JP3976731B2 - A new biochemical pesticide that uses a gene derived from a black wilt fungus WT # 3 (KCCM10283), a novel phytopathogenic fungus that affects pear trees - Google Patents

Abstract

The present invention relates to a biopesticide using a plant pathogen, and more particularly, to a biopesticide having an improved resistance against plant pathogens and an improved plant growth effect, which is superior to that of HrpN, a plant-senstive protein isolated from Erwinia amylovora ATCC 15580, by using a gene isolated from WT#3(Erwinia pyrifoliae WT#3)[KCCM 10283] thus enabling to be used as a fertilizer as well a biopesticide.

Description

The present invention relates to a novel biochemical pesticide using a gene derived from a phytopathogenic fungus WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283], which is a novel plant pathogenic fungus isolated in the Chuncheon region of Gangwon-do, Korea. This pathogen is unique to Korea. This new biochemical pesticide is more sensitive to plant diseases, promotes plant growth and improves pest repellency than HrpN, a hypersensitive reaction-inducing protein isolated from a burn disease fungus ( Erwinia amylovora ATCC 15580 ^T ) that does not exist in Korea Is excellent. Therefore, this novel biochemical pesticide can be used not only as a biochemical pesticide effective for preventing plant diseases caused by pathogenic bacteria and pests but also as an effective fertilizer for promoting plant growth.

  Of the various problems facing humanity, the food shortage phenomenon has emerged as the most serious problem. However, crops cultivated to increase food production have been pointed out as a very serious problem because their production volume has been greatly reduced by the occurrence of pests such as pathogenic bacteria and pests. Currently, the most widely used method for controlling the spread of pests is chemical control that directly sprays bactericides and pesticides to prevent or kill pests. However, in the case of such fungicides and insecticides, the pests are directly killed, so the visible effect is fast and easy to use, but if used continuously and excessively, the chemicals in various pests Tolerance to chemical pesticides is induced. Furthermore, in the case of pesticides that are highly toxic and most effective, there is social anxiety due to environmental destruction such as serious soil and water pollution. Therefore, there is no risk of inducing any resistance to drugs while having effective agricultural chemical activity, and there is an urgent need for development of environmentally friendly biochemical agricultural chemicals.

  The most common purpose of using biochemical pesticides is to distribute the microorganisms that are hostile to the pests directly on the plant to obtain a pest control effect. The level that humans want is not reached. Therefore, recently, research has been conducted in the direction of controlling pests by a method of stimulating a plant's self-defense system using substances produced by such microorganisms instead of distributing hostile microorganisms themselves. That is, the plant body is treated with a microorganism-derived substance to activate the autoimmune function of the plant body, thereby preventing the occurrence and spread of pests.

  Plants are resistant to disease mainly by plant defense systems through structural barriers such as plant epidermal cell cuticles, wax layers and pore patterns. When a pathogen enters a plant cell, various chemical substances such as saponins and lectins secreted by the plant block the spread of the invading pathogen. [Agrios, GN 1997. Plant Pathology. 4th ed. Academic Press, New York; Dong, X. 1998. SA. JA, ethylene, and disease resistance in plants. Curr. Opin. Plant. Biol. 1: 316-323; Feys, BJ & Parker, JE 2000. Interplay of signaling pathways in plant disease resistance. Trends Genet. 16: 339-455].

  A more important resistance to plant disease is called hypersensitive reaction (HR), which is rapid and local necrosis to prevent the spread of pathogens, and some microbial-derived substances can cause plant resistance to many pathogens. Stimulate the self-defense system with active defense. [Richberg, M.H., Aviv, D.H. & Dangl, J.L. 1998. Dead cells do tell tales. Curr. Poin. PlantBiol. 1: 480-485]. The first method of resistance to plant diseases involving the induction of hypersensitive reactions is that the plant activates a system that quickly informs the cells around the site infected with the pathogen, and the surrounding cells increase resistance to the pathogen Such a defense system is called local acquired resistance (LAR).

  On the other hand, in the second method, the defense system is activated even in an uninfected part of the plant, and a stronger defense system is activated against the secondary infection in the whole plant. Such a defense system is called systemic acquired resistance (SAR), which can last for weeks or longer and is also resistant to various other pathogens that are often unrelated. [Hunt, MD, Neuenschwander, UH, Delaney, TP, Weymann, KB, Friedrich, LB, Lawton, KA, Steiner, HY and Ryals, JA 1996. Recent advances in systemic acquired resistance research-a review. Gene 179: 89-95].

In addition, other forms of plant resistance have been reported such as induced systemic resistance (ISR) and wound response to pests [Pieterse, CM, van Wees, SC, van Pelt, JA , Knoester, M., Laan, R., Gerrits, H., Weisbeek, PJ and van Loon, LC 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis . Plant Cell 10: 1571-1580; Ryan, CA and Pearce , G. 1998. SYSTEMIN: a polypeptide signal for plant defensive genes. Annu. Rev. Cell Dev. Biol. 14: 1-17].

  Such resistance mechanisms against plant diseases are all triggered by inducers that induce plant defense systems [Kessmann, H., Staub, T., Hofmann, C., Maetzke, T., Herzog, J., Ward, E., Uknes, S. and Ryals, J. 1994. Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol. 32: 439-459]. Typical SAR inducers include salicylic acid (SA), a phenolic signal transmitter produced by plants, and erycithin and harpin isolated from pathogenic bacteria [Ponchet, M., Panabieres, F., Milat, ML, Mikes, V., Montillet, JL, Suty, L., Triantaphylides, C., Tirilly, Y. and Blein, JP 1999. Are elicitins cryptograms in plant-oomycete communications.Cell Mol. Life Sci. 56: 1020-1047].

  Harpin is the general name of a protein produced from the hrp gene population of a plant pathogenic fungus. HrpN, a kind of Harpin, is an abbreviation of Erwinia amylovora, a burn fungus that does not exist in Korea. It is a protein produced from the hrpN gene located in the 40 kb hrp gene population. When HrpN is inoculated into a host plant such as an apple, HrpN acts as a virulence factor that causes burn disease, but when given to a non-host plant, it is recognized as a foreign substance in the plant and is a resistance that is a hypersensitive reaction (HR). Act the sex mechanism.

The HrpN protein is acidic and stable to heat (100 ° C.) and has a molecular weight of 44 kDa [electrophoresed on an acrylamide gel, then stained with 0.025% Coomassie Blue R-250, Bio-Rad Molecular Weight Standard (Catalog # 161-0305, Bio-Rad Laboratories, 2000 Alfred Nobel Drive Hercules, CA 94547, USA)] with high glycine content but no cysteine [Zhong-Min, W., Laby, RJ, Zumoff, CH, Bauer, DW, He, SY, Collmer, A. and Beer, SV 1992. Harpin, elicitor of the hypersensitive response produced by the Plant pathogen Erwinia amylovora . Science 257: 85-88; US Pat. No. 6,001,959; US Pat. No. 5,850,015; US Pat. No. 6,172,184, B1; US Pat. No. 6,174 717B1; U.S. Pat. No. 5,849,868 U.S. Pat. No. 6,977,060; U.S. Pat. No. 5,859,324; U.S. Pat. No. 5,776,889; Korean Patent Publication No. 1999-022577; Korean Patent Publication No. 2000-075751; Korean Patent Publication No. 2000-070495; Korean Patent Publication No. 2000-057395].

Substances that induce these plant defense systems are currently commercially available in various pharmaceutical forms. That is, since it has been reported that salicylic acid (SA) is an inducer of SAR, INA (2,6-dichloroisonicotinic acid) and BTH (benzoic acid) having a structure similar to SA are reported. Thiadiazole (benzothiadiazole) was also found to induce SAR, and after being registered as a plant active substance, it is now under the names Actigard (trademark) and BION (trademark) to prevent diseases of foliage plants, tomatoes and tobacco It is sold in the US and Europe. In Japan, PBZ (probenazole) is sold under the name Oryzemate (registered trademark) as a rice blast and white leaf blight control agent [Yoshioka, K., Nakashita, H., Klessig , DF and yamaguchi, I. 2001. Probenazole induces systemic acquired resistance in Arabidopsis with a novel type of action. Plant J. 25: 149-157].

In particular, Harpin, the first gram-negative bacterium in Erwinia amylovora , that causes burn disease in Rosaceae plants, is not a chemical but a protein, and when sprayed directly on plants, Acts as a SAR inducer to control various plant diseases, some pests, mites and nematodes, promotes photosynthesis and nutrient absorption and promotes plant vegetative and reproductive growth (PGP) growth prompting) (Dong, HS, Delaney, TP, Bauer, DW and Beer, SV 1999. Harpin induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene. Plant J. 20: 207-215]. In addition, Harpin (HrpN) protein has almost no toxicity and is a protein, so it is biologically degraded early after use, and is characterized by no risk of contaminating the environment. However, it is reported that the preparation is easy because it is not destroyed [Zhong-Min, W., Laby, RJ, Zumoff, CH, Bauer, DW, He, SY, Collmer, A. and Beer, SV 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora . Science 257: 85-88].

Therefore, in 2000, Eden Bioscience, a new venture company in the US, commercialized HrpN protein, a plant hypersensitive reaction-inducing protein derived from a burn fungus, under the trademark Messenger (trademark). It is commercially available in the United States for controlling diseases of crops such as cotton, tomato, tobacco, pepper, cucumber, strawberry and wheat. That is, the HrpN protein is recognized as a biopesticide such as an antifungal agent, antibacterial agent, antiviral agent, insect repellent, and plant growth promoter [US Pat. No. 6,174,717 B1; US Pat. U.S. Pat. No. 6,977,060; U.S. Pat. No. 5,859,324; U.S. Pat. No. 5,776,889; Korean Patent Publication No. 1999-022577; No. 2000-075751; Korean Patent Publication No. 2000-070495; Korean Patent Publication No. 2000-057395].
US Pat. No. 6,001,959 US Pat. No. 5,850,015 US Pat. No. 6,172,184B1 US Pat. No. 6,174,717 B1 US Pat. No. 5,849,868 US Pat. No. 6,977,060 US Pat. No. 5,859,324 US Pat. No. 5,776,889 Korean Patent Publication No. 1999-022577 Korean Patent Publication No. 2000-075751 Korean Patent Publication No. 2000-070495 Korean Patent Publication No. 2000-057395 Agrios, GN 1997. Plant Pathology. 4th ed. Academic Press, New York Dong, X. 1998. SA. JA, ethylene, and disease resistance in plants. Curr. Opin. Plant. Biol. 1: 316-323 Feys, BJ & Parker, JE 2000. Interplay of signaling pathways in plant disease resistance.Trends Genet. 16: 339-455 Richberg, MH, Aviv, DH & Dangl, JL 1998. Dead cells do tell tales. Curr. Poin. PlantBiol. 1: 480-485 Hunt, MD, Neuenschwander, UH, Delaney, TP, Weymann, KB, Friedrich, LB, Lawton, KA, Steiner, HY and Ryals, JA 1996. Recent advances in systemic acquired resistance research-a review. Gene 179: 89-95 [Pieterse, CM, van Wees, SC, van Pelt, JA, Knoester, M., Laan, R., Gerrits, H., Weisbeek, PJ and van Loon, LC 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis Plant Cell 10: 1571-1580 Ryan, CA and Pearce, G. 1998. SYSTEMIN: a polypeptide signal for plant defensive genes. Annu. Rev. Cell Dev. Biol. 14: 1-17 Kessmann, H., Staub, T., Hofmann, C., Maetzke, T., Herzog, J., Ward, E., Uknes, S. and Ryals, J. 1994. Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol. 32: 439-459 Ponchet, M., Panabieres, F., Milat, ML, Mikes, V., Montillet, JL, Suty, L., Triantaphylides, C., Tirilly, Y. and Blein, JP 1999. Are elicitins cryptograms in plant-oomycete communications. Cell Mol. Life Sci. 56: 1020-1047 Zhong-Min, W., Laby, RJ, Zumoff, CH, Bauer, DW, He, SY, Collmer, A. and Beer, SV 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257 : 85-88 Yoshioka, K., Nakashita, H., Klessig, DF and yamaguchi, I. 2001.Probenazole induces systemic acquired resistance in Arabidopsis with a novel type of action.Plant J. 25: 149-157 Dong, HS, Delaney, TP, Bauer, DW and Beer, SV 1999. Harpin induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene.Plant J. 20: 207-215

Therefore, the present inventors have isolated and identified pathogenic bacteria from diseased tissues of plants showing the symptoms of branch dying in the apple and pear cultivation areas in the Chuncheon region of Korea, and recently reported by German researchers. was Edakuro blight (Erwinia pyrifoliae) and morphologically distinct novel Edakuro blight (Erwinia pyrifoliae) found WT # 3 (KCCM 10283). That is, Erwinia pyrifoliae WT # 3 (KCCM 10283) does not have flagella, but the German branch reported that Erwinia pyrifoliae has periflagellate flagellum. In addition, Erwinia pyrifoliae WT # 3 (KCCM 10283) was also different from the known burn fungus (Erwinia amylovora). From this new strain, genes and proteins that induce plant hypersensitive reactions in non-host plants have been isolated and are superior in plant disease resistance and plant growth-promoting effects to pathogens and pests than HrpN derived from Erwinia amylovora It was clarified that the present invention was completed.

Accordingly, an object of the present invention is to provide a novel Erwinia pyrifoliae WT # 3 (KCCM10283) and an effective biochemical pesticide, plant growth promoter, seed treatment agent, pest repellent and fertilizer using the same. It is to provide.

In one embodiment of the present invention, when a plant cell is contacted with or treated with the gene, a black blight fungus that induces a hypersensitive reaction to a non-host or resistance to a pathogenic fungus in a plant ( A gene (KCCM10282) encoding a non-infectious form of a protein or polypeptide derived from Erwinia pyrifoliae ) is provided.

Further, in another embodiment of the present invention, a transformant comprising a gene encoding a polypeptide or protein in a non-infectious form derived from E. coli WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM10283] is provided. .

  Furthermore, in another embodiment of the present invention, a biochemical pesticide composition comprising the polypeptide or protein and a carrier is provided.

  Furthermore, the other embodiment of this invention provides the said composition which can be used for an agrochemical, a plant growth promoter, a seed treatment agent, a pest repellent, a fertilizer, etc.

Furthermore, in another embodiment of the present invention, a strain of black wilt fungus WT # 3 ( Erwinia pyrifoliae WT # 3, KCCM 10283) and a black wilt fungus WT # 3 ( Erwinia pyrifoliae WT # 3, KCCM 10283) are derived. A polypeptide or protein that induces a hypersensitive reaction or resistance is isolated from a transformant (KCCM 10282) containing a plant hypersensitive reaction (HR) inducing gene of the strain and purified to induce the hypersensitive reaction or resistance. Methods for mass production of the polypeptide or the protein are provided.

A novel bacterial wilt fungus WT # 3 ( Erwinia pyrifoliae WT # 3, KCCM10283) in the present invention was isolated and identified, and a new protein or polypeptide translated from a plant hypersensitive reaction inducing gene (KCCM10282) was purified, As a result of analyzing the protein, it was found that the protein is more resistant to plant disease resistance, promotes plant growth, repels insects, increases photosynthesis and chlorophyll, and seeds than Erwinia amylovora ATCC 15580 ^T- derived protein (HrpN) It is highly suitable for the development of new and excellent plant hypersensitive reaction-inducing biochemical pesticides because of its excellent treatment effect and early induction of plant hypersensitive reactions at low concentrations.

Accordingly, the present invention is a new and improved method comprising a black wilt fungus WT # 3 ( Erwinia pyrifoliae WT # 3) or a plant hypersensitive reaction-inducing protein derived therefrom (hereinafter referred to as “Pioneer”). It is very useful for developing biochemical pesticides and fertilizers.

Hereinafter, the present invention will be described in more detail. The novel branch blight fungus WT # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283] according to the present invention is isolated from a diseased trunk exhibiting the condition of branch dying in apple and pear cultivation estates in Gangwon-do, Korea. As a result of the identification, Erwinia amylovora which is a burn fungus and Erwinia pyrifoliae which is a black blight fungus (Apple pear blight; Erwinia pyrifoliae reported by a German research team in 1999) and a new species belonging to the same genus Erwinia Identified. Erwinia amylovora and a German research team reported by Erwinia pyrifoliae have periflagellate flagellum, but a new fungus WT # 3 ( Erwinia pyrifoliae WT # 3 ) [KCCM 10283] does not have flagella and has a great morphological difference from Erwinia pyrifoliae, which exists only in Korea. The new strain was named WB # 3 ( Erwinia pyrifoliae WT # 3) [KCCM 10283], deposited at the Korean Preservation Center on June 11, 2001, and assigned the accession number KCCM 10283. .

In particular, a gene encoding a protein (elicitor; inducer) that induces a hypersensitive reaction in a non-host plant was isolated from a branch blight fungus WT # 3 ( Erwinia pyrifoliae WT # 3). Compared with the hrpN gene encoding the HrpN protein marketed by Eden Bioscience co., The analysis results in a new kind of gene having a low similarity to the hrpN gene encoding HrpN. I understood. In particular, several nucleic acid sequence fragments have been inserted into a gene encoding a protein that induces a hypersensitive reaction in a non-host plant derived from the shoot blight fungus WT # 3 ( Erwinia pyrifoliae WT # 3). The sequence fragment was not present in the hrpN gene from E. amylovora . More specifically, the fragment was inserted at positions 222-230 bp, 249-263 bp, 348-371 bp and 397-411 bp. Therefore, the polypeptide or protein produced from this gene has an amino acid sequence and molecular weight different from the amino acid sequence and molecular weight of the HrpN peptide.

In addition, pKEP3 which is a high expression vector containing the gene derived from the said strain ( Erwinia pyrifoliae WT # 3) was constructed, and this was transformed into Escherichia coli. This transformant was deposited with the Korean Preservation Center on June 11, 2001 and assigned the deposit number KCCM10282.

Plant hypersensitive reaction superior in effects such as resistance to plant diseases, promotion of plant growth and improvement of pest repellent than conventional HrpN derived from E. amylovosa by culturing a transformant containing the expression vector in large quantities And polypeptides or proteins that induce disease resistance can be produced in large quantities.

As a result of assaying the biological activity effect of the polypeptide or protein that induces plant hypersensitivity reaction or plant disease resistance, cucumber powdery mildew, red pepper anthracnose, red pepper plague, oriental melon downy mildew, pepper plague, rice blast It was revealed that its effectiveness in diseases was improved over plant hypersensitive reaction protein (HrpN) derived from burn fungus. Furthermore, in the yield increase experiment of cucumber, pepper, pepper and strawberry, this protein increased their yield over HrpN protein. In addition, a polypeptide or protein that induces a plant hypersensitive reaction in a non-host plant derived from a novel black wilt fungus WT # 3 ( Erwinia pyrifoliae WT # 3) increases the photosynthesis and chlorophyll content of cucumber and pepper. Also proved to be excellent. Therefore, the polypeptide or the protein derived from the branch blight fungus WT # 3 ( Erwinia pyrifoliae WT # 3) can be used as an agrochemical, a plant growth promoter and a fertilizer.

Furthermore, the plant hypersensitive reaction-inducing polypeptide or protein derived from the branch blight fungus WT # 3 ( Erwinia pyrifoliae WT # 3) of the present invention has an excellent pest repellent effect on aphids, for example, and is obtained by ordinary foliage treatment. In addition, since the rice seed soaked with the protein or polypeptide of the present invention has grown rapidly during the seedling raising period, the protein or polypeptide of the present invention can be used as a seed treating agent. Or it can be used for plants by the usual seed soaking method.

  Hereinafter, the present invention will be described in more detail with reference to the following examples and test examples. However, these are for illustrating the present invention and do not limit the scope of the present invention.

(Separation and identification of new strains)
1) Physiological and biochemical experiments according to Schaad's guideline and Bergey's Manual To isolate and identify pathogens from diseased tissues that show signs of branch dying in pears from the cultivated area near Chuncheon, Gangwon-do, Korea. Schaad's guidebook [Schaad, NW 1988. Initial identification of common genera. In: Laboratory Guide for Identification of a plant Pathogenic Bacteria , ed. By NW Schaad. American Phytopathological Society., Minnesot. Pp. 44-59] and Bergey's Manual [Lelliott, RA and Dickey, RS 1984. Genus Erwinia . In: Bergey's Manual of Systemic Bacteriology. Vol. 1, pp. 469-476, Williams and Willkins Co., Baltimore / London] The results of various physiological and biochemical experiments of the genus Erwinia are shown in Table 1 below.

The isolates are gelatin liquefaction, in good agreement with EP16 ^T is representative species of general branch black blight (Erwinia pyrifoliae) in physiology experiments such as motility and pectate (pectate) degradation in 3% agar. On the other hand, in the biochemical requirement experiment for examining the availability of the carbon source, different results were obtained particularly in trehalose and L-arabinose. That is, from this, the physiological and biochemical characteristics of the isolated strain in the present invention are different from those of EP16 ^T and Erwinia amylovora ATCC 15580 ^T , which are representative species of Erwinia pyrifoliae. I understand that.

2) Morphological characteristics of isolate WT # 3 strain As a result of observing the morphological characteristics of E. pyrifoliae phytopathogenic fungus WT # 3 ( E. pyrifoliae ) using a transmitted electron microscope (TEM), The morphological characteristics of black wilt pathogen WT # 3 ( E. pyrifoliae ) are due to the recently reported black wilt fungus EP16 ^T (Erwinia pyrifoliae EP16 ^T ) strain and apple that cause necrotic disease in pear trees It was also confirmed that it was different from the burn disease fungus ATCC 15580 ^T ( Erwinia amylovora ATCC 15580 ^T ) that causes burn disease in pears [Fig. 1].

That is, the branch black Blight pathogen (Erwinia pyrifoliae) EP16 ^T burns mildew (Erwinia amylovora) Erwinia genus ATCC15580 ^T belongs, though is generally bacillus number of flagella forms more peritrichous flagella On the other hand, the novel Erwinia pyrifoliae WT # 3 was a gonococcus having no flagella and a slight oval shape.

3) Growth of isolate WT # 3 strains at various temperatures Erwinia pyrifoliae WT # 3 strains In order to investigate the physiological and biochemical characteristics, draw growth curves at various temperatures, Turbidity was measured using C. Measure doubling time and specific growth rate at various temperatures of Erwinia pyrifoliae WT # 3 and Erwinia amylovora ATCC 15580 ^T at temperatures ranging from 12 ° C to 39 ° C at 3 ° C intervals. Calculated [Figure 2].

As a result, Erwinia pyrifoliae WT # 3 had a higher specific growth rate and a shorter doubling time than 27 ° C. and an optimum temperature of 27 ° C., compared with the burn disease fungus ( Erwinia amylovora ). Even at low temperatures below 20 ° C., Erwinia pyrifoliae WT # 3 grew much faster than Erwinia amylovora ATCC 15580 ^T. Therefore, Erwinia pyrifoliae WT # 3 is a relatively cold region compared to other regions in winter and has environmental conditions different from those of Erwinia amylovora ATCC 15580 ^T. Since it is well adapted to the area near Chuncheon, it is suggested that it has cold resistance.

4) Among the physiological and biochemical properties of various growth branch black blight (Erwinia pyrifoliae isolates WT # 3 share for the pH value) WT # 3 strains, in order to examine the effect of pH on growth, various Turbidity was measured using Bioscreen C for growth at pH values of. Measured at 0.5 intervals within the range of pH 5.5 to pH 9.5 at a constant temperature of 28 ° C., various types of Erwinia pyrifoliae WT # 3 and burner fungus ( Erwinia amylovora ) ATCC 15580 ^T The doubling time and specific growth rate at pH were calculated [Figure 3].

As a result, the optimum pH range of Erwinia pyrifoliae WT # 3 is pH 7.0 to pH 8.0, and rapid growth is observed at alkaline conditions of pH 7.5 or higher, and Erwinia amylovora ) It was different from ATCC 15580 ^T.

5) Characteristics of isolate WT # 3 strain using Biolog System Biolog system designed to monitor the use of 96 different carbon and nitrogen sources [BIOLOG, Hayward, CA 94545 , USA], the biochemical characteristics of the isolated WT strain # 3 were examined in detail.

  First, after culturing at 28 ° C. for 24 hours in a TSA (triptic soy agar) medium, the cells were treated with 0.4% sodium chloride, 0.03% Pluronic F-68 and 0.01% gellan gum (Gellan). Gum) was suspended in a solution containing 63% turbidity and then placed in a well containing 96 different carbon and nitrogen sources.

  Thereafter, the isolate WT # 3 strain was further cultured for 24 hours in a constant temperature incubator at 35 to 37 ° C., and the color changed to purple using a carbon source and a nitrogen source was recorded using a reader. Were divided into mathematical taxonomics.

As can be seen from FIG. 4, the burn strains ( Erwinia amylovora ) ATCC 15580, LMG2068, LMG1877, LMG1946 and ea246 (USA) strains were shown to be in the same group. On the other hand, the isolate WT # 3 strain was in the same group as the black rot fungus ( Erwinia pyrifoliae , EP4, EP8, EP16 ^T ). That is, the isolated WT strain # 3 was found to be a different species from Erwinia amylovora , a burn disease fungus.

6) Analysis of 16S rRNA gene of isolate WT # 3 strain In order to examine the phylogenetic position of the isolate, it is essential in life phenomena, its nucleic acid sequence is relatively well preserved, and phylogenetically The nucleic acid sequence of the 16S rRNA gene, which is easy to analyze, was analyzed. The 16S rRNA gene was obtained by amplification by PCR using the fD1 primer of SEQ ID NO: 1 and the rP2 primer of SEQ ID NO: 2. Then, it cloned into pGEM-T vector and analyzed the nucleic acid sequence.

  Based on the 16s rRNA nucleic acid sequence analyzed, the mega program [Kumar, S., Tamura, K. and Nei, M. 1993. MEGA: molecular evolutionary genetics analysis, version 1.0. The Pennsylvania State University, FIG. 5 shows a phylogenetic tree created using University Park.].

From the viewpoint of similarity, the isolated WT strain # 3 is similar to E. pyrifoliae Ep16 ^T and burn fungus ( Erwinia amylovora ATCC 15580 ^T ), and E. pyrifoliae Ep16 ^T ) with 98.9% sequence identity and with burn disease ( Erwinia amylovora ATCC 15580 ^T ) with 97.5% sequence identity and with E. pyrifoliae more than burn disease. Ep16). Table 2 below shows the similarity of the 16S rRNA gene between each strain.

As a result of analyzing the 16s rRNA gene, the isolated WT strain # 3 belongs to the same group as E. pyrifoliae , which is a black blight fungus. However, E. amylovora , a burn fungus, and a Korean apple, It was revealed that it belongs to a group different from the group of Enterobacter pyrinus that was reported to infect pears.

7) Analysis of 16S-23S intergenic transcription spacer (Intergenic Transcribed Spacer, ITS) region of isolate WT # 3 strain In order to analyze ITS of Korean black blight fungus and burn disease fungus outside Korea, 16S-23S The ITS region was amplified by PCR using the R16-1F primer of SEQ ID NO: 3 and the R23-1R primer of SEQ ID NO: 4. Subsequently, after cloning into the pGEM-T vector, the nucleic acid sequence of the ITS region of 16S-23S was analyzed. As a result, the ITS region of 16S-23S was divided into two groups. That is, burn fungus ( E. amylovora ) has three types of band patterns of about 1215, 970 and 720 bp, while E. pyrifoliae , a pathogen in Korea, is 970. Only two band patterns of 720 bp and 720 bp appeared.

So far, in all strains of these two groups, the 970 bp band pattern has a tRNA ^Ala region of about 70 bp in size and the 720 bp band pattern has a tRNA ^Glu region. Indicated.

FIG. 6 shows a phylogenetic tree prepared by analyzing nucleic acid sequences of the 16S-23S ITS region of the burn fungus E. amylovora ATCC 15580 ^T and the isolated bacterium Erwinia pyrifoliae WT # 3 strain.

As a result of analyzing the nucleic acid sequence of the 970 bp band encoding the 70 bp tRNA ^Ala region in the ITS region and creating a phylogenetic tree, the isolate WT # 3 strain was different from the group of the burn fungus ( Erwinia amylovora ), It showed 47.4% similarity with the burn fungus. However, the tRNA ^Ala region of Erwinia pyrifoliae , named by German researchers, was not registered in GenBank and could not be compared.

As a result of analyzing the nucleic acid sequence of a 720 bp band encoding the tRNA ^Glu region, the isolated bacterium Erwinia pyrifoliae WT # 3 strain was found to be from that of Erwinia pyrifoliae announced by German researchers and 85.2. It showed 92.7% sequence identity, suggesting the same group [Figure 7].

8) Analysis of Erwinia pyrifoliae WT # 3 by plasmid profile Results of isolation of plasmids of Erwinia pyrifoliae and Erwinia amylovora outside Korea and analysis of their appearance The Korean branch blight fungus ( Erwinia pyrifoliae ) and the Korean burn disease fungus ( Erwinia amylovora ) were divided into the following two groups [Fig. 8].
Group I-burn fungus E. amylovora (ATCC15580, LMG1877, 10296) (1 plasmid> 29 kb)
Group II- E. pyrifoliae (Ep1, Ep16, WT # 3) (1 plasmid> 29 kb, 1 sized plasmid, 3 sized 2-4 kb) Plasmid)

In other words, there is only one plasmid larger than 29 kb in the group of burn fungus ( Erwinia amylovor ), but the group of pear tree blight fungus ( E. pyrifoliae ) containing isolate WT # 3 strain Was shown to have 5 plasmids.

9) Analysis of DNA relevance by DNA-DNA hybridization The whole genome relevance between Erwinia pyrifoliae in Korea and burn fungus outside of Korea ( Erwinia amylovora ) was examined. As the method, purely separated total DNA was dissolved in 100 μl of TE buffer, quantified to a concentration of 1 ng / μl, 10N NaOH was added, and then boiled at 80 ° C. for 10 minutes to denature the DNA. . The denatured DNA was applied to HyBond-N ⁺ nylon membrane using a slot-blot apparatus. Then, using a DIG-High Prime system [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany], natural DNA used as a probe is labeled, and the DNA immobilized on the nylon membrane is used for 3 hours at 49 ° C. Prehybridization was performed and then hybridized at the same temperature for 16 hours. The membrane after the reaction was developed with a DIG fluorescence detection kit (DIG Luminescent Detection Kit) [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany], and the reaction was assayed.

As a result, non-Korea burn fungus ( E. amylovora ATCC15580 ^T , LMG1877, LMG1946, LMG2068) belongs to Group I, and Korean branch blight fungus ( E. pyrifoliae Ep16 ^T , WT # 3) belongs to Group II. Belonged. That is, a burn disease fungus ( Erwinia amylovora ) outside of Korea belonged to Group I, and a Korean branch blight fungus ( Erwinia pyrifoliae ) belonged to Group II. This is because Korean wilt ( Erwinia pyrifoliae ), including WT # 3 strain, is different from Erwinia amylovora , and Korean wilt ( Erwinia pyrifoliae ) is a Korean indigenous fungus. It clearly shows that. Table 3 shows the similarity of related strains.

Summarizing the biochemical, physiological and genetic characteristics of the above isolate WT # 3 strain, the isolate WT # 3 strain has the physiological characteristics, biochemical characteristics according to the guidelines of Schaa and Bergey's manual, As a result of experiments related to temperature and pH values, Biolog system, 16S rRNA gene, 16S-23S ITS, plasmid profile, and association by DNA-DNA hybridization, only present in Korea in 1999 It was shown to be in the same group as E. pyrifoliae reported, but there are several different characteristics between Erwinia pyrifoliae WT # 3 and Ep16 ^T. there were. In particular, isolate WT # 3 does not have morphological flagella, and since it was first reported in the genus Erwinia that this flagellum was not present, Edakuro reported by German researchers. It is clear that it is different from blight fungus ( Erwinia pyrifoliae ) and burn fungus ( Erwinia amylovora ). Therefore, the isolate WT # 3 strain was named branch wilt fungus WT # 3 ( Erwinia pyrifoliae WT # 3). This was deposited with the Korean Preservation Center on June 11, 2001, and was given the accession number KCCM 10283.

In addition, pKEP3, which is a high expression vector containing a gene derived from the above-mentioned branch blight fungus WT # 3 ( Erwinia pyrifoliae WT # 3), was constructed, transformed into Escherichia coli, and this transformant was used as the Korea Microbial Preservation Center. On June 11, 2001, and was given the deposit number KCCM10282.

(Characteristics of a specific protein that induces a plant hypersensitive reaction derived from Erwinia pyrifoliae WT # 3 and a gene encoding the protein)
1) branch black blight (Erwinia pyrifoliae) WT # 3 to analyze the genes encoding specific proteins that induce analyzed plant hypersensitive response of plants hypersensitive reaction induction gene from branch black oryzae (Erwinia pyrifoliae ) WT # 3 total DNA was incubated at 37 ° C. so that it was partially digested with the Sau3AI enzyme. Thereafter, 1 μl of the DNA was electrophoresed every hour to examine the degree of degradation of the DNA. As a result, it was found that the most suitable digestion time was about 6 hours. The total DNA thus treated was prepared as insert DNA, cultured at 14 ° C. for 12 hours, and ligated to the BamHI polylinker site of the pLAFR3 cloning vector using DNA ligase. The complete plasmid DNA ligated with the inserted DNA and the vector was transformed into E. coli HB101 by the transformation method with calcium chloride. Thereafter, the E. coli strain was cultured on Luria agar medium containing tetracycline (30 mg / ml) at 37 ° C. for 24 hours, and 2,000 colonies formed were selected, and genomic DNA live was selected. Created a rally.

From each of the 2000 selected Erwinia pyrifoliae WT # 3 genomic DNA library clones, a clone encoding a specific protein that induces a plant hypersensitive reaction was selected from each clone. Total protein was extracted by the following procedure. The culture broth cultured for 12 hours in LB medium was centrifuged, and 5 mM MES buffer solution and 0.1 mM PMSF solution were suspended in the resulting pellet, and then sonicated to dissolve, and the pellet was dissolved at 100 ° C. for 10 hours. Boiled for a minute. Thereafter, only the supernatant obtained by centrifugation is collected, and the main vein on the back side of the leaf of tobacco ( Nicotiana tabacum L. Samsun) grown on four or more true leaves each having a diameter of 15 cm or more. Were injected using a syringe. Necrosis that appeared in tobacco leaves 24 hours after the injection was regarded as a hypersensitive reaction (HR), and then a genomic DNA library clone showing HR was selected [FIG. 9].

  An 8.5 kb DNA fragment containing a gene that induces a plant hypersensitive reaction was cloned from the selected clone pCEP33 into a pUC19 vector, and then a physical map was prepared using restriction enzymes [FIG. 10].

FIG. 11 shows an analysis of a nucleic acid sequence of a selected gene, and a gene encoding a plant hypersensitive reaction-inducing protein derived from Erwinia pyrifoliae WT # 3 (KCCM10283) according to the present invention is identified as a burn disease fungus ATCC 15580 ^T. It is compared with the hypersensitive reaction-inducing gene (hrpN) derived from the origin.

From the Erwinia pyrifoliae WT # 3 according to the present invention, a 1287 bp gene encoding a plant hypersensitive reaction-inducing protein was obtained. Therefore, the 1287 bp gene was named “WT hypersensitive reaction-derived gene derived from WT # 3”, and the degree of similarity with the hrpN gene (1212 bp) of the burn fungus ( E. amylovora ATCC15580 ^T ) was investigated.

As a result, five novel nucleic acid sequence fragments were obtained from the WT # 3 plant hypersensitivity reaction-inducing gene 222-230 bp (TTTAACGGGG), 249-263 bp (TGGGCGGGTCTGCT), 327-333 bp (TCTGGGGT), 348-371 bp ( CGGCATTGGCGGCGGGATTGGGTGG) and 397 to 411 bp (ACCGTGGGGACCCTCT) were inserted, and as a result, the molecular weight of the gene was shown to increase. On the other hand, the plant hypersensitive reaction-inducing gene derived from WT # 3 had 83.2% homology with the hrpN gene of Erwinia amylovora , and the sequence similarity with the hrpN gene was low. Therefore, the gene encoding the plant hypersensitive reaction-inducing protein of Erwinia pyrifoliae WT # 3 has not only a nucleic acid sequence different from the hrpN gene of the conventional burn fungus ( Erwinia amylovora ), but also several By inserting a new nucleic acid sequence fragment, it was shown that it had a new gene structure that could not be found from the hrpN gene of Erwinia amylovora . The nucleic acid sequence of the gene encoding the plant hypersensitive reaction inducing protein of Erwinia pyrifoliae WT # 3 is shown in SEQ ID NO: 5.

2) Construction of an expression vector for a plant hypersensitive reaction-inducing protein derived from Erwinia pyrifoliae WT # 3 Encodes the plant hypersensitive reaction-inducing protein of the selected Erwinia pyrifoliae WT # 3 In order to extract and purify a large amount of plant hypersensitive reaction protein from the gene to be purified, an expression vector pKEP3 containing the selected gene was constructed as follows.

To construct the expression vector pKEP3, an E. coli recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) was used. The system is derived from the pBR322 plasmid and connects the T7 promoter and operator to a lac repressor in front of the foreign gene insertion site in the pBR322 plasmid. This structure facilitates large-scale expression of foreign inserted genes by T7 RNA polymerase produced in the host E. coli genome. In particular, when IPTG used as a substrate is added 3 hours after culture, the lac repressor produced from the lacI gene binds to this IPTG and the expression of T7 RNA polymerase cannot be suppressed, so that a large amount of protein is synthesized. Become so. In addition, pKEP3 contains an ampicillin resistance gene in order to distinguish it from those that are not linked or those that are not transformed into E. coli. Thereby, when a complete transformant is selected, ampicillin can be added to the medium as a selection marker.

A gene encoding a plant hypersensitive reaction-inducing protein derived from Erwinia pyrifoliae WT # 3 and the plasmid of the above-mentioned Escherichia coli recombinant protein system were incubated at 37 ° C. for 12 hours in the presence of the restriction enzymes NdeI and BamHI. Digestion produced identical forms of DNA 5 ′ and 3 ′ ends. They were then ligated to restriction sites using DNA ligase at 14 ° C. for 16 hours and transformed into E. coli by transformation with calcium chloride.

  The pKEP3 (1) can use an ampicillin resistance gene as a selection marker, (2) has a His tag and is easily purified, (3) has a strong T7 lac promoter, It has many advantages, such as the ability to produce large amounts of protein from ligated insert DNA.

  A transformant of Escherichia coli transformed by introducing the expression vector pKEP3 was deposited with the Korean Preservation Center on June 11, 2001, and assigned the accession number KCCM10282.

On the other hand, the hrpN gene of the burn fungus E. amylovora ATCC 15580 ^T was cloned using the same E. coli recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) and derived from Erwinia pyrifoliae WT # 3. Were used as a control group for the biological activity test of pKEP3 containing a novel plant hypersensitive reaction-inducing gene.

3) Expression of plant hypersensitive reaction-inducing protein For mass production of proteins from E. coli transformants (pKEP3; KCCM 10282), ampicillin (50 μg / ml) as a selection marker and other proteins made from the genome of E. coli itself Bacterial cells were inoculated into an LB liquid medium supplemented with chloramphenicol (33 μg / ml) to inhibit protein synthesis, subcultured at 37 ° C. for 12 hours, and then the bacterial transformant of the present invention ( KCC10282) was cultured for 7 hours at 30 ° C. using the same medium. When the OD value of the transformant (KCC10282) reached 0.6 after about 3 hours from the culture, 0.4 mM IPTG was added, and the temperature was lowered to 30 ° C. and cultured for 4 hours. After a total of 7 hours of main culture, the mixture was centrifuged (6,000 rpm, 15 minutes), the supernatant was discarded, and only the pellet contained 5 mM MES buffer and 0.1 mM PMSF. Suspended well in solution. The suspension of transformant (KCCM 10282) was dissolved by sonication until the suspension became clear and boiled at 100 ° C. for 10 minutes. Thereafter, the mixture was centrifuged at 15,000 rpm for 10 minutes and the supernatant was discarded. A protein inhibitory cocktail was added at a ratio of 1/1000, then filtered through a 0.45 μm filter, and the amount of extracted protein was quantified.

A plant produced through the above-mentioned process from a transformant (KCCM 10282) containing a pKEP3 plasmid containing a gene encoding a plant hypersensitive reaction-inducing protein derived from E. pyrifoliae WT # 3; KCCM 10283 The hypersensitive reaction-inducing protein was named Pioneer.

On the other hand, in the present invention, the hrpN gene of E. amylovora ATCC15580 ^T was cloned using the same E. coli recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) used in pKEP3, and the organism of Pioneer As a control protein for the activity test, the expressed HrpN protein was used in the experiment under the same conditions.

As a result, as shown in FIG. 12, a plant hypersensitive reaction-inducing protein of E. amylovora ATCC15580 ^T and Erwinia pyrifoliae WT # 3 according to the present invention cloned into the expression vector pKEP3. Both of the genes coding for were successfully expressed by the recombinant protein expression system, and it was confirmed that a large amount of plant hypersensitive reaction-inducing protein was synthesized.

4) Analysis of similarity of plant hypersensitive reaction-inducing protein (Pioneer, Pioneer) of Erwinia pyrifoliae WT # 3 Analysis of amino acid sequence of purified plant hypersensitive reaction-inducing protein (Pioneer, Pioneer) Compared with the plant hypersensitive reaction-inducing protein of the burn fungus ( E. amylovora ATCC15580 ^T ), the similarity was investigated [FIG. 13].

  As a result, 76 to 79 (Thr-Gly-Leu-Leu), 88 to 92 (Leu-Gly-Gly-Gly-Ser), 102 to 113 (Gly-Leu-Gly-Gly-Leu-Gly-) from the N-terminus. Gly-Asp-Leu-Gly-Ser-Thr) and 131-137 (Gly-Ala-Thr-Val-Gly-Thr-Ser) were found to have a new protein domain of Pioneer. . In addition, the homology with the amino acid sequence of the HrpN protein is 85.9%, the identity of the amino acid sequence is low, and the molecular weight of the pioneer is 41.1 kD, while the molecular weight of the HrpN protein is 39.7 kD. [This is not a comparison with a molecular weight standard on an acrylamide gel, but shows the molecular weight of each amino acid inferred from the base sequence of the gene using the Winstar program.] ].

  Therefore, this protein (Pioneer, Pioneer) has a new form of protein domain formed by the insertion of a new nucleic acid sequence fragment, and these changes indicate that Pioneer exhibits better biological activity than HrpN protein. Can be considered.

5) Plant hypersensitivity reaction-inducing protein hypersensitivity reaction (HR)
To date, plant hypersensitive reaction-inducing proteins are known to be pathogenic factors in host plants and to induce HR in non-host plants. That is, the induction of a hypersensitive reaction can be indirectly interpreted as indicating that the host plant has pathogenicity. Therefore, a plant hypersensitive reaction-inducing protein (Pioneer) derived from E. pyrifoliae WT # 3, a plant hypersensitive reaction-inducing protein (HrpN) derived from E. amylovora ATCC 15580 ^T , and As a control group, MES buffer, which is a protein lysis buffer, was inoculated into the veins of tobacco, which is a non-host plant, using a syringe [FIG. 14].

As shown in FIG. 14, in Pioneer, which is a plant hypersensitive reaction-inducing protein of Erwinia pyrifoliae WT # 3, the leaf table of tobacco was observed, and as a result, HR was administered at a dose of 10 μg / ml. On the other hand, HrpN, a plant hypersensitive reaction-inducing protein derived from E. amylovora ATCC 15580 ^T, clearly observed HR reaction at a dose of 20 μg / ml. On the back of the same leaf, in the case of pioneer, the HR response was clearly observed at a dose of 5 μg / ml, and in the HrpN protein, HR was clearly observed at a dose of 10 μg / ml. That is, it was shown that pioneer induces the HR reaction at a lower concentration and in a shorter time than HrpN protein.

  As can be seen from Table 4 below, pioneer (Pioneer) was inoculated at a dose of 5 μg / ml, 24 hours after inoculation, and at a dose of 10 μg / ml, 14 hours after inoculation. However, HrpN clearly induced HR 48 hours after inoculation at a dose of 5 μg / ml and 18 hours after inoculation at a dose of 10 μg / ml. That is, this clearly shows that at a concentration of 5 μg / ml, pioneer showed HR 24 hours earlier than HrpN protein, whereas at a concentration of 10 μg / ml, it showed HR 4 hours earlier.

  The result of repeating this experiment three times suggests that Pioneer induces the plant immune system at a lower and faster concentration than the HrpN protein.

6) Pathogenicity test against pear of a plant hypersensitive reaction-inducing protein (Pioneer, Pioneer) derived from Erwinia pyrifoliae WT # 3 Purified pioneer at a concentration of 500 μg / ml The fruit surface was inoculated with a hole having a diameter of 0.5 mm and a depth of 10 mm.

  As can be seen from FIG. 15, it was possible to observe a symptom in which the surface of the immature fruit changed to black after 4 days from the treatment as compared with the surface of the control group treated with the buffer alone. Thus, although further investigation is needed, it was established that Pioneer may have a strong pathogenicity against host plants.

The characteristics of the above pioneers and the characteristics of the gene encoding them are summarized as follows.
(1) The gene encoding Pioneer, a plant hypersensitive reaction-inducing protein of Erwinia pyrifoliae WT # 3, has several novel nucleic acids at several sites in the Pioneer gene. Although the sequence fragment is inserted, these cannot be found from the hrpN gene, and the size of the hrpN gene is 1,212 bp, while the size of the pioneer gene is 1,287 bp. It was big.
(2) In the structure of the protein, the molecular weight of Pioneer is increased by the formation of new forms of peptide domains in various parts, while the HrpN protein is 39.7 kD, whereas it is 41.1 kD. It was. [This is not a comparison with a molecular weight standard on an acrylamide gel, but an inference of the molecular weight of each amino acid from the nucleic acid sequence of the gene using the Winstar program].
(3) Particularly in HR observed in tobacco leaves, this protein (Pioneer, Pioneer) was shown to induce the plant immune system at a lower concentration faster than the HrpN protein. Therefore, Pioneer, a plant hypersensitive reaction-inducing protein derived from Erwinia pyrifoliae WT # 3, is superior to HrpN, a protein derived from a burn fungus ( Erwinia. Amylovora) . It is considered suitable for the development of better biochemical pesticides.

(Bioactivity study using a plant hypersensitive reaction-inducing protein (Pioneer, Pioneer) derived from Erwinia pyrifoliae WT # 3)
1) Examination of the control effect against cucumber powdery mildew (Sphaerotheca fuliginea) To test the control effect of a plant hypersensitive reaction-inducing protein (pioneer, Pioneer) derived from Erwinia pyrifoliae WT # 3 against cucumber powdery mildew The gene encoding the plant hypersensitive reaction-inducing protein was cloned into the pKEP3 vector, and the protein was purified.

  Cucumber was cultivated by the rain-protecting method, which is a common practice in farms, and the test substance was applied three times according to the randomized complete block design (RCB). According to the concentration recommended by EDEN Bioscience, cucumber foliage treatment was performed using Pioneer, a hypersensitive reaction-inducing protein with a concentration of 20 μg / ml.

  As a control group, the EDEN Bioscience formulation Messenger (Messenger®) was used at the same concentration. In addition, stems and leaves were treated with Fenarimol (chemical agrochemical), which has already been registered as a drug for cucumber powdery mildew in Korea, according to the usage guidelines.

The processing method is as follows;
(1) Three treatment groups-Pioneer, Messenger (registered trademark), and chemical pesticide at 10-day intervals from the early stage of Sphaerotheca fuliginea Fenarimol was sprayed three times on each cucumber stem and leaf.
(2) 4 times treatment group-on the 7th, 21st, 35th, and 49th day after planting, Pioneer, Messenger (registered trademark) and chemicals of EDEN Bioscience The pesticide Fenarimol was sprayed three times on the stems and leaves of each cucumber.

For the cucumbers treated as described above, the disease index of Sphaerotheca fuliginea naturally occurring from 8 leaves to 3 leaves, 0 to 1%, 1 to 5.1% without illness. Based on the criteria of -20% as 2, 20.1-40% as 3, and 40% or higher as 4, their severity was measured 7 days after the last drug treatment.

  As shown in Table 5, the pioneer has a control effect of 122 in each of the three-time treatment group and the four-time treatment group, compared to the messenger (Messenger (registered trademark)) of EDEN Bioscience. .6% and 187.0% increase, so use as an excellent pesticide is expected.

2) Test of increase in cucumber yield In order to confirm the increase in cucumber yield due to pioneer treatment, cucumber was used at a concentration of 20 μg / ml at intervals of 14 days from 7 days before planting. The stems and leaves were treated 5 times. Further, as a control group, cucumber stems and leaves were treated with a protein (HrpN) derived from the same concentration of a burn disease fungus ( Erwinia amylovora ATCC15580 ^T ).

  Harvest cucumbers for this experiment on the 8th, 10th, 12th, 14th, 16th, 18th, 21st, 23rd, 25th and 30th days after planting And investigated. It was judged that cucumbers with a harvested cucumber length of 20 cm or more could be commercialized, and the results were expressed as product yields below.

  As a result, in Pioneer, the product yield increased by 8.1% compared to the untreated product and by 4.6% compared to that treated with the HrpN protein. Therefore, the composition (Pioneer, Pioneer) can be used more effectively than HrpN as a plant growth promoter and fertilizer.

3) Assay for increased cucumber photosynthesis and chlorophyll content To confirm changes in cucumber physiological responses when treated with Pioneer, ie, increased photosynthesis and chlorophyll content, cucumber stems and leaves were examined. Then, treatment was performed 5 times using Pioneer at a concentration of 20 μg / ml at intervals of 14 days from 7 days before planting. As a control group, HrpN protein was also given to cucumber stems and leaves at the same concentration as above.

  Cucumbers for this experiment were harvested on the 34th, 42nd and 56th days after planting, and were used with a portable photosynthesis measuring device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 micromol). A chlorophyll meter (Chlorophyll meter SPAD-502, Minolta, Japan) was used for the investigation.

  As can be seen from the above table, when cucumber was treated with Pioneer, the amount of photosynthesis increased by 16.2%, the chlorophyll content increased by 5.4% compared to the untreated one, and compared with the HrpN protein, The amount of photosynthesis was 9.8%, and the chlorophyll content was 2.0% higher. Therefore, Pioneer may be much more useful as a plant growth promoter and fertilizer than HrpN protein.

4) Assay of control effect against Phytophthora capsici To test the control effect of Pioneer against Pepper plague, the gene encoding a plant hypersensitive reaction-inducing protein was cloned into a pKEP3 vector, Purified.

  Capsicum was cultivated according to the open field culture method, which is a common practice in farms. Pepper stems and leaves were treated with Pioneer at concentrations of 40, 20, and 10 μg / ml. In addition, as a control group, HrpN protein was also given to the pepper stem and leaf at the same concentration as described above for comparison.

The processing method is as follows.
(1) On the 8th and 12th days after planting, stalks and leaves of pepper were treated with Pioneer and HrpN protein at various concentrations. The capsicum treated as described above was inoculated with Phytophthora capsici at 2 × 10 ⁶ cells / ml, and the disease severity was measured 63 days after the treatment.

  As can be seen from Table 8 above, Pioneer (10 μg / ml concentration) showed a higher control value than HrpN protein (40 μg / ml concentration).

  Therefore, Pioneer can be more effectively used as an agrochemical that exhibits an excellent control effect at a lower concentration than HrpN protein.

5) Testing the control effect against pepper anthracnose ( Colletotrichum orbiculare ) To test the control effect of pioneer against pepper anthracnose ( Coletotrichum orbiculare ), the gene encoding a plant hypersensitive reaction-inducing protein was cloned into the pKEP3 vector. The protein was then purified.

  Capsicum was cultivated according to the open field culture method, which is a common practice in farms. Pepper stems and leaves were treated 5 times with Pioneer at a concentration of 10 μg / ml between 7 days before treatment and 14 days after planting. In addition, as a control group, HrpN protein was also given to the pepper stem and leaf at the same concentration as described above for comparison.

The processing method is as follows.
(1) On the 8th and 12th day after planting, the stems and leaves of pepper were treated with pioneer and HrpN protein at each concentration. On the 20th, 27th, 34th, and 40th day after planting, the seeds of capsicum treated and planted as described above were expressed as diseased fruit and healthy fruit and expressed as diseased fruit rate.

As can be seen from Table 9, Pioneer showed a control value for Colletotrichum orbiculare that was 14.3% higher than the HrpN protein. Therefore, Pioneer can be used more effectively as an agrochemical than HrpN protein.

6) Examination of increase in yield of capsicum To confirm the increase in yield of capsicum by pioneer (Pioneer) treatment, pioneer (Pioneer) was cultivated on the 8th and 12th day after planting at a concentration of 10 μg / ml. The stems and leaves were sprayed 5 times. As a control group, HrpN protein was also inoculated into stems and leaves at the same concentration for comparison.

The processing method is as follows.
(1) Soaking + spraying method: Pioneer and HrpN protein were diluted to a concentration of 10 μg / ml using MES buffer, and each was soaked with pepper at 28 ° C. for 24 hours. The seedlings were sown in plant pots, grown for 46 days and planted in the open ground. On days 8 and 12, pioneer and HrpN proteins were sprayed onto pepper stems and leaves, respectively. The peppers for this experiment were harvested and examined on the 18th, 25th, 32nd, 39th and 46th days after planting.

  As can be seen from Table 10, in Pioneer, the yield was 22.7% higher than the HrpN protein. Therefore, Pioneer is more useful as a plant growth promoter and fertilizer than HrpN protein.

7) Assay for increase in photosynthesis and chlorophyll content of red pepper In order to confirm changes in the physiological response of red pepper when treated with pioneer, that is, increase in photosynthesis and chlorophyll content, Pioneer (Pioneer at a concentration of 20 μg / ml) ), The stems and leaves of pepper were treated 5 times at 14-day intervals from 7 days before planting. As a control group, HrpN protein was also given to the pepper stems and leaves at the same concentration as above.

  The capsicum for this experiment was harvested on the 34th, 42nd and 56th day after planting, and was used with a portable photosynthesis measuring device (LCA-4 system, ADC BioScientific Ltd., UNK; light source: 1,500 micromol). Measurement was performed using a chlorophyll meter (Chlorophyll meter SPAD-502, Minolta, Japan).

  From the above table, after processing capsicum with pioneer, the amount of photosynthesis and the content of chlorophyll were measured. As a result, the amount of photosynthesis increased by 16.0% and the content of chlorophyll increased by 6.7% compared to the untreated one. It was confirmed that the amount of photosynthesis was increased by 7.5% and the content of chlorophyll was increased by 4.9% compared to the HrpN protein. Therefore, Pioneer is more useful as a plant growth promoter and fertilizer than HrpN protein.

8) Examination of control effect against oriental melon downy mildew ( Pseudoperonospora cubensis ) In order to test the control effect of pioneer against oriental melon downy mildew ( Pseudoperonospora cubensis ), induction of plant hypersensitive reaction The gene encoding the protein was cloned into the pKEP3 vector and the protein was purified.

  Stem and leaves of oriental melon were treated 5 times with Pioneer at a concentration of 40 μg / ml. As a control group, the same concentration of HrpN protein was given to stems and leaves of oriental melon for comparison.

The processing method is as follows;
(1) Soaking + spraying method: Pioneer and HrpN protein are diluted with MES buffer to a concentration of 10 μg / ml, and seeds of oriental melon are soaked at 28 ° C. for 24 hours, respectively. Was planted in flowerpots, and on day 17 and day 28, stems and leaves of oriental melon were treated with Pioneer and HrpN protein.
(2) Spraying method: On the 17th and 28th days after sowing, the stems and leaves of oriental melon were treated with Pioneer and HrpN protein.

  The degree of onset of naturally occurring melon downy mildew (oriental melon) downy mildew was measured 55 days after treatment.

  As can be seen from Table 12, the control effect of the Pioneer spray group was 96.0%, and the immersion + spray group was 44.6% higher than the HrpN protein. Therefore, Pioneer is more useful as an agrochemical compared to HrpN protein.

9) Assay of control effect against Phytophthora capsici In order to test the control effect of Pioneer against pepper disease, the gene encoding a plant hypersensitive reaction-inducing protein was cloned into a pKEP3 vector, Purified.

  Peppers for testing the effect of controlling the pepper pepper were planted in pots with a diameter of 25 cm and cultivated in a glass greenhouse. Bell pepper stems and leaves were treated with Pioneer at a concentration of 20 μg / ml recommended by EDEN Biosciences for the proper concentration for solanaceous crops. As a control group, the same concentration of HrpN protein was given to the stems and leaves of peppers for comparison.

The processing method is as follows;
(1) Eight days after planting, the stems and leaves of peppers were treated with Pioneer and HrpN protein. After the bell pepper treated as described above was inoculated with 2 × 10 ⁶ cells / ml of Phytophthora capsici , the disease severity was measured 45 days after the treatment.

  As can be seen from Table 13, Pioneer was 87.1% more effective in controlling than HrpN protein. Therefore, Pioneer is more useful as an agrochemical compared to HrpN protein.

10) Test for increasing the yield of sweet pepper To confirm the increase of the yield of sweet pepper treated with Pioneer, Pioneer at a concentration of 40 μg / ml was used to establish the stems and leaves of the sweet pepper 8 days after planting. Processed. Further, as a control group, the HrpN protein was treated with foliage at the same concentration.

  Bell peppers were planted in pots with a diameter of 25 cm and cultivated in a glass greenhouse. The sweet peppers treated as described above were planted and examined on the 41st and 45th days.

  Pioneer was 21.6% more effective in increasing yield compared to HrpN protein. Accordingly, Pioneer is more useful as a plant growth promoter and fertilizer than HrpN protein.

11) Test for increasing the yield of strawberries To confirm the increase in the yield of strawberries treated with Pioneer, the stems and leaves of strawberries grown in a vinyl house were used in a Pioneer concentration of 20 μg / ml. Was processed. As a control group, HrpN protein was given to stems and leaves at the same concentration.

  In order to examine the increase in the yield of strawberries treated as described above, the strawberries were harvested on the 30th, 33rd, 38th, 41st, 48th and 55th days after planting. The total weight value (g).

  As can be seen from Table 15, Pioneer was 13.8% more effective in increasing the yield of strawberries than the HrpN protein. Therefore, Pioneer is more useful as a plant growth promoter and fertilizer than HrpN protein.

12) Examination of control effect against rice blast fungus ( Magnaporthe grisea ) To test the control effect of Pioneer against rice blast fungus ( Magnaporthe grisea ), a gene encoding a plant hypersensitive reaction inducing protein was cloned into pKEP3 vector. The protein was then purified.

  Rice was cultivated according to the open field culture method, which is a common practice in farmers. Pioneer was diluted with MES buffer to a concentration of 10 μg / ml and soaked at 28 ° C. for 24 hours. Rice seeds were sown on a nursery, grown for 16 days, and planted in a test field. Thereafter, on days 45 and 52, Pioneer was sprayed on the stems and leaves of rice. Further, as a control group, HrpN protein was given to rice stalks and leaves at the same concentration and in the same manner as described above for comparison.

  The incidence of rice blast that naturally occurred in the rice treated as described above was measured 85 days after the treatment.

  As can be seen from Table 16, Pioneer (10 μg / ml concentration) showed a higher control value than the HrpN protein (20 μg / ml concentration). Therefore, Pioneer can be used more effectively as an excellent pesticide even at a lower concentration than HrpN protein.

13) Assay of repellent effect on aphids To test the repellent effect of Pioneer on aphids, a gene encoding a plant hypersensitive reaction-inducing protein was cloned into a pKEP3 vector and the protein was purified.

  In order to test the repellent effect against aphids, cucumbers were selected as the aphid host crops, cultivated by the rain-protecting method normally used by farmers, and the cucumber stems and leaves were And pioneer at a concentration of 20 μg / ml. In addition, as a control group, HrpN protein was given to cucumber stems and leaves at the same concentration and in the same manner for comparison. When the height of the cucumber was 1 m, the cucumber stems and leaves were treated with Pioneer and HrpN three times at 10 day intervals.

  The number of aphids naturally occurring in the cucumber treated as described above was counted 7 days after the treatment.

  As can be seen from Table 17, pioneer has an excellent aphid repellent effect at a lower concentration compared to HrpN, and the aphid repellent effect increased by 29.4%. Pioneer is therefore more useful as a pest repellent against aphids than HrpN.

14) Examination of the effect of increasing elongation at the seedling stage of rice In order to test the effect of increasing the elongation at the seedling stage of rice treated with Pioneer, a gene encoding a plant hypersensitive reaction-inducing protein was cloned into a pKEP3 vector. The protein was purified.

  Pioneer was diluted with MES buffer to a concentration of 40, 20 and 10 μg / ml, rice stems and leaves were soaked at 28 ° C. for 24 hours, seeded on a nursery, and grown for 16 days. Planted in a test field. As a control group, HrpN protein was given to rice stems and leaves at the same concentration and in the same manner for comparison.

As a result, in rice seedlings treated with Pioneer, it was confirmed that the length was about 3 to 4 cm longer than that of the untreated rice seedlings, and 1 cm longer than the HrpN protein treated group. Further, the higher the concentration, the better the elongation of the length. As a result, in Pioneer having a concentration of 40 μg / ml, the elongation at the rice seedling stage was the best. Therefore, Pioneer can be used more effectively than HrpN as a seed treatment agent that directly treats seeds to bring about growth promotion.

FIG. 1 is a graph showing E. pyrifoliae WT # 3 ( E. pyrifoliae WT # 3) [KCCM 10283], a Korean black rot pathogen ( E. pyrifoliae Ep16 ^T ), and a burn disease fungus ATCC 15580 ^T ( E. amylovora ATCC 15580 ^T ) is a photograph of a transmission electron microscope (TEM). FIG. 2 is a diagram showing growth curves according to the temperature of branch black blight fungus WT # 3 ( E. pyrifoliae WT # 3) and burn fungus ATCC 15580 ^T ( E. amylovora ATCC 15580 ^T ). FIG. 3 is a diagram showing growth curves according to the pH of branch black blight fungus WT # 3 ( E. pyrifoliae WT # 3) and burn fungus ATCC 15580 ^T ( E. amylovora ATCC 15580 ^T ). FIG. 4 is a diagram showing the results of numerical analysis of E. pyrifoliae WT # 3 according to the present invention using the Biolog system. FIG. 5 is a diagram showing the results of a phylogenetic analysis of 16S rRNA gene of black wilt fungus WT # 3 ( E. pyrifoliae WT # 3, KCCM 10283) according to the present invention. FIG. 6 is a diagram showing the results of a phylogenetic analysis of a tRNA ^Ala- encoding region in the ITS region of the branch blight fungus WT # 3 ( E. pyrifoliae WT # 3, KCCM 10283) according to the present invention. is there. FIG. 7 is a diagram showing the results of a phylogenetic analysis of a region encoding tRNA ^Glu in the ITS region of E. pyrifoliae WT # 3, KCCM 10283) according to the present invention. is there. FIG. 8 shows plasmids of E. pyrifoliae WT # 3, Ep1, Ep16 having 5 plasmids and a burn fungus having one plasmid ( E. amylovora, ATCC 15580 ^T , LMG1877, LMG1946). is a diagram showing the results of analysis of the profile [lane 1: 1 kb ladder, 2: E. pyrifoliae Ep1, 3 : E. pyrifoliae Ep16 T, 4: E. pyrifoliae WT # 3, 5: E. amylovora ATCC15580 T, 6: E. amylovora LMG1877, 7: E. amylovora LMG1946]. FIG. 9 shows a hypersensitive reaction (HR) appearing 24 hours after inoculating a tobacco leaf with a genomic library clone constructed from E. pyrifoliae WT # 3 KCCM10283. [B: MES buffer, C: plant hypersensitive reaction-inducing protein (HrpN) derived from E. amylovora ATCC 15580 ^T , 1: plant hypersensitive reaction-inducing protein derived from clone 1, 2: clone 2 derived Plant hypersensitive reaction-inducing protein of 3: plant hypersensitive reaction-inducing protein derived from pCEP33, 4: plant hypersensitive reaction-inducing protein derived from clone 4, and NC: protein derived from pLAFR3 vector]. FIG. 10 shows a region encoding a plant hypersensitive reaction-inducing gene derived from a clone (pCEP33) of a genomic library in which a hypersensitive reaction (HR) derived from E. pyrifoliae WT # 3 appears. It is a figure which shows no physical map. FIG. 11 shows a gene (KCCM10282) encoding a plant hypersensitive reaction-inducing protein derived from E. pyrifoliae WT # 3 ( E. pyrifoliae WT # 3, KCCM10283) according to the present invention, E. amylovora ATCC15580. It is the figure compared with the hypersensitive reaction induction gene (hrpN) derived from ^T [A: Plant hypersensitive reaction induction gene derived from E. pyrifoliae WT # 3, B: burn disease fungus ( E. amylovora ) ATCC 15580 ^T- derived plant hypersensitive reaction-inducing gene (hrpN)]. FIG. 12 is a diagram showing a plant hypersensitive reaction-inducing protein (Pioneer) expressed from a plant hypersensitive reaction-inducing gene derived from E. pyrifoliae WT # 3 cloned into the plasmid vector pKEP3. [M: protein size marker, 1: Pioneer-41.1kD, 2: HrpN-39.7kD, 3: pET15b vector]. FIG. 13 shows the amino acid sequence of Pioneer, a plant hypersensitive reaction-inducing protein derived from E. pyrifoliae WT # 3 (KCCM10283) according to the present invention, and E. amylovora ATCC 15580. It is the figure which compared the amino acid sequence of the plant hypersensitive reaction induction protein (HrpN) derived from ^T [A: Pioneer (Pioneer, B: HrpN)]. FIG. 14 shows Pioneer, a plant hypersensitive reaction-inducing protein derived from various concentrations of E. pyrifoliae WT # 3 (KCCM10283), and a control group, E. amylovora . it is a diagram illustrating a processing plant hypersensitive response leaf tobacco ATCC15580 ^T from plant hypersensitive reaction inducing protein (hrpN). FIG. 15 shows that immaturity 4 days after inoculating the control buffer and Pioneer, a plant hypersensitive reaction-inducing protein derived from E. pyrifoliae WT # 3 according to the present invention. It is a photograph which shows the symptom of the surface of a pear fruit.

Claims (17)

  Erwinia pyrifoliae WT # 3, KCCM 10283), which is a pathogen of the genus Erwinia that is effective in controlling plant diseases and promoting plant growth.   A gene comprising the nucleic acid sequence of SEQ ID NO: 5. A gene encoding a polypeptide or protein consisting of the amino acid sequence represented by SEQ ID NO: 6.   The gene according to claim 2, characterized in that the nucleic acid sequence is derived from a black wilt fungus WT # 3 (Erwinia pyrifoliae WT # 3, KCCM 10283).   A recombinant expression vector comprising the gene according to claim 2. A transformant comprising the recombinant vector according to claim 5 . The transformant according to claim 6, wherein the transformant is a bacterium . It comprises the amino acid sequence of SEQ ID NO: 6, when contacting the plant cells other than None, characterized in that it induces a hypersensitive reaction or resistance to pathogens in plants other than None, non-infectious form of a polypeptide or protein.   The polypeptide or protein according to claim 8, characterized in that the amino acid sequence is derived from the black wilt fungus WT # 3 (Erwinia pyrifoliae WT # 3, KCCM 10283). The polypeptide or protein according to claim 8 , wherein the polypeptide or protein is recombinant.   A biochemical pesticide composition comprising the polypeptide or protein according to claim 8 or 9 and a carrier.   An agrochemical using the polypeptide or protein according to claim 8 or 9, and a carrier.   A plant growth promoter using the polypeptide or protein according to claim 8 or 9, and a carrier.   A seed treatment agent using the polypeptide or protein according to claim 8 or 9, and a carrier.   A pest repellent using the polypeptide or protein according to claim 8 or 9, and a carrier.   A fertilizer using the polypeptide or protein according to claim 8 or 9 and a carrier. Branch black oryzae WT # 3 (Erwinia pyrifoliae WT # 3, KCCM 10283) cultures, and Edakuro oryzae WT # 3 a (Erwinia pyrifoliae WT # 3, KCCM 10283) from strains plant hypersensitive response induced genes A method for mass-producing the polypeptide or protein by separating and purifying a polypeptide or protein that induces a hypersensitive reaction or resistance from a transformant (KCCM 10282).

Images