer can be used as a plant growth promoter and fertilizer.

12) Rice Blast ( Magnaporthe grisea Control effect test

To test Pioneer's control effect on rice blast, the gene encoding plant-induced response protein was cloned into pKEP3 vector to purify the protein.

The field was grown in the field according to the farming practices, and the treatment concentration was dilute Pioneer in MES buffer at concentrations of 40, 20, 10 ㎍ / ml, soaked at 28 ° C for 24 hours, and then seeded on seedlings for 16 days. It was grown and put in test packaging. Pioneer was then foliage treated on days 45 and 52. In addition, the control was compared to HrpN protein by the same concentration and method.

The incidence index of the rice blast naturally occurring in the rice treated as described above was displayed after 85 days.

A control value of 10 µg / ml of pioneer was higher than 20 µg / ml of HrpN protein. This indicates that Pioneer can be used as an excellent plant disease control agent at lower concentrations than HrpN protein.

13) Evasion test for aphids

To test Pioneer's control effect on aphids, the genes encoding plant hypersensitivity induction proteins were cloned into pKEP3 vectors to purify proteins.

Cucumber was selected as a host crop of aphids to test the repellent effect on aphids, and the field was rain-cultivated according to the farming practices. In addition, the control was compared to HrpN protein by the same concentration and method. Treatment method was three leaves at 10-day intervals when the height of the cucumber 1m.

The number of naturally occurring aphids in cucumbers treated as above was indicated 7 days after the last drug treatment.

As a result, Pioneer increased aphid pest aversion effect by 29.4% compared to HrpN. Therefore, Pioneer could be used as a pest repellent against aphids.

14) Test to increase the rice seedling growth rate

In order to examine the effect of pioneer treatment on the growth rate of rice seedling growth, the gene encoding the plant hypersensitivity induction protein was cloned into pKEP3 vector to purify the protein.

Treatment concentration was dilution of Pioneer in MES buffer at 40, 20, 10 ㎍ / ㎖ concentration, soaked at 28 ℃ for 24 hours, seeded on seedlings and grown for 16 days to examine the height of the seedlings. In addition, the control was compared to HrpN protein by the same concentration and method.

As a result, in the seedling treated with Pioneer, the elongation of about 3 to 4 cm was increased compared to the no treatment, and it was confirmed that the 1 cm was increased compared to the HrpN protein treatment. In addition, the higher the concentration, the higher the growth rate of the kidney. As a result, the highest growth rate of the rice seedlings was obtained at the concentration of 40 ㎍ / ㎖ Pioneer. This suggests that Pioneer can be used as a seed treatment that can be treated directly on seeds to promote growth.

As described above, the present invention has isolated and identified a novel branched black blight pathogen WT # 3 (KCCM 10283), and purified the new polypeptide or protein from the branched black blight pathogen WT # 3 (KCCM 10283) As a result of analysis, plant disease resistance and plant growth promoting effect are better than those of burn-derived bacterium ATCC15580, and it is suitable for the development of plant-induced biochemical pesticides by inducing hypersensitivity reactions at low concentrations in a short time.

Therefore, the eggplant black bacterium according to the present invention is expected to be used as biochemical pesticides and fertilizers containing WT # 3 or plant hypersensitivity inducing protein (Pioneer) derived therefrom.

Claims (20)

Erwinia pyrifoliae WT # 3 [KCCM 10283], which is effective for controlling plant diseases and promoting plant growth. A gene characterized in that when contacted or treated with a plant cell, the plant cell encodes a non-infectious form of a polypeptide or protein derived from Erwinia pyrifoliae which induces hypersensitivity or resistance to the pathogen. The gene according to claim 2, wherein the DNA molecule comprises the nucleotide sequence of SEQ ID NO: 5. The gene according to claim 2, wherein the polypeptide or protein comprises an amino acid sequence corresponding to SEQ ID NO: 6. According to claim 2, wherein the black bung pathogen is egg black bung pathogen WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283] characterized in that the gene. An expression vector system comprising the gene of claim 2. The expression vector system according to claim 6, wherein the gene comprises a nucleotide sequence of SEQ ID NO. A transformant comprising the gene of claim 2. The transformant of claim 8, wherein the transformant is selected from the group consisting of plants and bacteria. A non-infectious form of polypeptide or protein derived from Erwinia pyrifoliae , in which plant cells induce hypersensitivity or resistance to pathogens when contacted or treated with plant cells. 11. The polypeptide or protein according to claim 10, wherein the Erwinia pyrifoliae bacterium is Erwinia pyrifoliae WT # 3 [KCCM 10283]. The polypeptide or protein of claim 10, wherein the polypeptide or protein contains the amino acid sequence of SEQ ID NO: 6. 12. The polypeptide or protein of claim 10, wherein the polypeptide or protein is recombinant. A biochemical pesticide composition comprising the polypeptide or protein of claim 11 and a carrier. Plant disease control agent by applying the polypeptide or protein of Claim 11. Plant growth promoting agent by applying the polypeptide or protein of claim 11. Seed treatment due to the polypeptide or protein application of claim 11. A pest repellent due to the application of the polypeptide or protein of claim 11. Fertilizers by applying the polypeptide or protein of claim 11. A method for mass production of hypersensitivity or resistant derivative polypeptides or proteins by isolating and purifying hypersensitivity or resistant derivative polypeptides or proteins from cultures of Erwinia pyrifoliae WT # 3 [KCCM 10283].