KR20010103046A - Compositions and Methods for the Treatment of Immune Related Diseases - Google Patents

Abstract

The present invention relates to methods of diagnosing and treating immune related diseases and compositions comprising novel proteins therefor.

Description

Compositions and Methods for the Treatment of Immune Related Diseases {Compositions and Methods for the Treatment of Immune Related Diseases}

Immune-related and inflammatory diseases are complex, often complex, interrelated biological pathways that are important for normal physiological conditions in response to injury or injury, initiation of repair of injury or damage, and initiation of innate or acquired defenses against foreign organisms. Signs or consequences. A disease or illness, if these normal physiological pathways are directly related to the intensity of the response or result in further injury or damage in response to self, or as a result of abnormal control or excessive stimulation, or a combination thereof This happens.

The development of such a disease often involves a multistage pathway and often a number of different biological systems / paths, but can result in improvement or therapeutic effects by intervening at critical points in one or more of these pathways. Therapeutic intervention may result from antagonism of harmful processes / paths or stimulation of beneficial processes / paths.

Many immune related diseases are known and extensively studied. Such diseases include immune mediated inflammatory diseases, non-immune mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia and the like.

T lymphocytes (T cells) are important components of the mammalian immune response. T cells recognize antigens associated with autologous molecules encoded by genes in major histocompatibility complexes (MHC). This antigen can be presented with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer cells, grafts and the like. The T cell system eliminates these modified cells that pose a health threat to the host mammal. T cells include helper T cells and cytotoxic T cells. Helper T cells multiply extensively after recognizing antigen-MHC complexes on antigen presenting cells. In addition, helper T cells secrete several cytokines, ie lymphokines, which play a pivotal role in activating B cells, cytotoxic T cells, and various other cells that participate in immune responses.

Central events in both humoral and cell mediated immune responses are activation of helper T cells and clonal expansion. Activation of helper T cells is initiated by the interaction of the T-cell receptor (TCR) -CD3 complex with antigen-MHC on the surface of antigen presenting cells. This interaction mediates a cascade of biochemical events that induce dormant helper T cells to enter the cell cycle (G0 to G1 transition), resulting in expression of high affinity receptors for IL-2 and sometimes IL-4. do. Activated T cells proliferate and differentiate over cycles to become memory cells or effector cells.

In addition to signals mediated through TCR, activation of T cells includes additional costimulation induced through interaction with cytokine or antigen presenting cells secreted by antigen presenting cells and membrane binding molecules in T cells. Cytokines IL-1 and IL-6 have been found to provide costimulatory signals. In addition, the interaction of B7 molecules expressed on antigen presenting cell surfaces with CD28 and CTLA-4 molecules expressed on T cell surfaces also affects T cell activation. Activated T cells increase the number of expression of cell adhesion molecules such as ICAM-1, integrin, VLA-4, LFA-1, CD56 and the like.

T cell proliferation in mixed lymphocyte culture or mixed lymphocyte response (MLR) is an established indicator of the immune system stimulation of the compounds. In many immune responses, inflammatory cells infiltrate the site of injury or infection. Such mobile cells may be neutrophils, eosinophils, monocytes or lymphocytes, as determined by histology of damaged tissue (Current Protocols in Immunology, ed. John E. Coligan, 1994, John Wiley & Sons, Inc.).

Immune related diseases can be treated by suppressing the immune response. The use of neutralizing antibodies that inhibit molecules with immune stimulatory activity would be beneficial in the treatment of immune mediated and inflammatory diseases. Molecules that inhibit the immune response can be used to suppress the immune response (through direct use of the protein or through the use of antibody agonists) and thus ameliorate immune related diseases.

Summary of the Invention

The present invention relates to compositions and methods for the diagnosis and treatment of immune related diseases in mammals, including humans. The present invention is based on the identification of proteins (including agonist and antagonist antibodies) that stimulate or inhibit an immune response in mammals. Immune related diseases can be treated by inhibiting or enhancing an immune response. Molecules that enhance the immune response stimulate or enhance the immune response to the antigen. If enhancing the immune response is beneficial, therapeutic molecules can be used to stimulate the immune response. In addition, these stimulatory molecules may be inhibited if inhibition of the immune response is valuable.

Neutralizing antibodies are examples of molecules that inhibit molecules with immune stimulatory activity and would be beneficial for the treatment of immune related and inflammatory diseases. In addition, molecules that inhibit the immune response can be used to ameliorate immune related diseases by inhibiting the immune response (either directly using the protein or through the use of antibody agonists).

Accordingly, PRO polypeptides and anti-PRO antibodies and fragments thereof are useful for the diagnosis and / or treatment (including prevention) of immune related diseases. Antibodies that bind to stimulatory proteins are useful for inhibiting the immune system and immune responses. Antibodies that bind to inhibitory proteins are useful for stimulating the immune system and immune responses. In addition, PRO polypeptides and anti-PRO antibodies are useful in the manufacture of medicines and medicaments for the treatment of immune related diseases and inflammatory diseases.

In one embodiment, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide.

In one aspect, the isolated nucleic acid molecule comprises (a) a full length amino acid sequence as described herein, an amino acid sequence with no signal peptide as described herein, or a transmembrane protein with or without a signal peptide as described herein. DNA molecule encoding a PRO polypeptide having an extracellular domain, or any other specifically defined fragment of a full length amino acid sequence as described herein, or (b) nucleic acid sequence identity with the complement of said DNA molecule (a) At least about 80%, alternatively at least about 81%, alternatively at least about 82%, alternatively at least about 83%, alternatively at least about 84%, alternatively at least about 85%, alternatively at least about 86%, alternatively At least about 87%, alternatively at least about 88%, alternatively at least about 89%, alternatively at least about 90%, alternatively at least about 91%, alternatively at least about 92%, alternatively at about 93 At least%, alternatively at least about 94%, alternatively at least about 95%, alternatively at least about 96%, alternatively at least about 97%, alternatively at least about 98%, and alternatively at least about 99%. .

In another aspect, the isolated nucleic acid molecule can comprise (a) the coding sequence of the full-length PRO polypeptide cDNA as described herein, the coding sequence of the PRO polypeptide without a signal peptide as described herein, or the signal peptide as described herein. With the extracellular domain of the transmembrane PRO polypeptide, with or without the coding sequence of any other specially defined fragment of the full length amino acid sequence as described herein, or (b) the complement of said DNA molecule (a) At least about 80%, alternatively at least about 81%, alternatively at least about 82%, alternatively at least about 83%, alternatively at least about 84%, alternatively at least about 85%, alternatively at least about 86% Alternatively at least about 87%, alternatively at least about 88%, alternatively at least about 89%, alternatively at least about 90%, alternatively at least about 91%, alternatively at least about 92%, Nucleotide sequences that are at least about 93%, alternatively at least about 94%, alternatively at least about 95%, alternatively at least about 96%, alternatively at least about 97%, alternatively at least about 98%, alternatively at least about 99% It includes.

In a further aspect, the invention provides a DNA molecule encoding the same mature polypeptide as that encoded by any of (a) any of the human protein cDNA deposited with the ATCC as described herein, or (b) said DNA molecule (a) At least about 80%, alternatively at least about 81%, alternatively at least about 82%, alternatively at least about 83%, alternatively at least about 84%, alternatively at least about 85%, Is at least about 86%, alternatively at least about 87%, alternatively at least about 88%, alternatively at least about 89%, alternatively at least about 90%, alternatively at least about 91%, alternatively at least about 92%, alternatively At least about 93%, alternatively at least about 94%, alternatively at least about 95%, alternatively at least about 96%, alternatively at least about 97%, alternatively at least about 98%, alternatively at least about 99% Isolated Nucleic Acid Molecules It relates.

In another aspect, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide having a transmembrane domain deleted or inactivated a transmembrane domain, or a complement of such a coding nucleotide sequence, wherein The transmembrane domain (s) are described herein. Thus, soluble extracellular domains of the PRO polypeptides described herein are contemplated.

Another embodiment is a PRO polypeptide that can be used as a hybridization probe for, for example, an antisense oligonucleotide probe, or optionally a coding fragment of a PRO polypeptide that can encode a polypeptide comprising a binding site for an anti-PRO polypeptide antibody. To a fragment of a coding sequence or complement thereof. Such nucleic acid fragments generally have at least about 20 nucleotides in length, alternatively at least about 30, alternatively at least about 40, alternatively at least about 50, alternatively at least about 60, alternatively at least about 70, Is at least about 80, alternatively at least about 90, alternatively at least about 100, alternatively at least about 110, alternatively at least about 120, alternatively at least about 130, alternatively at least about 140, At least about 150, alternatively at least about 160, alternatively at least about 170, alternatively at least about 180, alternatively at least about 190, alternatively at least about 200, alternatively at least about 250, alternatively about At least 300, alternatively at least about 350, alternatively at least about 400, alternatively at least about 450, alternatively at least about 500, alternatively at least about 600, alternatively at least about 700, alternatively at about 800 More than about 900 Or at least about 1000, alternatively at least about 1500, alternatively at least about 2000, alternatively at least about 2500, alternatively at least about 3000, alternatively at least about 4000, alternatively at least about 5000 Wherein the term "about" in this context means 10% of the length of the nucleotide sequence referred to herein. New fragments of the nucleotide sequence encoding each PRO polypeptide can be used to align each nucleotide encoding this PRO polypeptide with other known nucleotide sequences using any of a number of well known sequence alignment programs, and which nucleotide sequence fragments. It is to be understood that the determination may be made in a routine manner by determining if the (s) are new. All such nucleotide sequences encoding respective PRO polypeptides are contemplated herein. Also contemplated are polypeptide fragments comprising a binding site for a nucleotide molecule, preferably an anti-PRO polypeptide antibody, that encodes a fragment of a PRO polypeptide.

In another embodiment, the invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above.

In certain aspects, the invention provides a full-length amino acid sequence as described herein, an amino acid sequence with no signal peptide as described herein, an extracellular domain of a transmembrane protein with or without a signal peptide as described herein, or herein Amino acid sequence identity with a PRO polypeptide having any other specifically defined fragment of the full-length amino acid sequence as described below is at least about 80%, alternatively at least about 81%, alternatively at least about 82%, alternatively about 83% Or at least about 84%, alternatively at least about 85%, alternatively at least about 86%, alternatively at least about 87%, alternatively at least about 88%, alternatively at least about 89%, alternatively at least about 90% Alternatively at least about 91%, alternatively at least about 92%, alternatively at least about 93%, alternatively at least about 94%, alternatively at least about 95%, alternatively To an isolated PRO polypeptide comprising an amino acid sequence that is at least about 96%, alternatively at least about 97%, alternatively at least about 98%, alternatively at least about 99%.

In a further aspect, the invention provides that the amino acid sequence identity with an amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC as described herein is at least about 80%, alternatively at least about 81%, alternatively At least about 82%, alternatively at least about 83%, alternatively at least about 84%, alternatively at least about 85%, alternatively at least about 86%, alternatively at least about 87%, alternatively at least about 88%, alternatively about At least 89%, alternatively at least about 90%, alternatively at least about 91%, alternatively at least about 92%, alternatively at least about 93%, alternatively at least about 94%, alternatively at least about 95%, alternatively about 96% An isolated PRO polypeptide comprising an amino acid sequence of at least%, alternatively at least about 97%, alternatively at least about 98%, alternatively at least about 99%.

In a further aspect, the invention provides a full length amino acid sequence as described herein, an amino acid sequence with no signal peptide as described herein, an extracellular domain of a transmembrane protein with or without a signal peptide as described herein, or At least about 80% positive, alternatively at least about 81% positive, alternatively at least about 82% positive, as compared to the amino acid sequence of a PRO polypeptide having any other specifically defined fragment of the full length amino acid sequence as described herein Is at least about 83% positive, alternatively at least about 84% positive, alternatively at least about 85% positive, alternatively at least about 86% positive, alternatively at least about 87% positive, alternatively at least about 88% positive, alternatively about At least 89% positive, alternatively at least about 90% positive, alternatively at least about 91% positive, alternatively about At least 92% positive, alternatively at least about 93% positive, alternatively at least about 94% positive, alternatively at least about 95% positive, alternatively at least about 96% positive, alternatively at least about 97% positive, alternatively about 98% An isolated PRO polypeptide comprising an amino acid sequence that records at least a positive, alternatively at least about 99% positive.

In a specific aspect, the invention provides an isolated PRO polypeptide encoded by a nucleotide sequence encoding the amino acid sequence as described herein and having no N-terminal signal peptide and / or initiating methionine. Also described herein are methods of preparing the isolated PRO polypeptides, which method comprise culturing a host cell comprising a vector comprising a suitable coding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, and removing the PRO from the cell culture. Recovering the polypeptide.

In another aspect the invention provides an isolated PRO polypeptide wherein the transmembrane domain is deleted or the transmembrane domain is inactivated. Also described herein are methods of preparing the isolated PRO polypeptides, which method comprise culturing a host cell comprising a vector comprising a suitable coding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, and removing the PRO from the cell culture. Recovering the polypeptide.

In another embodiment of the invention, the invention provides a vector comprising a DNA encoding any of the PRO polypeptides. Also provided are host cells comprising any of these vectors. By way of example, the host cell can be a CHO cell, E. coli or yeast. Methods of making any of the polypeptides described herein are also provided, which include culturing the host cell under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.

In other embodiments, the present invention provides chimeric molecules comprising any polypeptide described herein fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any polypeptide described herein fused to an epitope tag sequence or an Fc region of an immunoglobulin.

In other embodiments, the present invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or useful as antisense probes, wherein the probes may be derived from any of the above or following nucleotide sequences.

In other embodiments, the invention relates to agonists and antagonists of PRO polypeptides that mimic or inhibit one or more functions or activities of PRO polypeptides. In certain embodiments, the agonist and antagonist are antibodies that bind to a PRO polypeptide or small molecule.

In other embodiments, the invention also provides antibodies that specifically bind to any of the above or below polypeptides. Optionally this antibody is a monoclonal antibody, humanized antibody, antibody fragment or single chain antibody. In one aspect, the invention relates to an isolated antibody that binds to a PRO polypeptide. In another aspect, the antibody mimics the activity of the PRO polypeptide (agonist antibody), or vice versa, the antibody inhibits or neutralizes the activity of the PRO polypeptide (antagonist antibody). In another aspect, the antibody is preferably a monoclonal antibody having nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody can be labeled and immobilized on a solid support. In a further aspect, the antibody is an antibody fragment, monoclonal antibody, single chain antibody or anti-idiotype antibody.

In a further embodiment, the present invention relates to a method of identifying an agonist or antagonist for a PRO polypeptide, comprising contacting the PRO polypeptide with a candidate molecule to monitor the biological activity mediated by the PRO polypeptide. Preferably, the PRO polypeptide is a native sequence PRO polypeptide.

In another embodiment, the present invention relates to a composition of matter comprising a PRO polypeptide or an agonist or antagonist antibody that binds to the polypeptide in an admixture with a carrier or excipient. In one aspect, the composition contains a therapeutically effective amount of the peptide or antibody. In another aspect, where the composition comprises an immune stimulating molecule, the composition may (a) increase inflammatory cell infiltration into tissue from a mammal that needs to increase inflammatory cell infiltration into tissue, or (b) T in response to an antigen in a mammal in need of stimulating or enhancing an immune response in a mammal that needs to stimulate or enhance an immune response, or (c) increasing the proliferation of T-lymphocytes in response to an antigen. Useful for increasing the proliferation of lymphocytes. In a further aspect, if the composition comprises an immunosuppressive molecule, the composition may (a) reduce inflammatory cell invasion into the tissue from a mammal that needs to reduce inflammatory cell invasion into the tissue, or (b A) in response to an antigen in a mammal in need of inhibiting or alleviating an immune response in a mammal in need thereof, or (c) reducing the proliferation of T-lymphocytes in response to an antigen. It is useful for reducing the proliferation of T-lymphocytes. In another aspect, the composition comprises additional active ingredients, which may be, for example, additional antibodies or cytotoxic or chemotherapeutic agents. This composition is preferably sterilized.

In another embodiment, the invention relates to the use of the polypeptides and antibodies of the invention for the preparation of a composition or medicament having said use.

In a further embodiment, the invention provides anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti -PRO272, anti-PRO332, anti-PRO526, anti-PRO701, anti-PRO361, anti-PRO362, anti-PRO363, anti-PRO364, anti-PRO356, anti-PRO531, anti-PRO533, anti-PRO1083, anti-PRO865 Anti-PRO770, Anti-PRO769, Anti-PRO788, Anti-PRO1114, Anti-PRO1007, Anti-PRO1184, Anti-PRO1031, Anti-PRO1346, Anti-PRO1155, Anti-PRO1250, Anti-PRO1312, Anti-PRO1192, Anti -PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344 Anti-PRO333, Anti-PRO381, Anti-PRO720, Anti-PRO866, Anti-PRO840, Anti-PRO982, Anti-PRO836, Anti-PRO1159, Anti-PRO1358, Anti-PRO1325, Anti-PRO1338, Anti-PRO1434, Anti Nucleic acids encoding -PRO4333, anti-PRO4302, anti-PRO4430 or anti-PRO5727 antibodies, and vectors and recombinant host cells comprising such nucleic acids. In a further embodiment, the invention comprises culturing a host cell transformed with a nucleic acid encoding the antibody under conditions suitable for expression of the antibody, and recovering the antibody from the cell culture. It relates to a method for producing.

In a further embodiment, the invention relates to an isolated nucleic acid molecule that hybridizes to a nucleic acid molecule encoding a PRO polypeptide or complement thereof. The nucleic acid is preferably DNA and hybridization preferably takes place under stringent conditions. Such nucleic acid molecules act as antisense molecules of the amplified genes identified herein and can be used for the regulation of each amplified gene or as antisense primers in the amplification reaction. In addition, such sequences can be used as part of ribozymes and / or triple helix sequences and used to control amplified genes.

In another embodiment, the invention comprises a cell suspected of containing and / or expressing said polypeptide, anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235 Anti-PRO245, Anti-PRO172, Anti-PRO273, Anti-PRO272, Anti-PRO332, Anti-PRO526, Anti-PRO701, Anti-PRO361, Anti-PRO362, Anti-PRO363, Anti-PRO364, Anti-PRO356, Anti -PRO531, anti-PRO533, anti-PRO1083, anti-PRO865, anti-PRO770, anti-PRO769, anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155 , Anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti -PRO205, anti-PRO21, anti-PRO269, anti-PRO344, anti-PRO333, anti-PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358 , Anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333, anti-PRO4302, anti-PRO4430 or anti-PRO5727 antibody, and the antibody binds to the cells. , To a method for measuring the presence of PRO polypeptide, comprising measures how.

In another embodiment, the present invention provides a method for determining the expression level of a gene encoding a PRO polypeptide in (a) a test sample of tissue cells obtained from a mammal, and (b) a control sample of known normal tissue cells of the same cell type. Wherein the higher or lower expression level in the test sample compared to the control sample indicates the presence of an immune related disease in the mammal from which the test tissue cell was obtained. It is about a method.

In another embodiment, the present invention provides a method for the detection of complexes between (a) contacting an anti-PRO polypeptide antibody with a test sample of tissue cells obtained from a mammal, and (b) detecting complex formation between the antibody and each PRO polypeptide in the test sample, respectively. Wherein the complex formation is indicative of the presence or absence of the disease. The detection method can be quantitative or qualitative and can be performed by monitoring and comparing complex formation in a control sample of known normal tissue cells of the same cell type. More complexes formed in the test sample indicates the presence or absence of an immune related disease in the mammal from which the test tissue cells were obtained. Preferably, the antibody has a detectable label. Complex formation can be monitored, for example, by optical microscopy, flow cytometry, fluorometry, or other techniques known in the art. Test samples are generally obtained from individuals who are suspected of having an immune system deficient or abnormal.

In another embodiment, the invention provides anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti- PRO272, anti-PRO332, anti-PRO526, anti-PRO701, anti-PRO361, anti-PRO362, anti-PRO363, anti-PRO364, anti-PRO356, anti-PRO531, anti-PRO533, anti-PRO1083, anti-PRO865, Anti-PRO770, anti-PRO769, anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti- PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344, Anti-PRO333, anti-PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti- A diagnostic kit comprising a PRO4333, anti-PRO4302, anti-PRO4430 or anti-PRO5727 antibody and a carrier (eg buffer) in a suitable package. The kit preferably includes instructions on how to use the antibody for detecting the PRO polypeptide.

In a further embodiment the invention relates to an article of manufacture comprising a container, a guide on a container, and an active agent-containing composition contained in the container, wherein the composition is effective for stimulating or suppressing an immune response in a mammal, and Courageous instructions indicate that the composition can be used for the treatment of an immune related disease and that the active agent in the composition is an agent that stimulates or inhibits the expression and / or activity of the PRO polypeptide. In a preferred aspect, the active agent is PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083 , PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269 , PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 Polypeptide, or Anti-PRO200, Anti-PRO204, Anti-PRO212, Anti -PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti-PRO272, anti-PRO332, anti-PRO526, anti-PRO701, anti-PRO361, anti-PRO362 Anti-PRO363, Anti-PRO364, Anti-PRO356, Anti-PRO531, Anti-PRO533, Anti-PRO1083, Anti-PRO865, Anti-PRO770, Anti-PRO769, Anti-PRO788, Anti-PRO1114, Anti-PRO1007, Anti -PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1 155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, Anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344, anti-PRO333, anti-PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti- PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333, anti-PRO4302, anti-PRO4430 or anti-PRO5727 antibody.

A further embodiment is a method of identifying compounds capable of inhibiting the expression and / or activity of the PRO polypeptide by contacting these two components under time and conditions sufficient to interact with the candidate compound and the PRO polypeptide. In specific aspects, the candidate compound or PRO polypeptide is immobilized on a solid support. In another aspect, the unfixed component has a detectable label.

Another embodiment of the invention is the use of a PRO polypeptide, or agonist or antagonist thereof, as described herein in the manufacture of a PRO polypeptide, or agonist or antagonist thereof, or a medicament useful for the treatment of a condition responsive to an anti-PRO antibody. It is about.

The present invention relates to methods for diagnosing and treating immune related diseases and compositions therefor.

1 shows DNA29101-1276 (SEQ ID NO: 1).

2 shows the native sequence PRO200 polypeptide UNQ174 (SEQ ID NO: 2).

3 shows DNA30871-1157 (SEQ ID NO: 11).

4 shows the native sequence partial-length PRO204 polypeptide UNQ178 (SEQ ID NO: 12).

5 shows DNA30942-1134 (SEQ ID NO: 13).

6 shows native sequence PRO212 polypeptide UNQ186 (SEQ ID NO: 14).

7 shows DNA33087-1158 (SEQ ID NO: 18).

8 shows native sequence PRO216 polypeptide UNQ190 (SEQ ID NO: 19).

9 shows DNA33460-1166 (SEQ ID NO: 20).

10 shows native sequence PRO226 polypeptide UNQ200 (SEQ ID NO: 21).

11 shows DNA34387-1138 (SEQ ID NO: 25).

12 shows native sequence PRO240 polypeptide UNQ214 (SEQ ID NO: 26).

13 shows DNA35558-1167 (SEQ ID NO: 30).

14 shows native sequence PRO235 polypeptide UNQ209 (SEQ ID NO: 31).

15 shows DNA35638-1141 (SEQ ID NO: 35).

16 shows native sequence PRO245 polypeptide UNQ219 (SEQ ID NO: 36).

17 shows DNA35916-1161 (SEQ ID NO: 40).

18 shows native sequence PRO172 polypeptide UNQ146 (SEQ ID NO: 41).

19 shows DNA39523-1192 (SEQ ID NO: 45).

20 shows native sequence PRO273 polypeptide UNQ240 (SEQ ID NO: 46).

21 shows DNA40620-1183 (SEQ ID NO: 50).

22 shows native sequence PRO272 polypeptide UNQ239 (SEQ ID NO: 51).

23 shows DNA40982-1235 (SEQ ID NO: 56).

24 shows native sequence PRO332 polypeptide UNQ293 (SEQ ID NO: 57).

25 shows DNA44184-1319 (SEQ ID NO: 61).

26 shows native sequence PRO526 polypeptide UNQ330 (SEQ ID NO: 62).

27 shows DNA44205-1285 (SEQ ID NO: 66).

28 shows native sequence PRO701 polypeptide UNQ365 (SEQ ID NO: 67).

29 shows DNA45410-1250 (SEQ ID NO: 71).

30 shows native sequence PRO361 polypeptide UNQ316 (SEQ ID NO: 72).

31 shows DNA45416-1251 (SEQ ID NO: 79).

32 shows native sequence PRO362 polypeptide UNQ317 (SEQ ID NO: 80).

33 shows DNA45419-1252 (SEQ ID NO: 86).

34 shows native sequence PRO363 polypeptide UNQ318 (SEQ ID NO: 87).

35 shows DNA47365-1206 (SEQ ID NO: 91).

36 shows native sequence PRO364 polypeptide UNQ319 (SEQ ID NO: 92).

37 shows DNA47470-1130 (SEQ ID NO: 101).

38 shows native sequence PRO356 polypeptide UNQ313 (SEQ ID NO: 102).

39 shows DNA48314-1320 (SEQ ID NO: 106).

40 shows native sequence PRO531 polypeptide UNQ332 (SEQ ID NO: 107).

41 shows DNA49435-1219 (SEQ ID NO: 111).

42 shows the native sequence PRO533 polypeptide UNQ334 (SEQ ID NO: 112).

43 shows DNA50921-1458 (SEQ ID NO: 116).

44 shows native sequence PRO1083 polypeptide UNQ540 (SEQ ID NO: 117).

45 shows DNA53974-1401 (SEQ ID NO: 123).

46 shows native sequence PRO865 polypeptide UNQ434 (SEQ ID NO: 124).

47 shows DNA54228-1366 (SEQ ID NO: 133).

48 shows native sequence PRO770 polypeptide UNQ408 (SEQ ID NO: 134).

49 shows DNA54231-1366 (SEQ ID NO: 139).

50 shows native sequence PRO769 polypeptide UNQ407 (SEQ ID NO: 140).

51 shows DNA56405-1357 (SEQ ID NO: 141).

52 shows native sequence PRO788 polypeptide UNQ430 (SEQ ID NO: 142).

53 shows DNA57033-1403 (SEQ ID NO: 143).

54 shows native sequence PRO1114 polypeptide UNQ557 (SEQ ID NO: 144).

55 shows DNA57690-1374 (SEQ ID NO: 145).

56 shows native sequence PRO1007 polypeptide UNQ491 (SEQ ID NO: 146).

57 shows DNA59220-1514 (SEQ ID NO: 147).

58 shows native sequence PRO1184 polypeptide UNQ598 (SEQ ID NO: 148).

59 shows DNA59294-1381 (SEQ ID NO: 149).

60 shows native sequence PRO1031 polypeptide UNQ516 (SEQ ID NO: 150).

61 shows DNA59776-1600 (SEQ ID NO: 151).

62 shows native sequence PRO1346 polypeptide UNQ701 (SEQ ID NO: 152).

63 shows DNA59849-1504 (SEQ ID NO: 156).

64 shows native sequence PRO1155 polypeptide UNQ585 (SEQ ID NO: 157).

65 shows DNA60775-1532 (SEQ ID NO: 158).

66 shows native sequence PRO1250 polypeptide UNQ633 (SEQ ID NO: 159).

67 shows DNA61873-1574 (SEQ ID NO: 160).

68 shows native sequence PRO1312 polypeptide UNQ678 (SEQ ID NO: 161).

69 shows DNA62814-1521 (SEQ ID NO: 162).

70 shows native sequence PRO1192 polypeptide UNQ606 (SEQ ID NO: 163).

71 shows DNA64885-1529 (SEQ ID NO: 167).

72 shows native sequence PRO1246 polypeptide UNQ630 (SEQ ID NO: 168).

73 shows DNA65404-1551 (SEQ ID NO: 169).

74 shows the native sequence PRO1283 polypeptide UNQ653 (SEQ ID NO: 170).

75 shows DNA65412-1523 (SEQ ID NO: 177).

76 shows native sequence PRO1195 polypeptide UNQ608 (SEQ ID NO: 178).

77 shows DNA66675-1587 (SEQ ID NO: 179).

78 shows native sequence PRO1343 polypeptide UNQ698 (SEQ ID NO: 180).

79 shows DNA68864-1629 (SEQ ID NO: 184).

80 shows native sequence PRO1418 polypeptide UNQ732 (SEQ ID NO: 185).

81 shows DNA68872-1620 (SEQ ID NO: 186).

82 shows native sequence PRO1387 polypeptide UNQ722 (SEQ ID NO: 187).

83 shows DNA68874-1622 (SEQ ID NO: 188).

84 shows native sequence PRO1410 polypeptide UNQ728 (SEQ ID NO: 189).

85 shows DNA76400-2528 (SEQ ID NO: 190).

86 shows native sequence PRO1917 polypeptide UNQ900 (SEQ ID NO: 191).

87 shows DNA77624-2515 (SEQ ID NO: 192).

88 shows native sequence PRO1868 polypeptide UNQ859 (SEQ ID NO: 193).

89 shows DNA30868-1156 (SEQ ID NO: 228).

90 shows partial native sequence PRO205 polypeptide UNQ179 (SEQ ID NO: 229).

91 shows DNA36638-1056 (SEQ ID NO: 230).

92 shows the native sequence PRO21 polypeptide UNQ21 (SEQ ID NO: 231).

93 shows DNA38260-1180 (SEQ ID NO: 232).

94 shows native sequence PRO269 polypeptide UNQ236 (SEQ ID NO: 233).

95 shows DNA40592-1242 (SEQ ID NO: 240).

96 shows native sequence PRO344 polypeptide UNQ303 (SEQ ID NO: 241).

97 shows DNA41374-1312 (SEQ ID NO: 248).

98 shows partial length native sequence PRO333 polypeptide UNQ294 (SEQ ID NO: 249).

99 shows DNA44194-1317 (SEQ ID NO: 250).

100 shows native sequence PRO381 polypeptide UNQ322 (SEQ ID NO: 251).

101 shows DNA53517-1366 (SEQ ID NO: 255).

102 shows native sequence PRO720 polypeptide UNQ388 (SEQ ID NO: 256).

103 shows DNA53971-1359 (SEQ ID NO: 257).

104 shows native sequence PRO866 polypeptide UNQ435 (SEQ ID NO: 258).

105 shows DNA53987-1438 (SEQ ID NO: 266).

106 shows native sequence PRO840 polypeptide UNQ433 (SEQ ID NO: 267).

107 shows DNA57700-1408 (SEQ ID NO: 268).

108 shows native sequence PRO982 polypeptide UNQ483 (SEQ ID NO: 269).

109 shows DNA59620-1463 (SEQ ID NO: 270).

110 shows native sequence PRO836 polypeptide UNQ545 (SEQ ID NO: 271).

111 shows DNA60627-1508 (SEQ ID NO: 272).

112 shows native sequence PRO1159 polypeptide UNQ589 (SEQ ID NO: 273).

113 shows DNA64890-1612 (SEQ ID NO: 274).

114 shows native sequence PRO1358 polypeptide UNQ707 (SEQ ID NO: 275).

115 shows DNA66659-1593 (SEQ ID NO: 276).

116 shows the native sequence PRO1325 polypeptide UNQ685 (SEQ ID NO: 277).

117 shows DNA66667-1596 (SEQ ID NO: 278).

118 shows the native sequence PRO1338 polypeptide UNQ693 (SEQ ID NO: 279).

119 shows DNA68818-2536 (SEQ ID NO: 280).

120 shows native sequence PRO1434 polypeptide UNQ739 (SEQ ID NO: 281).

121 shows DNA84210-2576 (SEQ ID NO: 285).

122 shows native sequence PRO4333 polypeptide UNQ1888 (SEQ ID NO: 286).

123 shows DNA92218-2554 (SEQ ID NO: 292).

124 shows the native sequence PRO4302 polypeptide UNQ1866 (SEQ ID NO: 293).

125 shows DNA96878-2626 (SEQ ID NO: 294).

126 shows the native sequence PRO4430 polypeptide UNQ1947 (SEQ ID NO: 295).

127 shows DNA98853-1739 (SEQ ID NO: 296).

128 shows native sequence PRO5727 polypeptide UNQ2448 (SEQ ID NO: 297).

I. Definition

The terms "PRO polypeptide (s)" and "PRO", as used herein, refer to a variety of polypeptides, followed by numbers, with the full name (ie, "PRO / number" or more specifically, PRO200, PRO204, PRO212). , PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007 , PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840 , PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727) is a term that refers to a specific polypeptide sequence as described herein. As used herein, in the terms "PRO / number polypeptide" and "PRO / number" "number" is represented by the actual number (eg, as described above), which means that the native sequence polypeptide and polypeptide variants (additional herein) Term). The PRO polypeptides described herein can be isolated from a variety of sources, such as human tissue or other sources, or prepared by recombinant or synthetic methods.

“Native sequence PRO polypeptide (s)” includes polypeptides having the same amino acid sequence as the corresponding PRO polypeptide from nature. Such native sequence PRO / number polypeptides can be isolated from nature or prepared by recombinant or synthetic methods. The term “natural sequence PRO polypeptide (s)” specifically refers to naturally occurring truncated or secreted forms (eg extracellular domain sequences) of a particular PRO / number polypeptide, naturally occurring variant forms of such polypeptides (eg Such as alternatively spliced forms) and naturally occurring allelic variants. In various embodiments of the invention, the native sequence PRO polypeptides described herein are mature or full length native sequence polypeptides comprising the full length amino acid sequences shown in the accompanying drawings. Start and stop codons are indicated in bold and underlined in the figures. However, although the PRO / numerical polypeptides disclosed in the figures attached herein appear to begin with methionine residues designated at amino acid position 1 in the figures, other methionine residues located upstream or downstream from amino acid position 1 in the figures are starting amino acids of the PRO polypeptide. It is conceivable and possible that it can be used as a residue.

"PRO polypeptide (s) extracellular domain" or "ECD" refers to such polypeptide forms that are essentially free of transmembrane and cytoplasmic domains. Typically the PRO polypeptide ECD will thus comprise less than 1% of the transmembrane and / or cytoplasmic domains, preferably less than 0.5% of said domains. It will be appreciated that all transmembrane domains identified in the PRO polypeptides of the invention have been identified according to criteria commonly used to identify hydrophobic domain types in the art. The exact boundaries of the transmembrane domain may vary, but most are within about 5 amino acid ranges at either end of this domain, as initially identified herein. Thus, the extracellular domain of the PRO polypeptide may optionally comprise up to about 5 amino acids at either interface of the transmembrane domain / extracellular domain identified in the Examples or the description, with the accompanying signal peptide Such polypeptides that are absent, and nucleic acids encoding them, are included in the present invention.

Approximate positions of “signal peptides” of the various PRO / number polypeptides described herein are shown herein and / or in the accompanying drawings. However, it should be borne in mind that although the C-terminal boundary of the signal peptide may vary, most are about 5 amino acids in either interface of the signal peptide C-terminal first identified herein, wherein C-terminal boundaries can be identified according to criteria commonly used to identify the type of amino acid sequence element in the art (see, eg, Nielsen et al., Prot. Eng. 10: 1-6 (1997). And von Heinje et al., Nucl.Acids.Res. 14: 4683-4690 (1986).) In addition, in some cases the cleavage of the signal sequence of the secreting polypeptide is not entirely identical resulting in one or more secreted polypeptides. These mature polypeptides whose cleavage of the signal peptide is within the range of about 5 amino acids or less on either interface of the C-terminus of the signal peptide identified herein, And polynucleotides encoding them.

“PRO polypeptide variant”, “PRO / numeric variant” or “PRO variant” refers to a full-length native sequence PRO polypeptide sequence described herein, a PRO polypeptide sequence without a signal peptide as described herein, or with a signal peptide as described herein An active PRO polypeptide as defined herein (eg, below) having an amino acid sequence identity of at least about 80% with an extracellular domain of a PRO polypeptide that is absent, or any other fragment of the full-length PRO polypeptide sequence as described herein. do. Such PRO polypeptide variants include, for example, PRO polypeptides having one or more amino acid residues added or deleted at the N-terminus or C-terminus of the full-length natural amino acid sequence. Typically, a PRO polypeptide variant is a full length native sequence PRO polypeptide sequence disclosed herein, a PRO polypeptide sequence without a signal peptide as described herein, an extracellular domain of a PRO polypeptide with or without a signal peptide as described herein, or as described herein. As shown, the amino acid sequence identity with any other specially defined fragment of the full-length PRO polypeptide sequence is at least about 80%, alternatively at least about 81%, alternatively at least about 82%, alternatively at least about 83%, alternatively about At least 84%, alternatively at least about 85%, alternatively at least about 86%, alternatively at least about 87%, alternatively at least about 88%, alternatively at least about 89%, alternatively at least about 90%, alternatively at about 91 At least%, alternatively at least 92%, alternatively at least about 93%, alternatively at least about 94%, alternatively at least about 95%, alternatively about 96% Or at least about 97%, alternatively at least about 98%, alternatively at least about 99%. Typically, PRO variant polypeptides are at least about 10 amino acids in length, alternatively at least about 20 amino acids, alternatively at least about 30 amino acids, alternatively at least about 40 amino acids, alternatively at least about 50 amino acids, alternatively At least about 60 amino acids, alternatively at least about 70 amino acids, alternatively at least about 80 amino acids, alternatively at least about 90 amino acids, alternatively at least about 100 amino acids, alternatively at least about 150 amino acids, alternatively about 200 At least about amino acids, alternatively at least about 300 amino acids, alternatively at least about 400 amino acids, alternatively at least about 500 amino acids, alternatively at least about 600 amino acids, alternatively at least about 700 amino acids, alternatively at least about 800 Amino acids, alternatively about 900 or more amino acids, alternatively about 1000 On the amino acid, alternatively at least about 1200 amino acids, alternatively at least about 1400 amino acids, alternatively at least about 1500 amino acids or more.

“Amino acid sequence identity (%)” for a PRO polypeptide sequence as disclosed herein aligns a candidate sequence with a particular PRO polypeptide sequence and, where necessary, any conservative substitutions after introducing a gap to obtain a maximum of percent sequence identity. Defined as the ratio of amino acid residues in a candidate sequence that is identical to the amino acid residues of a particular PRO / number polypeptide sequence without being considered part of. Alignment to determine percent amino acid sequence identity is achieved using a variety of methods known in the art, for example, publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. can do. One skilled in the art can determine suitable parameters for measuring alignment, including any algorithms needed to maximally align over the entire length of the sequences being compared. However, for purposes herein,% amino acid sequence identity values can be obtained using the sequence comparison computer program ALIGN-2, which complete source code for the ALIGN-2 program is described in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genenctech, Inc., and the source code shown in Table 1 was submitted with the user documentation to the U.S. Copyright Office (20559 Washington, DC, USA) and registered under U.S. copyright. It is registered as TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, CA, or may be compiled from the source code described in Table 1 below. The ALIGN-2 program should be compiled and used on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set in the ALIGN-2 program and do not change.

When ALIGN-2 is used for amino acid sequence comparison, the amino acid sequence identity (%) of a given amino acid sequence B to B, or a given amino acid sequence A to B (or to a given amino acid sequence B, B, or B) Can be expressed differently by a given amino acid sequence A having or including specific% amino acid sequence identity to

X / Y × 100

Where X is the number of amino acid residues recorded as equally matched by the sequence alignment program ALIGN-2 in the program alignment of A and B, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity (A) of A to B will not be equal to the amino acid sequence identity (B) of B to A. As an example of calculating amino acid sequence identity using this method, Tables 2 and 3 show a method for calculating the amino acid sequence identity (%) of an amino acid sequence referred to as a "comparative protein" to an amino acid sequence designated as "PRO". Wherein "PRO" represents the amino acid sequence of the PRO polypeptide of the household of interest, "comparative protein" represents the amino acid sequence of the polypeptide to be compared with the "PRO" polypeptide of interest, and "X", "Y" and "Z" Each represents an amino acid residue of a different family.

Unless specifically stated otherwise, all percent amino acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph. However, amino acid sequence identity values (%) can also be obtained using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-80 (1996)), as described below. Most of the WU-BLAST-2 search parameters are set to their default values. Those not set to the default values, ie adjustable parameters, are set to the following values: overlap span = 1, overlap fraction = 0.125, word limit (T) = 11, and score matrix = BLOSUM62. Using WU-BLAST-2, the amino acid sequence identity value (%) is determined by (a) the amino acid sequence of the PRO polypeptide of interest with the sequence derived from the native PRO polypeptide and the comparative amino acid sequence of interest (ie, with the PRO polypeptide of interest). The number of identical amino acid residues matched with the sequence to be compared, which may be a PRO polypeptide variant), is determined by determining WU-BLAST-2, which is determined by dividing the total amino acid residues of (b) the PRO polypeptide of interest . For example, the term "polypeptide comprising amino acid sequence A having at least 80% amino acid sequence identity with amino acid sequence B", wherein amino acid sequence A is the amino acid sequence of interest to be compared and amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest to be.

% Amino acid sequence identity can also be determined using the sequence comparison program NCBI-BLAST-2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST-2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.) Or obtained from the National Institutes of Health, Bethesda, Maryland, USA. NCBI-BLAST-2 uses several search parameters, all of which are set to default values, for example, Unmask = Yes, Strand = All, Expectations = 10, Minimum Low Complexity Length = 15 / 5, multi-pass e-value = 0.01, constant for multi-pass = 25, dropoff = 25 for final gap alignment and score matrix = BLOSUM62.

When NCBI-BLAST-2 is used for amino acid sequence comparison, the amino acid sequence identity (%) of a given amino acid sequence A to B, or B to a given amino acid sequence B (for a given amino acid sequence B, B, or B Can be expressed differently by a given amino acid sequence A having or including specific% amino acid sequence identity to

X / Y × 100

Where X is the number of amino acid residues that are recorded as identical matches by the sequence alignment program NCBI-BLAST-2 in the program alignment of A and B, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity (A) of A to B will not be equal to the amino acid sequence identity (B) of B to A.

A “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is a nucleic acid molecule encoding an active PRO polypeptide as defined below, which includes (1) a full length native sequence PRO polypeptide sequence as described herein, (2) described herein Full length native sequence PRO polypeptide sequence without signal peptide as described herein, (3) the extracellular domain of a PRO polypeptide with or without signal peptide as described herein, or (4) any other of the full length PRO polypeptide sequence as described herein. A nucleic acid molecule having at least about 80% nucleic acid sequence identity with a nucleic acid sequence encoding a fragment. Typically, a PRO polypeptide variant polynucleotide comprises (1) a full length native sequence PROpolypeptide sequence as described herein, (2) a full length native sequence PRO polypiped sequence without a signal peptide as described herein, (3) described herein At least about 80% or different nucleic acid sequence identity with the extracellular domain of a PRO polypeptide sequence with or without a signal peptide, or (4) a nucleic acid sequence encoding any other fragment of a full-length PRO polypeptide sequence as described herein Is at least about 81%, alternatively at least about 82%, alternatively at least about 83%, alternatively at least about 84%, alternatively at least about 85%, alternatively at least about 86%, alternatively at least about 87%, alternatively At least about 88%, alternatively at least about 89%, alternatively at least about 90%, alternatively at least about 91%, alternatively at least about 92%, alternatively at least about 93%, To about 94%, alternatively at least about 95%, alternatively at least about 96%, alternatively at least about 97%, alternatively at least about 98%, alternatively to at least about 99%. Variants do not encompass native nucleotide sequences.

Typically, PRO polypeptide variant polynucleotides are at least about 30 nucleotides in length, alternatively at least about 60 nucleotides, alternatively at least about 90 nucleotides, alternatively at least about 120 nucleotides, alternatively at least about 150 nucleotides, Alternatively at least about 180 nucleotides, alternatively at least about 210 nucleotides, alternatively at least about 240 nucleotides, alternatively at least about 270 nucleotides, alternatively at least about 300 nucleotides, alternatively at least about 450 nucleotides, alternatively At least about 500 nucleotides, alternatively at least about 600 nucleotides, alternatively at least about 700 nucleotides, alternatively at least about 800 nucleotides, alternatively at least about 900 nucleotides, alternatively at least about 1000 nucleoles Teats, alternatively at least about 1200 nucleotides, alternatively at least about 1400 nucleotides, alternatively at least about 1600 nucleotides, alternatively at least about 1800 nucleotides, alternatively at least about 2000 nucleotides, alternatively at least about 2500 nucleotides, Alternatively at least about 3000 nucleotides, alternatively at least about 3500 nucleotides, alternatively at least about 4000 nucleotides, alternatively at least about 5000 nucleotides or more.

With respect to the PRO coding nucleic acid sequences identified herein, “% nucleic acid sequence identity” refers to the alignment of a particular PRO nucleic acid sequence with a candidate sequence and, if necessary, the introduction of a gap to obtain a maximum of sequence identity, followed by It is defined as the proportion of nucleotides of the candidate sequence that are identical to nucleotides. Alignment to determine percent nucleic acid sequence identity is accomplished using various methods known in the art, for example, publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. can do. However, for purposes herein,% nucleic acid sequence identity values can be obtained using the sequence comparison computer program ALIGN-2, the complete source code for which the ALIGN-2 program is described in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc., and the source code shown in Table 1 was submitted to the US Copyright Office (20559 Washington, DC, USA) with user documentation and registered as US Copyright TXU510087. have. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, CA, or may be compiled from the source code described in Table 1 below. The ALIGN-2 program should be compiled and used on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set in the ALIGN-2 program and do not change.

When ALIGN-2 is used for nucleic acid sequence comparison, to a given nucleic acid sequence D, to D, or to a nucleic acid sequence identity (%) of a given nucleic acid sequence C to D (for a given nucleic acid sequence D, to D, or to D) Can be expressed differently by a given nucleic acid sequence C having or including a constant percent nucleic acid sequence identity to)

W / Z × 100

Where W is the number of nucleotides recorded as equally matched by the sequence alignment program ALIGN-2 in the program alignment of C and D, and Z is the total number of nucleotides in D. It will be appreciated that if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the nucleic acid sequence identity (C) of C to D will not be the same as the nucleic acid sequence identity (D) of D to C. As examples of nucleic acid sequence identity calculations, Tables 4 and 5 show methods for calculating nucleic acid sequence identity (%) of nucleic acid sequences referred to as "comparative DNA" to nucleic acid sequences referred to as "PRO-DNA" and " PRO-DNA "refers to the PRO polypeptide-encoding nucleic acid sequence of the hypothesis of interest," comparative DNA "refers to the nucleotide sequence of the nucleic acid molecule to which the" PRO-DNA "nucleic acid molecule of interest is to be compared, and" N "," L "and "V" each represents a different assumption of nucleotides.

Unless specifically stated otherwise, all percent nucleic acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described in the immediately preceding paragraph. However,% nucleic acid sequence identity values are obtained using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-80 (1996)) as described below. Most of the WU-BLAST-2 search parameters are set to their default values. Parameters not set by default, ie adjustable parameters, were set to the following values: overlap span = 1, overlap fraction = 0.125, word limit (T) = 11, and score matrix = BLOSUM62. If WU-BLAST-2 is used, the nucleic acid sequence identity value (%) is compared to the nucleic acid sequence of (a) the PRO polypeptide encoding nucleic acid molecule of interest (ie, the reference sequence) with the sequence derived from the native PRO polypeptide-encoding nucleic acid. The number of identical nucleotides that are matched with the nucleic acid molecule that is being compared (i.e., may be a PRO variant polynucleotide as a sequence compared to the PRO polypeptide encoding nucleic acid molecule of interest) is obtained by WU-BLAST-2 followed by (b) PRO Obtained by dividing by the total number of nucleotides in the reference sequence. For example, isolated nucleic acid molecule comprising nucleic acid sequence A having at least 80% nucleic acid sequence identity with nucleic acid sequence B, wherein nucleic acid sequence A is the sequence of nucleic acid molecule of interest to be compared and nucleic acid sequence B is a PRO polypeptide. Is the nucleic acid sequence of the nucleic acid molecule of interest that encodes.

Nucleic acid sequence identity (%) can also be calculated using the sequence comparison program NCBI-BLAST-2 described below (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST-2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.) Or obtained from the National Institutes of Health, Bethesda, Maryland. NCBI-BLAST-2 uses several search parameters, all of which are set to their default values, for example, Unmask = Yes, Strand = All, Expectations = 10, Minimum Low Complexity Length = 15/5 , Multi-pass e-value = 0.01, constant for multi-pass = 25, dropoff = 25 for final gap alignment and score matrix = BLOSUM62.

When NCBI-BLAST-2 is used for nucleic acid sequence comparison, nucleic acid sequence identity (%) of a given nucleic acid sequence C to D, or D, to a given nucleic acid sequence D (for a given nucleic acid sequence D, D, or D Can be expressed differently by a given nucleic acid sequence C having or including a constant percent nucleic acid sequence identity to

W / Z × 100

Where W is the number of nucleotides recorded as identical matches by the sequence alignment program NCBI-BLAST-2 in the program alignment of C and D, and Z is the total number of nucleotides in D. It will be appreciated that if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the nucleic acid sequence identity (C) of C to D will not be the same as the nucleic acid sequence identity (D) of D to C.

In other embodiments the PRO variant polynucleotide is a nucleic acid molecule encoding an active PRO polypeptide (preferably under stringent hybridization and wash conditions) capable of hybridizing to the nucleotide sequence encoding the full length PRO polypeptide described herein. The PRO variant polypeptide may be one encoded by a PRO variant polynucleotide.

The term “positive” with respect to sequence comparisons performed as described above means residues of the compared sequences that are not identical but similar in nature (eg, as a result of conservative substitutions, see Table 6 below). To achieve the object herein, a positive value (%) is determined by (a) an amino acid sequence to be compared with the PRO polypeptide sequence of interest having a sequence derived from the native PRO polypeptide sequence (ie, the amino acid sequence with which the PRO polypeptide sequence is compared). The number of amino acid residues that recorded positive values between and is determined in the BLOSUM 62 matrix of WU-BLAST-2 and then divided by (b) the total number of amino acid residues of the PRO polypeptide of interest.

Unless stated otherwise, positive values (%) are calculated as described in the immediately preceding paragraph. However, amino acid sequence identity comparisons performed as described for ALIGN-2 and NCBI-BLAST-2 above include amino acid residues of the comparing sequences that are not identical but have similar properties. Amino acid residues that report positive values for amino acid residues of interest are the same as the amino acid residues of interest or are preferred substitutions of amino acid residues of interest (described in Table 6 below).

For amino acid sequence comparisons using ALIGN-2 or NCBI-BLAST-2, for a given amino acid sequence B, with B, or a positive value (%) of a given amino acid sequence A for B (with a given amino acid sequence B, Or a given amino acid sequence A having or including a constant positive percentage (%) for B), is calculated as follows:

X / Y × 100

Where X is the number of amino acid residues that record the positive value defined above by the sequence alignment program ALIGN-2 or NCBI-BLAST-2 in the program alignment of A and B, and Y is the total number of amino acid residues in B to be. It will be appreciated that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the positive value (%) of A for B will not be equal to the positive value (%) of B for A.

“Isolated,” as used to describe the various polypeptides described herein, means that the polypeptide has been identified, isolated and / or recovered from its natural environmental elements. Contaminant elements of the polypeptide's natural environment generally interfere with the diagnostic or therapeutic use of the polypeptide, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is purified to a degree sufficient to (1) obtain at least 15 residues of the N-terminal or internal amino acid sequence using a spinning cup sequencer, or (2) Coomassie blue or preferably silver staining It will be purified to show only one band in SDS-PAGE under non-reducing or reducing conditions. PRO Polypeptides Isolated polypeptides include polypeptides in situ within recombinant cells since at least one element of the natural environment will not be present. However, normally isolated polypeptide will be obtained by one or more purification steps.

By “isolated” PRO polypeptide coding nucleic acid or other polypeptide coding nucleic acid is meant a nucleic acid molecule identified and separated from one or more contaminating nucleic acid molecules which are commonly bound in the natural source of the polypeptide coding nucleic acid. Isolated polypeptide encoding nucleic acid molecules exist differently from the forms or states found in nature. Thus, isolated polypeptide encoding nucleic acid molecules are distinguished from polypeptide encoding nucleic acid molecules present in natural cells. However, for example, polypeptide encoding nucleic acid molecules present at different chromosomal positions from natural cells and typically contained in cells expressing a particular polypeptide are included in the isolated polypeptide encoding nucleic acid molecule.

The term "regulatory sequence" refers to a DNA sequence necessary for the expression of a coding sequence operably linked in a particular host organism. Suitable regulatory sequences for prokaryotes include, for example, promoters, optionally operator sequences, and ribosomal binding sites. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

Nucleic acids are “operably linked” when placed in a functional relationship with other nucleic acid sequences. For example, the DNA of a presequence or secretion leader is operably linked to the DNA of the polypeptide when expressed as a shear protein, which is in the form before the polypeptide is secreted, and the promoter or enhancer affects the transcription of the coding sequence. Is operably linked to the coding sequence, and the ribosome binding site is operably linked to the coding sequence when placed to facilitate translation. In general, "operably linked" means that the DNA sequences to be linked are located contiguously, and in the case of a secretory leader, not only are located contiguous, but also are present in the reading frame. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction enzyme sites. If such sites do not exist, the synthetic oligonucleotide adapters or linkers are used in accordance with conventional practice.

The "stringency" of the hybridization reaction can be readily determined by one skilled in the art and is generally an experimental calculation that depends on probe length, wash temperature, salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. Therefore, the higher the relative temperature, the more stringent the reaction conditions, while the lower the relative temperature, the less stringent the reaction conditions. For further information and explanation regarding the stringency of the hybridization reaction, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995).

As defined herein, "strict conditions" or "high stringency conditions" means: (1) 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfide at low ionic strength and high temperature, e.g. Conditions using pate, or (2) conditions using a denaturant such as formamide during hybridization, e.g. 50 mM sodium phosphate buffer (pH 6.5) with 750 mM sodium chloride, 75 mM sodium citrate at 42 ° C. Conditions using 50% (volume / volume) formamide with 0.1% bovine serum albumin / 0.1% picol / 0.1% polyvinylpyrrolidone, (3) 50% formamide, 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 × Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate Is used at 42 ° C., and 0.2 × SSC (sodium chloride / hour at 42 ° C.). Acid sodium salt), and washed at 55 ℃ in 50% formamide, at 55 ℃ to perform a high-stringency wash with EDTA saturable also a 0.1 x SSC.

"Medium stringency conditions" are those described in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press 1989, and are less stringent than hybridization conditions (e.g., Temperature, ionic strength and% SDS). Examples of moderate stringency conditions include 20% formamide, 5 x SSC (150 mM sodium chloride, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate and 20 The solution is incubated at 37 ° C. overnight in a solution containing mg / ml of truncated salmon sperm denatured DNA and then washed with 1 × SSC at about 37-50 ° C. Those skilled in the art will know how to adjust the temperature, ionic strength, and the like necessary to match factors such as probe length and the like.

"Antibodies" (Ab) and "immunoglobulins" (Ig) are glycoproteins with the same general structural features. Antibodies show binding specificities for specific antigens, but immunoglobulins include antibodies as well as other antibody-like molecules without antigen specificity. Polypeptides of immunoglobulins are produced in small amounts, for example by the lymphatic system, and in increased amounts by myeloma. The term “antibody” is used in its broadest sense and specifically includes intact monoclonal antibodies (eg agonists, antagonists and neutralizing antibodies, etc.), polyclonal antibodies, multispecific antibodies formed from two or more intact antibodies (eg Bispecific antibodies), single chain antibodies that bind to PRO polypeptide specific epitopes, and antibody fragments exhibiting the desired biological activity, and the like, are collectively but not limited to these. Anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti-PRO272, anti-PRO332, anti- PRO526, anti-PRO701, anti-PRO361, anti-PRO362, anti-PRO363, anti-PRO364, anti-PRO356, anti-PRO531, anti-PRO533, anti-PRO1083, anti-PRO865, anti-PRO770, anti-PRO769, Anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246, anti-PRO1283, anti- PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344, anti-PRO333, anti-PRO381, Anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333, anti-PRO4302, anti- PRO4430 or anti-PRO5727 antibodies are PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865 , PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344 And an antibody that immunologically binds to a PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, or PRO5727 polypeptide. The antibody can bind any domain of the PRO polypeptide that can contact this antibody. For example, the antibody may bind to any extracellular domain of the polypeptide and, if the entire polypeptide is secreted, to any domain on the polypeptide that is available for binding to the antibody.

"Natural antibodies" and "natural immunoglobulins" are generally about 150,000 daltons of heterotetramer glycoproteins consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to the heavy chain by one disulfide covalent bond, and the number of disulfide bonds depends on the different immunoglobulin isotypes of the heavy chain. In addition, each heavy and light chain has regular intervals of intrachain disulfide bonds. Each heavy chain has at one end a variable domain (V _H ) followed by several constant domains. Each light chain has a variable domain (V _L ) at one end, a constant domain at the other end, the constant domain of the light chain is arranged in line with the first constant domain constant domain of the heavy chain, and the light chain variable domain is It is arranged in line with the variable domain. Particular amino acid residues are believed to form a covalent region between the light and heavy chain variable domains.

The term “variable” means that the sequence of a particular portion of the variable domain is greatly different between the antibodies and is used for the binding and specificity of each particular antibody to a particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. Variability is concentrated in three or four segments, referred to as "complementarity determining regions (CDRs)" or "hypervariable regions," in both light and heavy chain variable domains. The highly conserved portions of the variable domains are called framework regions (FRs). Each variable domain in the natural heavy and light chains is usually four or five having a β-sheet configuration, linked by CDRs that link the β-sheet structure or optionally form a loop that forms part of the structure. Contains framework areas. The CDRs in each chain are kept in close proximity to each other by the FR regions and contribute to the formation of the antigen binding site of the antibody with the CDRs of the other chain (Kabat et al., NIH Publ. No. 91-3242, Vol. I , pages 647-669 (1991)). There are two or more techniques for measuring the extent of CDRs: (1) Approaches based on the degree of interspecies sequence variability (ie, Kabat et al., S equences of Proteins of Immunological Interest) in the United States of Bethesda, Maryland, USA Public health center)); And (2) an approach based on crystallographic studies on antigen-antibody complexes (Chothia, C. et al. , (1989), Nature 342 : 877). CDRs may also be defined using a hybrid approach in which the residues are identified by both techniques described above. The constant domains do not directly participate in antibody binding to the antigen, but exhibit several effector functions such as, for example, antibody involvement in antibody dependent cytotoxicity.

An “antibody fragment” comprises a portion of an intact antibody, preferably the antigen binding region or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ', F (ab') ₂ and Fv fragments; Diabodies; Linear antibodies (Zapata et al., Protein Eng. 8 (10): 1057-1062 (1995)); Single chain antibody molecules; And multispecific antibodies formed from antibody fragments.

Papain digestion of the antibody results in two identical antigen binding fragments (called “Fab” fragments), each with a single antigen binding site, and the remaining “Fc” fragments that reflect the ability to readily crystallize. Treatment of pepsin results in an F (ab ′) ₂ fragment that has two antigen binding sites and still can cross-link antigen.

"Fv" is the minimum antibody fragment that contains a complete antigen recognition and antigen binding site. This region consists of a dimer consisting of one heavy chain variable domain and one light chain variable domain that are tightly covalently bonded. In this structure, three CDRs in each variable domain interact to form an antigen binding site on the surface of the V _H -V _L dimer. In conclusion, six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of the Fv comprising only three CDRs specific for the antigen) has affinity than the entire binding site but has the ability to recognize and bind the antigen.

The Fab fragment also comprises the constant domain of the light chain and the first constant domain constant domain (CH1) of the heavy chain. Fab fragments differ from Fab 'fragments in that several residues have been added to the carboxy terminus of the heavy chain CH1 domain comprising one or more cysteines derived from the antibody hinge region. Fab'-SH herein refers to Fab 'in which the cysteine residue (s) of the constant domains bear a free thiol group. F (ab ') ₂ antibody fragments originally were produced as a pair of Fab' fragments with hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

The “light chain” of an antibody (immunoglobulin) derived from any vertebrate species can be classified into one of two distinctly different types called kappa (κ) and lambda (λ) based on the amino acid sequence of its constant domain. .

Immunoglobulins can be classified into different classes depending on the amino acid sequence of the constant domain of their heavy chains. Immunoglobulins have five main classes of IgA, IgD, IgE, IgG and IgM, some of which may be further classified into subclasses (isotypes), for example IgG1, IgG2, IgG3, IgG4, IgA and IgA2. Can be. Heavy chain constant domains corresponding to different classes of immunoglobulins are referred to as α, δ, ε, γ, and μ, respectively. Subunit structures and three-dimensional structures of different classes of immunoglobulins are well known.

As used herein, the term “monoclonal antibody” refers to the same individual antibodies that make up a population, except for antibodies from a population of substantially homologous antibodies, ie, possible naturally occurring mutants that may be present in small amounts. Monoclonal antibodies are highly specific and antibodies directed against a single antigenic site. Also, in contrast to conventional antibody (polyclonal antibody) preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant in the antigen. In addition to their specificity, monoclonal antibodies are synthesized by hybridoma culture and have the advantage that they are not contaminated with other immunoglobulins. The modifier “monoclonal” refers to the characteristics of an antibody obtained from a substantially homogeneous antibody population and is not to be construed as requiring antibody production by any particular method. For example, the monoclonal antibodies used in the present invention are hybridoma methods or recombinant DNA methods first described in Kohler et al., Nature , 256 : 495 (1975) (eg, US Pat. No. 4,816,567). Reference). In addition, "monoclonal antibodies" are described, for example, in Clackson et al., Nature , 352 : 624-628 (1991) and Marks et al., J. Mol. Biol ., 222 : 581-597 (1991). Can be isolated from phage antibody libraries using the techniques described. See also US Pat. Nos. 5,750,373, 5,571,698, 5,403,484, and 5,223,409, which describe methods of making antibodies using phagemids and phage vectors.

Monoclonal antibodies of the present disclosure are specifically identical or homologous to the corresponding sequences in an antibody derived from a particular species or an antibody belonging to a particular antibody class or subclass, provided that the monoclonal antibody exhibits the desired biological activity. And the rest of the chain (s) include antibodies from another species or antibodies belonging to another antibody class or subclass and "chimeric" antibodies (immunoglobulins) having the same or homologous as those antibody fragments. (US Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA , 81 : 6851-6855 (1984)).

An “humanized” form of a non-human (eg, murine animal) antibody is an immunoglobulin chain or fragment thereof (eg, Fv, Fab, Fab) containing a minimal sequence derived from a chimeric immunoglobulin, a non-human immunoglobulin ', F (ab') ₂ or other antigen binding subsequence of the antibody). In most cases humanized antibodies are human immunoglobulins in which residues in the complementarity determining regions (CDRs) of the receptor are replaced with residues in the CDRs of non-human species (donor antibodies) such as mice, rats or rabbits with the desired specificity, affinity and ability. (Accepting antibody). In some cases, Fv framework region (FR) residues of human immunoglobulins are substituted with corresponding non-human residues. Humanized antibodies may also comprise residues that are not found in either the recipient antibody or the CDR or framework sequences to be introduced. Such modifications result in improved and maximized antibody performance. In general, humanized antibodies will comprise substantially all of one or more, generally two or more variable domains, wherein all or substantially all CDR regions correspond to regions of non-human immunoglobulins and all or substantially all FR regions are human immune. Corresponding to a region of the globulin consensus sequence. In addition, the humanized antibody will optionally comprise an immunoglobulin constant region (Fc), generally at least a portion of the constant region of human immunoglobulin. Further details are given in Jones et al., Nature , 321 : 522-525 (1986); Riechmann et al., Nature , 332 : 323-327 (1988); and Presta, Curr. Op. Struct. Biol. 2 : 593-596 (1992). Humanized antibodies include "primatized" antibodies in which the antigen binding region of the antibody is derived from an antibody produced by immunizing a macaque with an antigen of interest. In addition, antibodies comprising residues from the Old World monkey can also be used in the present invention. See, for example, US Pat. Nos. 5,658,570, 5,693,780, 5,681,722, 5,750,105, and 5,756,096.

In addition, antibodies of the invention and fragments thereof may be modified by altering one or more amino acid sequences of the CDR regions and / or framework regions to alter their affinity for the antigen to which the antibody or fragment thereof binds. Affinity matured "antibodies. Affinity maturation can increase or decrease the affinity of the mature antibody for the antigen as compared to the starting antibody. In general, the starting antibody will be a humanized, human, chimeric or murine antibody and the affinity matured antibody will have increased affinity than the starting antibody. During the maturation process, one or more amino acid residues in the CDR or framework regions are changed to different residues by any standard method. Suitable methods include well known cassette mutagenesis (Well et al., 1985, Gene, 34: 315) or oligonucleotide mediated mutagenesis (Zoller et al., 1987, Nucleic Acids Res., 10: 6487-6504). Point mutagenesis and the like. Affinity maturation also employs known selection methods that generate many mutations and select mutants with the desired affinity from a pool or library of mutants based on improved affinity for the antigen or ligand. It may also be performed. This approach can conveniently use known phage display techniques. See, for example, US Pat. No. 5,750,373, US Pat. No. 5,223,409, and the like.

Human antibodies also fall within the scope of antibodies of the invention. Human antibodies can also be prepared using a variety of techniques known in the art, including phage display libraries (Hoogenboom et al., J. Mol. Biol. , 227 : 381 (1991); Marks et al., J. Mol. Bio. , 222 : 581-597 (1991)). In addition, techniques such as Cole et al. And Boerner can also be used for the production of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, p. 77 ( 1985); Boerner et al., J. Immunol. , 147 (1) : 86-95 (1991); US Pat. No. 5,750,373). Similarly, transgenic animals in which the endogenous immunoglobulin gene is partially or wholly inactivated. Human antibodies can be prepared by introducing human immunoglobulin loci into (eg mice). Following challenge, human antibody production is observed, which closely resembles that observed in humans, including gene rearrangements, assemblies and antibody lists. This is described in, for example, US Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,661,016, and scientific publications (Marks et al., Bio / Technology 10 , 779-783 (1992); Lonberg et al., Nature 368 , 856-859 (1994), Morrison, Nature 368 , 812-13 (1994); Fishwild et al., Nature Biotechnology 14 , 845-51 (1996) Neuberger, Nature Biotechnology 14 , 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995)).

"Single-chain Fv" or "sFv" antibody fragments comprise the V _H and V _L domains of an antibody present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the V _H and V _L domains that allow the sFv to form the structure required for antigen binding (see Pluckthan in The Pharmacology of Monoclonal Antibodies , vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994)).

The term "diabody" refers to a small antibody fragment with two antigen binding sites, comprising a heavy chain variable domain (V _H ) linked to a light chain variable domain (V _L ) within the same polypeptide chain (V _H -V _L ). Say By using a linker that is too short to pair two domains in the same chain, the domain is forced to pair with the complementary domains of the other chain to create two antigen binding sites. Diabodies are described, for example, in EP 404,097, WO 93/11611 and Hollinger et al., Proc. Natl. Acad. Sci. USA , 90: 6444-6448 (1993).

The term "label" as used herein refers to a detectable compound or composition that is conjugated directly or indirectly to a compound such as an antibody or polypeptide to produce an "labeled" antibody. The label can be detected by itself (radioisotope label or fluorescent label) or, in the case of an enzyme label, can catalyze the chemical alteration of the detectable substrate compound or composition.

"Solid phase" means a non-aqueous matrix to which an antibody of the invention may be attached. Examples of solid phases include partially or completely formed glass (eg pore controlled glass), polysaccharides (eg agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone, and the like. In certain embodiments, depending on the content, the solid phase may comprise the wells of an assay plate, and in other embodiments the solid phase is a purification column (eg, an affinity chromatography column). The term also encompasses discrete solid phases of discrete particles, such as those described in US Pat. No. 4,275,149.

The term "immune related disease" means a disease in which any component of the mammalian immune system causes, mediates or contributes to the incidence of a disease in the mammal. Also included are diseases in which the stimulation or intervention of an immune response has the effect of accelerating the progression of the disease. The term includes immune mediated inflammatory diseases, non-immune mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia and the like.

The term "T cell mediated" disease refers to a disease in which T cells directly or indirectly mediate or contribute to the incidence of disease in that mammal. The T cell mediated disease may be related to cell mediated effects, lymphokine mediated effects, and the like, and may also be related to B cells if B cells are stimulated by, for example, lymphokines secreted by T cells. It may be.

Examples of immune related diseases and inflammatory diseases, some of which are immune or T cell mediated and can be treated according to the present invention include systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, spondyloarthropathy, systemic sclerosis (sclerosis), Idiopathic inflammatory myopathies (skin myositis, multiple myositis), Sjoegren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hematuria), autoimmune thrombocytopenia (idogenic thrombocytopenia) Purpura, immune-mediated thrombocytopenia, thyroiditis (Grave's disease, Haemoidothyroiditis, juvenile lymphoma thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis), multiple sclerosis, idiopathic dehydration Ultraneurative neuritis or Guillain-Barre syndrome and chronic inflammatory demyelinating Demyelinating diseases of the central and peripheral nervous system, such as neuritis, infectious hepatitis (A, B, C, D, E hepatitis virus and other non-hepatic affinity viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis And hepatobiliary diseases such as sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis; Crohn'sdisease), gluten-sensitive bowel disease and whiff disease (Whipple's diesase), bullous skin disease, polymorphic erythema and contact dermatitis Allergic diseases such as autoimmune or immune-mediated skin diseases, psoriasis, asthma, allergic rhinitis, atopic dermatitis, food intolerance and urticaria, immune diseases of the lung such as eosinophilic pneumonia, idiopathic pulmonary fibrosis and irritable pneumonia Transplantation-related diseases such as transplant rejection and graft-versus-host disease, etc. Infections include AIDS (HIV infection), viral diseases such as hepatitis A, B, C, D and E, and herpes and bacteria. Infections, fungal infections, protozoan infections, and parasitic infections.

"Treatment" means an intervention performed to prevent the occurrence of a disorder or to change the pathology of the disorder. Thus, "treatment" refers to both therapeutic treatment and preventive or preventive measures. Subjects in need of treatment include those already afflicted with the disease as well as those who wish to prevent the disorder. In the treatment of an immune related disease, the therapeutic agent directly increases or decreases the degree of response of the immune response component, or makes the disease more sensitive to other therapeutic agents such as, for example, antibiotics, antifungal agents, anti-inflammatory agents, chemotherapeutic agents.

The term “effective amount” means a detectable improvement in the immune response component of a mammal as measured in an in vitro assay (eg, increasing or decreasing T-cell proliferation and / or vascular permeability as measured in the Examples herein). ) Is the minimum concentration or minimum amount of PRO polypeptide and / or agonist / antagonist that results in, induces, or results in such an improvement. In addition, a "therapeutically effective amount" means a PRO polypeptide that is effective at least for attenuation (which may be an increase or a decrease, in some cases) of the immune response component of a mammal, which has a beneficial effect on the treatment as defined in the preceding paragraph. And / or the minimum concentration or minimum amount of agonist / antagonist.

"Chronic" administration refers to administration of the agent (s) in a continuous manner as opposed to an acute mode, to maintain the initial therapeutic effect (activity) for a long time. "Intermittent" administration refers to treatment that is performed periodically by nature, rather than continuously without interruption.

The "pathology" of an immune related disease includes any phenomenon that impairs the health of the patient. These include abnormal or uncontrollable cell growth, antibody production, self-antibody production, complement production and activation, disruption of normal functioning of neighboring cells, abnormal secretion of cytokines or other secretions, inhibition or exacerbation of any inflammatory or immune response. , Infiltration of inflammatory cells (neutrophils, eosinophils, monocytes, lymphocytes) into the tissue space, and the like.

“Mammals” suitable for treatment include mammals, including humans, livestock and breeding animals, and zoos, competitions or pets such as dogs, horses, cattle, pigs, monkeys, hamsters, ferrets, cats, and the like. All animals classified as animals. Preferred mammals are humans.

Administration "in parallel" with one or more other therapeutic agents encompasses administration simultaneously (simultaneously) or sequentially in any order.

As used herein, “carrier” includes pharmaceutically acceptable carriers, excipients, or stabilizers that are nontoxic to cells or mammals exposed to the dosages and concentrations employed. A physiologically acceptable carrier is an aqueous pH buffer solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate and other organic acids; Antioxidants including ascorbic acid; Low molecular weight (less than about 10 residues) polypeptides; Proteins such as serum albumin, gelatin or immunoglobulins; Hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, arginine or lysine; Monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Salt-forming counter ions such as sodium; And / or nonionic surfactants such as TWEEN ^™ , polyethylene glycol (PEG) and PLURONICS ^™ .

As used herein, the term “cytotoxic agent” refers to a substance that inhibits or interferes with the function of a cell and / or destroys a cell. The term includes radioisotopes (eg I ¹³¹ , I ¹²⁵ , Y ⁹⁰ and Re ¹⁸⁶ ), chemotherapeutic agents and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin or fragments thereof. It is intended to be.

A "chemotherapeutic agent" is a chemical compound useful for treating cancer. Examples of chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxins, taxoids, For example, paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, NJ) and docetaxel (Taxotere, Longplan Lorea, Antony, France) (Rhone-Poulenc Rorer)), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, iphosphamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carbople Latin, teniposide, daunomycin, carminomycin, aminopterin, dactinomycin, mitomycin, esperamicin (see US Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also included in the definition of chemotherapeutic agents are hormonal agents that modulate or inhibit hormonal action on tumors such as tamoxifen and onapriston.

As used herein, a "growth inhibitor" refers to a compound or composition that inhibits growth in vitro or in vivo of a cell, particularly a cancer cell that overexpresses any gene identified herein. Thus, growth inhibitors are substances that greatly reduce the percentage of cells overexpressing such genes. Examples of growth inhibitory agents include agents that block cell cycle progression (at periods other than S phase), such as agents that induce G1 arrest and M arrest. Typical M blockers include vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide and bleomycin. Agents that stop G1, such as DNA alkylating agents, such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methoxtrexate, 5-fluorouracil and ara-C also act on S phase arrest do. Additional information can be found in Murakami et al., The Molecular Basis of Cancer , Mendelsohn and Israel, eds., "Cell cycle regulation, oncogens, and antineoplastic drugs" (WB Saunders: Philadelphia, 1995), Chapter 1, in particular page 13. It is described in.

The term "cytokine" is a generic name for proteins that act on other cells as intercellular mediators released by one cell population. Examples of cytokines include lymphokine, monocaine and typical polypeptide hormones. Cytokines include growth hormones such as human growth hormones, N-methionyl human growth hormones and bovine growth hormones, parathyroid hormones, thyroxine, insulin, proinsulin, rilacin, prorelaxine, follicle stimulating hormone (FSH), Glycoprotein hormones such as thyroid stimulating hormone (TSH) and luteinizing hormone (LH), liver growth factor, fibroblast growth factor, prolactin, placental lactogen, tumor necrosis factor-α and -β, mullerian inhibitors, mouse gonadotropin Stimulatory cell related peptides, inhibin, activin, vascular endothelial growth factor, integrin, thrombopoietin (TPO), nerve growth factor such as NGF-β; Platelet growth factor; Transforming cell growth factors (TGF) such as TGF-α and -β, insulin-like growth factor-1 and -Π, erythropoietin (EPO), osteoinduction factors, interferons such as interferon-α, -β and -γ, colony stimulating factor (CSF) such as macrophage-CSF (M-CSF), granulocyte-macrophage-CSF (GM-CSF) and granulocyte-CSF (G-CSF), interleukin (IL), for example IL-1, IL-1α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11 , IL-12; Tumor necrosis factors such as TNF-α or TNF-β; And other polypeptide factors including LIF and kit ligands (KL). As used herein, the term cytokine includes proteins from natural sources or recombinant cell culture and biologically active equivalents of native sequence cytokines and the like.

As used herein, the term “epitope tagged” refers to a chimeric polypeptide comprising a PRO polypeptide fused to a “tag polypeptide”. The tag polypeptide has enough residues to provide enough epitope for the antibody to be made but short enough to not interfere with the activity of the PRO polypeptide to be fused. It is also desirable that the tag polypeptide be very unique so that the antibody against itself does not substantially cross react with other epitopes. Suitable tag polypeptides generally have 6 or more amino acid residues, and usually have about 8 to 50 (preferably about 10 to 20 residues) amino acid residues.

“Activity” or “activity” as used for variants of a PRO polypeptide refers to the protein form (s) of the invention that are biological and / or retain the ability to produce antibodies against antigenic epitopes possessed by the PRO polypeptide. More specifically, "biological activity" refers to a biological function (inhibitory or stimulatory) by a native sequence or naturally occurring PRO polypeptide. Even more specifically, the term "biological activity" used for antibodies or other molecules (eg, organic or inorganic small molecules, peptides, etc.) that can be identified by the screening assays disclosed herein refers to the organization of inflammatory cells by such molecules. Refers to the ability to induce or inhibit invasion, to stimulate or inhibit T-cell proliferation or activation, to stimulate or inhibit cytokine release by cells, or to increase or decrease vascular permeability. Another specific biological activity is the increase or inhibition of vascular permeability.

The term “antagonist” is used in its broadest sense and refers to all molecules that partially or completely block, inhibit or neutralize the biological activity of the native PRO polypeptides described herein. Similarly, the term "agonist" is used in its broadest sense and refers to all molecules that mimic or amplify the biological activity of the native PRO polypeptides described herein. Suitable agonist or antagonist molecules include, in particular, antibodies or fragments of agonists or antagonists, fragments or amino acid sequence variants of native PRO polypeptides, peptides, small organic molecules, and the like. Methods for identifying an agonist or antagonist of a PRO polypeptide may include contacting the PRO polypeptide with a candidate agonist molecule or a candidate antagonist molecule and determining a detectable change in one or more biological activities normally associated with the PRO polypeptide.

A “small molecule” is defined herein as having a molecular weight of about 600 Daltons or less and is generally an organic compound.

A "liposome" is a small vesicle composed of various forms of lipids, phospholipids, and / or surfactants useful for delivering drugs (including chemotherapeutic agents) to a mammal. The components of the liposomes are typically aligned in bilayer form, similar to the lipid alignment of the biofilm.

As used herein, the term “immunoadhesin” refers to an antibody-like molecule that combines the effector function of an immunoglobulin constant domain and the binding specificity of a heterologous protein (“adhesin”). Structurally, immunoadhesin comprises a fusion of an immunoglobulin constant domain sequence with an amino acid sequence (ie, heterologous) having the desired binding specificity, but not the antigen recognition and binding site of the antibody. The adhesin portion of an immunoadhesin molecule is typically a contiguous amino acid sequence comprising at least the binding site of a receptor or ligand. The immunoglobulin constant domain sequence in immunoadhesin may be any immune such as IgG-1, IgG-2, IgG-3, IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM Obtained from globulin.

II. Compositions and Methods of the Invention

A. Preparation of PRO Polypeptides of the Invention

The present invention relates to newly identified and isolated nucleotide sequences encoding polypeptides referred to herein as PRO polypeptides. In particular, cDNA encoding various PRO polypeptides were identified and isolated as described in more detail in the Examples below. The PRO number of proteins produced in separate rounds of expression may vary but the UNQ number is specific to any given DNA and encoded protein and will not change. However, in the present specification, all of the proteins encoded by the full-length natural nucleic acid molecules described herein, and additional natural homologs and variants included in the above definitions, are referred to as "PRO / number" regardless of their origin and manner of preparation. Reference may also be made to "PRO".

In particular, as described in more detail in the following examples, PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 and PRO5727 Polypeptides (UNQ174, UNQ178, UNQ186, UNQ190, respectively) UNQ200, UNQ214, UNQ209, UNQ219, UNQ146, UNQ240, UNQ239, UNQ293, UNQ330, UNQ365, UNQ316, UNQ317, UNQ318, UNQ319, UNQ313, UNQ332, UNQ334, UNQ540, UNQ434, UNQ408, UNQ407, UNQ430, UNQ557, UNQ491 UNQ516, UNQ701, UNQ585, UNQ633, UNQ678, UNQ606, UNQ630, UNQ653, UNQ608, UNQ698, UNQ732, UNQ722, UNQ728, UNQ900, UNQ859, UNQ179, UNQ21, CDNA encoding UNQ236, UNQ303, UNQ294, UNQ322, UNQ388, UNQ435, UNQ433, UNQ483, UNQ545, UNQ589, UNQ707, UNQ685, UNQ693, UNQ739, UNQ1888, UNQ1866, UNQ1947 and UNQ2448).

More particularly, the present disclosure provides the natural sequences PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, DNA29101-1276, DNA30871-1157, cDNA encoding PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 and PRO5727 polypeptides, respectively DNA30942-1134, DNA33087-1158, DNA33460-1166, DNA34387-1138, DNA35558-1167, DNA35638-1141, DNA35916-1161, DNA39523-1192, DNA40620-1183, DNA40982-1235, DNA44184-1319, DNA44205-1285, DNA45410- 1250, DNA45416-1251, DNA45419-1252, DNA47365-1206, DNA47470-1130, DNA48314-1320, DNA49435-1219, DNA50921-1458, DNA53974-1401, DNA54228-1366, DNA5423 1-1366, DNA56405-1357, DNA57033-1403, DNA57690-1374, DNA59220-1514, DNA59294-1381, DNA59776-1600, DNA59849-1504, DNA60775-1532, DNA61873-1574, DNA62814-1521, DNA64885-1529, DNA65404- 1551, DNA65412-1523, DNA66675-1587, DNA68864-1629, DNA68872-1620, DNA68874-1622, DNA76400-2528, DNA77624-2515, DNA30868-1156, DNA36638-1056, DNA38260-1180, DNA40592-1242, DNA41374-1312, DNA44194-1317, DNA53517-1366, DNA53971-1359, DNA53987-1438, DNA57700-1408, DNA59620-1463, DNA60627-1508, DNA64890-1612, DNA66659-1593, DNA66667-1596, DNA68818-2536, DNA84210-2576, DNA92218- 2554, DNA96878-2626, DNA98853-1739.

As described in the Examples below, various cDNA clones were deposited with the ATCC. One skilled in the art can readily determine the actual nucleotide sequence of the clone by analyzing the sequence of the deposited clone using conventional methods in the art. Where there is a difference between the deposited sequence and the sequences described herein, it is understood that the sequence of the deposit contains the correct sequence. Conventional techniques can be used to determine the expected amino acid sequence from the nucleotide sequence. In the case of the PRO polypeptides described herein and the nucleic acids encoding them, the inventors have identified what is considered to be the best identifying frame using sequence information available at the time.

B. PRO Polypeptide Variants

In addition to the full length native sequence PRO polypeptides described herein, it is contemplated that PRO variants may be prepared. PRO variants can be prepared by introducing suitable nucleotide changes into the PRO DNA and / or synthesizing the desired PRO polypeptide. Those skilled in the art will appreciate that amino acid changes, such as changing the number or location of glycosylation sites or changing membrane anchoring properties, can alter the post-translational processing of PRO.

Variations in the various domains of the full-length native sequence PRO or PRO described herein can be prepared using, for example, conservative and non-conservative mutation techniques and instructions disclosed in US Pat. No. 5,364,934. The mutation may be a substitution, deletion or insertion of one or more codons encoding PRO to change the amino acid sequence of PRO as compared to native sequence PRO. Optionally, the mutation is produced by replacing one or more amino acids in one or more domains of PRO with any other amino acid. Amino acid residues that can be inserted, substituted or deleted without adversely affecting the desired activity compare the sequence of PRO to the sequence of known homologous protein molecules and minimize the number of amino acid sequence changes generated in highly homologous regions Can be determined. Amino acid substitutions may be the result of substitution of one amino acid with another amino acid having similar structural and / or chemical properties (eg, replacement of leucine with serine), ie, conservative amino acid substitutions. Insertions or deletions may optionally occur in the range of about 1 to 5 amino acids. Acceptable variations can be determined by systematically inserting, deleting, or replacing amino acids in the sequence to test the results of variations in activity exhibited by full length or mature native sequences.

The application provides PRO polypeptide fragments. For example, when compared to full-length natural proteins, these fragments may be truncated at the N- or C-terminus or missing internal residues. Some fragments lack amino acid residues that are not essential for the desired biological activity of the PRO polypeptides of the invention.

PRO fragments can be prepared by any of a number of conventional techniques. The desired peptide fragment can be synthesized chemically. Other methods include enzymatic digestion methods, such as generating a PRO fragment by treating the protein with an enzyme known to cut at a site defined by a particular amino acid residue or by cutting the DNA with a suitable restriction enzyme and isolating the fragment of interest. It includes a step. However, another suitable technique includes isolating and amplifying a DNA fragment encoding a polypeptide fragment of interest by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are used as 5 'and 3' primers in PCR. Preferably, the PRO polypeptide fragment shares one or more biological and / or immunological activities with the native PRO polypeptide disclosed herein.

In specific embodiments, conservative substitutions of the target are shown in Table 6 under the heading of preferred substitutions. When such substitutions resulted in a change in biological activity, more substantial changes were introduced and the products were screened as named as substitutions in Table 6 below or as described in more detail below for amino acid species.

Substantial modifications of the function or immunological identity of the PRO polypeptides may include (a) maintaining the structure of the polypeptide backbone at the substitution region, for example in sheet or helix form, or (b) maintaining the charge or hydrophobicity of the molecule at the target site. Or (c) selecting a substitution that significantly alters the effect on maintaining the size of the side chains. Naturally occurring residues are divided into the following groups according to common side chain properties:

(1) hydrophobic: norleucine, met, ala, val, leu, ile;

(2) neutral hydrophilic: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gln, his, lys, arg;

(5) residues affecting chain orientation: gly, pro; And

(6) aromatic; trp, tyr, phe.

Non-conservative substitutions will replace said one type of component with another type. In addition, such substituted moieties may be introduced at conservative substitution sites or more preferably at the remaining (non-conserved) sites.

Mutations can be carried out using methods known in the art such as oligonucleotide mediated (site-directed) mutagenesis, alanine scanning and PCR mutagenesis. Positional mutagenesis (Carter et al., Nucl.Acids Res. , 13 : 4331 (1986); Zoller et al., Nucl.Acids Res. , 10 : 6487 (1987)), cassette mutagenesis (Wells et. al., Gene , 34 : 315 (1985)), restriction selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA , 317 : 415 (1986)) or other known techniques It is possible to prepare PRO variant DNA by subjecting it to DNA.

Scanning amino acid assays can also be used to identify one or more amino acids along adjacent sequences. Preferred scanning amino acids are relatively small neutral amino acids. Such amino acids include alanine, glycine, serine and cysteine. Typically, alanine is the preferred scanning amino acid because it is less likely to remove side chains outside the beta-carbon and alter the backbone form of the variant (Cunningham and Wells, Science , 244 : 1081-1085 (1989)). Alanine is also preferred because it is usually the most common amino acid. In addition, alanine is commonly found both in buried and exposed locations (Creighton, The Proteins , (WH Freeman & Co., NY); Chothia, J. Mol. Biol. , 150 : 1 (1976)). If alanine substitutions do not produce adequate amounts of variants, isotopic amino acids can be used.

C. variant of PRO

Covalent modifications of PRO polypeptides are within the scope of this invention. One form of covalent modification involves reacting a target amino acid residue of the PRO polypeptide with an organic derivatizing agent that can react with a selected side chain or N-terminal or C-terminal residue of the PRO polypeptide. Derivatization with a bifunctional agent is useful for crosslinking PRO to a water-insoluble support matrix or surface, or vice versa, for example for use in anti-PRO antibody purification methods. Commonly used crosslinkers are, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example esters with 4-azidosalicylic acid, Homo-functional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis (succinimidylpropionate), difunctional maleimides such as bis-N-maleimido-1,8-octane and Materials such as methyl-3-[(p-azidophenyl) dithio] propioimidate.

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, lysine, Methylation of alpha-amino groups of arginine and histidine side chains (TE Creighton, Proteins: Structure and Molecular Properties , WH Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation of N-terminal amines and C- Amidation of terminal carboxyl groups.

Other forms of covalent modifications of PRO polypeptides encompassed within the scope of the present invention include changes in the natural glycosylation pattern of the polypeptide. For the purposes herein, a "change in the natural glycosylation pattern" is defined by the deletion of one or more carbohydrate moieties found in the native sequence PRO polypeptide (by removing the underlying glycosylation site or by deleting chemical glycosylation by chemical and / or enzymatic methods). And / or the addition of one or more glycosylation sites that are not present in native sequence PRO. The term also encompasses qualitative changes in glycosylation of natural proteins, including changes in the properties and proportions of the various carbohydrate moieties present.

The addition of glycosylation sites to the PRO polypeptide can be accomplished by changing the amino acid sequence. Changes can be made, for example, by adding or replacing one or more serine or threonine residues in the native sequence PRO (for O-linked glycosylation sites). The PRO amino acid sequence can optionally be changed, particularly through changes in the DNA level, by mutating the DNA encoding the PRO polypeptide at a preselected base such that a codon is produced that is translated into the desired amino acid.

Another method of increasing the number of carbohydrate moieties present in a PRO polypeptide is to couple the glycoside chemically or enzymatically to the polypeptide. Such methods are described, for example, in WO 87/05330 published September 11, 1987 and in Aplin and Wriston, CRC Crit. Rev. Biochem. , Pp. 259-306 (1981).

Removal of the carbohydrate moiety present in the PRO polypeptide can be accomplished chemically or by substitution by mutation of a codon encoding an amino acid residue that functions by an enzyme or functions as a target for glycosylation. Chemical deglycosylation techniques are known in the art and are described, for example, in Hakimuddin, et al., Arch. Biochem. Biophys. , 259 : 52 (1987) and Edge et al., Anal. Biochem. , 118 : 131 (1981). Enzymatic cleavage of carbohydrate moieties present in polypeptides can be achieved using various endoglycosidases and exoglycosidases, as described by Thotakura et al., Meth.Enzymol . , 138 : 350 (1987). Can be.

Other forms of covalent modifications of PRO include various nonproteinaceous polymers, eg, in the manner described in US Pat. Nos. 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791,192 or 4,179,337. For example connecting the PRO polypeptide to one of polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylene.

PRO polypeptides may also be modified in such a way as to form chimeric molecules comprising polypeptides of the invention fused to other heterologous polypeptides or amino acid sequences.

In one embodiment, such chimeric molecules comprise a fusion of PRO with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. Epitope tags are generally located at the amino- or carboxyl-terminus of PRO. The presence of the PRO polypeptide in the epitope tagged form can be detected using an antibody against the tag polypeptide. In addition, the introduction of epitope tags facilitates the purification of PRO by affinity purification using anti-tag antibodies or other forms of affinity matrices that bind to epitope tags. Various tag polypeptides and their respective antibodies are known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags, flu HA tag polypeptides and antibody 12CA5 (Field et al., Mol. Cell. Biol. , 8 : 2159). -2165 (1988)), c-myc tag and 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto (Evan et al., Molecular and Cellular Biology , 5 : 3610-3636 (1985)), and herpes simplex Viral glycoprotein D (gD) tags and antibodies thereof (Paborsky et al., Protein Engineering , 3 (6): 547-553 (1990)). Other tag polypeptides include Flag-peptide (Hopp et al., BioTechnology , 6 : 1204-1210 (1988)), KT3 epitope peptide (Martin et al., Science , 255 : 192-194 (1992)), alpha-tubulin Epitope peptides (Skinner et al., J. Biol. Chem. , 266 : 15163-15166 (1991)) and T7 gene 10 protein peptide tag (Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA , 87 : 6393-6397 (1990)).

In other embodiments, the chimeric molecule comprises a fusion of a PRO polypeptide with an immunoglobulin or a specific region of an immunoglobulin. For the bivalent form of the chimeric molecule (also referred to as “immune adhesin”), the fusion may be a fusion with the Fc region of an IgG molecule. This Ig fusion preferably comprises the substitution of a soluble (deleted or inactivated transmembrane domain) form of the polypeptide of the invention in place of one or more variable regions in the Ig molecule. In particularly preferred embodiments, the immunoglobulin fusions comprise the hinge, CH2 and CH3, or the hinge, CH1, CH2 and CH3 regions of the IgG1 molecule. For methods of producing immunoglobulin fusions, see US Pat. No. 5,428,130, issued June 27, 1995.

D. Manufacture of PRO

The following description relates primarily to a method of preparing PRO by culturing cells transformed or transfected with a vector comprising the PRO nucleic acid. Of course, other methods known in the art can also be used to prepare the PRO. For example, PRO sequences or portions thereof can be prepared by direct peptide synthesis using solid phase techniques (Stewart et al., Solid-Phase Peptide Synthesis , WH Freeman Co., San Francisco, CA (1969)). Merrifield, J. Am. Chem. Soc. , 85 : 2149-2154 (1963)). In vitro protein synthesis can be performed by manual techniques or by automation. Automated synthesis can be performed using, for example, Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Full length PRO can be prepared by individually chemically synthesizing the various parts of PRO and then combining them by chemical or enzymatic methods.

1. Isolation of DNA Encoding PRO Polypeptide (s)

DNA encoding PRO may be obtained from a cDNA library prepared from tissues that are thought to retain PRO mRNA and express it at detectable levels. Therefore, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue as described in the Examples below. PRO coding genes can also be obtained by genome libraries or known synthetic methods (eg, automated nucleic acid synthesis).

The library can be screened with a probe (eg, an antibody against PRO or an oligonucleotide consisting of about 20 to 80 or more bases) designed to identify the gene of interest or the protein it encodes. Screening of cDNA or genomic libraries using selected probes can be carried out using standard methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Haror Laboratory Press, 1989). Can be performed. Another method for isolating the gene encoding the PRO polypeptide is to use PCR method (Sambrook et al, supra; Dieffenbach et al, PCR Primer: .. A Laboratory Manual (Cold Spring Haror Laboratory Press, 1995)) .

The following examples illustrate techniques for screening cDNA libraries. Oligonucleotide sequences selected as probes should be sufficiently clear and of sufficient length to minimize the result of false positives. Oligonucleotides are preferably labeled so that they can be detected immediately after hybridization with DNA in the library being screened. Labeling methods are known in the art and include the use of radiolabels, biotinylation or enzyme labels, such as ³² P labeled ATP. High stringency hybridization conditions, and including the stringency of the medium is provided in the literature (Sambrook et al., Supra).

The sequences identified in the library screening method can be aligned by comparison with other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at the amino acid or nucleotide level) within a defined region of the molecule or across the full length sequence can be determined using methods known in the art and the methods described herein.

Nucleic acid having protein coding sequence is to first use the estimated amino acid sequences disclosed herein (and the literature to detect the precursor, if necessary (Sambrook et al., Using conventional primer extension method described in the literature)) selected cDNA or Genomic libraries can be screened and obtained by processing intermediates of mRNA that are not reverse transcribed into cDNA.

2. Selection and Transformation of Host Cells

Host cells are cultured in conventional nutrient media transfected or transformed with the expression or cloning vectors described herein for production of PRO polypeptide and modified to be suitable for promoter induction, transformant selection or gene amplification encoding the desired sequence. do. Those skilled in the art can select culture conditions such as medium, temperature, pH and the like without undue trial and error. In general, the cell principles to maximize the productivity of water culture, protocols and techniques that are carried out are described in (Mammalian Cell Biotechnology:.. A Practical Approach, M. Butler, ed (IRL Press, 1991) and Sambrook et al, supra) It is described in.

Transfection methods (eg CaPO ₄ and electroporation) are known to those skilled in the art. Depending on the host cell used, transformation is carried out using standard techniques suitable for the cell. Literature (Sambrook et al., Supra) calcium salt treatment or electroporation for use as described is used for the typically prokaryotic cells or other cells that contain substantial wall barriers. Infection with Agrobacterium tumefaciens has been described in certain plant cells as described in Shaw et al., Gene , 23 : 315 (1983) and WO 89/05859 published June 29, 1989. Used for transformation of For mammalian cells without the cell wall, the calcium phosphate precipitation method of Graham and van der Eb, Virology , 52 : 456-457 (1978) can be used. General aspects of mammalian cell host system transformation are described in US Pat. No. 4,399,216. Transformation with yeast is commonly described by Van Solingen et al., J. Bact. , 130 : 949 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA) , 76 : 3829 (1979 ). It is performed according to the method of)). However, other methods for introducing DNA into cells (e.g. intranuclear microinjection, electroporation, fusion of intact cells with bacterial protoplasts, or polymer cations (e.g. polybrene, polyornithine) ) Can also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods in Enzymology , 185: 527-537 (1990) and Mansour et al., Nature , 336: 348-352 (1988). See.

Suitable host cells for cloning or expressing the DNA in the vectors herein are prokaryotic, yeast or higher eukaryotic cells. Suitable prokaryotic cells are eubacteria, such as Gram-negative or Gram-positive organisms comprising (Enterobacter bacteria seae (Enterobacteriaceae), such as for example E. coli), but is not limited to this. Several E. coli strains, such as E. coli K12 strain MM294 (ATCC 31,446), E. coli X1776 (ATCC 31,537), E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635) are readily available. Other suitable prokaryotic host cells include Escher Escherichia (Esherichia) and Enterobacter bacteria seae, for example Escherichia coli, Enterobacter (Enterobacter), El Winiah (Erwinia), keulrep when Ella (Klebsiella), Proteus (Proteus), such as, Salmonella (Salmonella ), e.g., Salmonella typhimurium (typhimurium), Serratia marcescens (Serratia), e.g., Serratia dry process kanseu (marcescans) and Shigella (Shigella), and Bacillus (Bacillus), e.g., rain. Subtilis and B. subtilis . Needle piece formate miss (B.licheniformis) P e. (E.g. described in a non-DD 266,710, published April 12, dated 1989-object you miss formate 41P), Pseudomonas (Pseudomonas), for example. Rugi ah include labor (P.aeruginosa) and Streptomyces (Streptomyces). This example is for illustrative purposes and is not limiting. Strain W3110 is one of particularly preferred hosts or parent hosts because it is a common host strain for recombinant DNA product fermentation. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, by transforming a strain W3110 a mutation in a gene encoding an endogenous protein of the host may be to take place, examples of such hosts include E. coli with the E. coli W3110 strain 1A2, complete genotype tonA ptr3 having a complete genotype tonA W3110 strain 9E4, having a complete genotype tonA ptr3 phoA E15 (argF-lac ) 169 degP ompT kan E. coli W3110 strain having ^r 27C7 (ATCC 55,244), complete genotype tonA ptr3 phoA E15 (argF-lac ) 169 degP ompT rbs7 ilvG kan r E. coli W3110 strain 37D6, E. coli W3110 strain 40B4, strain 37D6 having a non-kanamycin resistant degP deletion mutation, and E. coli strains having the periplasmic protease mutant disclosed in U.S. Patent No. 4,946,783, issued August 7, 1990 Include. Alternatively, in vitro cloning methods such as PCR or other nucleic acid polymerase reactions are suitable.

In addition to prokaryotic cells, eukaryotic microorganisms such as fibrous fungi or yeast are also suitable as cloning or expression hosts for vectors encoding PRO. Saccharomyces cerevisiae is a lower eukaryotic host microorganism commonly used. Other microorganisms include Schizosaccharomyces pombe (Beach and Nurse, Nature , 290: 140 (1989), EP 139,383 published May 2, 1985), Kluyveromyces host (US patent) 4,943,529; Fleer et al., Bio / Technology , 9: 968-975 (1991)), e.g. K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al., J. Baceriol. , 154 (2): 737-742 (1983)), K. K.fragilis (ATCC 12,424), K. K.bulgaricus (ATCC 16,045 ), K. W. Kerawick (ATCC 24,178), K. K.waltii (ATCC 56,500), K. K.drosophilarum (ATCC 36,906; Van den Berg et al., Bio / Technology , 8: 135 (1990)), K. K.thermotolerans and K. Maxianus ); Yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol. , 28: 265-278 (1988)); Candida (Candida); Trichoderma reesia (EP 244,234); Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA , 76: 5259-5263 (1979)); Schwanniomyces , eg, ciwaniomyses occidentalis (EP 394,538, published October 31, 1990); And fibrous fungi such as neurospora, Penicillium , Tolypocladium (WO 91/00357 published January 10, 1991) and Aspergillus hosts, for example Listen a. Nidul lance (A.nidulans) (Ballance et al ,, Biochem Biophys Res Commun, 112: 284-289 (1983); Tilburn et al, Gene, 26:..... 205-221 (1983); Yelton et al , Proc. Natl. Acad. Sci. USA , 81: 1470-1474 (1984)) and A. A.niger (Kelly and Hynes, EMBO J. , 4: 475-479 (1985)). In the present invention, methyl nutritionally demanding yeast is suitable and is composed of Hansenula , Candida, Kloeckera , Peachia , Saccharomyces , Torulopsis and Rhodotorula . Selected from the genus, including but not limited to yeast capable of growing on methanol. A list of specific species illustrating this class of yeast can be found in C. Anthony, The Biochemistry of Methylotrophs , 269 (1982).

Suitable host cells for the expression of glycosylated PRO polypeptides are from multicellular organisms. Examples of invertebrate cells include insect cells and plant cells, such as Drosophila S2 and Spodoptera Sf9. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) cells and COS cells. More specific examples include monkey kidney CV1 line transformed with SV40 (COS-7, ATCC CRL 1651), kidney lines of human embryos (293 cells or 293 cells subcloned to grow in suspension culture, Graham et al., J. Gen Virol. , 36:59 (1997)), Chinese Hamster Ovary Cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA , 77: 4216 (1980)), Mouse Sertoli Cells (TM4) , Mather, Biol. Reprod. , 23: 243-251 (1980)), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065) and mouse breast tumors (MMT 060562, ATCC CCL51) Include. Those skilled in the art can easily select suitable host cells.

3. Selection and use of replicable vectors

Nucleic acids encoding a PRO polypeptide (eg, cDNA or genomic DNA) can be inserted into a replicable vector for cloning (amplification of DNA) or expression. Several vectors are readily available. For example, the vector may be in the form of a plasmid, cosmid, viral particles or phage. Suitable nucleic acid sequences can be inserted into the vector in a variety of ways. In general, DNA is inserted into suitable restriction endonuclease site (s) using techniques known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Preparation of suitable vectors comprising one or more of these components uses standard ligation techniques known to those skilled in the art.

PRO can be produced not only directly by recombinant methods but also as a fusion polypeptide with a heterologous polypeptide, which can be a mature protein or other polypeptide or signal sequence having a specific cleavage site at the N-terminus of the polypeptide. In general, the signal sequence may be a component of the vector or may be part of a DNA encoding a PRO inserted into the vector. The signal sequence can be, for example, a prokaryotic signal sequence selected from the group consisting of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leader. For yeast secretion, signal sequences are for example yeast invertase leader, α factor leader (Saccharomyces and Kluyveromyces α-factor leader (US Pat. No. 5,010,182)) or acid phosphatase leader, C. C. albicans glucoamylase leader (EP 362,179 published April 4, 1990) or signal sequence described in WO 90/13646 published November 15, 1990. In mammalian cell expression, mammalian signal sequences (eg, signal sequences from secretory polypeptides of the same or related species and viral secretion leader) can be used to direct the secretion of the protein.

Both expression vectors and cloning vectors comprise nucleic acid sequences that enable the vector to be replicated in one or more selected host cells. Such sequences are known for various bacteria, yeasts and viruses. The origin of replication from plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) can be used to detect vectors in mammalian cells. Useful for cloning.

Expression vectors and cloning vectors will typically comprise a selection gene (also called a selectable marker). Conventional selection genes (a) encode proteins that confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, methotrexate or tetracycline, (b) encode proteins that compensate for dystrophic deficiencies, or Or (c) encodes a protein that supplies an important nutrient that is not available from the complex medium (eg, the gene encoding D-alanine racemase in the case of Bacillus ).

Examples of selectable markers suitable for mammalian cells are those that allow for the identification of cellular components capable of accepting nucleic acids encoding PRO, for example DHFR or thymidine kinase. When wild type DHFR is used, a suitable host cell is a CHO cell line lacking DHFR activity and is prepared and proliferated as described in Urlaub et al, Proc. Natl. Acad. Sci. USA , 77: 4216 (1980). do. Suitable selection genes for use in yeast are the trp1 gene present in yeast plasmid YRp7 (Stinchcomb et al., Nature , 282: 39 (1979); Kingsman et al., Gene , 7: 141 (1979); Tschemper et al , Gene , 10: 157 (1980)). The trp1 gene provides a selection marker for mutant strains of yeast (eg ATCC 44076 or PEP4-1) without growth capacity to tryptophan (Jones, Genetics , 85: 12 (1977)).

Expression vectors and cloning vectors typically include a promoter operably linked to the nucleic acid sequence encoding the PRO, which directs RNA synthesis. Promoters recognized by various potential host cells are known. Suitable promoters for use in prokaryotic hosts include β-lactamase and lactose promoter systems (Chang et al., Nature , 275: 615 (1978); Goeddel et al., Nature , 281: 544 (1979)), alkaline phosphatase , Tryptophan (trp) promoter system (Goeddel, Nucleic acid Res. , 8: 4057 (1980); EP 36,776), and hybrid promoters such as the tac promoter (deBoer et al., Proc. Natl. Acad. Sci. USA , 80: 21-25 (1983). In addition, a promoter for use in a bacterial system will also include a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding the PRO.

Examples of suitable promoter sequences for use in yeast hosts include 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. , 255: 2073 (1980)) or other glycolytic enzymes (Hess et al., J. Adv.Enzyme Reg. , 7: 149 (1968); Holland, Biochemistry , 17: 4900 (1978)), for example enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruv Bate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosphosphate isomerase, phosphoglucose isomerase and glucokinase It includes a promoter for.

Other yeast promoters, which are inducible promoters with additional transcriptional benefits controlled by growth conditions, include alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degrading enzymes involved in nitrogen metabolism, metallothionein, glyceraldehyde- Promoter region for 3-phosphate dehydrogenase and enzymes responsible for the use of maltose and galactose. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.

PRO transcription of vectors in mammalian host cells can include viruses (eg polyoma virus, poultry virus (UK 2,211,504 published July 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma Obtained from the genome of viruses, avian sarcoma viruses, cytomegaloviruses, retroviruses, hepatitis B virus and monkey virus 40 (SV40), heterologous mammalian promoters (eg actin promoters or immunoglobulin promoters), heat-shock promoters If promoters are suitable for the host cell line, they are regulated by these promoters.

Transcription of the DNA encoding the PRO polypeptide by higher eukaryotic cells can be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 bp in length and act on the promoter to increase transcription of that DNA. Many enhancer sequences from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin) are now known. Typically, however, one will use an enhancer derived from a eukaryotic virus. Examples include SV40 enhancer (bp 100-270) behind the origin of replication, cytomegalovirus early promoter enhancer, polyoma enhancer behind the origin of replication, and adenovirus enhancers. The enhancer can be spliced into a vector at the 5 'or 3' position of the PRO polypeptide coding sequence, but is preferably located at the 5 'site of the promoter.

In addition, expression vectors for use in eukaryotic host cells (nucleated cells from yeast, fungi, insects, plants, animals, humans or other multicellular organisms) will also include sequences required for transcription termination and mRNA stabilization. Such sequences are commonly available in the 5 'and sometimes 3' untranslated regions of DNA or cDNA of eukaryotic cells or viruses. These regions include nucleotide segments that are transcribed into polyadenylation fragments in the untranslated portion of the mRNA encoding PRO.

Other methods, vectors, and host cells suitable for application to the synthesis of PRO polypeptides in recombinant vertebrate cell culture are described in Genet et al., Nature , 293: 620-625 (1981); Mantei et al., Nature , 281: 40-46 (1979); EP 117,060 and EP 117,058.

4. Detection of gene expression

Gene expression may include, for example, conventional Southern blotting, Northern blotting to quantify transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA , 77: 5201-5205 (1980)), dot blotting (DNA) Assay) or in situ hybridization with appropriately labeled probes based on the sequences provided herein. Alternatively, antibodies can be used that can recognize specific double helices, including DNA double helix, RNA double helix and DNA-RNA hybrid double helix or DNA-protein double helix. Then, after labeling the antibody, an assay may be performed in which the double helix binds to the surface, and when the double helix is formed on the surface, the presence of the antibody bound to the double helix may be detected.

Alternatively, gene expression can be measured by immunological methods such as immunohistochemical staining of cells or tissue sections and analysis of cell culture or body fluids for direct quantification of expression of gene products. Antibodies useful for immunohistochemical staining and / or analysis of sample fluids can be monoclonal or polyclonal antibodies and can be prepared in any mammal. Conveniently, antibodies to exogenous sequences fused to native sequence PRO polypeptides or to DNAs encoding synthetic peptides or PRO polypeptides based on DNA sequences provided herein and to DNAs encoding specific antibody epitopes can be prepared.

5. Purification of Polypeptides

Various forms of PRO can be recovered from culture medium or from host cell lysates. If in the membrane bound form, it may be released from the membrane using an appropriate detergent solution (eg Triton-X 100) or by cleavage by enzymes. Cells used for the expression of PRO can be pulverized by various physical or chemical methods such as freeze-thaw cycles, sonication, mechanical grinding or cell lysates.

It may be desired to purify PRO from recombinant cell proteins or polypeptides. Examples of suitable purification methods include fractionation on ion exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica or cation exchange resins (eg DEAE), chromatographic focusing, SDS-PAGE, ammonium sulfate precipitation, eg Gel filtration using Sephadex G-75, Protein A Sepharose column to remove contaminants such as IgG, and metal chelate columns to bind epitope tagged forms of PRO polypeptide. Several methods of protein purification can be used, such methods are known in the art and are described, for example, in Deutscher, Methods in Enzymology , 182 (1990); Scopes, Protein Purification: Principles and Practice , Springer-Verlag, New York (1982). The purification step (s) selected will depend, for example, on the production method used and the properties of the particular PRO produced.

E. Tissue Distribution

The location of the tissues expressing PRO can be identified by measuring mRNA expression in various human tissues. The location of these genes provides information on which tissues will be most affected by the activity of stimulating and inhibiting PRO polypeptides. In addition, the location of genes in specific tissues provides sample tissue for the activity blocking assay discussed below.

As pointed out above, gene expression in various tissues can be achieved by conventional Southern blotting, Northern blotting to quantify transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)). , Dot blotting (DNA analysis), or in situ hybridization with appropriately labeled probes based on the sequences provided herein. Alternatively, antibodies can be used that can recognize specific double helices, including DNA double helix, RNA double helix and DNA-RNA hybrid double helix or DNA-protein double helix.

Alternatively, gene expression in various tissues can be measured by immunological methods such as immunohistochemical staining of tissue sections and cell culture or fluid assays for direct quantification of expression of gene products. Antibodies useful for immunohistochemical staining and / or analysis of sample fluids can be monoclonal or polyclonal antibodies and can be prepared in any mammal. Conveniently, antibodies to the native sequence or synthetic peptide of the PRO polypeptide can be prepared based on the DNA sequence encoding the PRO polypeptide, or exogenous fused to the DNA encoding the PRO polypeptide and the DNA encoding a particular antibody epitope. Antibodies to the sequences can be prepared. General techniques for antibody preparation and specific protocols for northern blotting and in situ hybridization are provided below.

F. Antibody Binding Studies

In addition, the activity of the PRO polypeptide is anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti- PRO272, anti-PRO332, anti-PRO526, anti-PRO701, anti-PRO361, anti-PRO362, anti-PRO363, anti-PRO364, anti-PRO356, anti-PRO531, anti-PRO533, anti-PRO1083, anti-PRO865, Anti-PRO770, anti-PRO769, anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti- PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344, Anti-PRO333, anti-PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti- PRO4333, anti-PRO4302, anti-PRO4430 or anti-PRO5727 antibodies against tissue cells PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PR O362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, or PRO5727 Polypeptide This can be further demonstrated by antibody binding studies that test the ability to inhibit effects. Examples of antibodies include polyclonal antibodies, monoclonal antibodies, humanized antibodies, bispecific antibodies, heterozygous antibodies, and the like, and methods for their preparation will be described below.

Antibody binding studies can be performed by known assays, such as competitive binding assays, direct and indirect sandwich assays and immunoprecipitation assays (Zola, Monoclonal Antibodies: A Manual of Technique , pp. 147-158 (CRC Press, Inc.). , 1987)).

Competitive binding assays rely on the ability of a labeled standard to compete with a test sample analyte for binding to a limited amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard substance that will bind to the antibody. In order to easily determine the amount of reference material to be bound, the insoluble antibody is preferably insolubilized before or after competition, and conveniently, the reference material and assay in which the standard and analyte bound to the antibody remain unbound. Can be separated from water.

Sandwich assays involve the use of two antibodies, each capable of binding to different immunogen portions, or epitopes, of the proteins detected. In the sandwich assay, the test sample analyte is bound to a first antibody immobilized on a solid support, and then the second antibody binds to the analyte to form an insoluble tripartite complex. See, for example, US Pat. No. 4,376,110. The second antibody itself can be labeled with a detectable moiety (direct sandwich assay) or it can be measured using an anti-immunoglobulin antibody labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable residue is an enzyme.

For immunohistochemistry, tissue samples can be fresh or frozen or buried in paraffin and fixed with a preservative such as formalin.

G. Cell-Based Analysis

Cell-based assays and animal models for immune-related diseases can further be used to understand the relationship between genes and polypeptides identified herein and the occurrence and pathogenesis of immune-related diseases.

In another approach, cells of a cell type known to be involved in a particular immune related disease are transfected with the cDNA described herein to analyze the stimulation or inhibition of immune function by this cDNA. Appropriate cells can be transfected with the desired genes and the immune function activity can be monitored. This transfected cell line can then be used to test the immune response stimulation or inhibition of poly- or monoclonal antibodies or antibody compositions, such as adjusting T-cell proliferation or inflammatory cell infiltration. Cells transfected with the coding sequences of the genes identified herein can also be used to identify drug candidates for the treatment of immune related diseases.

In addition, although stable cell lines are preferred, primary cultures derived from transgenic animals (as described below) can also be used for cell-based assays herein. Techniques for inducing continuous cell lines from transgenic animals are known in the art (see, eg, Small et al., Mol. Cell. Bio ., 5 , 642-648 (1985)).

One suitable cell-based assay is mixed lymphocyte reaction (MLR) (Current Protocols in Immunology, unit 3.12; JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W. Strober, National Institutes of Health, John Wiley & Sons, Inc.) In this assay, the stimulation or inhibition of the test compound against the proliferation of activated T cells is assayed The suspension of responder T cells is incubated with allogeneic stimulator cells and uptake of tritiated thymidine This assay is a general measure of T cell responsiveness, since most T cells respond and produce IL-2 immediately after activation, so the responsiveness differences in this assay are partially due to the response cells. Reflects IL-2 production differences MLR results can be demonstrated with standard lymphokine (IL-2) detection assays (Current Protocols in Immunology, 3.15, 6.3).

Proliferative T cell responses in MLR assays may be due to the direct mitogenic properties of the analyzed molecules or activation induced by foreign antigens. T cell stimulatory activity of PRO polypeptides can be further demonstrated by costimulatory assays. T cell activation requires antigen specific signals mediated through the T cell receptor (TCR) and costimulatory signals mediated through a second ligand binding interaction, eg, B7 (CD80, CD86) / CD28 binding interaction. . CD28 crosslinking increases lymphokine secretion by activated T cells. T cell activation receives both negative and positive regulation through the binding of ligands with a negative or positive effect. CD28 and CTLA-4 are related glycoproteins of the Ig macrophages that bind B7. CD28 binding to B7 has a positive costimulatory effect on T cell activation, whereas CTLA-4 binding to B7 has a negative T cell inactivation effect (Chamners, CA and Allison, JP, Curr. Opin. Immunol. (1997) 9: 396. Schwartz, RH, Cell (1992) 71: 1065; Linsey, PS and Ledbetter, JA, Annu. Rev. Immunol. (1993); June, CH et al., Immunol. Today ( 1994) 15: 321; Jenkins, MK, Immunity (1994) 1: 405). In a costimulatory assay, the PRO polypeptide is analyzed for cellular costimulatory or inhibitory activity.

PRO polypeptides and other compounds of the invention are agonists, eg, agonist antibodies, as determined by MLR and costimulatory assays, are stimulators of T cell proliferation (costimulators), poor and suboptimal (次) Iii) useful for the treatment of immune related diseases characterized by suboptimal or inappropriate immune function. These diseases are treated by stimulating the proliferation and activation of T cells (and T cell mediated immunity), and by stimulating compounds such as stimulatory PRO polypeptides to enhance the immune response in mammals. Stimulating polypeptides are, for example, PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083 , PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269 , PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptide, or agonist antibodies thereof.

Direct use of a stimulating compound as in the present invention is a member of the tumor necrosis factor receptor family that binds to ligands (4-1BBL) expressed on primed T cells and signals the activation and growth of T cells. Experiments with 4-1BB glycoproteins were confirmed (Alderson, ME et al., J. Immunol. (1994) 24: 2219).

In addition, the use of agonist stimulating compounds has been experimentally verified. Activation of 4-1BB by agonist anti-4-1BB antibody treatment enhances tumor eradication (Hellstrom, I. and Hellstrom, KE, Crit. Rev. Immunol. (1998) 18: 1). Described in more detail, immunoadjuvant therapy for the treatment of tumors is another example of the use of a stimulating compound of the present invention.

In addition, immune stimulating or enhancing effects can be achieved by antagonizing or blocking the activity of PRO that has been shown to inhibit in MLR assays. Eliminating the inhibitory activity of a compound produces a net stimulating effect. Suitable antagonist / blocking compounds are antibodies or fragments thereof that recognize and bind to inhibitory proteins, block the effective interaction of the protein with the receptor and inhibit signaling through the receptor. This effect was validated by experiments with anti-CTLA-4 antibodies that enhance T cell proliferation, suggesting that this is by elimination of suppression signals caused by CTLA-4 binding (Waluna, YL et al., Immunity ( 1994) 1: 405).

Alternatively, immune stimulating or increasing effects may be achieved by administering PRO having vascular permeability enhancing properties. Vascular permeability enhancement will be beneficial for disorders that can be attenuated by local infiltration and inflammation of immune cells (eg monocytes, eosinophils, PMN).

PRO polypeptides, and other compounds of the invention, on the other hand, are direct inhibitors of T cell proliferation / activation, lymphokine secretion, and / or vascular permeability, and can be used directly to inhibit immune responses. These compounds are useful for alleviating the degree of immune response and for the treatment of immune related diseases characterized by hyperactivity, suboptimal or autoimmune responses. This use of the compounds of the invention was verified by the experiment described above where CTLA-4 bound to receptor B7 inactivates T cells. Direct inhibitory compounds of the present invention function in a similar manner. Use of compounds that inhibit vascular permeability will be expected to reduce inflammation. Such use would be beneficial for the treatment of conditions associated with excessive inflammation.

Alternatively, compounds that bind to stimulatory PRO polypeptides and block the stimulatory effects of these molecules, such as antibodies, produce a net inhibitory effect and inhibit T cell proliferation / activation and / or lymphokine secretion. It can be used to suppress T cell mediated immune responses. Blocking the stimulatory effects of polypeptides inhibits the immune response of mammals. This use has been demonstrated in experiments with anti-IL2 antibodies. In this experiment, the T cell inhibitory effect was achieved by the antibody binding to IL2 and blocking the binding of IL2 to the receptor of IL2.

H. Animal Models

Cell based in vitro assay results were further demonstrated using in vivo animal models and T cell function assays. Using a variety of known animal models

The role of the genes identified herein in the development and pathogenesis of immune-related diseases can be further understood and the efficacy of candidate therapeutic agents including antibodies and other antagonists of natural polypeptides such as small molecule antagonists can be tested. The in vivo nature of these models predicts response in human patients. Animal models of immune related diseases include both non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodents such as murine models. Such models can be generated by introducing cells into syngeneic mice using standard techniques, such as, for example, subcutaneous injection, tail vein injection, spleen transplantation, intraperitoneal transplantation, and subcutaneous transplantation. have.

Graft-versus-host disease occurs when immunocompetent cells are transplanted into immunosuppressive or resistant patients. Donor cells recognize and respond to host antigens. This response can vary from life-threatening severe inflammation to mild cases of diarrhea and weight loss. The graft-versus-host disease model provides a means of assessing T cell responsiveness to MHC antigens and a few transplant antigens. Suitable methods are described in detail in the Current Protocols, unit 4.3 above.

Animal models for cutaneous allograft rejection are a means of testing the in vivo tissue disruption media of T cells and measuring their role in transplant rejection. The most commonly accepted model uses murine tail-skin grafts. Repeated experiments have found that skin allograft rejection is mediated by T cells, helper T cells, and killer-effector T cells and not by antibodies (Auchincloss, HH. Jr. and Sachs, DH, Fundamental Immunology , 2nd ed., WE Paul ed., Raven Press, NY, 1989, 889-992). Suitable methods are described in the Current Protocols in Immunology, unit 4.4 above. Other transplant rejection models that can be used to test compounds of the present invention are described in Tanabe, M .. et al., Transplantation (1994) 58:23 and Tinubu, SA et al., J. Immunol. (1994) 4330-4338) is a homologous heart transplant model.

Delayed hypersensitivity animal models also provide assays for cell mediated immune function. Delayed-type hypersensitivity is a T cell mediated in vivo immune response characterized by inflammation that does not peak after some time after administration of the antigen. This response also occurs in tissue specific autoimmune diseases such as multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE, model for MS). Suitable methods are described in detail in the above (Current Protocols, unit 4.5).

EAE is a T cell mediated autoimmune disease characterized by T cell and monocyte inflammation and subsequent demyelination of axons in the central nervous system. EAE is generally considered to be an animal model associated with human MS (Bolton, C., Multiple Sclerosis (1995) 1 : 143). Acute and relapsing-remitting models have been developed. Compounds of the present invention can be tested for T cell stimulation or inhibitory activity against immunomediated demyelination diseases using the protocols described above (Current Protocols in Immunology, units 15.1 and 15.2). See also a model for myelin disease in which oligodendrocytes or Schwann cells are transplanted into the central nervous system as described in Duncan, ID et al., Molec. Med. Today (1997) 554-561.

Contact hypersensitivity is a simple delayed type hypersensitivity in vivo analysis of cell mediated immune function. In this method, skin exposure to exogenous hapten causing a delayed-type hypersensitivity reaction was measured and quantified. Contact sensitivity includes the trigger followed by the initial sensitizer. Induction occurs when T lymphocytes encounter the antigens they previously contacted. Swelling and inflammation develop to be an excellent model of human allergic contact dermatitis. Suitable methods are described in detail in Current Protocols in Immunology, JE Cologan, AM Kruisbeek, DH Margulies, EM Shevach and W. Strober, John Wiley & Sons, Inc., 1994, unit 4.2. See also Grabbe, S. and Schwartz, T., Immun.Today 19 (1): 37-44 (1998).

Animal models of arthritis are collagen-induced arthritis. This model has the clinical, histological and immunological characteristics of human autoimmune rheumatoid arthritis and is an acceptable model of human autoimmune arthritis. Mouse and rat models are characterized by erosion of synovitis, cartilage and subchondral bone. Compounds of the present invention can be tested for activity against autoimmune arthritis using the protocol described above in Current Protocols in Immunology, unit 15.5. See also the model using monoclonal antibodies against CD18 and VLA-4 integrins described in Issekutz, A. C. et al., Immunology (1996) 88: 569.

An asthma model is described in which an antigen-induced airway hyperreactivity, pulmonary eosinophilia, and inflammation are sensitized to an animal with egg albumin, and then the same protein is aerosol administered to the animal. Some animal models (guinea pigs, rats, non-human primates) developed symptoms similar to atopic asthma in humans immediately after administration of the aerosol antigen. The murine model has many features of human asthma. Suitable methods for testing the compounds of the present invention for activity and effectiveness in the treatment of asthma are described in WOLYNIEC, WW et al., Am. J. Respir. CEll Mol. Biol. (1998) 18: 777 It is described in the cited references.

The compounds of the invention can also be tested on animal models of psoriatic disease. There is evidence to suggest a T cell hospital for psoriasis. Compounds of the invention can be tested in the scid / scid mouse model described in Schon, MP et al., Nat. Med. (1997) 3: 183, wherein the mice have histopathological skin lesions similar to psoriasis. Explain. Another suitable model is the human skin / scid mouse chimera prepared as described in Nickoloff, B. J. et al., Am. J. Path. (1995) 146: 580.

Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of the animal of interest using standard techniques for preparing transgenic animals. Animals that can serve as targets for transgenic manipulation include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates such as baboons, chimpanzees, and monkeys. . Techniques in the art for introducing transgenes into such animals include, but are not limited to, prokaryotic microinjection (Hoppe and Wanger, US Pat. No. 4,873,191), retrovirus mediated gene delivery to the germ line. (See, e.g., Van der Putten et al., Proc. Natl. Acad. Sci. USA , 82 : 6148-615 (1985)), gene targeting in embryonic hepatocytes (Thompson et al. , Cell , 56 : 313-32 (1989)), embryonic electroporation method (Lo, Mol. Cell. Biol. , 3 : 1803-1814 (1983)); Sperm mediated gene transfer (Lavitrano et al., Cell. 57 : 717-73 (1989)). See, for example, US Pat. No. 4,736,866.

For the purposes of the present invention, transgenic animals include animals ("mosaic animals") that have a transgene only in a portion of the cell. The transgene may be integrated into a single transgene or concatamer, eg, a head-head or head-tail arrangement. In addition, selective introduction of transgenes into specific cell types is possible, for example, by the techniques of Proc. Natl. Acd. Sci. USA. 89 : 6232-636 (1992).

Transgene expression in transgenic animals can be monitored using standard techniques. For example, Southern blotting analysis or PCR amplification can be used to demonstrate insertion of the transgene. MRNA expression levels can then be analyzed using techniques such as in situ hybridization, northern blotting analysis, PCR or immunocytochemistry.

Animals may further investigate signals of immune disease pathology, for example by histological examination, to determine immune cell infiltration into specific tissues. In addition, blocking experiments may be performed in which a transgenic animal is treated with a compound of the present invention to determine the extent of T cell proliferation stimulation or inhibition of the compound. In these experiments, a blocking antibody that binds to a PRO polypeptide, prepared as described above, is administered to the animal to determine its effect on immune function.

Alternatively, as a result of cognate recombination between the endogenous gene encoding the polypeptide and the modified genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal, it has a defect or modified gene encoding the polypeptide identified herein. Create "knockout" animals. For example, cDNA encoding a particular polypeptide can be used to clone genomic DNA encoding that polypeptide according to established techniques. Portions of genomic DNA encoding a particular polypeptide can be deleted or substituted with other genes, such as genes encoding selectable markers that can be used to monitor integration. In general, thousands of bases of unmodified flanking DNA (at both the 5 'and 3' ends) are included in the vector (e.g., for homologous recombinant vectors, see Thomas and Capecchi, Cell , 51: 503). (1987)). This vector is introduced into an embryonic stem cell line (e.g. by electroporation) and cells that have undergone homologous recombination between the introduced DNA and endogenous DNA are selected (e.g. Li et al., Cell , 69: 915 (1992)). Selected cells are then injected into blastocysts of animals (eg mice or rats) to form aggregated chimeras (see, eg, Bradley, Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. IRL, Oxford, 1987), pp. 113-152). The chimeric embryo can then be implanted into a suitable fertility surrogate animal, which will produce a "knockout" animal. Progeny that possesses cognate recombinant DNA in germ cells can be identified by standard techniques and can be used to breed animals in which all cells are cognate recombined DNA. Knockout animals can be characterized, for example, by the ability to defend against certain pathological symptoms and the development of pathological conditions due to the absence of polypeptide.

I. Immune Adjuvant Therapy

In one embodiment, the immune stimulating compounds of the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer). It is well established that T cells recognize human tumor specific antigens. A group of tumor antigens, encoded by the MAGE, BAGE, and GAGE gene families, is silent in all adult normal tissues but is expressed in significant amounts in tumors such as melanoma, lung cancer, head cancer, neck cancer, and bladder cancer (DeSmet, C et al., (1996) Proc. Natl. Acad. Sci. USA, 93: 7149). Co-stimulation of T cells has been shown to induce tumor regression and anti-tumor responses both in vitro and in vivo (Melero, I. et al., Nature Medicine (1997) 3: 682; Kwon, e. D., et al., Proc. Natl. Acad. Sci. USA (1997) 94: 8099; Lynch, DH et al., Nature Medicine (1997) 3: 625; Finn, OJ and Lotze, MT, J. Immunol. (1998) 21: 114). Stimulating compounds of the invention can be administered alone or in combination with growth regulators, cytotoxic agents or chemotherapeutic agents to stimulate T cell proliferation / activation and anti-tumor responses to tumor antigens. Growth regulators, cytotoxic agents, or chemotherapeutic agents can be administered in conventional amounts using known methods of administration. Immune stimulating activity by the compounds of the present invention potentially mitigates toxicity to patients by reducing the amount of growth regulators, cytotoxic agents, or chemotherapeutic agents.

J. Screening Assay for Drug Candidates

Screening assays for drug candidates include compounds that bind to or complex with polypeptides encoded by the genes identified herein or biologically active fragments thereof, or compounds that interfere with the interaction of these encoded polypeptides with other intracellular proteins. Is designed to make sure. Such screening assays include assays that can be highly screened against chemical libraries, which would be particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include peptides, preferably soluble peptides, (poly) peptide-immunoglobulin fusions, and polyclonal and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotype antibodies and chimeric antibodies or such antibodies. Or synthetic organic or inorganic compounds, including humanized antibodies of fragments, and antibodies, including but not limited to human antibodies and antibody fragments. Assays can be performed in a variety of formats including well-characterized protein-protein binding assays, biochemical screening assays, immunoassays and cell-based assays.

Common to all assays is that they require contact of the drug candidate with the polypeptide encoded by the nucleic acid identified herein for sufficient conditions and time to interact.

In binding assays, the interaction is binding, and the complexes formed can be isolated or detected in the reaction mixture. In certain embodiments, a PRO polypeptide or drug candidate substance encoded by a gene identified herein is immobilized to a solid phase, eg, a microtiter plate, by covalent or non-covalent attachment. Non-covalent attachment is generally accomplished by coating the solid surface with a PRO polypeptide solution and drying. Alternatively, immobilized antibodies, such as monoclonal antibodies specific for immobilized PRO polypeptides, can be used to anchor them to a solid surface. This assay can be performed by adding an unfixed component that can be labeled with a detectable label to a coding surface comprising a fixed component, such as an anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and complexes anchored to the solid surface are detected. If a component that was not originally immobilized had a detectable label, detection of the label immobilized on the surface meant that the complexation reaction occurred. If a component that is not originally immobilized does not have a label, the complexing reaction can be detected using, for example, a labeled antibody that specifically binds to the immobilized complex.

If a candidate compound interacts with, but does not bind to, a particular PRO polypeptide encoded by a gene identified herein, the interaction of the candidate compound with the polypeptide can be analyzed by methods well known for detecting protein-protein interactions. Such assays include conventional methods such as crosslinking, coimmunoprecipitation, and copurification via gradient or chromatographic columns. Protein-protein interactions are also described in Fields and Song, Nature (London) , 340: as described by Chevray and Nathans, Proc. Natl. Acad. Sci. USA , 89: 5789-5793 (1991). 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA , 88: 9578-9582 (1991). Many transcriptional activators (eg yeast GAL4) consist of two physically distinct modular domains, one acting as a DNA-binding domain and the other as a transcription-active domain. The yeast expression system (commonly referred to as "2-hybrid system") described in this publication utilizes these properties and uses two hybrid proteins, one of which is that the target protein is associated with the DNA-binding domain of GAL4. The other is a candidate active protein fused with an activation domain. The expression of the GAL1-lacZ reporter gene under the control of the GAL4-activation promoter depends on the reconstitution of GAL4 activity through protein-protein interactions. Colonies containing interacting polypeptides are detected using a pigment producing substrate for β-galactosidase. A complete kit (MATCHMAKER ^™ ), which confirms protein-protein interactions between two specific proteins using 2-hybrid technology, can be purchased from Clontech. In addition, the system can be extended to map protein domains involved in specific protein interactions, as well as to pinpoint the location of amino acid residues critical for such interactions.

In order to identify compounds that interfere with the interaction of genes identified herein with other intracellular or extracellular components, a reaction mixture, typically comprising a gene product and intracellular or extracellular components, allows for interaction and binding of the two products. It can be prepared and tested under the conditions and time. To test the binding inhibition of the test compound, the reaction is carried out in the presence and absence of the test compound. In addition, placebo may be added to a third reaction mixture that serves as a positive control. Binding (complex formation) between test compounds present in the mixture and intracellular or extracellular components is monitored as described above. The formation of a complex in the control reactant (s) but no complex in the reaction mixture comprising the test compound means that the test compound interferes with the interaction of the test compound with its reaction counterpart.

K. Compositions and Methods of Treating Immune-Related Diseases

Compositions useful for the treatment of immune related diseases include, for example, proteins, antibodies, organic and inorganic small molecules, peptides, phosphopeptides that inhibit or stimulate immune functions such as T cell proliferation / activation, lymphokine release, or immune cell infiltration. , Antisense and ribozyme molecules, triple helix molecules, and the like.

For example, antisense RNA and RNA molecules hybridize to target mRNAs to inhibit protein translation and thereby directly block translation of mRNA. When antisense DNA is used, it is preferred that it is, for example, an oligodeoxyribonucleotide derived from the translation initiation site between the -10 and +10 positions of the target gene nucleotide sequence.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization with complementary target RNAs followed by endonuclease cleavage. Known techniques can identify specific ribozyme cleavage sites within potential RNA targets. For further details, see, eg, Rossi, Current Biology , 4: 469-471 (1994) and PCT Publication No. WO 97/33551 (September 18, 1997).

Triple-stranded nucleic acid molecules used to inhibit transcription must be single-stranded and composed of deoxynucleotides. The base composition of such oligonucleotides is designed to facilitate triple helix formation through the Hoogsteen base pair rule, which typically requires significant size purine or pyrimidine stretch in one of the double helixes. Shall be. For further details see the literature (eg PCT Publication WO 97/33551, supra).

The molecules can be identified by any of the one or more screening assays discussed above and / or by other screening techniques well known to those skilled in the art.

L. Antibodies

The invention further provides anti-PRO antibodies and fragments thereof that can inhibit (antagonist) or stimulate (agonist) T cell proliferation, eosinophil infiltration, vascular permeability and the like. Such anti-PRO antibodies and fragments thereof include polyclonal, monoclonal, humanized, bispecific and heteroconjugate antibodies.

1. Polyclonal Antibodies

Anti-PRO antibodies can include polyclonal antibodies. Methods of making polyclonal antibodies are known to those skilled in the art. Polyclonal antibodies can be produced, for example, by injecting the mammal with one or more immunizing agents and, if necessary, adjuvant. Typically, the immunizing agent and / or adjuvant will be injected into the mammal several times subcutaneously or intraperitoneally. Immunizing agents can include PRO polypeptides or fusion fragments thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic to the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine tyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that can be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicholinomycolate). One skilled in the art can select an immunization protocol without undue trial and error.

2. Monoclonal Antibodies

Alternatively, the anti-PRO antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using hybridoma methods as described in Kohler and Milstein, Nature , 256 : 495 (1975). In hybridoma methods, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to induce lymphocytes capable of producing or producing antibodies that will specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vitro.

Immunizing agents will typically comprise a PRO polypeptide or a fusion protein thereof. Typically, peripheral blood lymphocytes (“PBLs”) are used (if cells of human origin are desired), or spleen cells or lymph node cells (if nonhuman mammal sources are desired). Then, a suitable fusion agent such as polyethylene glycol is used to fuse the lymphocytes with the immortalized cell line to form hybridoma cells (Goding, Monoclonal Antibodies: Principle and Practice , Academic Press, (1986) pp. 59-103). Immortalized cell lines are usually transformed mammalian cells, especially myeloma cells of rodent, bovine and human origin. Typically, rat or mouse myeloma cell lines are used. Hybridoma cells are preferably cultured in a suitable culture medium comprising one or more substances that inhibit the growth or survival of unfused immortalized cells. For example, if the parent cell lacks hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT) enzymes, the culture medium for hybridomas is typically hypoxanthine, aminopterin and thymidine ("HAT medium"). And these substances inhibit the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support high levels of stable production of antibodies by selected antibody-producing cells, and are sensitive to media such as HAT media. More preferred immortalized cell lines are, for example, murine myeloma cell lines available from the Salk Institute Cell Distribution Center (San Diego, CA, USA) and the American Type Culture Collection (Mansas, VA, USA). . Also described are human myeloma cell lines and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133 : 3001 (1984); and Brodeur et al., Monoclonal Antibody Production Techniques). and Applications , Marcel Dekker, Inc., New York, (1987) pp. 51-63).

Culture medium in which hybridoma cells are cultured can be assayed for the presence of monoclonal antibodies directed against PRO. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is measured by immunoprecipitation or in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA). . Such techniques and assays are known in the art. The binding affinity of monoclonal antibodies can be determined, for example, by the Scatchard assay (Munson and Pollard, Anal. Biochem. , 107 : 220 (1980)).

After identifying the desired hybridoma cells, the clones can be subcloned by restriction dilution and cultured by standard methods (Goding, supra ). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be cultured in vivo ascites in mammals.

Monoclonal antibodies secreted by subclones are conventional immunoglobulin purification methods such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography. It can be isolated or purified from the culture medium or ascites fluid by.

Monoclonal antibodies can also be prepared by recombinant DNA methods such as those described in US Pat. No. 4,816,567. The DNA encoding the monoclonal antibodies of the invention can be easily isolated using conventional methods (e.g., using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of murine animal antibodies). Can be sequenced. The hybridoma cells of the present invention serve as a preferred source of such DNA. Once isolated, the DNA can be placed into an expression vector, which is then transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins separately. Monoclonal antibodies can be synthesized in cells. Also, for example homologous St. murine replacing the coding sequence for human heavy and light chain constant domains in place of the animal sequence or (U.S. Patent Nos. 4,816,567;. Morrison et al, supra), or a non-immunoglobulin coding for a polypeptide DNA may also be modified by covalently binding all or a portion of the sequence to an immunoglobulin coding sequence. Such non-immunoglobulin polypeptides can be substituted for the constant domains of the antibodies of the invention, or for the variable domains of one antibody-binding site of the antibodies of the invention to generate chimeric bivalent antibodies.

Preferably, the antibody may be a monovalent antibody. Methods of making monovalent antibodies are known in the art. For example, one method involves recombinant expression of an immunoglobulin light chain and a modified heavy chain. Heavy chains are generally truncated at any point in the Fc region to prevent heavy chain crosslinking. Alternatively, related cysteine residues are substituted or deleted with other amino acid residues to prevent crosslinking.

In vitro methods are also suitable for the preparation of monovalent antibodies. Cleavage of antibodies to prepare antibody fragments, particularly Fab fragments, can be performed using conventional techniques known in the art.

3. Human and Humanized Antibodies

Anti-PRO antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (eg, murine animal) antibodies are immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ', F (ab) that contain minimal sequences derived from chimeric immunoglobulins, non-human immunoglobulins. ') ₂ or other antigen binding subsequence of the antibody). Humanized antibodies are human immunoglobulins (receptive antibodies) in which residues in the complementarity determining regions (CDRs) of the receptor are substituted with residues in the CDRs of non-human species (donating antibodies) such as mice, rats or rabbits with the desired specificity, affinity and ability. ). In some cases, Fv framework residues of human immunoglobulins are substituted with corresponding nonhuman residues. Humanized antibodies may also comprise residues that are not found in either the recipient antibody or the CDR or framework sequences to be introduced. In general, humanized antibodies will comprise substantially all of one or more, generally two or more variable domains, wherein all or substantially all CDR regions correspond to regions of non-human immunoglobulins and all or substantially all FR regions are human immune. Corresponding to a region of the globulin consensus sequence. Humanized antibodies will also optionally include immunoglobulin constant regions (Fc), generally at least a portion of the constant regions of human immunoglobulins (Jones et al., Nature , 321 : 522-525 (1986); Riechmann et. al., Nature , 332 : 323-327 (1988); and Presta, Curr. Op. Struct. Biol. 2 : 593-596 (1992).

Methods of humanizing nonhuman antibodies are well known in the art. In general, humanized antibodies have one or more amino acid residues introduced thereto from a non-human origin. These nonhuman amino acid residues are often referred to as "import" residues and are typically obtained from an "import" variable domain. Humanization is in essence a method of Winter et al. (Jones et al., Nature , 321 : 522-525 (1986); Riechmann et al., Nature , 332 : 323-327 (1988); Verhoeyen et al., Science , 239 : 1534-1536 (1988)) can be used to replace the corresponding sequence of a human antibody with a rodent CDR or CDR sequence. Thus, such “humanized” antibodies are chimeric antibodies (US Pat. No. 4,816,567) in which substantially fewer intact human variable domains are substituted with corresponding sequences of non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues in analogous sites of rodent antibodies.

Human antibodies can also be prepared using a variety of techniques known in the art, including phage display libraries (Hoogenboom et al., J. Mol. Biol. , 227 : 381 (1991); Marks et al., J. Mol. Bio. , 222 : 581-597 (1991)). In addition, techniques such as Cole and Boerner can also be used to prepare human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, p. 77 ( 1985) and Boerner et al., J. Immunol. , 147 (1) : 86-95 (1991). Similarly, human antibodies can be prepared by introducing human immunoglobulin loci into transgenic animals (eg mice) in which the endogenous immunoglobulin genes have been partially or wholly inactivated. Following challenge, human antibody production is observed, which closely resembles that observed in humans, including gene rearrangements, assemblies and antibody lists. This is described in, for example, US Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, 5,661,016, and scientific publications (Marks et al., Bio / Technology 10 , 779-783 (1992); Lonberg et al., Nature 368 , 856-859 (1994), Morrison, Nature 368 , 812-13 (1994); Fishwild et al., Nature Biotechnology 14 , 845-51 (1996) Neuberger, Nature Biotechnology 14 , 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995)).

The antibody may also be affinity matured using known selection and / or mutagenesis as described above. The affinity of the preferred affinity matured antibody is 5 times, more preferably 10 times, even more preferably 20 or 30 times that of the starting antibody (typically a murine, humanized or human antibody) from which the mature antibody is prepared.

4. Bispecific Antibodies

Bispecific antibodies are monoclonal, preferably human or humanized antibodies with binding specificities for at least two different antigens. In this case, one of the binding specificities is for PRO and the other is for any other antigen, preferably for cell surface proteins or receptors or receptor subunits.

Methods of making bispecific antibodies are known in the art. Typically, recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy / light chain pairs, where the two heavy chains have different specificities (Millstein and Cuello, Nature , 305 : 537-539 ( 1983). Due to the random classification of immunoglobulin heavy and light chains, these hybridomas (quadromas) are capable of a mixture of 10 different antibody molecules, only one of which has the correct bispecific structure. Purification of the correct molecule is usually performed by an affinity chromatography step. Similar methods are described in WO 93/08829, published May 13, 1993, and Traunecker et al., EMBO J. , 10: 3655-3659 (1991).

Antibody variable domains (antibody-antigen binding sites) with the desired binding specificities can be fused to immunoglobulin constant domain sequences. This fusion is preferably a fusion of at least a portion of the hinge with an immunoglobulin heavy chain constant domain comprising CH2 and CH3 regions. It is preferred that the first heavy chain constant region (CH1) comprising the site necessary for light chain binding is present in at least one fusion. The immunoglobulin heavy chain fusion, and, if necessary, the DNA encoding the immunoglobulin light chain, are inserted into separate expression vectors and cotransfected into the appropriate host organism. For further details on producing bispecific antibodies, see, eg, Suresh et al., Methods in Enzymmology , 121 : 210 (1986).

According to another method disclosed in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimer recovered from recombinant cell culture. Preferred interfaces comprise at least part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the first antibody molecular interface are replaced with larger side chains (eg tyrosine or tryptophan). By replacing large amino acid side chains with smaller ones (eg, alanine or threonine), complementary "cavities" of the same or similar size as the large side chain (s) are created at the interface of the second antibody molecule. This provides a mechanism for increasing the yield of heterodimer to be higher than other unwanted end-products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg, F (ab ') ₂ bispecific antibodies). Techniques for making bispecific antibodies from antibody fragments are described in the literature. For example, bispecific antibodies can be prepared using chemical bonds. Brennan et al., Science 229: 81 (1985) describe methods for cleaving intact antibodies by proteolysis to produce F (ab ') ₂ fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize nearby dithiol and prevent intermolecular disulfide formation. Thereafter, the Fab 'fragments generated are converted to thionitrobenzoate (TNB) derivatives. Thereafter, one of the Fab'-TNB derivatives is reduced with mercaptoethylamine, reconverted to Fab'-thiol and mixed with an equimolar amount of another Fab'-TNB derivative to form a bispecific antibody. The resulting bispecific antibodies can be used as substances for the selective immobilization of enzymes.

Fab 'fragments can be directly recovered from E. coli and chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med. 175: 217-225 (1992) disclose fully humanized bispecific antibody F (ab ') ₂ molecules. Each Fab 'fragment was secreted separately from E. coli and formed a bispecific antibody with the indicated in vitro chemical coupling. The bispecific antibody thus formed was able to bind cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.

In addition, several techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture are also disclosed. For example, bispecific antibodies have been prepared using leucine zippers (Kostelny et al., J. Immunol . 148 (5): 1547-1553 (1992)). Leucine zipper peptides from Fos and Jun proteins were linked by gene fusion to the Fab 'portion of two different antibodies. The antibody homodimer was reduced in the hinge region to form a monomer and then reoxidized to form an antibody heterodimer. This method can also be used to prepare antibody homodimers. The "diabody" technique described by Hollinger et al., Proc. Natl. Acad. Sci. USA 90: 6444-6448 (1993) provides a separate mechanism for making bispecific antibody fragments. This fragment contains a heavy chain variable domain (V _H ) linked to the light chain variable domain (V _L ) with a linker that is too short to pair two domains of the same chain. Thus, the V _L and V _H domains of one fragment are paired with the complementary V _H and V _L domains of the other fragment, forming two antigen binding sites. Another strategy for making bispecific antibody fragments using single chain Fv (sFv) dimers has been reported (see Gruber et al., J. Immunol. 152: 5368 (1994)).

Antibodies having a bivalent or higher valency are considered. For example, trispecific antibodies can be prepared (Tutt et al., J. Immunol. 147: 60 (1991)).

For example, bispecific antibodies can bind to two different epitopes on a given PRO polypeptide. Alternatively, in order to focus on intracellular defense mechanisms against cells expressing a particular PRO polypeptide, the anti-PRO polypeptide arm may be triggered on a leukocyte triggering molecule, such as a T-cell receptor molecule (eg, CD2). , CD3, CD28 or B7), or an Fc receptor (FcγR) of IgG, for example FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16). In addition, bispecific antibodies can be used to localize cytotoxic agents to cells that express particular PRO polypeptides. Such antibodies have a PRO-binding arm and an arm that binds to a cytotoxic or radionuclide chelating agent such as EOTUBE, DPTA, DOTA or TETA. Another bispecific antibody of interest binds to the PRO polypeptide and further binds to tissue factor (TF).

5. Heteroconjugate Antibodies

Heteroconjugate antibodies consist of two covalently linked antibodies. Such antibodies target, for example, immune system cells to unwanted cells (US Pat. No. 4,676,980) and for the treatment of HIV infection (WO 91/00360, US 92/200373, and EP 03089). Proposed. Heteroconjugate antibodies are contemplated that can be prepared in vitro using methods known in synthetic protein chemistry, including methods using crosslinking agents. For example, immunotoxins can be prepared using disulfide exchange reactions or by forming thioether bonds. Examples of suitable reagents for this purpose include iminothiolates and methyl-4-mercaptobutyrimidates and reagents disclosed in US Pat. No. 4,676,980.

6. Effector function operation

It may be desirable to modify the antibody of the invention to effector function (eg to enhance the effect of the antibody in the treatment of an immune related disease). For example, cysteine residue (s) can be introduced into the Fc region to form interchain disulfide bonds in this region. Homodimer antibodies thus produced can enhance internalization capacity and / or increase complement-mediated cell death and antibody-dependent intracellular cytotoxicity (ADCC) (Caron et al., J. Exp Med. , 176: 1191-1195 (1992) and Shopes, J. Immunol. , 148: 2918-2922 (1992)). In addition, homodimeric antibodies with enhanced anti-tumor activity can also be prepared using heterobifunctional crosslinkers, as described by Wolfff et al. Cancer Research , 53 : 2560-2565 (1993). Alternatively, antibodies with double Fc regions can be engineered to enhance complement lytic and ADCC ability (see Stevenson et al., Anti-Cancer Drug Design , 3: 219-230 (1989)).

7. Immunoconjugates

In addition, the present invention relates to cytotoxic agents such as chemotherapeutic agents, toxins (eg, enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof) or radioisotopes (ie, radioconjugates); It relates to an immunoconjugate comprising a bound antibody.

Chemotherapeutic agents useful for the production of such immunoconjugates are described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, unbound active fragment of diphtheria toxin, exotoxin A chain (derived from Pseudomonas aeruginosa ), lysine A chain, abrin A chain, modecine A chain. , Alpha- sarsine , Aleurites fordii protein, diantine protein, Phytolaca americana protein (PAPI, PAPII and PAP-S), bitter melon (momordica charantia) inhibitor, cursin, Crotins, sapaonaria officinalis inhibitors, gelonin, mitogelin, restritocin, phenomycin, enomycin, and trichotheneses. Various radionuclides can be used to prepare radioconjugated antibodies. For example ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re.

Various difunctional protein-coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), difunctional derivatives of imidoesters (eg For example, dimethyl adipimidate HCL), active esters (e.g. disuccinimidyl suverate), aldehydes (e.g. glutaraldehyde), bis-azido compounds (e.g. bis (p- Azidobenzoyl) hexanediamine), bis-diazonium derivatives (eg bis- (p-diazoniumbenzoyl) -ethylenediamine), diisocyanates (eg tolyene 2,6-diisocyanate), and Bis-active fluorine compounds (eg, 1,5-difluoro-2,4-dinitrobenzene) can be used to make conjugates of antibodies and cytotoxic agents. For example, lysine immunotoxins can be prepared as described in Vitetta et al., Science , 238 : 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is a common chelating agent linking radionucleotides with antibodies (see WO 94/11026). ).

In another embodiment, the antibody is conjugated to a "receptor" (eg, streptavidin) for use in tumor pretargeting, and the antibody-receptor conjugate is administered to a subject to be administered and then removed from the circulatory system using a scavenger. Unbound conjugates are removed and "ligand" (eg avidin) conjugated to a cytotoxic agent (eg radionucleotide).

8. Immunoliposomes

The proteins, antibodies, and the like disclosed herein may also be formulated into immunoliposomes. Liposomes comprising this antibody can be prepared using methods known in the art, for example, Epstein et al., Proc. Natl. Acad. Sci. USA , 82 : 3688 (1985); Hwang et al., Proc. Natl Acad. Sci. USA , 77 : 4030 (1980); and US Pat. Nos. 4,485,045 and 4,544,545). Liposomes with increased circulation time are disclosed in US Pat. No. 5,013,556.

Particularly useful liposomes may be prepared by reverse phase evaporation using lipid compositions comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). The liposomes are pushed through a filter of defined pore size to yield liposomes with the desired diameter. Fab 'fragments of the antibodies of the invention can be conjugated to liposomes via disulfide-interchange reactions as described in Martin et al., J. Biol. Chem. , 257 : 286-288 (1982). . If desired, chemotherapeutic agents (eg, Doxorubicin) are included in the liposomes (see Gabriel et al., J. National Cancer Inst. , 81 (19): 1484 (1989)).

M. Pharmaceutical Composition

Administration of the active PRO molecules of the invention (eg, PRO polypeptides, anti-PRO antibodies, and / or variants thereof) and other molecules identified by the screening assay described above for the treatment of immune related diseases in the form of pharmaceutical compositions can do.

Therapeutic formulations of the active PRO molecules, preferably polypeptides or antibodies of the present invention, can be used for storage of antibodies of the desired purity in any pharmaceutically acceptable carrier, excipient or stabilizer ( Remington's Pharmaceutical Sciences , 16th edition, Osol). , A. ed. (1980)) in the form of lyophilized formulations or aqueous solutions. Pharmaceutically acceptable carriers, excipients or stabilizers should be nontoxic to patients at the dosages and concentrations administered, and include buffers such as buffers of phosphoric acid, citric acid and other organic acids; Antioxidants and preservatives including ascorbic acid and methionine (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethium chloride; phenol, butyl or benzyl alcohol; methyl or propyl parabens Such as alkyl parabens; catechols; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; Proteins such as serum albumin, gelatin or immunoglobulins; Hydrophobic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; Monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; Chelating agents such as EDTA; Sugars such as sucrose, mannitol, trehalose or sorbitol; Salt-forming counter ions such as sodium; Metal complexes (eg, Zn-protein complexes); And / or nonionic surfactants such as TWEEN ™, PLURONICS ™ or polyethylene glycol (PEG).

Compounds identified by the screening assays described herein can be formulated in a similar manner using standard techniques known in the art.

Lipofection or liposomes may also be used to deliver the antibody or antibody fragment intracellularly. If antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based on the variable-region sequences of an antibody, peptide molecules can be devised that have the ability to bind a target protein sequence. Such peptides may be chemically synthesized and / or prepared by recombinant DNA techniques (eg, Marasco et al., Proc. Natl. Acad. Sci. USA , 90: 7889-7893 (1993)). Reference).

In addition, the formulations herein may comprise one or more active compounds necessary for treating a particular condition, preferably compounds with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may comprise agents that enhance its function, such as cytotoxic agents, cytokines, chemotherapeutic agents, or proliferation-inhibiting agents. Such molecules are suitably present in the formulation in amounts that are effective for the purpose intended.

Active PRO molecules are for example coacervation techniques or interfacial polymerization, for example in colloidal drug delivery systems (eg liposomes, albumin microspheres, microemulsions, nanoparticles and nanocapsules) or macroemulsions, respectively, For example, it may be enclosed in microcapsules prepared by hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacrylate) microcapsules. This technique is disclosed in Remington's Pharmaceutical Sciences , 16th edition, Osol, A. Ed. (1980).

The formulations to be used for in vivo administration should be sterile. This is readily accomplished by filtration through sterile filtration membranes.

Sustained release formulations or PRO molecules can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles (eg films or microcapsules). Examples of sustained release matrices include polyesters, hydrogels (eg, poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactide (US Pat. No. 3,773,919), L Copolymers of glutamic acid and γethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers, for example LUPRON DEPOT ^™ (injectables consisting of lactic acid-glycolic acid copolymers and leuprolide acetate Microspheres), and poly-D-(-)-3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid can release molecules for more than 100 days, but certain hydrogels release proteins for shorter time periods. If encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37 ° C., resulting in a loss of biological activity and changing immunogenicity. Reasonable strategies can be devised depending on the mechanism involved for stabilization. For example, if the aggregation mechanism is found to be an intermolecular SS bond formation through thio-disulfide interchange, modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, use of appropriate additives and specific polymers Stabilization can be achieved by the development of a matrix composition.

N. Treatment Methods

T cells, including diseases characterized by infiltration of inflammatory cells into tissues, stimulation of T cell proliferation, inhibition of T cell proliferation, increase or decrease in vascular invasiveness or inhibition thereof using polypeptides, antibodies and other active compounds of the invention It is contemplated that various immune related diseases and conditions, such as mediated diseases, can be treated.

Examples of conditions or disorders treated with polypeptides, antibodies and other compounds of the invention include systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, osteoarthritis, spinal osteoarthritis, systemic sclerosis (sclerosis), idiopathic inflammatory myopathy (dermatitis , Multiple myositis), Sjoegren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune thrombocytopenia, paroxysmal nocturnal hematuria), autoimmune thrombocytopenia, idiopathic thrombocytopenia ), Thyroiditis (Grave's disease, ischaemia thyroiditis, juvenile lymphoma thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated kidney disease (glomerulonephritis, tubulointerstitial nephritis), multiple sclerosis, idiopathic demyelination polyneuritis or guillain- Such as Guillain-Barre syndrome and chronic inflammatory demyelinating polyneuritis Demyelinating diseases of the cervical and peripheral nervous system, infectious hepatitis (A, B, C, D, E hepatitis virus and other non-hepatic hepatitis viruses), autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis and sclerotic cholangitis Autoimmune diseases such as hepatobiliary diseases, inflammatory bowel disease (ulcerative colitis; Crohn's disease), gluten-sensitive bowel disease and whip's disease, bullous skin disease, polymorphic erythema and contact dermatitis Or immune diseases of the lung, such as immunological skin diseases, psoriasis, asthma, allergic rhinitis, atopic dermatitis, food intolerance and urticaria, eosinophilic pneumonia, idiopathic pulmonary fibrosis and irritable pneumonia, transplant rejection and grafts Transplant-related diseases such as host disease.

In systemic lupus erythematosus, the central mediator of the disease is the production of autoreactive antibodies to autologous proteins / tissues and subsequent development of immunomediated inflammation. Antibodies mediate tissue damage directly or indirectly. Although T lymphocytes do not appear to be directly involved in tissue damage, T lymphocytes are required for the production of autoreactive antibodies. Therefore, the disease occurs depending on T lymphocytes. Various tissues and systems are clinically affected, including the kidneys, lungs, musculoskeletal system, skin mucosa, eyes, central nervous system, cardiovascular system, gastrointestinal tract, bone marrow and blood.

Rheumatoid arthritis (RA) is a chronic systemic autoimmune inflammatory disease in which the joints of several joints are primarily associated with damage to articular cartilage. Pathogens are T lymphocyte dependent and are involved in the production of autoantibodies to rheumatic factors, autologous IgG, resulting in the formation of immune complexes and high levels in joint fluid and blood. Within the joint, these complexes can significantly infiltrate lymphocytes and monocytes into the synovial membrane and then induce significant changes of the synovial membrane (joint space / solution changes when similar cells infiltrate with the addition of numerous neutrophils). Affected tissues are mainly joints and often appear in a symmetrical pattern. However, extra-articular diseases also occur in two main forms. One form is the development of extra-articular lesions with progressive joint disease and typical lesions of pulmonary fibrosis, vasculitis and skin ulcers. Another form is the so-called Felty's syndrome, which sometimes occurs later in the RA disease process, sometimes after the progression of joint disease, after joint disease is better, and includes the presence of neutropenia, thrombocytopenia, and splenomegaly. . It may involve vasculitis in many organs and is accompanied by the formation of infarction, skin ulcers and necrosis. Also, in patients, rheumatoid nodules often occur in the subcutaneous tissue just above the affected joints, and later in the nodules have necrotic centers surrounded by mixed inflammatory cell infiltration. Other symptoms that can occur in RA include: pericarditis, pleurisy, coronary arteryitis, interstitial pneumonia with pulmonary fibrosis, dry keratoconjunctivitis, and rheumatoid nodules.

Juvenile chronic arthritis is a chronic idiopathic inflammatory disease that often begins under age 16. This phenotype has some similarities to RA: Some patients with positive rheumatic factors are classified as juvenile rheumatoid arthritis. The disease is further divided into three major categories: minor joint, polyarticular, and systemic. Arthritis can be severe and usually disruptive, resulting in joint stiffness and growth retardation. Other symptoms may include chronic pre uveitis and systemic hereditary.

Spondyloarthropathy is a group of disorders that have some common clinical features and common relevance to the expression of the HLA-B27 gene product. These disorders include: ankylosing spondylitis, Reiter's syndrome (reactive arthritis), arthritis associated with inflammatory bowel disease, sclerosis associated with psoriasis, juvenile spondyloarthropathy and nondifferentiated spondyloarthropathy. Distinguishing features include sacral osteoarthritis, inflammatory asymmetric arthritis with or without spondylitis; Association with HLA-B27 (serologically defined allele of the HLA-B locus of class I MHC); Ocular inflammation, and the absence of autoantibodies associated with other rheumatic diseases. The most relevant cell at the heart of disease induction is CD8 + T lymphocytes, which target the antigen presented by class I MHC molecules. CD8 + T cells can respond to class I MHC allele HLA-B27 as if it is a foreign peptide expressed by MHC class I molecules. It is hypothesized that the epitopes of HLA-B27 can mimic the antigenic epitopes of bacteria or other microorganisms and induce CD8 + T cell responses.

The etiology of systemic sclerosis (sclerosis) is unknown. Hallmark of this disease is skin hardening, which is likely to be induced by an active inflammatory process. Scleroderma can be local or systemic; Vascular lesions are common, endothelial cell damage in the microvascular system is a major early event of the development of systemic sclerosis, and vascular damage may be immunomediated. Immunological evidence is suggested by the presence of mononuclear cell infiltrates in skin lesions and the presence of anti-nuclear antibodies in many patients. ICAM-1 is often upregulated on the cell surface of fibroblasts in skin lesions, suggesting that the interaction of these cells with T cells may play a role in the pathogenesis of the disease. Other related organs include: gastrointestinal tract (fibrosis and smooth muscle atrophy resulting in abnormal peristalsis / motility); Kidney (intimal hyperplasia of the concentric subcutaneous layer, affecting the archery artery and the lobular artery, and consequently reducing the renal cortical flow, results in proteinuria, nitroemia and hypertension); Skeletal muscle (gastric, interstitial fibrosis, inflammation); Lung (interstitial pneumonia and interstitial fibrosis); And heart (constriction band necrosis, scar formation / fibrosis).

Idiopathic inflammatory myopathy, including dermatitis, multiple myositis, and the like, is a chronic muscle inflammatory disorder of unknown etiology and results in muscle weakness. Muscle damage / inflammation is often symmetrical and progressive. Autoantibodies are associated with most forms. These myositis-specific autoantibodies are directed against components, proteins and RNA involved in protein synthesis to inhibit their function.

Sjoegren's syndrome is due to immunomediated inflammation and subsequent functional breakdown of the lacrimal gland and salivary glands. This disease is associated with or accompanied by inflammatory connective tissue disease. This disease is associated with autoantibody production against Ro and La antigens, both of which are small RNA-protein complexes. Lesions cause dry keratitis, dry mouth, with other symptoms or relationships, such as biliary cirrhosis, peripheral or sensory neuropathy, and palpable purpura.

Systemic vasculitis is a disease in which the primary lesion is inflamed and then damages the blood vessels, resulting in ischemia / necrosis / degeneration in the tissues supplied by these affected blood vessels, and in some cases resulting in virtual terminal organ failure. . Vasculitis may also occur as a secondary lesion or sequelae of other immune inflammatory mediated diseases, such as rheumatoid arthritis, systemic sclerosis, especially those associated with immune complex formation. Diseases belonging to the primary systemic vasculitis group include: systemic necrosis vasculitis: nodular polyarteritis, allergic vasculitis and granulomatosis, multiple vasculitis; Wegener's granulomatosis; Lymphoma granulomatosis; And giant cell arteritis. Other vasculitis includes: skin mucosal lymph node syndrome (MLNS or Kawasaki's disease), isolated CNS vasculitis, Behet's disease, obstructive thrombovascular disease (Burger's disease) and skin necrosis Sexual phlebitis. Most of the pathogenic mechanisms of the listed vasculitis types are believed to be due primarily to the deposition of immunoglobulin complexes in the vessel wall and then to the induction of inflammatory responses through ADCC, complement activation, or both.

Sarcoidosis is an unknown etiology characterized by the presence of epithelial granulomatosis in almost all tissues in the body. The most common is that the lungs are involved. Pathogens involve activated macrophage and lymphoid cell persistence at the site of disease and have subsequent chronic sequelae resulting from the release of local and systemic active products released by these cell types.

Autoimmune hemolytic anemia, including autoimmune hemolytic anemia, immune pancytopenia, and paroxysmal nocturnal hematuria, is caused by the production of antibodies that react with antigens expressed on the surface of red blood cells (and in some cases other blood cells, such as platelets). The result is the removal of cells coated with these antibodies via complement mediated lysis and / or ADCC / Fc receptor mediated mechanisms.

In autoimmune thrombocytopenia, including immune mediated thrombocytopenia and thrombocytopenic purpura, with different clinical conditions, platelet destruction / removal may be caused by antibody or complement attachment to platelets followed by complement lytic action, ADCC or Fc receptor mediated mechanisms. Occurs as a result of removal.

Thyroiditis, including Graves' disease, Hasimodo thyroiditis, juvenile lymphoma thyroiditis, and atrophic thyroiditis, are the result of an autoimmune response to thyroid antigens by the production of antibodies that are present in the thyroid and often react with proteins specific to the thyroid. Experimental models include the following models: natural model-rats (BUF and BB rats) and chickens (obesity chicken strains); Immunization of Animals with Inducible Model-Tyroglobulin, Thyroid Microsomal Antigen (Thyroid Peroxidase).

Type 1 diabetes mellitus or insulin dependent diabetes is autoimmune destruction of pancreatic islet β cells, which is mediated by autoantibodies and autoreactive T cells. In addition, antibodies to insulin or insulin receptors can produce an insulin non-responsive phenotype.

Immuno-mediated kidney disease, including glomerulonephritis and tubulointerstitial nephritis, are the result of the production of autoreactive antibodies or T cells to the renal antigen, or indirectly reactive to other, non-renal antigens in the kidney and / or As a result of immune complex deposition, it is a result of antibody or T lymphocyte mediated damage to kidney tissue. Therefore, other immune mediating diseases that result in the formation of immune complexes may induce immune mediated kidney disease with indirect sequelae. Both direct and indirect immune mechanisms result in inflammatory responses that produce / induce lesion development in renal tissue resulting in impaired organ function and, in some cases, progression to renal failure. Both humoral and cellular immune mechanisms may be involved in the pathogenesis of the lesion.

The demyelinating diseases of the central and peripheral nervous system, including multiple sclerosis, idiopathic demyelinating neuritis or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuritis are autoimmune and rare oligodendrocytes or myelin It is believed to result in demyelination of the nerve as a result of damage occurring directly in the. In multiple sclerosis, there is evidence suggesting that disease induction and progression are dependent on T lymphocytes. Multiple sclerosis is a demyelination disease that is T lymphocyte dependent and has a relapsing-remitting course or a chronic progressive course. The etiology is unknown, but viral infections, genetic predisposition, environment and autoimmunity are all involved. Lesions mainly include T lymphocyte mediated, microglia and invasive macrophage infiltrates, and CD4 + T lymphocytes are the predominant cell type in the lesion. Death of oligodendrocytes and subsequent demyelinating mechanisms are unknown, but appear to be due to T lymphocytes.

Inflammatory and fibrotic lung diseases, including eosinophilic pneumonia, idiopathic pulmonary fibrosis, and irritable pneumonia, may include a dysregulated immune inflammatory response. Inhibition of such a response would be therapeutically beneficial.

Autoimmune or immunomediated skin diseases, including bullous skin disease, polymorphic erythema and contact dermatitis, are mediated by autoantibodies, the pathology of which is T lymphocyte dependent.

Psoriasis is a T lymphocyte mediated inflammatory disease. Lesions include T lymphocytes, macrophages and antigen processing cells, and some neutrophil infiltrates.

Allergic diseases including asthma, allergic rhinitis, atopic dermatitis, food intolerance, and urticaria are T lymphocyte dependent. These diseases are primarily mediated by T lymphocyte-induced inflammation, IgE mediated inflammation, or a combination of both.

Transplant-related diseases including graft rejection and graft-versus-host disease (GVHD) are T lymphocyte dependent and have been ameliorated by inhibiting T lymphocyte function.

Other diseases for which the involvement of the immune and / or inflammatory response is beneficial include viral infections (including but not limited to AIDS, A, B, C, D, E hepatitis and herpes), bacterial infections, Fungal infections, and protozoan infections and parasitic infections (molecules (or derivatives / agonists) that stimulate MLR can be used therapeutically to enhance the immune response to infectious agents), immunodeficiency diseases (MLR Stimulating molecules / derivatives / agonists enhance the immune response to genetic, acquired, infection-induced states (such as in HIV infections), or elicitative (ie, due to chemotherapy, etc.) conditions Can be used therapeutically to treat), and neoplasia and the like.

In some human cancer patients, antibodies and / or T lymphocytes against antigens on neoplastic cells have been demonstrated. In addition, it has been shown in neoplastic animal models that an increase in immune response may result in rejection or degeneration of certain neoplasms. Cancers can be treated therapeutically using molecules that enhance the T lymphocyte proliferative response in the MLR (or small molecule agonists or antibodies that affect the same receptor in the form of agonists). In addition, molecules that inhibit the lymphocyte response in MLR function in vivo during the neoplasia period, inhibiting the immune response to the neoplasm, which may be expressed by the neoplastic cell itself or in cells whose expression is different. May be induced by neoplasms in the Antagonism of such inhibitory molecules (antibodies, small molecule antagonists or other means) enhances immune mediated tumor rejection.

In addition, inhibition of molecules with pre-inflammatory properties may include reperfusion injury, stroke, myocardial infarction, atherosclerosis, acute lung injury, hemorrhagic shock, burns, sepsis / septic shock, acute coronary necrosis, endometriosis, degenerative joint disease, and pancreatitis. Can be therapeutically beneficial.

Compounds of the present invention, eg, polypeptides or antibodies, can be administered intramuscularly, intraperitoneally, intracerebrospinally, according to known methods, such as intravenous administration as concentrated mass or by continuous infusion for a period of time. ), Subcutaneous, intraarterial, intracranial, intratracal, oral, topical, or inhalation (nasal, intrapulmonary) routes to mammals, preferably humans. Intravenous or inhaled administration of polypeptides and antibodies is preferred.

In immunoadjuvant therapy, other therapeutic regimens, such as administration of anticancer agents, can be combined with the proteins, antibodies or compounds of the invention. For example, patients treated with the immunoadjuvant of the present invention may also receive anticancer agents (chemotherapy agents) or radiation therapy. Formulations and dosing schedules for such chemotherapeutic agents may be determined and used experimentally by those skilled in the art or by one skilled in the art. Formulations and dosing schedules for such chemotherapy are also described in the Chemotherapy Service, edited by M. C. Perry, Williams & Wilkins, Baltimore, MD (1992). The chemotherapeutic agent may be administered before or after the administration of the immunoadjuvant or at the same time. In addition, antiestrogens such as tamoxifen or antiprogesterone such as onapristone (see EP 616812) may be provided in known dosages.

It may also be desirable to administer antibodies to other immune disease related or tumor associated antigens, such as CD20, CD11a CD18, ErbB2, EGFR, ErbB3, ErbB4, or antibodies that bind to vascular endothelial factor (VEGF). Alternatively, or in addition, two or more antibodies that bind to the same or two or more different antigens disclosed herein may be coadministrated to the patient. In addition, it may sometimes be beneficial to administer one or more cytokines to a patient. In one embodiment, the PRO polypeptide and the growth inhibitory agent are co-administered. For example, growth inhibitors may be administered first followed by administration of the PRO polypeptide. However, simultaneous or first administration is also contemplated. Suitable dosages for growth inhibitory agents are those currently used and can be lowered by the parallel action (synergism) of the growth inhibitory agent and the PRO polypeptide.

In order to alleviate the severity or severity of an immune related disease, suitable dosages of the compounds of the invention, as defined above, include the type of disease to be treated, the severity and course of the disease, whether the agent is administered for prophylactic or therapeutic purposes Whether administered, prior therapy, the patient's clinical history and response to the compound, and the judgment of the attending physician. The compound is suitably administered to the patient at one time or through a series of treatments.

For example, depending on the type and severity of the disease, about 1 μg / kg to 15 mg / kg (eg, 0.1-20 mg / kg) of the polypeptide or antibody may be administered, for example, by one or more separate administrations. Or an initial candidate dose for administration to a patient by continuous infusion. Typical daily dosages may range from about 1 μg / kg to 100 mg / kg or more, depending on the factors mentioned above. Depending on the condition, the treatment is continued until the condition of the disease is inhibited to the desired extent for repeated periods of several days or more. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.

O. Manufacturing Supplies

In another embodiment of the present invention, an article of manufacture is provided comprising a substance (eg, a PRO molecule) useful for diagnosing or treating the disorder described above. The article of manufacture comprises a container and instructions. Suitable containers include, for example, bottles, vials, syringes, test tubes, and the like. The container may be formed from various materials such as glass or plastic. The container holds a composition effective for diagnosing or treating a condition and may have a sterile access port (eg, the container may be an intravenous solution bag or a vial with a lid perforated with a hypodermic needle) . The active agent in the composition is typically the polypeptide or antibody of the invention. Containers with or with instructions or labels indicate that the composition is to be used for the diagnosis or treatment of a selected condition. The article of manufacture may further comprise a second container comprising a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.

P. Diagnosis and Prognosis of Immune-Related Diseases

Cell surface proteins, such as proteins overexpressed in certain immune related diseases, are excellent targets for drug candidates or disease treatment. Along with secreted proteins encoded by genes amplified in immune related disease states, these proteins have additional uses in the diagnosis and prognosis of these diseases. For example, antibodies to protein products of amplified genes in multiple sclerosis, rheumatoid arthritis, or other immune related diseases can be used for diagnosis or prognosis.

For example, antibodies comprising antibody fragments can be used to qualitatively or quantitatively detect the expression of a protein encoded by an amplified or overexpressed gene ("marker gene product"). The antibody is preferably equipped with a detectable label such as, for example, a fluorescent label, and the binding can be monitored by light microscopy, flow cytometry, fluorometry, or other techniques known in the art. These techniques are particularly suitable when the overexpressed genes encode cell surface proteins. This binding assay is performed essentially as described above.

In situ detection of the antibody against the marker gene product can be performed, for example, by immunofluorescence or immunoelectron microscopy. For this purpose, a histological sample is taken from the patient and the labeled antibody is preferably applied by placing the antibody on a biological sample. In addition, the distribution of marker gene products in the tissues examined by this method can be determined. It will be apparent to those skilled in the art that a wide range of histological methods are readily available for in situ detection.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

All patents and references cited herein are hereby incorporated by reference in their entirety.

Commercial reagents mentioned in the examples were used according to the manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC accession number throughout the following examples and specification is the American Type Culture Collection (Manassas, VA). Unless stated otherwise, the present invention is described in the literature and textbooks described above (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press NY, 1989; Ausubel et al., Current Protocols in Molecular Biology, Green) Publishing Associates and Wiley Interscience, NY, 1989; Innis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press, inc., NY, 1990; Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Press Recombinant DNA as described in Cold Spring Harbor, 1988; Gait, MJ, Oligonucleotide Synthesis, IRL Press, Oxford, 1984; RI Freshney, Animal Cell Culture, 1987; Coligan et al., Current Protocols in Immunology, 1991). Standard methods of technology were used.

Example 1

Human PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769 , PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381 Isolation of cDNA Clones Encoding Polypeptides, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, and PRO5727

Various techniques were used to isolate the cDNA clones described below. The general details of the method used are described immediately following, but the details of the particular sequence isolated are referred to separately for each native sequence. The actual sequence of a PRO polypeptide is included in a clone deposited with ATCC-or encoded by the clone and when there is a difference between the deposited sequence and the sequences described herein, it is understood that the sequence of the deposit is the true sequence.

ECD homology:

The EST database was searched using an extracellular domain (ECD) sequence from about 950 known secretory proteins from the Swiss-Prot public database, including secretory signal sequences, if present . EST databases include public EST databases (e.g., Genbank), private EST databases (e.g., LIFESEQ®, Insight Pharmaceutical, Palo Alto, Calif.), And Genen Included a tech-owned EST. A search was performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequences to six frame translations of the EST sequence. Comparatives with BLAST scores of 70 (or 90 in some cases) or higher that do not encode known proteins are clustered and the program “phrap” (Phil Green, University of Washington, Seattle, USA) And assembled into consensus DNA sequence.

Consensus DNA sequences were assembled using various ESTs from both public and private databases. Oligonucleotides were then synthesized and used as probes to identify cDNA libraries containing sequences of interest by PCR and to isolate clones encoding the specific native sequence PRO polypeptides identified herein.

To screen several libraries for the source of full-length native sequence clones, DNA from these libraries was screened by PCR amplification using the PCR primer pairs identified below. Thereafter, clones encoding the specific native sequence PRO polypeptide with one of the probe oligonucleotide and primer pairs were isolated by using a positive library.

RNA for preparing cDNA library was isolated from various human tissue libraries such as fetal lung, fetal liver, fetal brain, small intestine, and smooth muscle cells. The cDNA library used to isolate cDNA clones was constructed by standard methods using commercially available reagents such as reagents from Invitrogen (San Diego, CA, USA). The cDNA is primed with oligo dT with a NotI site, ligated to the SalI hemikinase treated adapter, cleaved with NotI, appropriately sized by gel electrophoresis, and appropriate cloning vector (eg, pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; see Holmes et al., Science , 253 : 1278-1280 (1991) and cloned in a defined direction to the only XhoI and NotI sites. The clones were sequenced in a known and readily available manner.

Amylase Yeast Screening:

1. Preparation of oligo dT primed cDNA libraries

MRNA was isolated from various tissues (eg, tissues shown above for ECD homologous methods) using reagents and protocols from Invitrogen (San Diego, Calif.) (Fast Track 2). The RNA was used to generate an oligo dT primed cDNA library on vector pRK5D using reagents and protocols from Life Technologies, Gettersburg, Maryland (Super Script Plasmid System). In this process, double stranded cDNAs were made larger than 1000 bp and SalI / NotI linker attached cDNAs were cloned into XhoI / NotI cleavage vectors. pRK5D is a cloning vector comprising a sp6 transcription initiation site, a SfiI restriction enzyme site, and a XhoI / NotI cDNA cloning site in that order.

2. Preparation of Random Primed cDNA Libraries

Secondary cDNA libraries were generated to preferentially provide the 5 'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (as described above) and random priming to vector pSST-AMY.0 using the RNA using reagents and protocols from Life Technologies (Super Script Plasmid System, as described above) CDNA libraries were generated. In this process, double-stranded cDNAs were made 500-1000 bp in size, ligated to the NotI adapter to the blunt ends, cut into SfiI and cloned into the SfiI / NotI cleavage vector. pSST-AMY.0 is a cloning vector having a yeast alcohol dehydrogenase promoter before the cDNA cloning site and mouse amylase sequence (mature sequence without secretion signal) and a yeast alcohol dehydrogenase terminator after the cloning site. Thus, cDNA cloned into the vector, fused with amylase sequence in frame, will secrete amylase from the appropriately transfected yeast colonies.

3. Transformation and detection

The DNA from the library described in paragraph 2 above was ice-cooled and 20 ml of electrocompetent DH10B bacteria (Life Technologies) was added. Bacteria and vector mixtures were electroporated as directed by the manufacturer. Then 1 ml of SOC medium (Life Technologies) was added and the mixture was incubated at 37 ° C. for 30 minutes. The transformants were then plated into 20 standard 150 mm LB plates containing ampicillin and incubated for 16 hours (37 ° C.). Positive colonies were removed from the plates and DNA was isolated from bacterial pellets using standard protocols such as CsCL-gradient method. Purified DNA was used to perform the following yeast protocol.

Yeast methods were classified into three categories: 1) transforming yeast using a plasmid / cDNA combination vector, 2) detecting and isolating yeast clones secreting amylase, and 3) inserting from yeast colonies PCR amplification of the sieve directly and purification of DNA for sequencing and further analysis.

The yeast strain used was HD56-5A (ATCC-90785). This strain has genotypes of MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast variants without post-translational pathways can be used. Such variants may have deficiency alleles due to translocation at sec71, sec72, sec62, preferably at truncated sec71. Alternatively, antagonists (antisense nucleotides) that interfere with the normal functioning of the gene or interfere with the formation of other proteins involved in the post-translational pathway (e.g., SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p or SSA1p-4p) or complexes of these proteins And / or ligands) in combination with amylase expressing yeast.

Transformation was performed based on the protocol outlined in Gitz et al., Nucl.Acid.Res ., 20 : 1425 (1992). The transformed cells were then seeded from agar into 100 ml of YEPD complex media broth and grown overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics , Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). Dilute overnight cultures to about 2 x 10 ⁶ cells / ml (about OD ₆₀₀ = 0.1) with 500 ml of fresh YEPD broth and regrow to about 1 x 10 ⁷ cells / ml (about OD ₆₀₀ = 0.4-0.5) I was.

The cells were recovered, then transferred to the GS3 rotor bottle of the Sorval GS3 rotor, centrifuged at 5,000 rpm for 5 minutes, discarded, and resuspended in sterile water in a 50 ml Falcon tube at 3,500 rpm in a Beckman GS-6KR centrifuge. Transformation was prepared by centrifugation again at. The supernatant was discarded and the cells washed with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and resuspended in LiAc / TE (2.5 ml).

In a microcentrifuge tube, 100 μl of the prepared cells were mixed with fresh denatured single stranded salmon testis DNA (Lofstrand Lab, Gatorsburg, Md.) And 1 μg of transformed DNA (vol <10 μl) to perform transformation. After the mixture was briefly mixed by vortexing, 600 μl of 40% PEG / TE (40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ Ac, pH 7.5) was added. The mixture was gently mixed and incubated at 30 ° C. with stirring for 30 minutes. The cells are then heat shocked at 42 ° C. for 15 minutes, the reaction vessel is centrifuged at 12,000 rpm for 5 to 10 seconds in a microcentrifuge to drain the supernatant, and 500 μl of TE (10 mM Tris-HCl). , 1 mM EDTA, pH 7.5) and recentrifuged. Cells were diluted with 1 ml of TE and 200 μl aliquots were plated onto preselected medium in 150 mm growth plates (VWR).

Alternatively, transformation was performed in one large reaction with increasing reagent volume instead of a small number of reactions.

The selection medium used was a synthetic full dextrose without uracil prepared as described in Kaiser et al., Methods in Yeast Genetics , Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994). It was a baby (SCD-Ura). Transformants were grown at 30 ° C. for 2-3 days.

Detection of amylase secreting colonies was performed by including red starch in the selective growth medium. Starch was coupled with a red dye (reactive Red-120, Sigma) according to the method as described in Biely et al., Anal. Biochem. , 172 : 176-179 (1988). The coupled starch was added to the SCD-Ura agar plate at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM).

Positive colonies were selected and streaked on fresh selection medium (on 150 mm plates) to obtain well isolated and identifiable single colonies. Red starch was added directly to the buffered SCD-Ura agar to detect well isolated single colonies that were amylase secretion positive. Positive colonies were determined by starch degradability (which produces a clear halo visible to the naked eye directly around the colonies).

Isolation and sequencing by standard techniques identified yeast EST fragments to be used as the basis for additional databases as described below.

4. Assemble

Various expression sequence tag (EST) databases were searched using the yeast EST fragments identified above. The EST database includes public databases (e.g., Genbank, Merck / Wash U) and private databases (LIFESEQ®, Insight Pharmaceutical, Palo Alto, CA). Included. A search was performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequences to six frame translations of the EST sequence. Comparatives with BLAST scores of 70 (or in some cases 90) or higher that do not encode known proteins are clustered and used as a consensus DNA sequence using the program “phrap” (Philgreen, University of Washington, Seattle, USA). Assembled.

Consensus DNA sequences were assembled for other EST sequences using phrap. This consensus sequence was stretched using repeated cycles of BLAST and phrap to stretch the consensus sequence as far as possible using the consensus DNA sequence as discussed above using the source of EST sequences discussed above and Genentech's proprietary EST sequence.

Oligonucleotides were synthesized based on the consensus sequence and used as 1) to identify cDNA libraries containing sequences of interest by PCR and 2) as probes to isolate clones encoding specific PRO polypeptides. To screen several libraries for full-length clones, DNA from these libraries was screened by PCR amplification using PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology . Then, clones encoding genes of interest were isolated using one of the probe oligonucleotide and primer pairs by using a positive library.

RNA for preparing cDNA libraries was isolated from various human tissue libraries. The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents such as reagents from Invitrogen (San Diego, CA, USA). The cDNA is primed with oligo dT with a NotI site, ligated to the SalI hemikinase treated adapter, cleaved with NotI, appropriately sized by gel electrophoresis, and appropriate cloning vector (eg, pRKB or pRKD; pRK5B is a precursor of pRK5D without the SfiI site; see Holmeset al., Science , 253 : 1278-1280 (1991)) and cloned in a defined direction to the only XhoI and NotI sites.

Signal algorithm:

Clustered and assembled EST fragments and expression sequence tags (EST) from public (eg, Genbank) and / or private (LIFESEQ®, Insight Pharmaceuticals, Palo Alto, CA, USA) databases We used a proprietary signal sequence search algorithm developed by Genentech, Inc. (South San Francisco, CA). The signal sequence algorithm calculated secretion signal scores based on the properties of the DNA nucleotides around the first and, optionally, second, methionine codon (s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must encode at least 35 distinct amino acids without any stop codons. If the first ATG had the required amino acid, the second ATG was not investigated. If this requirement was not met, the candidate sequences were not scored. To determine whether the EST sequence contained a clear signal sequence, a set of seven sensors (evaluation parameters) known to be associated with the secretion signal were used to score corresponding amino acid sequences around this DNA and ATG codons.

In this manner various expression sequence tag (EST) data, such as public EST databases (e.g., Genbank) and private EST DNA databases (LIFESEQ®, Insight Pharmaceuticals, Palo Alto, Calif.) The EST sequence compared to the base was identified. Homologous searches were performed using the computer programs BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparatives with BLAST scores of 70 (or in some cases 90) or higher that do not encode known proteins are clustered and used as a consensus DNA sequence using the program “phrap” (Philgreen, University of Washington, Seattle, USA). Assembled. This identified additional EST sequences that would correspond to the full-length clones to be investigated and sequenced or serve as templates for cloning oligonucleotide production and used for the screening of multiple tissue libraries to be used for the isolation of DNA encoding native sequence PRO polypeptides. .

A. Isolation of cDNA Clone Encoding Human PRO200 (UNQ174)

CDNA libraries derived from human glioma cell line G61 were screened using probes based on expression sequence tags (EST) identified from Insight Pharmacological database due to homology with VEGF. Screening can be performed in a manner similar to the methods described elsewhere herein. In particular, the following four probes were generated using the insight clone “INC1302516”.

5'-ACTTCTCAGTGTCCATAAGGG-3 '(SEQ ID NO: 3)

5'-GAACTAAAGAGAACCGATACCATTTTCTGGCCAGGTTGTC-3 '(SEQ ID NO: 4)

5'-CACCACAGCGTTTAACCAGG-3 '(SEQ ID NO: 5)

5'-ACAACAGGCACAGTTCCCAC-3 '(SEQ ID NO: 6)

Nine positives were identified and characterized. Three clones contained the complete coding region and were identical in sequence. In addition, partial clones were identified from the fetal lung library, and they were identical to sequences derived from glycoma except for one nucleotide change that did not modify the amino acid to be encoded.

For mammalian protein expression, the entire open reading frame (ORF) was cloned into a CMV-based expression vector. Epitope-tags (FLAG, Kodak) and histidine-tags (His8) were inserted between the ORF and stop codons. UNQ174-His8 and UNQ174-FLAG were transfected into human embryonic kidney 293 cells by SuperFect (Qiagen) and pulsed labeled with [ ³⁵ S] methionine and [ ³⁵ C] cysteine for 3 hours. (pelse-label). When 20 μl of serum-free conditioned medium of 15-fold concentration was electrophoresed on polyacrylamide gel (Novex) in sodium dodecyl sulfate sample buffer (SDS-PAGE), epitope tagged proteins were moved together. did. The UNF174-IgG expression plasmid was constructed by cloning the ORF before the human Fc (IgG) sequence.

Hinq supplemented with 10% fetal bovine serum with UNQ174-IgG plasmid with baculogold Baculovirus DNA (Pharmingen) using Lipofectin (GibcoBRL) Hink's) were transfected with 10 ⁵ Sf9 cells cultured in TNM-FH medium (JRH Biosciences). Cells were incubated at 28 ° C. for 5 days. After harvesting the supernatants, Sf9 cells were infected at approximately multiplicity of infection (MOI) 10 and used for first virus amplification. After incubating the cells for 3 days, the supernatant was harvested and 1 ml of this supernatant was bound to 30 μl of Protein-A (Protein-A) Sepharose CL-4B beads (Pharmacia), followed by SDS. -PAGE was analyzed to determine the expression rate of the recombinant plasmid. The first amplified supernatant was used to infect 500 ml spin cultures of Sf9 cells cultured in ESF-921 medium (Expression Systems LLC) with about 0.1 MOI. Cells were treated as above, but the harvested conflict was sterile filtered. Certain proteins were purified by binding to a Protein-A Sepharose 4 Fast Flow (Pharmacia) column.

The entire nucleotide sequence of the identified clone DNA29101 is shown in FIG. 1 (SEQ ID NO: 1). As indicated by the bold underline, clone DNA29101 (SEQ ID NO: 1) has a clear translation initiation site at nucleotide residues 285-287 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 1320-1322 (FIG. 1). , SEQ ID NO: 1). The predicted PRO200 polypeptide precursor (ie UNQ174, SEQ ID NO: 2) is 345 amino acids long, the calculated molecular weight is 39029 daltons and the pi is 6.06, which is shown in FIG. 2 (SEQ ID NO: 2). Potential N-glycosylation sites are amino acid residues 25, 54 and 254. CUB domains are amino acid residues 52-65, 118-125 and 260-273.

CDNA comprising DNA encoding UNQ174 (SEQ ID NO: 2) was deposited with the ATCC on March 5, 1998 and assigned Accession No. 209653.

B. Isolation of cDNA Clone Encoding Human PRO204 (UNQ178)

EST was confirmed by searching the Expression Sequence Tag (EST) DNA database (LIFESEQ®, Insight Pharmaceutical, Palo Alto, CA). Retinal cDNA libraries of human fetuses were screened with oligonucleotide primers to confirm hybridization with synthetic oligonucleotide probes based on EST sequences.

Hybridization Probes :

5'-GGCATGCAGCAGCTGGACATTTGCGAGGGCTTTTGCTGGCTG-3 '(SEQ ID NO: 7)

Omnidirectional PCR primers :

5'-CTGCTGCAGAGTTGCACGAAC-3 '(SEQ ID NO: 8)

Reverse PCR Primer 1 :

5'-CAGTTGTTGTTGTCACAGAGAAG-3 '(SEQ ID NO: 9)

Reverse PCR Primer 2 :

5'-AGTTCGTGCAACTCTGCAGCAG-3 '(SEQ ID NO: 10)

cDNA clones were identified and sequenced in their entirety. The entire nucleotide sequence of the identified clone DNA30871 is shown in Figure 3 (SEQ ID NO: 11). As indicated by the bold underline, clone DNA30871-1157 (SEQ ID NO: 11) has a clear translation initiation site at nucleotide positions 376-378 and comprises a single open reading frame ending at the stop codon (TAA) at nucleotide positions 1498-1500 ( 3, SEQ ID NO: 11). The predicted PRO204 polypeptide precursor (ie UNQ178, SEQ ID NO: 12) is 374 amino acids in length, the calculated molecular weight is 39,285 daltons and the pi is 6.06, which is shown in FIG. 4. CDNA comprising DNA encoding UNQ178 (SEQ ID NO: 12) was deposited with the ATCC on October 16, 1997 and assigned Accession No. 209380.

C. Isolation of cDNA Clones Coding Human PRO212 (UNQ186)

The full length DNA sequence for DNA30942 (FIG. 5, SEQ ID NO: 13) and the protein sequence UNQ186 derived therefrom were identified using the ECD homologous method described above from the lung library of the human fetus.

PCR primers (forward and reverse) and probes used in this method were as follows:

Forward primer : 5'-CACGCTGGTTTCTGCTTGGAG-3 '(SEQ ID NO: 15)

Reverse primer : 5'-AGCTGGTGCACAGGGTGTCATG-3 '(SEQ ID NO: 16)

Hybridization Probe : (SEQ ID NO: 17)

5'-CCCAGGCACCTTCTCAGCCAGCCAGCAGCTCCAGCTCAGAGCAGTGCCAGCCC-3 '

The full nucleotide sequence of DNA30942 is shown in FIG. 5 (SEQ ID NO: 13). As shown in bold, the clone DNA30942 (SEQ ID NO: 13) has a clear translation initiation site at nucleotide positions 101-103 and comprises a single open reading frame terminating at the stop codon (TGA) at positions 1001-1003 (FIG. 5, SEQ ID NO: 13). The predicted PRO212 polypeptide precursor is 300 amino acids in length, the calculated molecular weight is 32680 daltons and the pi is 8.70, which is shown in FIG. 6 (SEQ ID NO: 14). The PRO212 sequence in FIG. 6 (SEQ ID NO: 14) is believed to lack a transmembrane domain. In addition, amino acids 1 to 215 in FIG. 6 (SEQ ID NO: 14) are believed to contain four cysteine rich domains (CDRs). CDNA clone (identified as DNA30942-1134) containing DNA30942 (SEQ ID NO: 13) was deposited with the ATCC on 16 September 1997 Assigned to ATCC accession number 209254.

D. Isolation of cDNA Clones Coding Human PRO216 (UNQ190)

Using a method similar to the above used for the isolation of PRO212, DNA33087 (SEQ ID NO: 18) (FIG. 7) encoding the PRO216 polypeptide UNQ190 (SEQ ID NO: 19) (FIG. 8) can be isolated.

As indicated by the bold underline, DNA33087 has a clear translation initiation site at nucleotide residues 268-270 and comprises a single open reading frame ending at the stop codon (TAG) of residues 1531-1533 (FIG. 7, SEQ ID NO: 18). The predicted PRO215 polypeptide precursor (ie UNQ190, SEQ ID NO: 19) is 421 amino acids in length, the calculated molecular weight is 49492 daltons and the pi is 5.51 (FIG. 8).

Hydropathy analysis revealed signal sequences at amino acid residues 1-20, tyrosine kinase phosphorylation sites at amino acid residues 268-274 and 300-306, and N-myristoylation sites at residues 230-235, and residues 146-167. And leucine zippers at 217-238. In addition to traditional isolation methods, the DNA sequence is also publicly available from Genbank as Accession No. AB000114, encoding Dayhoff protein AB000114_1.

The sequence is also described in Ohno et al., Biochem. Biophys. Res. Commun. 228 (2): 411-414 (1996). A cDNA clone (identified as DNA33087-1158) containing DNA33087 was deposited with the American Type Culture Collection (ATCC) on September 16, 1997 to be assigned ATCC Accession No. 209381.

E. Isolation of cDNA Clones Coding Human PRO226 (UNQ200)

The full-length DNA sequence for DNA33460 (FIG. 9, SEQ ID NO: 20) and the native sequence protein UNQ200 derived therefrom (SEQ ID NO: 21) were identified from the lung library of the human fetus using the ECD homologous method described above.

As indicated by the bold underline, DNA33460 has a clear translation initiation site at nucleotide residues 62-64 and comprises a single open reading frame ending at the stop codon (TGA) of residues 1391-1393 (FIG. 9, SEQ ID NO: 20). The predicted PRO226 polypeptide precursor (ie UNQ200, SEQ ID NO: 21) is 443 amino acids in length, the calculated molecular weight is 49,391 Daltons and the pi is 4.82, which is shown as UNQ200 (SEQ ID NO: 21) in FIG. 10. A cDNA clone encoding DNA33460 (SEQ ID NO: 20), referred to as DNA33460-1166, was deposited with the ATCC on October 16, 1997 to be assigned ATCC Accession No. 209376.

The oligonucleotide sequence used in the method was as follows:

28722.p (OLI488) (SEQ ID NO: 22)

5'-TGTGTGGACATAGACGAGTGCCGCTACCGCTACTGCCAGCACCGC-3 '

28722.f (OLI489) (SEQ ID NO: 23)

5'-AGGACTGCCATAACTTGCCTG-3 '

28722.r (OLI490) (SEQ ID NO: 24)

5'-ATAGGAGTTGAAGCAGCGCTGC-3 '

F. Isolation of cDNA Clones Coding Human PRO240 (UNQ214)

The full length DNA sequence for DNA34387 (FIG. 11, SEQ ID NO: 11) and the native sequence protein UNQ214 (SEQ ID NO: 26) derived from the human fetal lung library were isolated using the ECD homologous method described above.

The total nucleotide sequence of DNA34387 is shown in FIG. 11 (SEQ ID NO: 25). As shown in bold, clone DNA34387 has a clear translation initiation site at nucleotide positions 12-14 and comprises a single open reading frame ending at the stop codon (TGA) at nucleotide positions 699-701 (FIG. 11, SEQ ID NO: 25) . The predicted PRO240 polypeptide precursor (ie UNQ214, SEQ ID NO: 26) is 229 amino acids in length, the calculated molecular weight is 24,689 Daltons and the pi is 7.83, which is shown in FIG. 12. CDNA comprising DNA34387 (SEQ ID NO: 25) was deposited with the ATCC on September 16, 1997 and was assigned ATCC Accession No. 209260.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the methods described above were as follows:

Omnidirectional PCR primer: 5'-TCAGCTCCAGACTCTGATACTGCC-3 '(SEQ ID NO: 27)

Reverse PCR Primer: 5'-TGCCTTTCTAGGAGGCAGAGCTCC-3 '(SEQ ID NO: 28)

Hybridization Probe: (SEQ ID NO : 29)

5'-GGACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAG-3 '

G. Isolation of cDNA Clones Coding Human PRO235 (UNQ209)

The full length DNA sequence for DNA35558 (FIG. 13, SEQ ID NO: 13) and the derived PRO235 native sequence protein UNQ209 (FIG. 14, SEQ ID NO: 31) were isolated from the lung library of the human fetus using the ECD homologous method described above.

The total nucleotide sequence of DNA35558 is shown in FIG. 13 (SEQ ID NO: 30). As shown in bold, the DNA35558 clone shown in FIG. 13 has a clear translation initiation site at nucleotide residues 667-669 and includes a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 2323-2325. The predicted PRO235 polypeptide precursor (ie UNQ209, SEQ ID NO: 31) is 552 amino acids in length, the calculated molecular weight is 61,674 daltons and the pi is 6.95 (FIG. 14). A cDNA clone containing DNA35558 was deposited with the ATCC on October 16, 1997 to be assigned ATCC Accession No. 209374.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the methods described above were as follows:

Omnidirectional PCR primer: 5'-TGGAATACCGCCTCCTGCAG-3 '(SEQ ID NO: 32)

Reverse PCR primers: 5'-CTTCTGCCCTTTGGAGAAGATGGC-3 '(SEQ ID NO: 33)

Hybridization Probe:

5'-GGACTCACTGGCCCAGGCCTTCAATATCACCAGCCAGGACGAT-3 '(SEQ ID NO: 34)

Isolation of cDNA clones encoding human PRO245 (UNQ219)

The full length DNA sequence for DNA35658 (FIG. 15, SEQ ID NO: 35) and the PRO245 native sequence protein UNQ219 (FIG. 16, SEQ ID NO: 36) derived from the human fetal lung library were isolated using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the methods described above were as follows:

Omnidirectional PCR primer 5'-ATCGTTGTGAAGTTAGTGCCCC-3 '(SEQ ID NO: 37)

Reverse PCR primer 5'-ACCTGCGATATCCAACAGAATTG-3 '(SEQ ID NO: 38)

Hybridization Probe (SEQ ID NO: 39)

5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3 '

The total nucleotide sequence of DNA35638 (SEQ ID NO: 35) is shown in FIG. 15. Clone DNA35638 has a clear translation initiation site at nucleotide positions 89-91 and comprises a single open reading frame ending at the stop codon (TAG) at nucleotide positions 1025-1027 (FIG. 15, SEQ ID NO: 35). The predicted PRO245 polypeptide precursor (ie UNQ219, SEQ ID NO: 36) is 312 amino acids in length, the calculated molecular weight is 34,554 Daltons and the pi is 9.39 (FIG. 36). A clone comprising DNA35638 (SEQ ID NO: 35) (called DNA35638-1141) was deposited with the ATCC on September 16, 1997 to be assigned ATCC Accession No. 209265.

I. Isolation of cDNA Clones Coding Human PRO172 (UNQ146)

The full-length DNA sequence for DNA35916 (FIG. 17, SEQ ID NO: 40) and the derived PRO172 native sequence protein UNQ146 (FIG. 18, SEQ ID NO: 41) were isolated from the kidney library of the human fetus using the ECD homologous method described above.

As shown in bold in FIG. 17, clone DNA35916 (SEQ ID NO: 40) has a clear translation initiation site at nucleotide positions 38-40 and comprises a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 2207-2209. . The predicted PRO172 polypeptide precursor (ie UNQ146, SEQ ID NO: 41) is 723 amino acids in length, the calculated molecular weight is 78,055 Daltons and the pi is 6.17 (Figure 18). A cDNA clone (called DNA35916-1161) comprising DNA35916 (SEQ ID NO: 40) was deposited with the ATCC on October 28, 1997 to be assigned ATCC Accession No. 209419.

The oligonucleotide sequence used in this method was as follows:

28765.p (OLI633)

5'-AAATCTGTGAATTGAGTGCCATGGACCTGTTGCGGACGGCCCTTGCTT-3 '(SEQ ID NO: 42)

28765.f (OLI644)

5'-GGATCTCGAGAACAGCTACTCC-3 '(SEQ ID NO: 43)

28765.r (OLI645)

5'-TCGTCCACGTTGTCGTCACATG-3 '(SEQ ID NO: 44)

J. Isolation of cDNA Clones Coding Human PRO273 (UNQ240)

The full-length DNA sequence for DNA39523 (FIG. 19, SEQ ID NO: 45) and the PRO273 native sequence protein UNQ240 derived therefrom were isolated from the kidney library of the human fetus using the ECD homologous method described above.

Synthesized PCR primers (forward and reverse) and hybridization probes were as follows:

Omnidirectional PCR primers:5'-CAGCGCCCTCCCCATGTCCCTG-3 ' (SEQ ID NO: 47)

Reverse PCR Primer:5'-TCCCAACTGGTTTGGAGTTTTCCC-3 ' (SEQ ID NO: 48)

Hybridization Probe:

5'-CTCCGGTCAGCATGAGGCTCCTGGCGGCCGCTGCTCCTGCTGCTG-3 '(SEQ ID NO: 49)

As indicated by the bold underline, clone DNA39523 (SEQ ID NO: 45) has a clear translation initiation site at nucleotide positions 167-169 and includes a single open reading frame terminating at a stop codon (TAG) at nucleotide positions 500-502 (FIG. 19). ). The predicted PRO273 polypeptide precursor (ie UNQ240, SEQ ID NO: 46) is 111 amino acids long, calculated molecular weight is 13,078 daltons, and pi is 10.37 (FIG. 20). A cDNA clone comprising DNA39523 (SEQ ID NO: 45) was deposited with the ATCC on October 31, 1997 to be assigned ATCC Accession No. 209424.

Isolation of cDNA Clones Coding K. Human PRO272 (UNQ239)

Full length DNA sequence for DNA40620 (FIG. 21, SEQ ID NO: 50) and derived therefrom from lung tissue of human fetuses using the above described ECD homologous method and in vivo cloning method using one of the probe oligonucleotide and primer pairs PRO272 native sequence protein UNQ239 (SEQ ID NO: 51) was isolated.

The forward and reverse PCR primers and hybridization probes used for the isolation of PRO272 encoding DNA sequences were as follows:

Omnidirectional PCR primer (.f1): 5'-CGCAGGCCCTCATGGCCAGG-3 '(SEQ ID NO: 52)

Omnidirectional PCR primer (.f2): 5'-GAAATCCTGGGTAATTGG-3 '(SEQ ID NO: 53)

Reverse PCR primers: 5'-GTGCGCGGTGCTCACAGCTCATC-3 '(SEQ ID NO: 54)

Hybridization Probe:

5'-CCCCCCTGAGCGACGCTCCCCCATGATGACGCCCACGGGAACTTC-3 '(SEQ ID NO: 55)

As shown in bold, the clone DNA40620 (SEQ ID NO: 50) has a clear translation initiation site at nucleotide positions 35-37 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1020-1022 (FIG. 21). ). The predicted polypeptide precursor is 328 amino acids long (FIG. 22), the calculated molecular weight is 37,493 Daltons, and the pi is 4.77. A cDNA clone comprising DNA40620 (SEQ ID NO: 50) was deposited with the ATCC on October 17, 1997 to be assigned ATCC Accession No. 209388.

Isolation of cDNA clones encoding L. PRO332 (UNQ293)

The full-length DNA sequence for DNA40982 (FIG. 23, SEQ ID NO: 56) and the PRO332 native sequence protein UNQ293 derived therefrom were isolated from the lung library of the human fetus using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the method were as follows:

5'-GCATTGGCCGCGAGACTTTGCC-3 '(SEQ ID NO: 58)

5'-GCGGCCACGGTCCTTGGAAATG-3 '(SEQ ID NO: 59)

5'-TGGAGGAGCTCAACCTCAGCTACAACCGCATCACCAGCCCACAGG-3 '(SEQ ID NO: 60)

The total nucleotide sequence of DNA40982 (SEQ ID NO: 56) is shown in FIG. 23. As shown in bold underline in FIG. 23, clone DNA40982 (SEQ ID NO: 56) has a clear translation initiation site at nucleotide positions 342-344 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 2268-2270. . The predicted PRO332 polypeptide precursor (ie UNQ293, SEQ ID NO: 57, FIG. 24) is 642 amino acids in length, calculated molecular weight is 72,067 and pi is 6.60. A cDNA clone (called DNA40982-1235) containing DNA40982 (SEQ ID NO: 56) was deposited with the ATCC on November 7, 1997 to be assigned ATCC Accession No. 209433.

Isolation of cDNA Clones Coding M. Human PRO526 (UNQ330)

The full length DNA sequence DNA44184 (FIG. 25, SEQ ID NO: 61) and the PRO526 native sequence protein UNQ330 (FIG. 26, SEQ ID NO: 62) derived therefrom were isolated from the lung library of the human fetus using the ECD homologous method described above.

Synthesized PCR primers (forward and reverse) and hybridization probes were as follows:

Omnidirectional PCR primer : 5'-TGGCTGCCCTGCAGTACCTCTACC-3 '(SEQ ID NO: 63)

Reverse PCR primers : 5'-CCCTGCAGGTCATTGGCAGCTAGG-3 '(SEQ ID NO: 64)

Hybridization Probe : (SEQ ID NO: 65)

5'-AGGCACTGCCTGATGACACCTTCCGCGACCTGGGCAACCTCACAC-3 '.

As shown in bold, the clone DNA44184 (SEQ ID NO: 61) has a clear translation initiation site at nucleotide positions 514-516 and includes a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1933-1935 (FIG. 61). ). The predicted PRO526 polypeptide precursor (ie UNQ330, SEQ ID NO: 62) is 473 amino acids in length (FIG. 62). The estimated molecular weight of the UNQ330 (SEQ ID NO: 62) protein shown in FIG. 62 is about 50708 Daltons and the pi is about 9.28. A cDNA clone (called DNA44184-1319) containing DNA44184 was deposited with the ATCC on March 26, 1998 and assigned Accession No. 209704.

UNQ330 (SEQ ID NO: 62) was analyzed and found that the signal peptide sequence is at amino acids about 1-26. The leucine zipper pattern was at about 135-156 amino acids. The glycosaminoglycan attachment site was amino acids about 436-439. N-glycosylation sites were amino acids about 82-85, 179-182, 237-240 and 423-426. Form C von Willebrand factor (VWF) domain (s) was found at amino acids about 411-425. One skilled in the art can understand which nucleotides correspond to these amino acids based on the sequences provided herein.

Isolation of cDNA clones coding for human PRO701 (UNQ365)

The full-length DNA sequence DNA44205 (FIG. 27, SEQ ID NO: 27) and the PRO526 native sequence protein UNQ365 derived therefrom were identified using the ECD homologous method described above from the lung library of human fetuses (FIG. 28, SEQ ID NO: 67).

PCR primers (forward and reverse) and hybridization probes synthesized for use in the method were as follows:

5'-GGCAAGCTACGGAAACGTCATCGTG-3 '(SEQ ID NO: 68)

5'-AACCCCCGAGCCAAAAGATGGTCAC-3 '(SEQ ID NO: 69)

5'-GTACCGGTGACCAGGCAGCAAAAGGCAACTATGGGCTCCTGGATCAG-3 '(SEQ ID NO: 70)

As shown in bold underline in FIG. 27, clone DNA44205 (SEQ ID NO: 66) has a clear translation initiation site at nucleotide positions 50-52 and comprises a single open reading frame terminating at a stop codon (TAG) at nucleotide positions 2498-3000. . The predicted PRO701 polypeptide precursor (ie, FIG. 28, UNQ365, SEQ ID NO: 67) is 816 amino acids long and the calculated molecular weight is 91,794 Daltons (pI: 5.88). A cDNA clone (called DNA44205-1285) containing DNA44205 (SEQ ID NO: 66) was deposited with the ATCC on March 31, 1998 to be assigned ATCC Accession No. 209720.

UNQ365 (SEQ ID NO: 67) includes a potential signal peptide cleavage site at amino acid position about 25. There are potential N-glycosylation sites at amino acid positions about 83, 511, 716 and 803. The Form B-carboxyesterase signature 2 sequence is at residues about 125-135. In addition, homologous regions with Form B-carboxyesterases are at residues about 54-74, 197-212, and 221-261. The potential transmembrane region corresponds approximately to amino acids 671 to about 700. Corresponding nucleic acids can generally be determined from the sequences provided herein.

O. Isolation of cDNA Clones Coding Human PRO361 (UNQ316)

Full length DNA sequence DNA45410 (FIG. 29, SEQ ID NO: 71) and derived therefrom using the ECD homologous method described above, and an in vivo cloning method using one of probe oligonucleotide and primer pairs from a human fetal kidney library PRO361 native sequence protein UNQ316 (FIG. 30, SEQ ID NO: 72) was identified.

Forward and reverse PCR primers and hybridization probes for use in the methods described above were synthesized as follows.

Omnidirectional PCR primer (.f1):

5'-AGGGAGGATTATCCTTGACCTTTGAAGACC-3 '(SEQ ID NO: 73)

Omnidirectional PCR primer (.f2):

5'-GAAGCAAGTGCCCAGCTC-3 '(SEQ ID NO: 74)

Omnidirectional PCR primer (.f3): 5'-CGGGTCCCTGCTCTTTGG-3 '(SEQ ID NO: 75)

Reverse PCR Primer (.r1): 5'-CACCGTAGCTGGGAGCGCACTCAC-3 '(SEQ ID NO: 76)

Reverse PCR primer (.r2): 5'-AGTGTAAGTCAAGCTCCC-3 '(SEQ ID NO: 77)

Hybridization Probes :

5'- GCTTCCTGACACTAAGGCTGTCTGCTAGTCAGAATTGCCTCAAAAAGAG-3 '(SEQ ID NO: 78)

As indicated by the bold underline, clone DNA45410 (SEQ ID NO: 71) has a clear translation initiation site at nucleotide positions 226-228 and comprises a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1519-1521 (FIG. 29). ). The predicted PRO361 polypeptide precursor (ie UNQ316, SEQ ID NO: 72) is 431 amino acids long (FIG. 30). The estimated molecular weight of the native sequence PRO361 protein, represented as UNQ316 in FIG. 30, is about 46810 and the pi is about 6.45. In addition, the region representing the Arginase family proteins is present at residues F3 to V14 and also at I39 to T57, while the transmembrane domain is at residues about P380 to S409. A cDNA clone comprising DNA45410 (SEQ ID NO: 71) was deposited with the ATCC on February 5, 1998 to be assigned ATCC Accession No. 209621.

Isolation of cDNA clones encoding P. human PRO362 (UNQ317)

The full length DNA sequence DNA45416 (FIG. 31, SEQ ID NO: 31) and the PRO362 native sequence protein UNQ317 (FIG. 32, SEQ ID NO: 80) derived therefrom were isolated from the brain library of the human fetus using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the method were as follows:

Omnidirectional PCR primer 1 : 5'-TATCCCTCCAATTGAGCACCCTGG-3 '(SEQ ID NO: 81)

Omnidirectional PCR Primer 2 : 5'-GTCGGAAGACATCCCAACAAG-3 '(SEQ ID NO: 82)

Reverse PCR primer 1 : 5'-CTTCACAATGTCGCTGTGCTGCTC-3 '(SEQ ID NO: 83)

Reverse PCR primer 2 : 5'-AGCCAAATCCAGCAGCTGGCTTAC-3 '(SEQ ID NO: 84)

Hybridization Probes :

5'-TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3 '(SEQ ID NO: 85)

As shown in bold, the clone DNA45416 (SEQ ID NO: 79) has a clear translation initiation site at nucleotide positions 119-121 and comprises a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1082-1084 (FIG. 31). ). The predicted PRO362 polypeptide precursor (ie UNQ317, SEQ ID NO: 80) is 321 amino acids long (Figure 32). The estimated molecular weight of the UNQ317 protein (SEQ ID NO: 80) shown in FIG. 32 is about 35,544 daltons and the pi is about 8.51. As shown in FIG. 32, the UNQ317 polypeptide was analyzed to demonstrate the presence of a glycosaminoglycan attachment site at amino acids about 149 to about 152 and the transmembrane domain at amino acids about 276 to about 306. A cDNA clone comprising DNA45416 (SEQ ID NO: 79) was deposited with the ATCC on February 5, 1998 to be assigned ATCC Accession No. 209620.

Q. Isolation of cDNA Clones Coding Human PRO363 (UNQ318)

The full-length DNA sequence DNA45419 (FIG. 33, SEQ ID NO: 33) and the PRO363 native sequence protein UNQ318 derived therefrom were isolated from the kidney library of the human fetus using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the method were as follows:

Omnidirectional PCR primers :

5'-CCAGTGCACAGCAGGCAACGAAGC-3 '(SEQ ID NO: 88)

Reverse PCR Primer :

5'-ACTAGGCTGTATGCCTGGGTGGGC-3 '(SEQ ID NO: 89)

Hybridization Probes :

5'-GTATGTACAAAGCATCGGCATGGTTGCAGGAGCAGTGACAGGC-3 '(SEQ ID NO: 90)

As indicated by the bold underline, clone DNA45419 (SEQ ID NO: 86) has a clear translation initiation site at nucleotide positions 190-192 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1309-1311 (FIG. 33). ). The predicted PRO363 polypeptide precursor (ie UNQ318, SEQ ID NO: 87) is 373 amino acids long (Figure 34). The estimated molecular weight of the UNQ318 protein (SEQ ID NO: 87) shown in FIG. 34 is about 41,281 Daltons and the pi is about 8.33. The UNQ318 polypeptide was analyzed as shown in FIG. 34 to demonstrate that the transmembrane domain is at amino acid residues about 221 to about 254. A cDNA clone containing DNA45419 (SEQ ID NO: 86) was deposited with the ATCC on February 5, 1998 to be assigned ATCC Accession No. 209616.

R. Isolation of cDNA Clones Coding Human PRO364 (UNQ319)

The expression sequence tag (EST) (Insert EST 3003460) encoding polypeptides homologous to members of the tumor necrosis factor receptor (TNFR) polypeptide family was identified using the ECD homologous method described above from the human small intestine library.

The consensus DNA sequence was then assembled for Insight 3003460 EST in a manner similar to that used in the ECD homologous method to produce the full length DNA sequence DNA47365 (FIG. 35, SEQ ID NO: 91) and the derived PRO364 native sequence protein UNQ319 (FIG. 36, sequence). 92) was isolated.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the screening method described above were as follows:

Omnidirectional PCR primer (44825.f1) : 5'-CACAGCACGGGGCGATGGG-3 '(SEQ ID NO: 93)

Omnidirectional PCR primer (44825.f2) : 5'-GCTCTGCGTTCTGCTCTG-3 '(SEQ ID NO: 94)

Omnidirectional PCR primer (44825.GITR.f) :

5'-GGCACAGCACGGGGCGATGGGCGCGTTT-3 '(SEQ ID NO: 95)

Reverse PCR primer (44825.r1) : 5'-CTGGTCACTGCCACCTTCCTGCAC-3 '(SEQ ID NO: 96)

Reverse PCR primer (44825.r2) : 5'-CGCTGACCCAGGCTGAG-3 '(SEQ ID NO: 97)

Reverse PCR Primer (44825.GITR.r) :

5'-GAAGGTCCCCGAGGCACAGTCGATACA-3 '(SEQ ID NO: 98)

Hybridization Probe (44825.p1) :

5'-GAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGC-3 '(SEQ ID NO: 99)

Hybridization Probe (44825.GITR.p) :

5'-AGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCC-3 '(SEQ ID NO: 100)

As indicated by the bold underline, clone DNA47365 (SEQ ID NO: 91) has a clear translation initiation site at nucleotide positions 121-123 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 844-846 (FIG. 35). ). The predicted PRO364 polypeptide precursor (ie UNQ319, SEQ ID NO: 92) is 241 amino acids long (FIG. 36). The estimated molecular weight of the UNQ319 (SEQ ID NO: 92) protein shown in FIG. 36 is about 26,000 Daltons and the pI is about 6.34. The potential N-glycosylation site of the amino acid sequence shown in FIG. 36 is between amino acids 146 and 149. The putative signal sequence of the sequence shown in FIG. 36 is at amino acids 1-25 and the potential transmembrane domain is between amino acids 162-180. A cDNA clone comprising DNA47365 (referred to as DNA47365-1206) was deposited with the ATCC on November 7, 1997 to be assigned the ATCC accession number ATCC 209436.

Isolation of cDNA Clones Encoding S. Human PRO356 (UNQ313) (NL4)

An expression sequence tag (EST) DNA database (LIFESEQ®, Insight Pharmaceutical, Palo Alto, Calif.) Was searched for EST (# 2939340) showing homology to human TIE-2 L1 and TIE-2 L2. ) Was confirmed.

Based on the EST, a pair of PCR primers (forward and reverse) and hybridization probes were synthesized as follows:

NL4,5-1 : 5'-TTCAGCACCAAGGACAAGGACAATGACAACT-3 '(SEQ ID NO: 103)

NL4,3-1 : 5'-TGTGCACACTTGTCCAAGCAGTTGTCATTGTC-3 '(SEQ ID NO: 104)

NL4,3-3 : 5'-GTAGTACACTCCATTGAGGTTGG-3 '(SEQ ID NO: 105).

CloneTech, Inc., Palo Alto, CA, using Life Technologies reagents and protocols (Super Script Plasmid System), Gettersburg, Maryland, USA. Uterine mRNA (Cat. No. 6537-1) purchased from (Clontech, INC) was used to prepare oligo dT primed cDNA library in vector pRK5D. PRK5D was prepared by sp6 transcription initiation site, SfiI restriction enzyme site, XhoI / NotI cDNA. A cloning vector comprising the cloning sites in sequence, cDNA primed with oligo dT with a NotI site, ligated to SalI hemikinase treated adapters, cleaved with NotI, and gel electrophoresis to be greater than 1000 bp It was appropriately classified according to size and cloned in the direction determined for pRK5D digested with XhoI / NotI.

To screen several libraries for the source of full length clones, DNA from these libraries was screened by PCR amplification using the PCR primer pairs identified above. The clones encoding the PRO356 gene were then isolated using one of the probe oligonucleotides and PCR primers using a positive library.

DNA sequencing of the isolated clones as described above provided the full-length DNA sequence encoding native sequence PRO356 (NL4) (ie, DNA47470, SEQ ID NO: 101) and the PRO356 protein sequence UNQ313 (SEQ ID NO: 102) derived therefrom.

The full nucleotide sequence of DNA47470 is shown in FIG. 37 (SEQ ID NO: 101). As indicated by the bold underline, clone DNA47470 (SEQ ID NO: 101) has a clear open initiation site at nucleotide positions 215-217 and comprises a single open reading frame with a TAA stop codon at nucleotide positions 1038-1040. The predicted PRO356 polypeptide is 46 long (ie, UNQ313 (SEQ ID NO: 102)), the calculated molecular weight is 40,018 daltons and the pi is 8.19. A cDNA clone comprising DNA47470 (SEQ ID NO: 101) was deposited with the ATCC on October 28, 1997 to be assigned ATCC Accession No. 209422.

Isolation of cDNA Clones Coding T. Human PRO531 (UNQ332)

The full length DNA sequence DNA48314 (FIG. 39, SEQ ID NO: 106) and PRO531 native sequence protein UNQ332 (FIG. 40, SEQ ID NO: 107) derived therefrom were isolated from the brain library of the human fetus using the ECD homologous method described above.

Synthesized PCR primers (forward and reverse) and hybridization probes were as follows:

Omnidirectional PCR Primer : 5'-CTGAGAACGCGCCTGAAACTGTG-3 '(SEQ ID NO: 108)

Reverse PCR Primer : 5'-AGCGTTGTCATTGACATCGGCG-3 '(SEQ ID NO: 109)

Hybridization Probe : (SEQ ID NO: 110)

5'-TTAGTTGCTCCATTCAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-3 '

As shown in bold, the clone DNA48314 (SEQ ID NO: 106) has a clear translation initiation site at nucleotide positions 171-173 and includes a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 2565-2567 (FIG. 39). ). The predicted PRO531 polypeptide precursor (ie UNQ332, SEQ ID NO: 107) is 789 amino acids long. The estimated molecular weight of the UNQ332 protein (SEQ ID NO: 107) shown in FIG. 39 is about 87552 Daltons and the pi is about 4.84. A clone containing DNA48314 (SEQ ID NO: 106) was deposited with the ATCC on March 26, 1998 and assigned Accession No. 209702.

The UNQ332 amino acid sequence of SEQ ID NO: 107 was analyzed to reveal the presence of a cadherin extracellular repeat domain signature at amino acids about 122-132, 231-241, 336-346, 439-449, and 549-559. ATP / GTP-binding site motif A (P-loop) was found at amino acids about 285-292 of SEQ ID NO: 107. In SEQ ID NO: 107, an N-glycosylation site is found at least in amino acids about 567-570, 786-790, 418-421, and 336-339, the signal peptide is at amino acids about 1-26, and the transmembrane domain is at about amino acids about 685- Found in 712.

U. Isolation of cDNA Clone Encoding Human PRO533 (UNQ334)

The murine fibroblast growth factor (FGF-15) of EST sequence accession number AF007268 was used to search for various public EST databases (eg, Genbank, Dayhof, etc.). Searches were performed using the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequences to six frame translations of the EST sequence. This search identified the Genbank EST AA220994, which was identified as the stratagene NT2 neuron precursor 937230.

Based on this sequence, oligonucleotides were synthesized for 1) cDNA library comprising the sequence of interest by PCR, and 2) as a probe to isolate a clone of the full-length coding sequence. To screen several libraries for the source of full-length clones, DNA from these libraries was screened by PCR amplification using PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology. A positive library was then used to isolate clones encoding the PRO533 gene of interest according to in vivo cloning methods using one of the probe oligonucleotides and PCR primers.

RNA for preparing cDNA library was isolated from the retina of a human fetus. The cDNA library used to isolate cDNA clones was constructed by standard methods using commercial reagents (eg, Invitrogen (San Diego, CA), Clontech, etc.). The cDNA is primed with oligo dT with a NotI site, ligated to a SalI hemikinase treated adapter, cleaved with NotI, appropriately sorted by size with gel electrophoresis, and appropriate cloning vector (e.g., pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain a SfiI site; cloned in the direction determined to the only XhoI and NotI sites in Holmes et al., Science, 253: 1278-1280 (1991).

cDNA clones were sequenced throughout. Full length nucleotide sequence DNA49435 (SEQ ID NO: 111) is shown in FIG. 41. As shown in bold underline in FIG. 41, clone DNA49435 (SEQ ID NO: 111) has a clear translation initiation site at nucleotide positions 464-466 and includes a single open reading frame ending at the stop codon (TAG) at nucleotide positions 649-651. . The predicted PRO533 polypeptide precursor (ie UNQ334, SEQ ID NO: 112) is 216 amino acids in length, the calculated molecular weight is 24,003 Daltons and the pi is 6.99. The clone DNA49435-1219 (called DNA49435-1219) was deposited with the ATCC on November 21, 1997 and assigned the ATCC accession number 209480.

The oligonucleotide sequence used in this method was as follows:

FGF15.f : 5'-ATCCGCCCAGATGGCTACAATGTGTA-3 '(SEQ ID NO: 113)

FGF15.p : 5'-GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA-3 '(SEQ ID NO: 114)

FGF15.r : 5'-CCAGTCCGGTGACAAGCCCAAA-3 '(SEQ ID NO: 115)

V. Isolation of cDNA Clones Coding Human PRO1083 (UNQ540)

For tissues isolated from kidney tissue of a human fetus, the EST sequence serving as a template for oligonucleotide production described below was found using the amylase yeast screening method described above, and the full-length DNA sequence was subjected to the screening in the kidney library of the human fetus. DNA50921 (FIG. 43, SEQ ID NO: 116) and the PRO1083 native sequence protein UNQ540 (SEQ ID NO: 117) derived therefrom were isolated.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the method were as follows:

Omnidirectional primer : (43422.f1): 5'-GGCATTGGAGCAGTGCTGGGTG-3 '(SEQ ID NO: 118)

Omnidirectional Primer : (43422.f2): 5'-AGAGCAACTCAGACAGCG-3 '(SEQ ID NO: 119)

Reverse primer : (43422.r1): 5'-TGGAGGCCTAGATGCGGCTGGACG-3 '(SEQ ID NO: 120)

Reverse primer : (43422.r2): 5'-CGAGGAGACCATCAGCAC-3 '(SEQ ID NO: 121)

Hybridization Probe : (43422.p1): (SEQ ID NO: 122)

5'-CCCAAACATCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGC-3 '

As shown in bold, the clone DNA50921 (SEQ ID NO: 116) has a clear translation initiation site at nucleotide positions 154-156 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 2233-2235 (FIG. 43). ). The predicted PRO1083 polypeptide precursor (ie UNQ540, SEQ ID NO: 117, FIG. 44) is 693 amino acids long. The estimated molecular weight of the UNQ540 (SEQ ID NO: 117) protein shown in FIG. 44 is about 77738 and the pi is about 8.87. A clone containing DNA50921 was deposited with the ATCC on May 12, 1998 and assigned Accession No. 209859.

Analyzing the amino acid sequence UNQ540 (SEQ ID NO: 117), the putative signal peptide signal peptide is at amino acids about 1-25 and the transmembrane domain is at amino acids about 382-398, 402-420, 445-468, 473-491, 519-537 , 568-590 and 634-657, the microsomal C-terminal targeting signal is at amino acids about 691-693, the cAMP- and cGMP-dependent protein kinase phosphorylation sites are at amino acids about 198-201 and 370-373, The N-glycosylation sites are at amino acids about 39-42, 148-151, 171-174, 234-237, 303-306, 324-227 and 341-344, wherein the receptor family domain coupled with the G-protein is an amino acid At about 475-504.

Isolation of cDNA Clones Coding W. Human PRO865 (UNQ434)

For tissues isolated from kidney tissue of a human fetus, the EST sequence serving as a template for oligonucleotide production described below was found using the amylase yeast screening method described above, and the full-length DNA sequence was subjected to the screening in the kidney library of the human fetus. DNA53974 (FIG. 45, SEQ ID NO: 123) and PRO865 native sequence protein UNQ434 (SEQ ID NO: 124) derived therefrom were isolated.

PCR primers (forward and reverse) and hybridization probes synthesized for use in the method were as follows:

Forward primer : (48615.f1): 5'-AAGCTGCCGGAGCTGCAATG-3 '(SEQ ID NO: 125)

Omnidirectional primer : (48615.f2): 5'-TTGCTTCTTAATCCTGAGCGC-3 '(SEQ ID NO: 126)

Omnidirectional primer : (48615.f3): 5'-AAAGGAGGACTTTCGACTGC-3 '(SEQ ID NO: 127)

Reverse primer : (48615.r1): 5'-AGAGATTCATCCACTGCTCCAAGTCG-3 '(SEQ ID NO: 128)

Reverse primer : (48615.r2): 5'-TGTCCAGAAACAGGCACATATCAGC-3 '(SEQ ID NO: 129)

Hybridization Probe : (43422.p1): (SEQ ID NO: 130)

5'-AGACAGCGGCACAGAGGTGCTTCTGCCAGGTTAGTGGTTACTTGGATGAT-3 '

As shown in bold, the clone DNA53974 (SEQ ID NO: 123) has a clear translation initiation site at nucleotide positions 173-175 and comprises a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1577-1579 (FIG. 45). ). The predicted PRO865 polypeptide precursor (ie UNQ865, SEQ ID NO: 124) is 468 amino acids long. The estimated molecular weight of the UNQ434 (SEQ ID NO: 124) protein shown in FIG. 46 is about 54,393 and the pi is about 5.63. A clone containing DNA53974 (SEQ ID NO: 123) was deposited with the ATCC on April 14, 1998 and assigned Accession No. 209774.

Analyzing amino acid sequence UNQ434 (SEQ ID NO: 124), the putative signal peptide is at amino acid residues about 1-23, the potential N-glycosylation sites are at amino acid residues about 280 and about 384, and the potential amidation sites are amino acid residues. From about 94 to residue about 97, the glycosaminoglycan attachment site is from amino acid residues about 20 to about 23 and residues about 223 to residues about 226, and the aminotransferase class-V pyridoxyl-phosphate amino acid sequence block is an amino acid It was found that residues from about 216 to about 222 and amino acid sequence blocks similar to those found in the interleukin-7 protein are from amino acid residues about 338 to about 343.

Isolation of cDNA clones encoding X. PRO770 (UNQ408)

The full-length murine m-FIZZ1 DNA (DNA 53517) was used to search the public expression sequence tag (EST) DNA database (Merck / Washington) to identify the EST, called AA524300, which showed homology to the m-FIZZ1 DNA. It was.

Full length clones corresponding to EST AA524300 were purchased from Insight (Insight Pharmaceutical, Palo Alto, Calif.) And sequenced in their entirety.

The total nucleotide sequence of the PRO770-encoded full-length clone thus obtained is shown in FIG. 47. This full-length clone, referred to as DNA54228 (SEQ ID NO: 133), has a clear translation initiation site at nucleotide positions 100-102, as indicated by bold underline (FIG. 47, SEQ ID NO: 133) and terminates at the stop codon (TGA) of residues 433-435. It includes a single open reading frame. The predicted PRO770 polypeptide precursor (including the putative signal sequence of 20 amino acids) (ie UNQ408, SEQ ID NO: 134) is 111 amino acids in length, the calculated molecular weight is 11,730 daltons and the pi is 7.82. Based on homology to m-FIZZ1 (50% when using ALIGN software), the protein is considered a human homologue of m-FIZZ1 and referred to as h-FIZZ1. A cDNA clone comprising DNA54228 (SEQ ID NO: 133) was deposited with ATCC and assigned ATCC Accession No. 209801.

Identification and cloning of m-FIZZ1 (DNA53517)

Mouse Asthma Model: Six to eight week old female Balb / C mice were divided into two test groups, a control and an asthma test. In the asthma test group, 10 μg of egg albumin + 1 mg of alum were immunized intraperitoneally, but not in the control group. After 2 weeks, mice were exposed to aerosols of 10 mg / ml of egg albumin in PBS aerosolized using UltraNeb nebulizer (DeVilbiss) daily at a rate of 2 ml / min for 30 minutes each day for 7 consecutive days. . Finally, the day after the aerosol injection, all blood, serum and bronchoalveolar lavage (BAL) samples were collected and lungs removed and stored for histological investigation, immunohistochemistry and in situ hybridization.

Gel electrophoresis of BAL samples: BAL sample irradiation by 16% Tricine gel phase gel electrophoresis showed that low molecular weight proteins were expressed in BAL samples of asthmatic mice but not BAL samples of control mice. This low molecular weight protein was called m-FIZZ1 and was observed to migrate with 8300 Dalton marker proteins.

Partial Protein Sequence: The protein of interest was transferred onto PVDF membrane and sequenced by Edman digestion. This sequence served as a template for various cloning oligos as described below.

Partial cDNA Sequences: We designed two modified oligonucleotide PCR primers corresponding to putative DNA sequences for the first and last seven amino acids of the partial protein sequence.

Raise # 1 :

5'-ACA AAC GCG TGA YGA RAC NAT HGA RAT-3 '(SEQ ID NO: 135)

Raise # 2 :

5'-TGG TGC ATG CGG RTA RTT NGC NGG RTT-3 '(SEQ ID NO: 136)

The cDNA prepared from the lungs of normal mice was used as a template for PCR reaction to yield 88 bp product. This 88 bp product contained a known 54 bp encoding the PCR primers and a new 34 bp encoding the other partial mFIZZ-1 sequences.

Full length cDNA clone: Primers were designed with this second partial sequence, resulting in successful successful full-length FIZZ clone (DNA53517) with RT-PCR of mouse lung poly (A) ⁺ RNA.

Raise # 3 :

5'-ACA AAC GCG TGC TGG AGA ATA AGG TCA AGG-3 '(SEQ ID NO: 137)

This oligo was used as an RT-PCR primer with Clontech's 5 'and 3' amplifiers.

Raise # 4 :

5'-ACT AAC GCG TAG GCT AAG GAA CTT CTT GCC-3 '(SEQ ID NO: 138)

This oligo was raised and used as an RT-PCR primer with d (T).

I. Isolation of cDNA Clones Coding Human PRO769 (UNQ407)

EST W42069 was identified by searching the public expression sequence tag (EST) DNA database (Merck / Washington University) using the full length murine m-FIZZ1 DNA (DNA 53517) described above.

Full length clones corresponding to EST fragment W42069 were purchased from Insight Pharmaceutical (Palo Alto, Calif.), And sequenced entirely to ultimately confirm the full length nucleotide sequence DNA54231 (SEQ ID NO: 139).

The nucleotide sequence corresponding to the full length native sequence PRO769 clone is shown in FIG. 49. This clone, referred to as DNA 54231 (SEQ ID NO: 139), has a clear open initiation site at nucleotide positions 75-77, as shown in bold underline, and contains a single open reading frame terminating at the stop codon (TGA) of residues 417-419. (FIG. 49). The predicted PRO769 polypeptide precursor (including signal sequence of 10 amino acids) (ie UNQ407, SEQ ID NO: 140) is 114 amino acids in length, the calculated molecular weight is 12,492 daltons and the pI is 8.19. Based on homology with m-FIZZ1 (34% when using ALIGN software), the protein was termed m-FIZZ3. A clone comprising DNA54231 (called DNA54231-1366) was deposited with the ATCC on April 23, 1998 to be assigned ATCC Accession No. 209804.

Z. Isolation of cDNA Clones Coding Human PRO788 (UNQ430)

Partial length EST sequence 2777282 was identified using the ECD homology method identified above. In addition, analysis of the corresponding full length sequence identified DNA56405 (SEQ ID NO: 141) and the native sequence PRO788 protein UNQ430 (SEQ ID NO: 142) derived therefrom.

As indicated by the bold underline, clone DNA56405 (SEQ ID NO: 141) has a clear translation initiation site at nucleotide positions 84-86 and includes a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 459-461 (FIG. 51). ). The predicted native sequence PRO788 polypeptide precursor (ie UNQ430, SEQ ID NO: 142) is 125 amino acids long (Figure 52), the calculated molecular weight is 13,115 daltons, and the pi is 5.90. The estimated molecular weight of the UNQ430 (SEQ ID NO: 142) protein shown in FIG. 52 is about 13115 and the pi is about 5.90. A clone containing DNA56405 (SEQ ID NO: 142) was deposited with the ATCC on May 6, 1998, assigned Accession No. 209849. If there is a difference between the nucleotide sequence of the deposit and the sequence described herein, it is understood that the deposited clone contains the correct sequence. In addition, the method of sequencing sequences provided herein is based on known sequencing techniques.

Analysis of UNQ430 (SEQ ID NO: 52) shown in FIG. 52 revealed that there was a signal peptide at amino acids about 1-17 and an N-glycosylation site at amino acid about 46.

AA. Isolation of cDNA Clone Encoding Human PRO1114 (UNQ557)

For tissues isolated from renal tissue of a human fetus, the amylase yeast screening method described above was used to find the EST sequence that functions as a template for oligonucleotide production, as described above, and screened in a human breast cancer library as described above. DNA sequence DNA57033 (FIG. 53, SEQ ID NO: 143) and PRO1114 native sequence protein UNQ557 (FIG. 54, SEQ ID NO: 144) derived therefrom were isolated.

The PCR primers used for isolation screening described in the above paragraph were as follows: Forward primer : (48466.f1): 5'-AGGCTTCGCTGCGACTAGACCTC-3 '(SEQ ID NO: 145)

Reverse primer : (48466.r1): 5'-CCAGGTCGGGTAAGGATGGTTGAG-3 '(SEQ ID NO: 146)

Hybridization probe : 48466.p1):

5'-TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3 '(SEQ ID NO: 147)

As indicated by the bold underline, clone DNA57033 (SEQ ID NO: 143) has a clear translation initiation site at nucleotide positions 250-252 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 1183-1185 (FIG. 53). , SEQ ID NO: 143). The predicted PRO1114 polypeptide precursor (ie UNQ557, SEQ ID NO: 144) is 311 amino acids in length, the calculated molecular weight is approximately 35,076 daltons and the estimated pi is approximately 5.04. The full length PRO1114 sequence shown in FIG. 54 (SEQ ID NO: 144) was analyzed to demonstrate the presence of: signal peptide of amino acid about 1 to amino acid about 29, transmembrane domain of amino acid about 230 to amino acid about 255, amino acid about 40 to amino acid A potential N-glycosylation site of about 43 and amino acids about 134 to about 137, an amino acid sequence block of amino acids about 92 to about 119, an amino acid sequence block homologous to a tissue factor protein, and amino acids about 232 to about 262, Amino acid sequence block homologous to integrin alpha chain protein. A cDNA clone comprising DNA57033 (SEQ ID NO: 143) was deposited with ATCC on May 27, 1998 and assigned ATCC Accession No. 209905.

AB. Isolation of cDNA Clone Encoding Human PRO1007 (UNQ491)

The ECD homologous method described above was used to identify and further investigate the EST sequence, referred to as Merck EST T70513, derived from human liver tissue (clone 83012 from Library 341). The corresponding full length clones were further investigated and sequenced to isolate the full length DNA sequence DNA57690 (FIG. 55, SEQ ID NO: 145) and the PRO1007 native sequence protein UNQ491 (FIG. 56, SEQ ID NO: 146) derived therefrom.

As indicated by the bold underline, clone DNA57690 (SEQ ID NO: 145) has a clear translation initiation site at nucleotide positions 16-18 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1054-1056 (FIG. 55). ). The predicted PRO1007 polypeptide precursor (ie UNQ491, SEQ ID NO: 146) is 346 amino acids long (Figure 56), calculated molecular weight is 35,971 Daltons, and pi is 8.17. The estimated molecular weight of the UNQ491 (SEQ ID NO: 146) protein shown in FIG. 56 is about 35971 Daltons and the pi is about 8.17. A cDNA clone comprising DNA57690 (SEQ ID NO: 145) was deposited with the ATCC on June 9, 1998 and assigned Accession No. 209950.

Analyzing the amino acid sequence of UNQ491 (SEQ ID NO: 146), the putative signal peptide is present at amino acid residues about 1-30, the transmembrane domain is present at amino acid residues about 325-346, and the amino acid residues about 118, 129, 163, 176 N-glycosylation sites are found at, 183 and 227, and Ly-6 / u-Par domain proteins are present at amino acid residues of about 17-36 and 209-222. Corresponding nucleotides of the amino acids provided herein can be generally determined according to the sequences provided herein.

AC. Isolation of cDNA Clone Encoding Human PRO1184 (UNQ598)

Insight EST 1428374 derived from ileal tissue library (39, SINTBST01) was identified using the signal algorithm method described above. Full length clones corresponding to this sequence were further investigated to isolate full length DNA59220 (FIG. 57, SEQ ID NO: 147) and PRO1184 native sequence protein UNQ598 (FIG. 58, SEQ ID NO: 148) derived therefrom.

As shown in FIG. 58, UNQ598 (SEQ ID NO: 148) has a clear open initiation site at nucleotide positions 106-108, as indicated by bold underline, and ends with a single open reading frame ending at the stop codon (TAG) at nucleotide positions 532-534. Include. The predicted PRO1184 polypeptide precursor (ie UNQ598, SEQ ID NO: 148) is 142 amino acids in length, the calculated molecular weight is approximately 15690 Daltons and the estimated pi is approximately 9.64. UNQ598 (SEQ ID NO: 148) was analyzed to demonstrate the presence of a signal peptide at amino acids about 1-38. A cDNA clone comprising DNA59220 (SEQ ID NO: 147) was deposited with the ATCC on June 9, 1998 and assigned Accession No. 209962. The deposited clones have the actual sequence and representatives thereof are presented herein.

AD. Isolation of cDNA Clone Encoding Human PRO1031 (UNQ516)

EST sequence Merck W74558 (clone 344649) was isolated using the ECD homologous method described above. Corresponding full length clones were examined and sequenced to isolate the DNA sequence of the full length DNA sequence DNA59294 (FIG. 59, SEQ ID NO: 149) and PRO1031 native sequence protein UNQ516 (FIG. 60, SEQ ID NO: 150) derived therefrom.

As shown in bold, the clone DNA59294 (SEQ ID NO: 149) has a clear translation initiation site at nucleotide positions 42-44 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 582-584 (FIG. 59). do. The predicted PRO1031 polypeptide precursor (ie UNQ516, SEQ ID NO: 150) is 180 amino acids long (FIG. 60). The estimated molecular weight of the UNQ516 protein shown in FIG. 60 is about 20437 and the pi is about 9.58. Clone DNA59294 (SEQ ID NO: 149) was deposited with the ATCC on May 14, 1998, assigned Accession No. 209866. With respect to this sequence, it is understood that the deposited clone contains the correct sequence and that the sequences given herein are based on known sequencing techniques.

Amino acid sequencing of UNQ516 (SEQ ID NO: 150) revealed a putative signal peptide at amino acid residues about 1-20 and an N-glycosylation site at amino acid residue about 75. The region having sequence identity with IL-17 is at amino acid residues about 96-180. Corresponding nucleotides can generally be determined according to the sequences provided herein.

AE. Isolation of cDNA Clone Encoding Human PRO1346 (UNQ701)

The full-length DNA sequence DNA59776 (FIG. 61, SEQ ID NO: 151) and the PRO1346 native sequence protein UNQ701 (FIG. 62, SEQ ID NO: 152) derived from the human fetal kidney library were isolated using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes used for isolation of DNA59776 (SEQ ID NO: 151) were as follows:

Omnidirectional PCR primer (45668.f1) : 5'-CACACGTCCAACCTCAATGGGCAG-3 '(SEQ ID NO: 153)

Reverse PCR primer (45668.r1) : 5'-GACCAGCAGGGCCAAGGACAAGG-3 '(SEQ ID NO: 154)

Hybridization Probe (45668.p1) : (SEQ ID NO: 155)

5'-GTTCTCTGAGATGAAGATCCGGCCGGTCCGGGAGTACCGCTTAG-3 '

Clone DNA59776 (SEQ ID NO: 151) has a clear translation initiation site at nucleotide positions 1-3 (ATG) and includes a single open reading frame that terminates at the stop codon (TAG) at nucleotide positions 1384-1386. The predicted PRO1346 polypeptide precursor (ie UNQ701, SEQ ID NO: 152) is 461 amino acids in length. The protein comprises a type II transmembrane domain evident at amino acid positions about 31 to about 50, a fibrinogen beta and gamma chain C-terminal domain signature at amino acid positions about 409-421, amino acid positions about 140-161, 147-168, 154-175 and 161-182 include leucine zipper patterns.

A cDNA clone comprising DNA59776, referred to as DNA59776-1600, was deposited with ATCC on August 18, 1998 and assigned ATCC Accession No. 203128. The estimated molecular weight of the UNQ701 (SEQ ID NO: 152) protein shown in FIG. 62 is about 50744 Daltons and the pi is about 6.38.

AF. Isolation of cDNA Clone Encoding Human PRO1155 (UNQ585)

Insight EST 2858870 derived from ileal tissue library (39, SININOT03) was identified using the signal algorithm method described above. Full length clones corresponding to this sequence were further examined to isolate the full length DNA sequence DNA59849 (FIG. 63, SEQ ID NO: 156) and the PRO1155 native sequence protein UNQ585 (FIG. 64, SEQ ID NO: 157) derived therefrom.

The UNQ585 (SEQ ID NO: 157) polypeptide shown in FIG. 64 has a clear translation initiation site at nucleotide positions 158-160, as indicated by bold underline, and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 563-565. . The predicted PRO1155 polypeptide precursor (ie UNQ585, SEQ ID NO: 157) is 135 amino acids long, the signal peptide is present at amino acid residues about 1 to about 18, and the leucine zipper pattern is present at amino acid residues about 43 to 64, and tachykinin Tachykinin family signatures occur at amino acid residues from about 86 to about 91. The calculated molecular weight of UNQ585 (SEQ ID NO: 157) is approximately 14833 Daltons and the estimated pi is approximately 9.78. A cDNA clone comprising DNA59849 (SEQ ID NO: 156), referred to as DNA59849-1504, was deposited with the ATCC on June 16, 1998 to be assigned ATCC Accession No. 209986.

AG. Isolation of cDNA Clone Encoding Human PRO1250 (UNQ633)

The signal algorithm method described above was used to identify the EST cluster sequence from the Insight database, referred to as Insight EST cluster sequence 56523. Then, as described for the signal algorithm method above, this sequence was compared with various other EST databases to further confirm Insight EST 3371784. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate the full length DNA sequence DNA60775 (FIG. 65, SEQ ID NO: 158) and the PRO1250 native sequence protein UNQ633 (FIG. 66, SEQ ID NO: 159) derived therefrom.

Clone DNA60775 (SEQ ID NO: 158) has a clear translation initiation site at nucleotide positions 74-76 and comprises a single open reading frame ending at the stop codon (TAG) at nucleotide positions 2291-2293 (FIG. 65). The predicted PRO1250 polypeptide precursor (ie UNQ633, SEQ ID NO: 159) is 739 amino acids long (FIG. 66). The estimated molecular weight of the UNQ633 (SEQ ID NO: 159) protein shown in FIG. 66 is about 82,263 Daltons and the pi is about 7.55. Analysis of UNQ633 (SEQ ID NO: 159) confirmed the presence of: Form II- transmembrane domains of amino acid residues about 61 to about 80, putative AMP-binding domain signature sequences of amino acid residues about 314 to about 325, and amino acids Potential N-glycosylation sites of residues about 102 to about 105, amino acid residues about 588 to about 591, and amino acid residues about 619 to about 622. A cDNA clone comprising DNA60775 (SEQ ID NO: 158) was deposited with the ATCC on September 1, 1998 and assigned ATCC Accession No. 203173.

AH. Isolation of cDNA Clone Encoding Human PRO1312 (UNQ678)

The yeast screening method was used to identify EST (DNA55773), which preferably represents the 5 'end of the primary cDNA clone in the renal cDNA library of human fetuses. Based on the DNA55773 sequence, oligonucleotides were synthesized and used as probes to isolate the full length DNA sequence DNA61873 (FIG. 67, SEQ ID NO: 160) and the PRO1312 native sequence UNQ678 (SEQ ID NO: 161) derived therefrom. .

The full-length DNA61873 clone shown in FIG. 67 (SEQ ID NO: 160) has a clear translation initiation site at nucleotide positions about 7-9, as indicated by bold underline, and terminates at the stop codon (TGA) at nucleotide positions about 643-645 It includes. The predicted PRO1312 polypeptide precursor (ie UNQ678, SEQ ID NO: 161) is 212 amino acids in length. The calculated molecular weight of UNQ678 (SEQ ID NO: 161) is approximately 24,024 Daltons and the estimated pi is approximately 6.26. Other features include signal peptides of amino acids about 1-14, transmembrane domains of amino acids about 141-160, and potential N-glycosylation sites of amino acids about 76-79 and 93-96. A clone comprising DNA61873 (SEQ ID NO: 160), referred to as DNA61873-1574, was deposited with the ATCC on August 18, 1998 and assigned Accession No. 203132.

AI. Isolation of cDNA Clone Encoding Human PRO1192 (UNQ606)

The full length DNA sequence DNA62814 (FIG. 69, SEQ ID NO: 162) and the derived PRO1192 native sequence protein UNQ606 (FIG. 70, SEQ ID NO: 163) were isolated from the lung library of the human fetus using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes used for isolation of DNA62814 (SEQ ID NO: 162) were as follows:

Omnidirectional PCR primer (35924.f1) : 5'-CCGAGGCCATCTAGAGGCCAGAGC-3 '(SEQ ID NO: 164)

Reverse PCR primer (35924.r1) : 5'-ACAGGCAGAGCCAATGGCCAGAGC-3 '(SEQ ID NO: 165).

Hybridization Probe (35924.p1) : (SEQ ID NO: 166).

5'-GAGAGGACTGCGGGAGTTTGGGACCTTTGTGCAGACGTGCTCATG-3 '

As shown in bold, the clone DNA62814 (FIG. 69, SEQ ID NO: 162) has a clear translation initiation site at nucleotide positions 121-123 and comprises a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 766-768. . The predicted PRO1192 polypeptide precursor (ie UNQ606, SEQ ID NO: 163) is 215 amino acids long. The UNQ606 (SEQ ID NO: 163) polypeptide precursor shown in FIG. 70 is a signal peptide of amino acids about 1-21, a transmembrane domain of amino acids about 153-176, a potential N-glycosylation site of amino acids about 39-42 and 118-121, and And homologous sites with the myelin P0 protein of amino acids about 27-68 and 99-128. The estimated molecular weight of UNQ606 (SEQ ID NO: 163) shown in FIG. 70 is about 24,484 Daltons, and pi is about 6.98.

A cDNA clone comprising DNA62814 (SEQ ID NO: 162), referred to as DNA62814-1521, was deposited with ATCC on August 4, 1998 to be assigned ATCC Accession No. 203093.

AJ. Isolation of cDNA Clone Encoding Human PRO1246 (UNQ630)

The signal algorithm method described above was used to identify the EST cluster sequence from the Insight database, referred to as Insight EST cluster sequence 56853. Then, as described for the signal algorithm method, insight EST 2481345 was further confirmed by comparing this sequence to various various EST databases. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate the full length DNA sequence DNA64885 (FIG. 71, SEQ ID NO: 167) and the PRO1246 native sequence protein UNQ630 (FIG. 72, SEQ ID NO: 168) derived therefrom.

As indicated by the bold underline, clone DNA64885 (SEQ ID NO: 167) has a clear translation initiation site at nucleotide positions 119-121 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1727-1729 (FIG. 71). ). The predicted PRO1246 polypeptide precursor (ie UNQ630, SEQ ID NO: 168) is 536 amino acids in length, estimated molecular weight is about 61,450 daltons, and pi is about 9.17 (FIG. 72). Analysis of UNQ630 (FIG. 72, SEQ ID NO: 168) revealed the presence of: signal amino acids about 1 to about 15 amino acids, amino acids about 108 to amino acids about 111, amino acids about 166 to amino acids about 169, amino acids about 193 to amino acids About 196, about 262 to about 265 amino acids, about 375 to about 378 amino acids, about 413 to about 416 amino acids, about 416 to about 416 amino acids, and about 498 to about 501 amino acids, and about 286 to about amino acids about amino acids 315, amino acid about 359 to amino acid about 369, and amino acid about 78 to amino acid about 97, an amino acid sequence block homologous to the sulfatase protein. CDNA comprising DNA64885 (SEQ ID NO: 167), referred to as DNA64885-1529, was deposited with the ATCC on November 3, 1998 to be assigned ATCC Accession No. 203457.

AK. Isolation of cDNA Clone Encoding Human PRO1283 (UNQ653)

The full-length DNA sequence DNA65404 (FIG. 73, SEQ ID NO: 169) and PRO1283 native sequence protein UNQ653 (FIG. 74, SEQ ID NO: 170) derived therefrom were isolated from the human breast cancer tissue library using the ECD homologous method described above.

PCR primers (forward and reverse) and hybridization probes used for isolation of DNA65404 (SEQ ID NO: 169) were as follows:

Omnidirectional PCR primer (28753.f1) :

5'-GGAGATGAAGACCCTGTTCCTG-3 '(SEQ ID NO: 171)

Omnidirectional PCR primer (28753.f11) :

5'-GGAGATGAAGACCCTGTTCCTGGGTG-3 '(SEQ ID NO: 172)

Reverse PCR Primer (28753.r1) :

5'-GTCCTCCGGAAAGTCCTTATC-3 '(SEQ ID NO: 173)

Reverse PCR Primer (28753.r11) :

5'-GCCTAGTGTTCGGGAACGCAGCTTC-3 '(SEQ ID NO: 174)

Hybridization Probe (28753.p1) : (SEQ ID NO: 175)

5'-CAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAG-3 '

Hybridization Probe (28753.p11) : (SEQ ID NO: 176)

5'-CTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTAC-3 '

As shown in bold, the clone DNA65404 (SEQ ID NO: 169) has a clear translation initiation site at nucleotide positions 45-47 and includes a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 555-557 (FIG. 73). do. The predicted PRO1283 polypeptide precursor (ie UNQ653, SEQ ID NO: 170) is 170 amino acids long (Figure 74). The estimated molecular weight of the UNQ653 (SEQ ID NO: 170) protein shown in FIG. 74 is about 19,457 Daltons and the pI is about 9.10. UNQ653 (SEQ ID NO: 170) was analyzed to demonstrate the presence of: A signal peptide of about 1 amino acid to about 17 amino acids. A cDNA clone comprising DNA65404 (SEQ ID NO: 169), referred to as DNA65404-1551, was deposited with the ATCC on September 9, 1998 and assigned ATCC Accession No. 203244.

AL. Isolation of cDNA Clone Encoding Human PRO1195 (UNQ608)

The EST cluster sequence 32204 from the Insight database was identified using the signal algorithm method described above. Then, as described for the signal algorithm method above, this sequence was compared with various other EST databases to further identify Insight EST352980. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate the full length DNA sequence DNA65412 (FIG. 75, SEQ ID NO: 177) and the PRO1195 native sequence protein UNQ608 (FIG. 76, SEQ ID NO: 178) derived therefrom.

As shown in bold, full-length clone DNA65412 (SEQ ID NO: 177) has a clear translation initiation site at nucleotide positions 58-60 and terminates a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 511-513 (FIG. 75). Include. The predicted PRO1195 polypeptide precursor (ie UNQ608, FIG. 76, SEQ ID NO: 178) is 151 amino acids in length, the calculated molecular weight is 17,227 daltons and the pi is 5.33. Analysis of UNQ608 (SEQ ID NO: 178) revealed that the signal sequence is in amino acids about 1-22, the calculated molecular weight is approximately 17277 daltons and the estimated pi is approximately 5.33. A cDNA clone comprising DNA65412 (SEQ ID NO: 177), referred to as DNA65412-1523, was deposited with the ATCC on August 4, 1998 to be assigned ATCC Accession No. 203094.

AM. Isolation of cDNA Clone Encoding Human PRO1343 (UNQ698)

For tissues isolated from human smooth muscle cell tissue, using the amylase yeast screening method described above, the EST sequence serving as a template for oligonucleotide production described below is screened and screened as described above in the human smooth muscle cell tissue library for full length. DNA sequence DNA66675 (FIG. 77, SEQ ID NO: 179) and PRO1343 native sequence protein UNQ698 (FIG. 78, SEQ ID NO: 180) derived therefrom were isolated.

Oligonucleotide probes used were as follows:

Omnidirectional PCR primer (48921.f1) 5'-CAATATGCATCTTGCACGTCTGG-3 '(SEQ ID NO: 181)

Reverse PCR primer (48921.r1) 5'-AAGCTTCTCTGCTTCCTTTCCTGC-3 '(SEQ ID NO: 182)

Hybridization Probe (48921.p1)

5'-TGACCCCATTGAGAAGGTCATTGAAGGGATCAACCGAGGGCTG-3 '(SEQ ID NO: 183)

As shown in bold, full length clone DNA66675 (SEQ ID NO: 179) has a clear translation initiation site at nucleotide positions 71-73 and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 812-814 (FIG. 77). The predicted PRO1343 polypeptide precursor (ie UNQ698, SEQ ID NO: 180, FIG. 78) is 247 amino acids in length, the calculated molecular weight is approximately 25,335 daltons and the estimated pi is approximately 7.0. Analyzing the UNQ698 sequence shown in FIG. 78 (SEQ ID NO: 180) demonstrated the presence of: a signal peptide of amino acids about 1 to about 25 and a circumsporozoite repeat of amino acids about 35 to about 225 Homologous region with. A cDNA clone comprising DNA66675 (SEQ ID NO: 179), referred to as DNA66675-1587, was deposited with the ATCC on September 22, 1998 and assigned ATCC Accession No. 203282.

In addition, yeast EST sequences isolated by the amylase screening were screened against various EST databases both public and private (see, for example, the ECD homology method above) to identify Insight EST clone 4701148. The corresponding full length clones were further analyzed and sequenced to isolate the DNA66675 sequence (SEQ ID NO: 179) shown in FIG. 77.

AN. Isolation of cDNA Clone Encoding Human PRO1418 (UNQ732)

The EST cluster sequence 10698 (Insight Cluster 121480) was identified using the signal algorithm method described above. The EST1306026 was further identified by comparing this sequence with various EST databases (including those derived from placental tissue libraries), as described for the signal algorithm method above. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate the full length DNA sequence DNA68864 (FIG. 79, SEQ ID NO: 184) and the PRO1418 native sequence protein UNQ732 (FIG. 80, SEQ ID NO: 185) derived therefrom.

The full length clone shown in FIG. 79 (DNA68864, SEQ ID NO: 184) has a clear open initiation site at nucleotide positions 138-140, as indicated by bold underline, and has a single open reading frame ending at the stop codon (TAA) at nucleotide positions 1188-1190. Include. The predicted PRO1418 polypeptide precursor (ie UNQ732, SEQ ID NO: 185) is 350 amino acids long, with signal peptide present at amino acids about 1-19, the calculated molecular weight is approximately 39003 Daltons and the estimated pi is approximately 5.59. A cDNA clone comprising DNA68864 (SEQ ID NO: 184), referred to as DNA68864-1629, was deposited with ATCC on September 22, 1998 and assigned ATCC Accession No. 203276.

AO. Isolation of cDNA Clone Encoding Human PRO1387 (UNQ722)

EST cluster sequence 10298 was identified using the signal algorithm method described above. Then, as described for the signal algorithm method above, this sequence was compared with various other EST databases to further confirm Insight EST3507924. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate the full length DNA sequence DNA68872 (FIG. 81, SEQ ID NO: 186) and the PRO1387 native sequence protein UNQ722 (FIG. 82, SEQ ID NO: 187) derived therefrom.

As indicated by the bold underline, clone DNA68872 (SEQ ID NO: 186) has a clear translation initiation site at nucleotide positions 76-78 and comprises a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1258-1260 (FIG. 81). ). The predicted PRO1387 polypeptide precursor (ie UNQ722, SEQ ID NO: 187) is 394 amino acids in length. The estimated molecular weight of UNQ722 (SEQ ID NO: 187) shown in FIG. 82 is about 44,339 Daltons and the pI is about 7.10. UNQ722 (SEQ ID NO: 187) also comprises a signal peptide at amino acid residues about 1 to about 19, a transmembrane domain at residues about 275 to about 296, and at residues about 76, 231, 302, 307, and 376. A potential N-glycosylation site and comprising an amino acid sequence block homologous to the myelin p0 protein at amino acid residues about 210 to about 239 and amino acid residues about 92 to about 121. A cDNA clone comprising DNA68872, referred to as DNA68872-1620, was deposited with ATCC on August 25, 1998 and assigned ATCC Accession No. 203160.

AP. Isolation of cDNA Clone Encoding Human PRO1410 (UNQ728)

EST cluster sequence 98502 was identified using the signal algorithm method described above. Then, as described for the signal algorithm method above, this sequence was compared with various other EST databases to further confirm insight EST1257046. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate full length DNA sequence DNA68874 (FIG. 83, SEQ ID NO: 188) and PRO1387 native sequence protein UNQ728 (FIG. 84, SEQ ID NO: 189) derived therefrom.

As shown in bold, the clone DNA68874 (SEQ ID NO: 188) has a clear translation initiation site at nucleotide positions 152-154 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 866-868 (Figure 83). do. The predicted PRO1410 polypeptide precursor (ie UNQ728, SEQ ID NO: 189) is 238 amino acids in length (FIG. 84). The estimated molecular weight of the UNQ728 protein (SEQ ID NO: 189) shown in FIG. 84 is about 25,262 Daltons, pi is about 6.44, signal peptide is present at amino acid residues about 1 to about 20 and transmembrane at amino acid residues about 194 to about 220 There is a domain and there is a potential N-glycosylation site at about 132 amino acid residues. A clone containing DNA68874 (SEQ ID NO: 188) was deposited with ATCC on September 22, 1998 and assigned ATCC Accession No. 203277.

AQ. Isolation of cDNA Clone Encoding Human PRO1917 (UNQ900)

The EST cluster sequence 85496 was identified using the signal algorithm method described above. Then, as described for the signal algorithm method above, this sequence was compared with various other EST databases to further confirm Insight EST3255033. This EST sequence was derived from a uterine cancer library. Full length clones corresponding to this EST sequence were further investigated and sequenced to isolate the full length DNA sequence DNA76400 (FIG. 85, SEQ ID NO: 190) and the PRO1917 native sequence protein UNQ900 (FIG. 86, SEQ ID NO: 191) derived therefrom.

The full-length clone DNA76400 (SEQ ID NO: 190) shown in FIG. 85 has a clear translation initiation site at nucleotide positions 6-9, as indicated by bold underline, and includes a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1467-1469. do. The predicted PRO1917 polypeptide precursor (ie UNQ900, SEQ ID NO: 191) is 487 amino acids in length. The calculated molecular weight for UNQ900 (SEQ ID NO: 191) is approximately 55,051 Daltons and the estimated pI is approximately 8.14. Additional features include: signal peptide of amino acid residues about 1-30; Potential N-glycosylation sites of amino acid residues about 242 and 481, protein kinase C phosphorylation sites of amino acid residues about 95-97, 182-184, and 427-429; N-myristoylation sites of amino acid residues about 107-112, 113-118, 117-122, 118-123, and 128-133; And an endoplasmic reticulum target sequence of amino acid residues about 484-487.

AR. Isolation of cDNA Clone Encoding Human PRO1868 (UNQ859)

EST clone 2994689 was identified from the lung library of human fetuses using the ECD homologous method described above. Corresponding full length clones were further investigated and sequenced to isolate DNA77624 (FIG. 87, SEQ ID NO: 192) and PRO1868 native sequence protein UNQ859 (FIG. 88, SEQ ID NO: 193) derived therefrom.

As shown in bold, the clone DNA77624 (FIG. 88, SEQ ID NO: 193) has a clear translation initiation site at nucleotide positions 51-53 and comprises a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 981-983. . The predicted PRO1868 polypeptide precursor (ie UNQ859, SEQ ID NO: 193, FIG. 89) is 310 amino acids long. The estimated molecular weight of the UNQ859 (SEQ ID NO: 193) protein shown in FIG. 89 is about 35,020 Daltons, pI is about 7.90, transmembrane domains at amino acid residues about 243 to about 263, potential N-glycos at amino acid residues about 104 and 192 Misfire site, cAMP- and cGMP-dependent protein kinase phosphorylation site at amino acid residues about 107 to about 110, casein kinase II phosphorylation site at amino acid residues about 106 to about 109 and amino acid residues about 296 to about 299, amino acid residues about 69 to residue about 77 tyrosine kinase phosphorylation site, and amino acid residue about 26 to residue about 31, residue about 215 to residue about 220, residue about 226 to residue about 231, residue about 243 to residue about 248, residue about 244 to residue There are potential N-myristolization sites at about 249 and residues about 262 to about 267. A cDNA clone comprising DNA77624 (SEQ ID NO: 193) was deposited with ATCC on Dec. 22, 1998 to be assigned ATCC accession number 203553.

AS. Isolation of cDNA Clone Encoding Human PRO205 (UNQ179)

The ECD homologous method described above was used to identify ECD sequences derived from human retinal libraries. Efforts have been made to identify full length clones using in vitro cloning methods, but no other PRO205 encoding DNA sequences could be identified.

DNA sequences encoding other polypeptides having substantial homology to the UNQ179 (SEQ ID NO: 229) polypeptide of FIG. 90 could be identified by Genbank accession numbers AB033089_1 and HSM802147_1.

As shown in bold underline in FIG. 89, clone DNA30868 (SEQ ID NO: 89) has an apparent translation initiation site at nucleotide positions 405-407 and includes what is considered to be an incomplete open reading frame. The predicted partial length PRO1868 polypeptide precursor (ie UNQ179, SEQ ID NO: 229) is 343 amino acids in length, the calculated molecular weight is 39285 Daltons and the pi is 6.06.

The UNQ179 (SEQ ID NO: 229) shown in FIG. 90 is analyzed for signal peptides at amino acid residues about 1 to 20, N-glycosylation sites at amino acid residues about 318-322, and amino acid residues at about 21-29 and 211-220. It was found that there is a tyrosine kinase phosphorylation site, there are N-myristolization sites at residues about 63-69, 83-89 and 317-323, and prokaryotic membrane lipoprotein lipid attachment sites at residues 260-271. A cDNA clone called DNA30868-1156 comprising DNA30868 (SEQ ID NO: 228) was deposited with the ATCC on March 2, 2000 to be assigned the ATCC accession number ---------.

AT. Isolation of cDNA Clone Encoding Murine PRO21 (UNQ21)

An isolation method of DNA36638 (FIG. 91, SEQ ID NO: 230) encoding native sequence PRO21 polypeptide UNQ21 (FIG. 92, SEQ ID NO: 231) has been reported in US Pat. No. 5,955,420. Other cloning and characterization information can be found in Schneider et al., Cell 54 (6): 787-93 (1988) and Manfioletti et al., Mol Cell Biol. 13 (8): 4976-85 (1993). Can be.

As indicated by the bold underline, clone DNA36638 has a clear translation initiation site at nucleotide residues 168-170 and comprises a single open reading frame ending at the stop codon (TAG) of nucleotide residues 2187-2189 (FIG. 91). The predicted PRO21 polypeptide precursor (ie UNQ21, SEQ ID NO: 231) is 673 amino acids in length, the calculated molecular weight is 74,512 daltons and the pi is 5.45. A cDNA clone comprising DNA36638, referred to as DNA36638-1056, was deposited with ATCC on November 12, 1997 and assigned ATCC Accession No. 209456.

Analyzing the UNQ21 polypeptide of FIG. 92 (SEQ ID NO: 231) has a signal sequence at amino acid residues about 1-27, a transmembrane domain at amino acid residues about 619-635, and N-glyco at residues 417-421 and 488-492 Has misfire sites, amino acid residues about 126-132, 135-141, 146-152, 173-179, 214-220, 253-259, 346-352, 374-380, 440-446, 479-485, 497- 503, 517-523, 612-618 have N-myristolization sites, about 130-142, 168-180, 209-221 and 248-260 have aspartic acid and asparagine hydroxylation site amino acid residues It was found that residues about 139-151 have a vitamin K-dependent carboxylation domain and an EGF-like domain cysteine pattern signature.

AU. Isolation of cDNA Clone Encoding Human PRO269 (UNQ236)

Full length DNA sequence DNA38260 (FIG. 93, SEQ ID NO: 232) and PRO269 derived therefrom using the ECD homologous method described above from a human fetal kidney library and an in vitro cloning method using one of the following probe oligonucleotide and primer pairs Native sequence protein UNQ236 (FIG. 94, SEQ ID NO: 233) was identified.

The forward and reverse PCR primers and hybridization probes used were as follows:

Omnidirectional PCR primer (.f1): (SEQ ID NO: 234)

5'-TGGAAGGAGATGCGATGCCACCTG -3 '

Omnidirectional PCR Primer (.f2): (SEQ ID NO: 235)

5'-TGACCAGTGGGGAAGGACAG-3 '

Omnidirectional PCR primer (.f3): (SEQ ID NO: 236)

5'-ACAGAGCAGAGGGTGCCTTG-3 '

Reverse PCR Primer (.r1): (SEQ ID NO: 237)

5'-TCAGGGACAAGTGGTGTCTCTCCC-3 '

Reverse PCR Primer (.r2): (SEQ ID NO: 238)

5'-TCAGGGAAGGAGTGTGCAGTTCTG-3 '

Hybridization Probe : (SEQ ID NO: 239)

5'-ACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCT-3 '

As indicated by the bold underline, clone DNA38260 (SEQ ID NO: 232) has a clear translation initiation site at nucleotide positions 314-316 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 1784-1786 (Figure 93). ). The predicted PRO269 polypeptide precursor is 490 amino acids long (ie UNQ236, FIG. 94, SEQ ID NO: 233), the calculated molecular weight is 51,636 daltons and the pi is 6.29. A cDNA clone comprising DNA38260 (SEQ ID NO: 232) was deposited with the ATCC on October 17, 1997 to be assigned ATCC Accession No. 209397.

Analyzing the UNQ236 polypeptide of FIG. 94 (SEQ ID NO: 223) has a signal sequence at amino acid residues about 1-16, a transmembrane domain at residues about 399-418, and an N-glyco at amino acid residues about 189-193 and 381-385 Has a misfire site, a glycosaminoglycan attachment site at amino acid residues about 289-293, a cAMP- and cGMP-dependent protein kinase phosphorylation site at amino acid residues about 98-102 and 434-438, and an amino acid residue about 30 -36, 35-41, 58-64, 59-65, 121-127, 151-157, 185-191, 209-215, 267-273, 350-356, 374-380, 453-459, 463-469 And 477-483 at the N-myristolization site and at about 262-274 amino acid residues aspartic acid and asparagine hydroxylation sites.

AV. Isolation of cDNA Coding Human PRO344 (UNQ303)

Full length DNA sequence DNA40592 (FIG. 95, SEQ ID NO: 240) and PRO344 derived therefrom using the ECD homologous method described above from a human fetal kidney library and an in vitro cloning method using one of the following probe oligonucleotide and primer pairs Native sequence protein UNQ303 (FIG. 96, SEQ ID NO: 241) was identified.

The forward and reverse PCR primers and hybridization probes used were as follows: Forward PCR primer (34398.f1): (SEQ ID NO: 242)

5'-TACAGGCCCAGTCAGGACCAGGGG-3 '

Omnidirectional PCR primer (34398.f2): (SEQ ID NO: 243)

5'-AGCCAGCCTCGCTCTCGG-3 '

Omnidirectional PCR primer (34398.f3): (SEQ ID NO: 244)

5'-GTCTGCGATCAGGTCTGG-3 '

Reverse PCR Primer (34398.r1): (SEQ ID NO: 245)

5'-GAAAGAGGCAATGGATTCGC-3 '

Reverse PCR Primer (34398.r2): (SEQ ID NO: 246)

5'-GACTTACACTTGCCAGCACAGCAC-3 '

Hybridization Probe (34398.p1): (SEQ ID NO: 247)

5'-GGAGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG-3 '

Clone DNA40592 (SEQ ID NO: 240) has a clear translation initiation site at nucleotide positions 227-229 and comprises a single open reading frame ending at the stop codon (TAG) at nucleotide positions 956-958 (FIG. 95). The predicted PRO344 polypeptide precursor (ie UNQ303, SEQ ID NO: 241) is 243 amino acids in length (FIG. 96), the calculated molecular weight is 25,298 daltons and the pi is 6.44. Analyzing the UNQ303 polypeptide of FIG. 96 (SEQ ID NO: 241), there are signal peptides at amino acid residues about 1-15, and N-myristolization sites at amino acid residues about 11-17, 68-74, and 216-222, and amino acids. It was found that there are cell attachment sites at residues about 77-80. A cDNA clone comprising DNA40592 (SEQ ID NO: 240) was deposited with ATCC on November 21, 1997 and assigned ATCC Accession No. 209492.

AX. Isolation of cDNA Clone Encoding Human PRO333 (UNQ294)

The partial length sequence DNA41374 (SEQ ID NO: 248, Figure 97) was used in combination with the ECD homologous method and the in vivo cloning method.

As indicated by the bold underline, clone DNA41374 (SEQ ID NO: 248) contains an incomplete open reading frame with an apparent translation end site (ie, stop codon, TGA) at nucleotide residues 1185-1187. The predicted partial length PRO333 polypeptide (ie UNQ294, SEQ ID NO: 249) is 394 amino acids in length, the calculated molecular weight is 43,725 daltons and the pi is 8.36.

The UNQ294 (SEQ ID NO: 249) polypeptide of FIG. 98 was analyzed to have a signal sequence at amino acid residues about 1-14, a transmembrane domain at residues about 359-376, and amino acid residues about 166-172, 206-212, 217-223. , 246-252, 308-314, 312-318, 361-367, and the N-myristoylation sites, and the amino globules 315-323 revealed the immunoglobulin and major histocompatibility complex protein signatures. A cDNA clone containing DNA41374 was deposited with the ATCC at ___________ and assigned an ATCC accession number ___________.

AY. Isolation of cDNA Clone Encoding Human PRO381 (UNQ322)

The full length DNA sequence DNA44194 (FIG. 99, SEQ ID NO: 250) and the PRO381 native sequence protein UNQ322 (FIG. 100, SEQ ID NO: 251) derived from the human fetal kidney library were isolated using the ECD homologous method described above.

The forward and reverse PCR primers and hybridization probes used were as follows:

Omnidirectional PCR Primer (39651.f1) : (SEQ ID NO: 252)

5'-CTTTCCTTGCTTCAGCAACATGAGGC-3 '

Reverse PCR Primer (39651.r1) : (SEQ ID NO: 253)

5'-GCCCAGAGCAGGAGGAATGATGAGC-3 '

Hybridization Probe (39651.p1) : (SEQ ID NO: 254)

5'-GTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTTG-3 '

As indicated by the bold underline, clone DNA44194 (SEQ ID NO: 250) has a clear initiation site at nucleotide positions 174-176 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 807-809 (FIG. 99). ). The predicted PRO381 polypeptide precursor (ie UNQ322, FIG. 100, SEQ ID NO: 251) is 211 amino acids in length, the calculated molecular weight is 24,172 daltons and the pi is 5.99. The UNQ322 (SEQ ID NO: 251) protein shown in FIG. 100 has the following characteristics: signal peptide of amino acid residues about 1 to about 20, potential N-glycosylation site of amino acid residues about 156, amino acid residues about 143 to about 146, residues About 156 to about 159, residues about 178 to about 181, residues about 200 to about 203 potential casein kinase phosphorylation sites, amino acid residues about 78 to about 114 and vesicle target sequences of residues about 118 to about 131, amino acid residues about 140 An EF-hand calcium binding domain of from about 159, and an S-100 / ICaBP-calcium binding domain of about 183 to about 203 amino acid residues. A cDNA clone comprising DNA44194 (SEQ ID NO: 250) was deposited with the ATCC on April 28, 1998 and assigned Accession No. 209808.

AZ. Isolation of cDNA Clone Encoding Murine PRO720 (UNQ388)

The method of making DNA53517 (SEQ ID NO: 255) is described above in "X. Isolation of cDNA Clones Encoding Human PRO770 (UNQ408) ". As indicated by the bold underline, clone DNA53517 (SEQ ID NO: 255) has a clear translation initiation site at nucleotide residues 36-38 and comprises a single open reading frame ending at stop codon (TAA) of 369-371 (FIG. 101). The predicted PRO720 polypeptide precursor (ie UNQ388, SEQ ID NO: 256) is 111 amino acids long (FIG. 102), the calculated molecular weight is 11,936 Daltons, and pi is 5.21.

The UNQ388 (SEQ ID NO: 256) polypeptide of FIG. 102 was analyzed to show a signal sequence at signal sequences at amino acid residues about 1-23, an N-myristolization site at amino acid residues 70-76 and 75-81, and 66-77. And 68-79 revealed prokaryotic lipoprotein lipid attachment sites. A cDNA clone comprising DNA53517 (SEQ ID NO: 255) was deposited with the ATCC on April 23, 1998 and assigned Accession No. 209802.

BA. Isolation of cDNA Clone Encoding Human PRO866 (UNQ435)

The full-length DNA sequence DNA53971 (FIG. 103, SEQ ID NO: 257) and the PRO866 native sequence protein UNQ435 (FIG. 104, SEQ ID NO: 258) derived from the kidney library of human fetuses were identified using the ECD homologous method described above.

The forward and reverse PCR primers and hybridization probes used were as follows: Forward PCR primer (44708.f1): (SEQ ID NO: 259)

5'-CAGCACTGCCAGGGGAAGAGGG-3 '

Omnidirectional PCR Primer (44708.f2): (SEQ ID NO: 260)

5'-CAGGACTCGCTACGTCCG-3 '

Omnidirectional PCR Primer (44708.f3): (SEQ ID NO: 261)

5'-CAGCCCCTTCTCCTCCTTTCTCCC-3 '

Reverse PCR Primer (44708.r1): (SEQ ID NO: 262)

5'-GCAGTTATCAGGGACGCACTCAGCC-3 '

Reverse PCR Primer (44706.r2): (SEQ ID NO: 263)

5'-CCAGCGAGAGGCAGATAG-3 '

Reverse PCR Primer (44706.r3): (SEQ ID NO: 264)

5'-CGGTCACCGTGTCCTGCGGGATG-3 '

Hybridization Probe (44708.p1): (SEQ ID NO: 265)

5'-CAGCCCCTTCTCCTCCTTTCTCCCACGTCCTATCTGCCTCTC-3 '

As shown in bold, the clone DNA53971 (SEQ ID NO: 257) has a clear translation initiation site at nucleotide positions 275-277 and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1268-1270 (Figure 103). ). The predicted native sequence PRO866 polypeptide precursor (ie UNQ435, SEQ ID NO: 258) is 331 amino acids long (FIG. 104), the calculated molecular weight is 35,844 daltons, and the pi is 5.45. The estimated molecular weight of the UNQ435 (SEQ ID NO: 258) protein shown in FIG. 104 is about 35,844 Daltons and the pi is about 5.45. Further analysis showed a signal peptide at amino acid residues about 1 to about 26, a glycosaminoclican attachment site at amino acid residues about 131-135, and cAMP- and cGMP-dependent protein kinase phosphorylation at amino acid residues about 144-148. Sites were found and amino acid residues 26-32, 74-80, 132-138, 134-140, 190-196, 287-293 and 290-296 were found to have N-myristoylation sites. A cDNA clone comprising DNA53971 (SEQ ID NO: 257) was deposited with the ATCC on April 7, 1998 and assigned Accession No. 209750.

BB. Isolation of cDNA Clone Encoding Human PRO840 (UNQ433)

For tissues isolated from a human thyroid library, the amylase yeast screening method is used as a template for PCR oligonucleotide production and ultimately DNA53987 (SEQ ID NO: 266, Figure 105) and derived from the PRO840 native sequence protein UNQ433 (SEQ ID NO: 43) 267, FIG. 106), to obtain an EST sequence to isolate.

In addition, a nucleotide sequence encoding a polypeptide having substantial homology to UNQ433 (SEQ ID NO: 267) in FIG. 106 was also available from Genbank under accession number HEEPSSARC_1.

As shown in FIG. 105, DNA53987 (SEQ ID NO: 266) has a clear open initiation site at nucleotide residues 18-20, as indicated by bold underline, and ends with a single open reading frame terminating at the stop codon (TGA) of nucleotide residues 1329-1331. Include. In addition, the second methionine codon at nucleotide residues 90-92 may be the actual translation initiation site, or it may encode an internal methionine. The predicted PRO840 polypeptide (ie, the longer translation) is called UNQ433 (SEQ ID NO: 267) and is 437 amino acids long (Figure 106), the calculated molecular weight is 49,851 Daltons and the pi is 6.47.

A cDNA clone comprising DNA53987 (SEQ ID NO: 266) was deposited with ATCC under ATCC Accession No. 209858 on May 12, 1998.

Analyzing the UNQ433 polypeptide of FIG. 106 (SEQ ID NO: 267) has a signal sequence at amino acid residues about 1-46, a transmembrane domain at amino acid residues about 319-338, and an N-glycosylation site at residues about 200-204. , Amino acid residues 23-27 have cAMP and cGMP-dependent protein kinase phosphorylation sites, amino acid residues 43-52 have tyrosine kinase phosphorylation sites, residues 17-23, 112-118, 116-122 and 185-191 It was found that there was a myristolization site.

BC. Isolation of cDNA Clone Encoding Human PRO982 (UNQ483)

EST cluster sequence 43715 was identified using the signal algorithm method described above. Then, as described for the signal algorithm method, Merck EST AA024389 was further identified by comparing this sequence to various various EST databases. The full length clone corresponding to this EST identified the full length sequence DNA57700 (FIG. 107, SEQ ID NO: 268) and the PRO982 native sequence protein UNQ483 (FIG. 108, SEQ ID NO: 269) derived therefrom.

The DNA57700 sequence (SEQ ID NO: 268) of FIG. 107 has a clear translation initiation site at nucleotide positions 26-28, as indicated by bold underline, and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 401-403. The predicted PRO982 polypeptide precursor (ie UNQ982, SEQ ID NO: 191) is 124 amino acids in length, the calculated molecular weight is approximately 14,198 daltons and the estimated pi is approximately 9.01 (FIG. 108). Further analysis of the UNQ483 (SEQ ID NO: 269) polypeptide of FIG. 108 revealed a signal peptide at amino acid residues about 1 to about 21 and a potential anaphylatoxin domain at amino acid residues about 1 to about 59. A cDNA clone comprising DNA57700 (SEQ ID NO: 268) was deposited with the ATCC on January 12, 1999 and assigned ATCC Accession No. 203583.

BD. Isolation of cDNA Clone Encoding Human PRO836 (UNQ545)

The EST cluster sequence was identified using the above described signal algorithm method, and then, as described for the above signal algorithm method, the sequence was compared with various EST databases to obtain Insight EST 2610075, which is an EST derived from colon tumor tissue. Further confirmed. The full length clone corresponding to this EST confirmed the full length sequence DNA59620 (FIG. 109, SEQ ID NO: 270) and the PRO836 native sequence protein UNQ545 (FIG. 110, SEQ ID NO: 271) derived therefrom.

The nucleotide sequence DNA59620 shown in FIG. 109 (SEQ ID NO: 270) has a clear translation initiation site at nucleotide positions 65-67, as indicated by bold underline, and includes a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 1448-1450. (FIG. 109). The predicted PRO836 polypeptide precursor (ie UNQ545, FIG. 110, SEQ ID NO: 271) is 461 amino acids in length. The estimated molecular weight of UNQ545 (SEQ ID NO: 271) shown in FIG. 110 is about 52,085 Daltons and the pI is about 5.36. Further analysis showed a signal peptide at amino acid residues about 1 to about 29, an N-glycosylation site at amino acid residues about 193 and 236, and N-myristoylation at residues about 15, 19, 234, 251, 402 and 451. Site, a conserved domain in the YJL126w / YLR351c / yhcX protein family at about 364 to about 372 amino acid residues, and a region having sequence identity with the SLS1 protein at about 68 to about 340 amino acid residues.

A cDNA clone comprising DNA59620 (SEQ ID NO: 270) was deposited with the ATCC on June 16, 1998 and assigned Accession No. 209989.

BE. Isolation of cDNA Clone Encoding Human PRO1159 (UNQ589)

Using the signal algorithm method described above, the EST cluster sequence EST cluster sequence 77245 was identified, and then, as described for the signal algorithm method, this sequence was further verified against various EST databases to further identify Insight EST 376776. . Full length clones corresponding to this EST sequence were analyzed to identify full length sequence DNA60627 (FIG. 111, SEQ ID NO: 272) and PRO1159 native sequence protein UNQ589 (FIG. 112, SEQ ID NO: 273) derived therefrom.

As indicated by the bold underline, clone DNA60627 (SEQ ID NO: 272) has a clear translation initiation site at nucleotide positions 92-94 and comprises a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 362-364 (FIG. 111). ). The predicted PRO1159 polypeptide precursor (ie UNQ589, SEQ ID NO: 273) is 90 amino acids long (FIG. 112). The estimated molecular weight of the UNQ589 (SEQ ID NO: 273) protein shown in FIG. 112 is about 9,840 Daltons and the pi is about 10.13.

The UNQ589 (SEQ ID NO: 273) sequence shown in FIG. 112 was analyzed to demonstrate the presence of: signal peptides at amino acid residues about 1 to about 15, and potential N-glycosylation sites at amino acid residues about 38. Clone DNA60627 (SEQ ID NO: 272) was deposited with ATCC on August 4, 1998 to be assigned ATCC Accession No. 203092.

BF. Isolation of cDNA Clone Encoding Human PRO1358 (UNQ707)

After identifying the EST cluster sequence using the signal algorithm method described above, as described for the signal algorithm method, the insight EST 088718, which is a fragment derived from the liver tissue library, was compared with the various EST databases. It was further confirmed. Full length clones corresponding to this EST were analyzed to identify full length sequence DNA64890 (FIG. 113, SEQ ID NO: 274) and PRO1358 native sequence protein UNQ707 (FIG. 114, SEQ ID NO: 275) derived therefrom.

The DNA64890 (SEQ ID NO: 274) clone shown in FIG. 113 has a clear translation initiation site at nucleotide positions 86-88, as indicated by bold underline, and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1418-1420. (FIG. 113). The predicted PRO1358 polypeptide precursor (ie UNQ707, SEQ ID NO: 275) is 444 amino acids long and has a signal peptide at amino acid residues about 1-18. The calculated molecular weight of UNQ707 (SEQ ID NO: 275) is approximately 50719 Daltons, and the estimated pi is approximately 8.82. A cDNA clone comprising DNA64890 (SEQ ID NO: 274), designated DNA64890-1612, was deposited with the ATCC on August 18, 1998. ATCC deposit number 203131 was assigned.

BG. Isolation of cDNA Clone Encoding Human PRO1325 (UNQ685)

The EST cluster sequence 139524 was identified using the signal algorithm method described above, and then, as described for the signal algorithm method, the sequence was further identified against various EST databases to further identify Insight EST 3744079. Full length clones corresponding to this EST were analyzed to identify full length sequence DNA66659 (FIG. 115, SEQ ID NO: 276) and PRO1325 native sequence protein UNQ685 (FIG. 116, SEQ ID NO: 277) derived therefrom.

As shown in bold, the clone DNA66659 (FIG. 115, SEQ ID NO: 276) has a clear translation initiation site at nucleotide positions 51-53 and includes a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 2547-2549. . The predicted PRO1325 polypeptide precursor (ie UNQ685, SEQ ID NO: 227) is 832 amino acids long. The estimated molecular weight of the UNQ685 (SEQ ID NO: 227) protein shown in FIG. 116 is about 94,454 Daltons and the pi is about 6.94. A further analysis of UNQ685 (SEQ ID NO: 227) revealed the presence of: amino acid about 1 to amino acid about 18 signal peptide, amino acid about 292 to amino acid about 317, amino acid about 451 to amino acid about 470, amino acid about 501 to amino acid about 520, About 607 to about 627 amino acid, about 751 to about 770 transmembrane domain, about 497 to about 518 leucine zipper pattern sequence and about 27 to about 30 amino acid, about 54 to about amino acid 57, Amino acid about 60 to about 63, amino acid position about 123 to amino acid position about 126, amino acid position about 141 to amino acid position about 144, amino acid position about 165 to amino acid position about 168, amino acid position about 364 to amino acid position about 367, amino acid position From about 476 to about 479 in amino acid position about 496 From about amino acid position 499, from about amino acid position 572 to amino acid position from about 575, from about amino acid position 603 to about amino acid position 606, and from about amino acid position 699 to amino acid position from about 702 potential N- glycosylation sites of the. A cDNA clone comprising DNA66659 (SEQ ID NO: 276) was deposited with ATCC on September 22, 1998 and assigned ATCC Accession No. 203269.

BH. Isolation of cDNA Clone Encoding Human PRO1338 (UNQ693)

The EST sequence obtained using the yeast screening method identified Insight EST2615184, an EST derived from cholecystitis gallbladder tissue, in comparison to various public and private EST databases in a manner similar to that described above for ECD homology. Ultimately, corresponding full length sequences were analyzed to isolate DNA66667 (SEQ ID NO: 278, FIG. 117) and the PRO1338 native sequence protein UNQ693 (SEQ ID NO: 279, FIG. 118) derived therefrom.

As shown in FIG. 117, DNA66667 (SEQ ID NO: 278) has an apparent translation initiation site at nucleotide residues about 115-117, as indicated by bold underline, and ends with a single open reading frame ending at the stop codon (TAA) at nucleotide positions 2263-2265. Include. The predicted PRO1338 polypeptide precursor (ie UNQ693, SEQ ID NO: 118) is 716 amino acids 716 long (Figure 118), the calculated molecular weight is 80,716 daltons, and the pi is 6.06.

The UNQ693 polypeptide (SEQ ID NO: 278) of FIG. 118 is analyzed to have a signal sequence at amino acid residues about 1-25, a transmembrane domain at amino acid residues about 629-648, and amino acid residues about 69-73, 96-100, 106-. 110, 117-121, 385-389, 517-521, 582-586 and 611-615 have N-glycosylation sites, residues about 573-582 have tyrosine kinase phosphorylation sites, amino acid residues about 16-22, 224-230, 464-470, 637-643 and 698-704 were found to have N-myristoylation sites.

CDNA comprising DNA66667 (SEQ ID NO: 278), referred to as DNA66667-1596, was deposited with the ATCC on September 22, 1998 and assigned ATCC Accession No. 203267.

BI. Isolation of cDNA Clone Encoding Human PRO1434 (UNQ739)

The full length DNA sequence DNA68818 (FIG. 119, SEQ ID NO: 280) and the PRO1434 native sequence protein UNQ739 derived therefrom were identified using the ECD homologous method described above from the human retinal tissue library (FIG. 120, SEQ ID NO: 281).

PCR primers (forward and reverse) and probes used in this method were as follows:

Omnidirectional PCR primers :

5'-GAGGTGTCGCTGTGAAGCCAACGG-3 '(SEQ ID NO: 282)

Reverse PCR Primer :

5'-CGCTCGATTCTCCATGTGCCTTCC-3 '(SEQ ID NO: 283)

Hybridization Probe : (SEQ ID NO: 284)

5'-GACGGAGTGTGTGGACCCTGTGTACGAGCCTGATCAGTGCTGTCC-3 '

As indicated in bold, the clone DNA68818 (SEQ ID NO: 280) has a clear translation initiation site at nucleotide positions 581-583 and includes a single open reading frame terminating at the stop codon (TAG) at nucleotide positions 1556-1558 (Figure 119). ). The predicted PRO1434 polypeptide precursor (ie UNQ739, SEQ ID NO: 281) is 325 amino acids in length (FIG. 120). The estimated molecular weight of the UNQ739 (SEQ ID NO: 281) protein shown in FIG. 120 is about 35,296 daltons and the pI is about 5.37. Further analysis showed a signal sequence at amino acid residues about 1-27, a glycosaminoglycan attachment site at amino acid residues about 80-84, and M-preparation at amino acid residues about 10-16, 102-108, 103-109. It was found that there is a stolation site, a cell attachment sequence at amino acid residues about 114-117, and an EGF-like domain cysteine pattern signature at amino acid residues about 176-188.

A clone comprising DNA68818 (SEQ ID NO: 280), referred to as DNA68818-2536, was deposited with the ATCC on February 9, 1999 to be assigned ATCC Accession No. 203657.

BJ. Isolation of cDNA Clone Encoding Human PRO4333 (UNQ1888)

Expression sequence tag (EST) DNA database (LIFESEQ®, Insight Pharmaceutical, Palo Alto, CA, USA) was searched in a manner analogous to the ECD homology method described above and homologous to the lymphotoxin-beta receptor. Checked EST looks like.

The ESTs functioned as templates and probes for oligonucleotide primer production to screen the kidney libraries of human fetuses in a manner similar to that described above for the ECD homologous method.

The oligonucleotides produced for this method were as follows:

Omnidirectional PCR primers : (SEQ ID NO: 287)

5'-GCAAGAATTCAGGGATCGGTCTGG-3 '

Probe : (SEQ ID NO: 288)

5'-CTGTGTTCCCTGCAACCAGTGTGGGCCAGGCATGG AGTTGTCTAAGG-3 '

Reverse : (SEQ ID NO: 289)

5'-AGATGGCATCACTG GTGGCTGAAC-3 '

Forward : (SEQ ID NO: 290)

5'-CAGAAGGCAAATTGTTCAGCCACCAG-3 '

Reverse : (SEQ ID NO: 291)

5'-ACAGTTTCCAGACCGATCCCTGAATTC-3 '

As a result, the full-length DNA sequence DNA84210 (SEQ ID NO: 285, Fig. 121) was isolated. The DNA84210 (SEQ ID NO: 285) clone shown in FIG. 121 has a clear translation initiation site at nucleotide positions 185-187, as indicated by bold underline, and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 1436-1438. do. The predicted PRO4333 polypeptide precursor (ie UNQ1888, SEQ ID NO: 286) is 417 amino acids long. The estimated molecular weight of the UNQ1888 protein (SEQ ID NO: 286) shown in FIG. 121 is about 45305 Daltons and the pi is about 5.12.

Analyzing the UNQ1888 polypeptide (SEQ ID NO: 286) of FIG. 121, the signal peptide is located at amino acid residues about 1-25, the transmembrane domain is at residues about 169-192, and residues about 105-109, 214-218, 319-323, 350-354, 368-372, 379-383 have N-glycosylation sites, residues about 200-204 and 238-242 have cAMP- and cGMP-dependent protein kinase protein kinase phosphorylation sites, and residues about 207-214 Etirosine kinase phosphorylation sites, residues 55-61, 215-218, and 270-276 have N-myristoylation sites, residues 259-270 have prokaryotic membrane lipoprotein lipid attachment sites, and residues about 89 It was found that there was a TNFR / NGFR family cysteine-rich region at -96.

A cDNA clone comprising DNA84210 (SEQ ID NO: 285), referred to as DNA84210-2576, was deposited with the ATCC on March 2, 1999 and assigned ATCC Accession No. 203818.

BK. Isolation of cDNA Clone Encoding Human PRO4302 (UNQ1866)

For tissues isolated from human tissues, EST sequences were obtained using the amylase screening methods described above and then described above for amylase yeast screening methods and / or ECD homologous methods compared to various EST databases. In the same way consensus sequences were generated. This consensus sequence was further analyzed to identify insight EST 2408081H1. Full length cron corresponding to EST 2408081H1 was analyzed to isolate full length native sequence clone DNA92218 (SEQ ID NO: 292) and PRO4302 full length native sequence protein UNQ1866 (SEQ ID NO: 293) derived therefrom.

As indicated by the bold underline, the full length clone DNA92218 (SEQ ID NO: 292) shown in FIG. 123 has a clear open initiation site at nucleotide positions 174-176 and a single open reading frame with a stop signal (TAG) at nucleotide positions 768-770. . The predicted PRO4302 polypeptide precursor (ie UNQ1866, SEQ ID NO: 293) is 198 amino acids in length, the calculated molecular weight is approximately 22,285 daltons and the estimated pi is approximately 9.35. UNQ1866 (FIG. 124, SEQ ID NO: 293) was analyzed to have a signal peptide at amino acid residues about 1 to about 23, a transmembrane domain at amino acid residues about 111 to about 130, and cAMP and cGMP-dependent at residues 26-30. Protein kinase phosphorylation site, residues 44-47 and 58-61 have casein kinase II phosphorylation site, residues 36-43 have tyrosine kinase phosphorylation site, residues 124-130, 144-150 and 189-195 It was found that there was a myristoylation site.

A cDNA clone comprising DNA92218 (SEQ ID NO: 292), referred to as DNA92218-2554, was deposited with the ATCC on March 9, 1999 and assigned Accession No. 203834.

BL. Isolation of cDNA Clone Encoding Human PRO4430 (UNQ1947)

The EST cluster sequence was identified using the signal algorithm method described above, and then, as described for the signal algorithm method, the sequence was further identified by comparing various EST databases. The consensus sequence was further analyzed to identify the full length sequence DNA96878 (FIG. 125, SEQ ID NO: 294) and the PRO4430 native sequence protein UNQ1947 (FIG. 126, SEQ ID NO: 295) derived therefrom.

The native sequence DNA sequence DNA96878 (SEQ ID NO: 294) shown in FIG. 125 has a clear translation initiation site at nucleotide positions 56-58, as indicated by bold underline, and is a single open reading frame terminating at the stop codon (TGA) at nucleotide positions 431-433. It includes. The predicted PRO4430 polypeptide precursor (UNQ1947, FIG. 126, SEQ ID NO: 295) is 125 amino acids long. The calculated molecular weight of the UNQ4430 protein (SEQ ID NO: 295) shown in FIG. 126 is approximately 13821 Daltons and the estimated pi is approximately 8.6. Further analysis shows a signal sequence at amino acid residues about 1 to about 18, an N-glycosylation site at residues about 77-80 and residues 88-91, a casein kinase II phosphorylation site at residues about 67-70, It was found that residues about 84-89 had an N-myristoylation site and residues about 85-98 had a Lys-6 / u-PAR domain.

A clone comprising DNA96878 (SEQ ID NO: 294), referred to as DNA96878-2626, was deposited with the ATCC on May 4, 1999 to be assigned the ATCC Accession No. 23-PTA.

BM. Isolation of cDNA Clone Encoding Human PRO5727 (UNQ2448)

A variety of known TNF-receptors were used to screen public and private EST databases (see, for example, the ECD homology method above) to identify insight clone 5091511H. This EST sequence derived from uterine cancer tissue then functioned as a template for the preparation of the cloning oligos shown below, after which the human thymus cDNA library containing the sequence of interest was identified by PCR. This oligonucleotide was as follows:

Omnidirectional primer (509-1) :

5'-GAGGGGGCTGGGTGAGATGTG-3 '(SEQ ID NO: 298)

Reverse Primer (509-4AS) :

5'-TGCTTTTGTACCTGCGAGGAGG-3 '(SEQ ID NO: 299)

In order to isolate the DNA sequence encoding the full length DNA98853 polypeptide, an inverse long distance PCR (FIG. 129) method was performed. The length of a PCR primer is generally in the range of 20 to 30 nucleotides. For long range reverse PCR, primer pairs were designed such that the 5 'to 3' directions of each primer were away from each other.

A pair of long range reverse PCR primers for cloning DNA98853 was synthesized as follows:

Primer 1 (left primer) (509-P5) :

5'-pCATGGTGGGAAGGCCGGTAACG-3 '(SEQ ID NO: 300)

Primer 2 (right primer) (509-P6) :

5'-pGATTGCCAAGAAAATGAGTACTGGGACC-3 '(SEQ ID NO: 301)

In the long range reverse PCR reaction, the template is a plasmid cDNA library. As a result, the PCR product has the entire vector sequence in the middle and the insert sequence of interest at both ends. After the PCR reaction, the PCR mixture was treated with Dpn I, which cuts only the template plasmid, and then PCR products larger than the size of the library cloning vector were purified by agarose gel. In addition, since the primers used for long-distance reverse PCR are also 5'-phosphorylated, the purified product is then self-ligation and transformed into E. coli-sensitive cells. Colonies were screened by PCR using 5 'vector primers and appropriate gene specific primers to identify clones with larger 5' sequences. Plasmids prepared from positive clones were sequenced. If necessary, the method can be repeated to obtain a longer 5 'sequence based on the new sequence obtained in the previous run.

The purpose of long range reverse PCR is to obtain the complete sequence of the gene of interest. Then, conventional PCR was used to obtain clones containing the full length coding region.

The primer pairs used to clone the full length coding region of DNA98853 (SEQ ID NO: 296) were as follows:

Omnidirectional Primer (Cla-MD-509):

5'-GGAGGATCGATACCATGGATTGCCAAGAAAATGAG-3 '(SEQ ID NO: 302)

Reverse primer (509.TAA.not):

5'-GGAGGAGCGGCCGCTTAAGGGCTGGGAACTTCAAAGGGCAC-3 '(SEQ ID NO: 303)

For cloning, the Cla I site and Not I site were included in the forward and reverse primers, respectively.

To clarify the correct PCR product, independent PCR reactions were performed and several cloned products were sequenced.

DNA sequencing of the clones isolated as described above provided the full length DNA sequence of the full length DNA sequence for DNA98853 (SEQ ID NO: 296, Figure 127) and the PRO5727 native sequence protein UNQ2448 (SEQ ID NO: 297, Figure 128) derived therefrom.

As shown in bold, the clone DNA98853 (SEQ ID NO: 296) has a clear translation initiation site at nucleotide positions 1-3 and includes a single open reading frame terminating at the stop codon (TAA) at nucleotide positions 901-903 (FIG. 127). do. The predicted PRO5727 polypeptide precursor (ie UNQ2448, SEQ ID NO: 297) is 299 amino acids in length (FIG. 128), the calculated molecular weight is 32,929 daltons, and the pi is 4.95. The estimated molecular weight of the UNQ2448 polypeptide (SEQ ID NO: 297) shown in FIG. 128 is about 3.3 kilodaltons and the pi is about 4.72. The potential N-glycosylation site of the amino acid sequence shown in FIG. 128 is between amino acids 74 and 77. The potential N-myristoylation site of the amino acid sequence shown in FIG. 128 is between amino acids 24 and 29. Potential casein kinase II phosphorylation sites of the amino acid sequence shown in FIG. 128 are between amino acids 123-126, 185-188, 200-203, 252-255, 257-260, 271-274, and 283-286. The potential transmembrane domain of the sequence shown in FIG. 128 is between amino acids 137-158. It is presently contemplated that the polypeptide does not comprise a signal sequence.

A cDNA clone comprising DNA98853 (SEQ ID NO: 296, referred to as DNA98853-1739) was deposited with the ATCC on April 6, 1999 to be assigned an ATTC accession number.

Example 2

Irritation Activity in Mixed Lymphocyte Reaction (MLR) Assay (Analysis 24)

This example shows that the polypeptide of the present invention is active as a stimulator of stimulated T-lymphocyte proliferation. Compounds that stimulate lymphocyte proliferation are therapeutically useful when enhancing the immune response is beneficial. The therapeutic agent may be an antagonist form of a polypeptide of the invention, eg, a murine-human chimeric antibody, humanized antibody or human antibody against said polypeptide.

Basic protocols for this analysis are described in Current Protocols in Immunology , unit 3.12; edited by JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W. Strober, National Institutes of Health, Published by John Wiley & Sons, Inc. ).

More specifically, in one assay variant, peripheral blood mononuclear cells (PBMCs) may be used for leukopheresis (one donor will supply stimulating cells PBMCs) in individual mammals such as human volunteers. Will supply the reaction cell PBMC). If necessary, these cells are frozen in fetal bovine serum and DMSO after isolation. Frozen cells were thawed overnight in assay medium (37 ° C., 5% CO ₂ ), then washed and washed with assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1 % Non-essential amino acids, 1% pyruvate) can be resuspended at 3 x 10 ⁶ cells / ml.

The cells were irradiated (˜3000 Rads) to prepare stimulator cells PBMCs. This assay was prepared by plating a mixture of 100 μl of the test sample diluted with 1% or 0.1%, 50 μl of irritated irradiated cells and 50 μl of reactive cell PBMCs in a 3-well well. 100 μl of cell culture medium or 100 μl of CD4-IgG was used as a control. These wells were then incubated at 37 ° C., 5% CO ₂ for 4 days. On day 5 each well was pulsed with tritiated thymidine (1.0 mC / well; Amersham). After 6 hours, the cells were washed three times, and then the amount of label uptake was measured.

In another variation of this assay, PBMCs were isolated from the spleen of Balb / c mice and C57B6 mice. Remove these cells from freshly harvested spleen in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids, 1% pyruvate) and Cells were placed on Lymphpholyte M (Organon Teknika) and centrifuged at 2000 rpm for 20 minutes, the mononuclear cell layer was collected and washed in assay medium, and these cells were placed in assay medium. It was isolated by resuspending at x 10 ⁷ pieces / ml. This assay was then performed as described above. The analytical results for the compounds of the present invention are shown below. If the positive increase for the control increased preferably by at least 180%, it is considered positive. However, higher values than the control suggest a stimulating effect on the test protein.

Example 3

In Hairless Guinea Pigs

Proinflammatory assay (analysis 32)

This assay is designed to determine whether a PRO polypeptide can induce vascular permeability. Polypeptides tested positive in this assay are expected to be useful in therapeutic treatment for conditions that would enhance vascular permeability, such as, for example, conditions where local immune system cell infiltration might be beneficial.

Hairless guinea pigs weighing more than 350 g were anesthetized with intramuscular ketamine (75-80 mg / kg) and 5 mg / kg xylazine. Test samples containing physiological buffers with or without PRO polypeptides were injected intradermally into the back skin of the test animal at 100 μl per injection site. The injection site per animal was approximately 16-24 sites. Next, 1 ml of Evans blue dye (1% in PBS) was injected intracardiacally. 1, 6 and / or 24 hours after administration of the test substance, the blue part diameter (mm) from the injection site was measured to determine skin vascular permeability (ie, the blemish of the injection site at the time of injection). ) Was scored visually. The diameter of the blue part (mm) was observed at the injection site, and the severity of vascular leakage for values where the standard deviation for the same animal control recorded 4 or more was also recorded. In this analysis, when the purified protein was tested, spot diameters greater than 5 mm were considered positive, indicating that there was a vascular leak or permeation induction. For conditioned medium samples, responses larger than 7 mm in diameter were considered positive. Human VEGF was used as a positive control, which induced a response of 4-8 mm in diameter at 0.1 μg / 100 μl and a response of 15-23 mm in diameter at 1 μg / 100 μl.

Test polypeptides were diluted to 1% of the initial stock solution. UNQ 585 was diluted in 10 mM HEPES / 140 mM NaCl / 4% mannitol / 1 mg / ml BSA (pH 6.8) and UNQ334 was diluted in 140 mM NaCl, 10 mM Hepes, 4% mannitol (pH 7.4).

Example 4

Skin Vascular Permeability Analysis (Analysis 64)

This analysis shows that certain PRO polypeptides induce mononuclear cells, eosinophils and PMN infiltration at the injection site of the animal, thereby stimulating the immune response and inducing inflammation. This skin vascular permeability analysis was performed as follows. Hairless guinea pigs weighing more than 350 g were anesthetized with intramuscular (IM) ketamine (75-80 mg / Kg) and 5 mg / Kg xylazine. Purified PRO polypeptide samples or conditioned medium test samples were injected intradermal at 100 μl per injection site on the back of the test animal. The injection site per animal may be about 10-30 sites, preferably about 16-24 sites. Next, 1 ml of Evans blue dye (1% in physiological buffered saline) was injected intracardiacally. The spots at the injection site were then measured 1 hour, 6 hours and 24 hours after injection (diameter in mm). Animals were sacrificed 6 hours after injection. Each skin injection site was biopsied and fixed in paraformaldehyde. The skin was then prepared for histopathology examination. Each site was examined for inflammatory cell infiltration into the skin. Sites with visible inflammatory cell infiltration were scored positive. Inflammatory cells may be neutrophils, eosinophils, monocytes or lymphocytes.

Scoring was positive if there was at least minimal perivascular infiltration at the injection site, and negative if there was no infiltration at the injection site.

Example 5

Inhibitory Activity in Mixed Lymphocyte Reaction (MLR) Assay (Analysis 67)

This example shows that one or more PRO polypeptides are active as inhibitors of proliferation of stimulated T-lymphocytes. Compounds that inhibit the proliferation of lymphocytes are useful therapeutically when inhibition of the immune response is beneficial.

Basic protocols for this assay are described in Current Protocols in Immunology , unit 3.12; edited by JE Coligan, AM Kruisbeek, DH Marglies, EM Shevach, W. Strober, National Institutes of Health, Published by John Wiley & Sons, Inc. It is described in.

More specifically, in one assay variant, peripheral blood mononuclear cells (PBMCs) can be used to provide leukopheresis (one donor will supply stimulating cell PBMCs in individual mammals, such as human volunteers, and the other donor will supply reactive cell PBMCs). Isolation). If necessary, these cells are frozen in fetal bovine serum and DMSO after isolation. Frozen cells were thawed overnight in assay medium (37 ° C., 5% CO ₂ ), then washed and washed with assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1 % Non-essential amino acids, 1% pyruvate) can be resuspended at 3 x 10 ⁶ cells / ml. The cells were irradiated (˜3000 Rads) to prepare stimulator cells PBMCs.

This assay was prepared by plating a mixture of 100 μl of the test sample diluted with 1% or 0.1%, 50 μl of irritated irradiated cells and 50 μl of reactive cell PBMC cells in a 3-well well. 100 μl of cell culture medium or 100 μl of CD4-IgG was used as a control. These wells were then incubated at 37 ° C., 5% CO ₂ for 4 days. On day 5 each well was pulsed with tritiated thymidine (1.0 mC / well; Amersham). After 6 hours, the cells were washed three times, and then the amount of label uptake was measured.

In another variation of this assay, PBMCs were isolated from the spleen of Balb / c mice and C57B6 mice. Remove these cells from freshly harvested spleen in assay medium (RPMI; 10% fetal bovine serum, 1% penicillin / streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids, 1% pyruvate), and Cells were placed on Lympholite M (Organon Technica) and centrifuged at 2000 rpm for 20 minutes and the mononuclear cell layer was collected and washed in assay medium, and these cells were reproduced in assay medium at 1 x 10 ⁷ cells / ml. Isolated by turbidity. This assay was then performed as described above.

A reduction below the control is considered a positive result for the inhibitory compound, with a reduction of 80% or less being preferred. However, lower values than the control suggest an inhibitory effect on the test protein.

Example 6

In-situ hybridization

In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences in cell and tissue samples. For example, it may be useful for identifying gene expression sites, analyzing tissue distribution of transcription, identifying and locating viral infections, tracking changes in specific mRNA synthesis, and chromosome mapping.

In situ hybridization was performed using ³³ P-labeled riboprobes generated by PCR with an optimal version of the protocol according to Lu and Gillett, Cell division 1: 169-176 (1994). Briefly, human tissues immobilized with formalin and cleaved in paraffin are cleaved, paraffin is removed, and proteins are removed with proteinase K (20 g / ml) at 37 ° C. for 15 minutes, as described in Lu and Gillett, Further treatment was performed for in situ hybridization as described above. ( ³³ P) UTP-labeled antisense riboprobe generated as a PCR product was hybridized overnight at 55 ° C. The slides were soaked in Kodak NTB2 nuclear track emulsion and exposed for 4 weeks.

³³ P-riboprobe synthesis

6.0 μl (125 mCi) of ³³ P-UTP (Amersham BF 1002, SA <2000 Ci / mMol) was dried at high speed vac. The following ingredients were added to each tube containing dried ³³ P-UTP: 2.0 μl 5 × transcription buffer, 1.0 μl DTT (100 mM), 2.0 μl NTP mixture (2.5 mM: 10 mM GTP, CTP and ATP 10 each) μ + 10 μl H ₂ O), 1.0 μl UTP (50 μM), 1.0 μl RNasin, 1.0 μl DNA template (l μg), 1.0 μl H ₂ 0

The tube was incubated for 1 hour at 37 ° C. 1.0 μl of RQ1 DNase was added and then incubated at 37 ° C. for 15 minutes. 90 μl of TE (10 mM Tris, pH 7.6) / l mM EDTA, pH 8.0) was added and the mixture was pipetted into DE81 paper. The remaining solution was loaded into a Microcon-50 ultrafiltration unit and spun for 6 minutes with program 10. The filtration unit was transferred to the second tube and spun with program 2 for 3 minutes. After the last recovery spinning, 100 μl of TE was added. 1 μl of the final product was pipetted onto DE81 paper and counted with 6 ml Bioflour II.

Probes were electrophoresed on TBE / urea gel. To 3 μl of loading buffer, 1-3 μl of probe or 5 μl of RNA Mrk III was added. After heating for 3 minutes in a 95 ° C heat block, the gel was immediately transferred to ice. After washing the wells of the gel, the samples were loaded and electrophoresed for 45 minutes at 180-250 volts. The gel was wrapped in a saran wrap and exposed to XAR film on a signal enhancing screen for 1 hour to overnight in a freezer at −70 ° C.

³³ P-hybridization

Pretreatment of frozen sections : The slides were removed from the freezer compartment and placed in an aluminum tray and melted for 5 minutes at room temperature. To reduce condensation, the trays were placed in a 55 ° C. incubator for 5 minutes. Slides were fixed for 10 minutes in ice 4% paraformaldehyde in a fume hood and washed for 5 minutes with 0.5 × SSC (25 ml 20 × SSC + 975 ml SQ H ₂ O) at room temperature. Protein was removed for 10 minutes at 37 ° C. with 0.5 μg / ml proteinase K (12.5 μl of 10 mg / ml stock in 250 ml of preheated RNase buffer without RNase), followed by 0.5 × SSC for 10 minutes at room temperature. Sections were washed. Sections were dehydrated with 70%, 95% and 100% ethanol for 2 minutes each.

Pretreatment of sections buried in paraffin : The paraffins of the slides were removed, placed in SQ H ₂ O and rinsed twice with 2 × SSC for 5 minutes at room temperature. 20 μl / ml proteinase K (10 mg / ml in 250 ml RNase buffer without RNase, 500 μl, 37 ° C., 15 min) (human embryo), or 8 × proteinase K (RNase 100 μl in 250 ml of buffer, 37 ° C., 30 min) (formalin tissue) was used to remove proteins from the sections. Then rinsed with 0.5 × SSC and dehydrated as described above.

Prehybridization: The slides were placed in a plastic box placed with filter paper saturated with Box buffer (4 × SSC, 50% formamide). Tissues were covered with 50 μl of hybridization buffer (3.75 g of dextran sulfate + 6 ml of SQ H 2 O) and vortexed, then heated in microwave for 2 minutes with the lid loosened. After ice cooling, 18.75 ml of formamide, 3.75 ml of 20 × SSC and 9 ml of SQ H ₂ O were added and the tissue well vortexed and then incubated at 42 ° C. for 1-4 hours.

Hybridization: 1.0 × 10 ⁶ cpm probe and 1.0 μl of tRNA (50 mg / ml stock) were added per slide and heated at 95 ° C. for 3 minutes. After ice cooling, 48 μl of hybridization buffer was added per slide. After vortexing, 50 μl of ³³ P mixture was added to 50 μl of prehybridization sample on the slide. This slide was incubated at 55 ° C. overnight.

Washing: 2x SSC at room temperature, washed twice with EDTA twice for 10 minutes (400 ml 20x SSC + 16 ml 0.25 M EDTA, final volume = 4 L) and treated with RNase A for 30 minutes at 37 ° C. (RNase 10 mg / ml in 250 ml of buffer, 500 μl = 20 μg / ml). Slides were washed twice with 2 × SSC, EDTA for 10 minutes at room temperature. Stringent washing conditions are as follows: 2 hours at 55 ° C. with 0.1 × SSC and EDTA (20 ml 20 × SSC + 16 ml EDTA, final volume = 4 L).

In addition, several tissue blots including poly A ⁺ RNA (2 μg per lane) from various human tissues were purchased from Clontech (Palo Alto, Calif.). DNA probes were labeled with [α- ³² P] dCTP using random priming DNA labeling beads (Pharmacia Biotech). Hybridization was performed with Expresshyb (Clontech) at 68 ° C. for 1 hour. The blots were then washed for 40 minutes with 2 × SSC / 0.05% SDS solution at room temperature and then replaced with fresh solution once while washing for 40 minutes with 0.1 × SSC / 0.1% SDS solution at 55 ° C. The blots were exposed to a phosphorizer.

DNA 29101 (VEGFB9)

DNA29101 (SEQ ID NO: 1) was examined in three separate in situ studies using the following probes:

VEGFB9-p1 (SEQ ID NO: 194):

5'-GGATTCTAATACGACTCACTATAGGGCGGCGGAATCCAACCTGAGTAG-3 '

VEGFB9-p2 (SEQ ID NO: 195):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GCG GCT ATC CTC CTG TGC TC-3 '

IS97-029 :

Expression was observed at the cartilaginous primitive edge (ie, around the outer edge) of the developing lower limb bone, and in the developing tendon, expression was observed in the vascular smooth muscle and in the cells surrounding the developing skeletal muscle muscle and root canal. In addition, expression was observed in the following tissues: bone tip growth plate; Lymph node-edge; Subcapsular regions, possibly subcapsular epithelial cells of the thymus-thymus cortex or proliferating double negative thymic cells found in these regions; Tracheal smooth muscle; Intensive expression in brain (cerebral cortex) -cortical neurons; Small intestine-smooth muscle; Thyroid-thyroid epithelial cells; Liver-ductal plate; Gastric-gastric smooth muscle; Basal layer of fetal skin-squamous epithelium; Interstitial cells of placental-trophic chorionic villi; No expression at all except the spinal cord-arterial wall and venous wall. No expression was observed in the spleen and adrenal gland.

The expression pattern suggests that DNA29101 may be involved in cell differentiation / proliferation.

IS97-037 :

Expression in hyperovulated rat ovaries was negative in all sections using antisense and sense probes. In this model no message was expressed or human probes did not crosslink with rats.

IS97-087:

High levels of expression were observed at the following sites: chimpanzee ovary-granulocytes of mature follicles, weak intensity signals observed in blastocysts; High levels of expression were observed in chimpanzee parathyroid-main cells; Moderate levels of expression were observed in stromal cells surrounding human fetal testis-developing tubes; High levels of expression were observed in chondrocytes of lung-developing bronchial medulla in human fetuses, and low levels in all branching bronchial epithelium.

Fetal (E12-E16) tissues examined include placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eyes, spinal cord, body wall, Pelvis and lower limbs. Adult tissues examined include liver, kidneys, adrenal glands, myocardium, aorta, spleen, lymph nodes, pancreas, lungs, skin, cerebral cortex (Rhesus monkey (rm)), hippocampus (Rhesus monkey), cerebellum (Rhesus monkey), Penis, eyes, bladder, stomach, gastric carcinoma, colon, colon carcinoma and chondrosarcoma. It has also been investigated to induce liver damage and cirrhosis induced by acetaminophen.

DNA30871 :

IS97-044 :

In fetal tissues, strong signals were observed throughout neurons in the fetal cerebral cortex, spinal cord, spinal ganglion and intestinal neurons in the fetal gastric wall. Signals were also observed in cells around the aortic muscle (possibly excitatory conduction system), adrenal medulla, mesenchymal cells in neurovascular bundles, renal parenchyma and cells lying between skeletal muscle cells. All other fetal tissues were negative.

No expression was observed in adult tissues. Fetal (12-16 weeks) tissues were tested including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eyes , Spinal cord, body wall, pelvis and lower limbs. Adult tissues were examined, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung and skin.

The probes used for this analysis were as follows:

DNA30871-p1 (SEQ ID NO: 196):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CCG TCT CCT CCT GTC CTC-3 '

DNA30871-p2 (SEQ ID NO: 197):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCT CGG CAT CTT CGT CAC ATT-3 '

DNA30942 :

DNA30942 (SEQ ID NO: 13) was investigated in four separate in-situ studies using the following probes (including two diseased tissue studies of Example 7 using the following probes):

DNA30942-p1 (SEQ ID NO: 198)

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TCG CTG CTG TGC CTG GTG TTG-3 '

DNA30942-p2: (SEQ ID NO: 199)

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG CTG CAG CCT CTT GAT GGA-3 '

IS97-043 :

No expression was observed in fetal tissues. Fetal tissues were examined including: placenta, umbilical cord, brain, spinal cord, eye, optic nerve, organ, lung, heart, thymus, liver, spleen, esophagus, small intestine, pancreas, adrenal gland, thyroid gland, body wall and lower limb.

No expression was observed in adult tissues. Adult tissues were examined, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung and skin.

DNA33087 (IS97-051):

In fetal tissues, expression of DNA33087 (SEQ ID NO: 18) was observed in osteoblasts, developing pulmonary arteries and aortic livers at all sites of new bone formation in the cartilage and periosteum. Fetal tissues were examined, including: placenta, umbilical cord, brain, spinal cord, eye, optic nerve, organ, lung, heart, thymus, liver, spleen, esophagus, small intestine, pancreas, adrenal gland, thyroid gland, body wall and lower limb tissue.

No expression was observed in adult tissues, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung and skin.

It is possible to play a role in controlling bone matrix deposition and / or osteoblast growth.

All adult tissues of the multiblock were positive for beta-actin.

The probes used in this method were as follows:

DNA33087-p1 (SEQ ID NO: 200):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC GAG TGT TTT CCA AGA-3 '

DNA33087-p2 (SEQ ID NO: 201):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAA GTT TAC TAG CCC ATC CAT-3 '

DNA33087-p3 (SEQ ID NO: 202):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TGG ATG GGC TAG TAA ACT TGA-3 '

DNA33087-p4 (SEQ ID NO: 203):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCC TTC TGC TCC TTC TTG TT-3 '

DNA34387 (IS97-109) :

Expression patterns of DNA34387 (SEQ ID NO: 25) were observed in fetal and adult human tissue at the following sites:

Fetus-thyroid epithelium, small intestine epithelium, gonad, pancreatic epithelium, liver cells and tubules of the liver. Expression was also observed in the developing vascular tissue of the long bone.

Moderate signals were observed in adult-placental cytotrophic membranes, tubular epithelium, bladder epithelium, parathyroid and epithelial tumors.

Fetal (week E12-E16) tissues were examined, including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower limbs.

Adult human tissue was examined, including: kidney (normal and terminal), adrenal gland, myocardium, aorta, spleen, lymph node, gallbladder, pancreas, lung, skin, eye (including retina), prostate, bladder, liver (normal, Cirrhosis, acute dysfunction).

Nonhuman primate tissues were examined, including:

Chimpanzee tissue: salivary glands, stomach, thyroid gland, parathyroid gland, skin, thymus, ovary, lymph nodes.

Rhesus monkey tissue: cerebral cortex, hippocampus, cerebellum, penis.

The probes used in this method were as follows:

DNA34387-p1 (SEQ ID NO: 206):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCG AGA TAT GCA CCC AAT GTC-3 '

DNA34387-p2 (SEQ ID NO: 207):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCC CAG AAT CCC GAA GAA CA-3 '

DNA35638 :

IS97-078 :

Expression of DNA35638 (SEQ ID NO: 35) was observed in the endothelium connecting a subset of fetal and placental vessels. Expression in the endothelium was limited to these tissue blocks only. Expression was also observed in placental mesenchymal cells.

Fetal (week E12-E16) tissues were examined, including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower limbs.

Adult tissues were examined, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (Rhesus monkey), hippocampus (Rhesus monkey), cerebellum (Rhesus monkey) ), Penis, eyes, bladder, stomach, stomach carcinoma, colon, colon carcinoma, thyroid gland (chimpanzee), parathyroid gland (chimpanch), ovary (chimpanch) and chondrosarcoma. In addition, hepatic damage and cirrhosis tissue induced by acetaminophen were also investigated.

Oligos used in the method were as follows:

DNA35638-p1 (SEQ ID NO: 208):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GGG AAG ATG GCG AGG AGG AG-3 '

DNA35638-p2 (SEQ ID NO: 209):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCA AGG CCA CAA ACG GAA ATC-3 '

DNA39523 :

The probes used in the in-vitro study were as follows:

DNA39523-p1 (SEQ ID NO: 210):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGC GCA CGG CCA CAG ACA-3 '

DNA39523-p2 (SEQ ID NO: 211):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAC CCT GCG CTT CTC GTT CCA-3 '

I98-052 :

DNA39523 (SEQ ID NO: 45) is particularly potent in basal epithelial cells in both normal human skin (the newborn's foreskin) and adult psoriasis skin-in the skin, in a monolayer along the basement membrane, a progenitor to all the epidermal cells above. Showed.

There was no expression in epidermal cells in the overlying layer (polar layer, granule layer, etc.). The signal intensity increased somewhat in psoriasis skin. Expression was also evident in the dermis (connective tissue directly below the epidermis) in both normal and psoriasis skin. The expression was most evident in spindle cells in the collagen matrix-interstitial fibroblasts.

In the brain, cerebral sections showed particularly strong expression in a subset of surface cortical neurons, a distinct pattern suggestive of a specific population of cortical neurons.

Inflammatory and normal bowel: In normal human colon and Crohn's or ulcerative colitis, there were moderate to strong specific manifestations of villus plaques in multivary patterns. In situ labeled cells were spindloid stromal cells best described as fibroblasts. There was no expression in intestinal epithelial cells, and no significant increase in expression (intensity or frequency) in the diseased intestine. Specifically, there was no correlation between expression and lesions in the inflammatory bowel.

In the kidneys of human fetuses, there were mild to moderate specific expressions in the developing tubules of polypathogenicity. Expression occurred in the coronary epithelium of this lesion.

The expression of DNA39523 (SEQ ID NO: 45) in the skin and particularly ubiquitous of basal epithelial cells of epidermal cells suggests that this plays a potential role in the differentiation / maintenance of basal epidermal cells. This expression pattern, along with the fact that it expresses in cells immediately adjacent to the base plate, suggests that these cells regulate the trafficking of white blood cells to the epidermis. As a result, DNA39523 (SEQ ID NO: 45) may be a structurally expressed signal for the transport of dendritic cells / langerhan cells or leukocytes to the epidermis. This traffic is a normal physiological event that occurs in normal skin and is considered an event involved in the skin's immune surveillance.

In inflammatory bowel disease, the expression of DNA39523 (SEQ ID NO: 45) was not increased than in normal tissues, and there was no correlation between inflammatory lesions and their expression. Similarly, its expression in basal epidermal cells in psoriasis skin lesions was equivalent or only slightly higher than that observed in normal newborn skin (but age-matched control adult skin was not available at the time of this study).

IS97-128 :

Expression of DNA39523 (SEQ ID NO: 45) was observed in the epithelium of mouse embryo skin as well as the basal epithelium and dermis of human fetal skin. In addition, basal epithelial lobes of squamous mucosa in chimpanzee tongue were also positive. It has also been observed to express in a subset of cells in the developing glomeruli of fetal kidneys, adult tubules, and the "thyroidized" epithelium of terminal renal disease. However, low expression was also observed in renal cell carcinoma, possibly in epithelial cells. In addition, expression was also observed in (1) stromal cells of the fetal lung (at a low level), and (2) stromal cells in the tip region of the gastric gland. Elevated expression was observed in the lamina propria of fetal small intestine villi, normal colon mucosa and colon carcinoma. Strong expression occurred in the benign connective tissue cells in the helanized stroma of the sarcoma. Expression also occurred in splenic red pulp and interstitial cells of placental villi. In the brain, expression occurred in cortical neurons.

DNA39523 (SEQ ID NO: 45) was also expressed in fetal nerve sheath cells and connective tissue around developing bone.

Fetal (week E12-E16) tissues were examined, including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower limbs. Adult tissues were examined, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (Rhesus monkey), hippocampus (Rhesus monkey), eye, stomach and stomach cancer Species, colon, colon carcinoma, thyroid gland (chimpanzee), parathyroid gland (chimpanch), ovary (chimpanch) and chondrosarcoma. In addition, hepatic damage and cirrhosis tissue induced with acetaminophen were also investigated.

IS98-092 :

Expression of DNA39523 (SEQ ID NO: 45) occurred in several cells in the outer layers (I and II) of the monkey cerebral cortex. In addition, a small subset of cells in the deep cortex also expressed mRNA for chemokine homologues. Dispersed cells in the molecular layer of the hippocampus and adjacent to the inner margin of the dentate gyrus were found to express DNA39523 (SEQ ID NO: 45). No expression was detected in the cerebellar cortex. Expression of DNA39523 (SEQ ID NO: 45) was not observed in infarcted brains, where cell death occurred in regions where the chemokine homologue is normally expressed. DNA39523 (SEQ ID NO: 45) may function as a marker of a subset of neurons, possibly in the cerebral cortical outer layer, possibly revealing neuronal migration disorder. Abnormal neuronal migration can be the cause of some seizure disorders and schizophrenia.

IS98-128 :

DNA39523 (SEQ ID NO: 45) showed an interesting and specific hybridization pattern in the brains of mice within 10 days of age (P) and adult mice. In one sagittal section of the P10 mouse brain, strong signals dispersed in the molecular layer of the hippocampus and the inner margin of the dentate gyrus were observed. Progenitor cells were appropriately labeled; The signal appeared elongated in a strong band through the outer layer of the laryngeal cortex and reduced to the background level in the laryngeal cortex. A subset of positive neurons was detected in the deep region of the P10 motor cortex; Neurons in the outer P10 cortex did not show signals greater than background values. In addition, a medium hybridization signal was detected in the estuary. Chemokine homologue signals were evaluated at different levels in three coronal sections of the adult mouse brain. Strong signals were detected in the septum and distributed neurons of the glial and motor muscles of the trigeminal nerve; Moderate signals were observed in the molecular layer of the hippocampus and the outer layer of the thick plate cortex.

IS99-027 :

Bolecaine (also known as BRAK-chemokine with significant homology with DNA39523 (SEQ ID NO: 45)) is a cys-x-cys (CXC) motif, and an amino-terminal glu-leu-arg (ELR) It belongs to the chemokine subgroup characterized by the absence of. Non-ELR CXC chemokines (including SDF-1, IP10, Mig and PF4) are chemotactic for a subset of white blood cells, such as B and T lymphocytes. They also have hemostatic activity.

DNA39523 (SEQ ID NO: 45) was detected in the (1) day-old mouse brain, and bolecaine signals were detected in the hippocampus (stratum lacunosum moleculare and dentate palate) and anterior olfactory nucleus. However, it was not detected in the developing cerebral cortex or cerebellum. Until P10, signals were present in a subset of cells in the 1st and 2nd layers of the cerebral cortex. In addition, a subpopulation of cells in the deep layer also expressed DNA39523 (SEQ ID NO: 45). The pattern in the hippocampus was similar to that in the P1 brain. Weak signals were present in the cerebellum, especially lobules IX and X. Signals also existed in the dorsal striatum and globules.

In the adult mouse brain, it was difficult to detect bolecaine-positive cells in the adult cerebral cortex, but signals were present in the anterior olfactory nucleus and hippocampus. However, in the ischemic mouse brain, bolecaine signals were induced in the penumbra.

In the developing cerebral cortex, bolecaine expression correlates with the final stage of neuronal migration and axon formation and synaptogenesis. Other CXC chemokines function in neuronal migration and patterning (SDF-1) in the central nervous system, and in the regulation of neuronal activity (IL-8 and GRO-a).

Bolecaine expression induces ischemic-reperfusion injury in the brain but not in other inflammatory conditions.

DNA47365 (IS97-142):

In fetal tissues, expression of DNA47635 (SEQ ID NO: 91) was observed in the fascia connecting the vertebral body front. There was expression in the retina of the fetus. There were low levels of expression in fetal neurons.

The probes used for this analysis were as follows:

DNA47365-p1 (SEQ ID NO: 214):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AAC CCG AGC ATG GCA CAG CAC-3 '

DNA47365-p2 (SEQ ID NO: 215):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT CCC AGC CGC CCC TTC TC-3 '

DNA49435 (IS97-136) :

DNA49435 (SEQ ID NO: 111) was observed to be moderately expressed in cortical neurons of the fetal brain. It was also expressed on the inner side of the fetal retina, possibly in the developing lens. Expression was also observed in the skin, cartilage, small intestine, placental villi and umbilical cord of the fetus. In adult tissues there was an extremely high level of expression in the gallbladder epithelium. DNA49435 (SEQ ID NO: 111) was observed to be moderately expressed in adult kidney, stomach and colon epithelium.

Fetal (week E12-E16) tissues were tested including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis, testicles and lower limbs. Adult human tissues were tested, including: kidney (normal and terminal), adrenal gland, spleen, lymph node, pancreas, lung, eye (including retina), bladder, liver (normal, cirrhosis, acute dysfunction).

Non-human primate tissues tested include the adrenal gland of chimpanzee tissue, and the cerebral cortex, hippocampus and cerebellum of rhesus macaque tissue.

The probes used for this analysis were as follows:

DNA49435-p1 (SEQ ID NO: 218):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GGA TCC TGG CCG GCC TCT G-3 '

DNA49435-p2 (SEQ ID NO: 219):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GCC CGG GCA TGG TCT CAG TTA-3 '

DNA54228 (IS98-105) :

Expression of DNA54228 (SEQ ID NO: 133) was observed in bone fragments of the following bones: fetal interosseous bone, fetal cranial canal (cranial bone) and human neoplasm (osteosarcoma and cartilage). Sarcoma) bone tissue. A weak but persistent signal was present in the small bone fragments and cartilage sarcomas and osteomyeloid fragments of the femoral bones. No signal was detected in fetal tissues including human lungs, liver, thymus, kidneys, thyroid, brain, spleen, and adrenal glands, brain, cartilage, lungs, liver, intestines, gonads, heart and skin .

The probes used in this method were as follows:

hmDETI-p1 (SEQ ID NO: 220):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC ACC ACC ACC CAG GAG C-3 '

hmDETI-p2 (SEQ ID NO: 221):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AAT GAA GTG GGA CGT TTG AGT-3 '

DNA54228-p1 (SEQ ID NO: 222):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTT CTT TCC TTC ACC ACC ACC-3 '

DNA54228-p2 (SEQ ID NO: 223):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT GCC TTG GCT TTT GAC AC-3 '

DNA54231 (mFIZZ3) :

IS98-070 :

DNA54231 (SEQ ID NO: 139) showed a moderate signal specific for adipocytes. This signal was present in the interstitial and mesenteric fats in the neck around the trachea. The expression pattern appears to be specific for adult fat.

IS98-109 :

The expression of DNA54231 (SEQ ID NO: 139) was specific for adipocytes and was expressed wherever these cells were present, such as the peritoneal mesentery, the perirenal fat in the renal pelvis, and the fat pad in the breast. Not expressed in normal murine brain, liver, kidney, mammary gland, pancreas, spleen, pancreas, bone marrow, stomach, duodenum, jejunum, ileum, colon, cecum, testes, skin, or any other type of cell in the lungs Did.

The selective distribution of this molecule in adipocytes suggests that it functions in fat metabolism or in the formation / forming of adipocytes, which is important for obesity.

The probes used in this method were as follows:

DNA54231-p1 (SEQ ID NO: 224):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGA GGG GGA CAG GAG CTA ATA-3 '

DNA54231-p2 (SEQ ID NO: 225):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTC CCA CGA GCC ACA GG-3 '

DNA59294 (IS98-138) :

DNA 59294 (SEQ ID NO: 149) was evaluated in a panel consisting of normal adult and fetal tissue and tissues with inflammation, mainly chronic lymphocytic inflammation. In summary, its expression was specific for muscle, certain types of smooth muscle in adults and skeletal muscle and smooth muscle in human fetuses. In adult humans, they were expressed in the smooth muscle of the coronary organs evaluated, such as the colon and gallbladder. There was no expression in the smooth muscle of the bronchus or blood vessels. Adult human skeletal muscle was not evaluated at all. In fetal tissues there was moderate to high diffuse expression in the skeletal muscles of the axial skeletal and extremities. It was weakly expressed in the smooth muscle of the intestinal wall but not in the heart muscle.

In adult tissues, low levels were diffusely expressed in the smooth muscle (muscle layer) of five specimens with chronic inflammatory bowel disease in the colon. In the gallbladder, there was weak to low expression in the smooth muscle of the gallbladder.

In human fetal tissue, there was moderate diffusion in skeletal muscle and mild to low expression in smooth muscle. However, no expression was detected in the heart of the fetus or any other fetal organ, including liver, spleen, CNS, kidney, gut, lung, and the like.

Other human tissues tested with no detectable expression included: lungs with chronic granulomatous inflammation and chronic bronchitis (5 patients), peripheral nerves, prostate, heart, placenta, liver (induced with acetomipine) Diseases including one injury and cirrhosis Multiblock), brain (cerebral and cerebellum), amygdala (reactive hyperplasia), peripheral lymph nodes, thymus.

The probes used in this method were as follows:

626.p1 (SEQ ID NO: 226):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGG AAT GGA CTG GCC TCA CAA-3 '

626.p2 (SEQ ID NO: 227):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG ATG GTC TCG GGC TGC TG-3 '

DNA30868 ( IS97-044 )

DNA30868 expression was found in fetal tissue: spinal cord, autonomic ganglia, small intestine nerve, sacral plexus, peripheral nerve and cranial nerve.

Fetal tissues were examined including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eyes, spinal cord, body wall, pelvis And lower limbs.

Adult tissues were examined, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lymph node, pancreas, lung and skin.

The probes used in this method were as follows:

DNA30868.p1 (C111-G): (SEQ ID NO: 304)

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGA GAC AGG GCA AGC AGA ATG-3 '

DNA30868.p2 (C111-H): (SEQ ID NO: 305)

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAA GGG GAT GAC TGG AGG AAC-3 '

DNA53517 :

IS98-070:

Expression of DNA53517 (SEQ ID NO: 255) in patches of normal adult murine lung was patchy, resulting in a subset of mucosal epithelial cells in the atmosphere (bronchi / bronchioles). In addition, they were expressed in distinct cells rarely found in the epilepsy of submucosal tissue adjacent to the atmosphere. These cells, typically 1-3 of the benign lesions, are adjacent to the large vessel and may be smooth muscle cells, peripheral nerve or schwann cells, or lymphatic vessels.

In murine adult lungs with allergic inflammation (eosinophilic, lymphocytic vasculitis, bronchiolitis and pulmonary interstitial), they strongly diffused and expressed in all mucosal epithelial cells of all airways (bronchi / bronchioles) of the lung. There was also strong expression in discrete cells, a subset of the epithelial cells connecting the alveoli; These cells were type II alveolar cells. In addition, they were expressed in distinct cells rarely found in the epilepsy of submucosal tissue adjacent to the atmosphere.

In normal adult murine small and large intestines, there was strong expression in several multipathogenic single cells present in the submucosal tissue, muscle layer and mesentery. Cells expressing the signal were almost always associated with the triple structure of nerves, veins, and arteries in this region. These cells are in spindle form and may be peripheral nerves, Schwann cells connected to the nerves, or some type of support cells connected to blood vessels or lymphatic vessels. Interestingly, there was no expression in the identifiable myenteric plexi in the muscle layer.

In inflammatory bowel (obtained from IL10R KO mice), expression patterns were similar but expression levels were significantly reduced.

IS98-093 :

The distribution of DNA53715 (SEQ ID NO: 255) was further examined by extensive screening of normal murine tissue. In normal lung, expression was variable when limited to epithelial cells of murine bronchus and type II alveolar cells of lung. Expression in these cells in the inflammatory lungs (allergic inflammation with hypertrophy / hyperplasia of the bronchial mucosa; asthma model) increased markedly. The expression of DNA53715 (SEQ ID NO: 255) in the intestine was most pronounced in the colon, in several distinct cells in the thin, well-distributed tissue layer between the submucosal and mucosal muscles, the musculature of the intestine and its mucous membranes. Existed. Although not exactly known what these cells are, their close association with fusiform shapes and capillaries and small blood vessels in submucosal tissue suggests the following possibilities: a subset of perivascular or anhydrous nerve fibers.

Expression of DNA53715 (SEQ ID NO: 255) in discrete cells in the intestinal submucosa is confined to the colon and jejunum. It was not expressed in the ileum, proximal duodenum or gastric sections. No expression was detected in the following normal murine tissues: liver, kidney, spleen, bone marrow, lung, pancreas, stomach, proximal duodenum, jejunum, ileum, brain, skin, testes, or mammary gland.

It is possible that DNA53715 (SEQ ID NO: 255) functions to enhance or stimulate mucosal immunity in the lung.

The probes used in this method were as follows:

DNA53517.p1 (C301-P): (SEQ ID NO: 308)

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC AGG ATG CCA ACT TTG A-3 '

DNA53517.p2 (C301-Q): (SEQ ID NO: 309)

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG AGG CCC ATC TGT TCA TAG-3 '

Example 7

In situ hybridization in cells and diseased tissues

Using the in situ hybridization method of Example 6, gene expression was measured for genes / DNAs and proteins of the present invention in diseased tissues isolated from individual individuals with specific diseases, and after analyzing the tissue distribution of transcripts, Specific mRNA synthesis changes were investigated. More specifically, the results show where the genes of the invention are expressed in diseased tissues, and in which the therapeutic effect of the inhibitory or stimulating compounds (and agonists or antagonists thereof) of the invention may be seen. The specific location is better predicted. Hybridization was performed according to the method of Example 6 using one or more of the following tissue and cell samples:

(a) lymphocytes and antigen presenting cells (dendritic cells, Langerhans cells, macrophages and monocytes, NK cells);

(b) lymphoid tissues: normal and reactive lymph nodes, thymus, bronchial Associated Lymphoid Tissues (BALT), mucosal Associated Lymphoid Tissues (MALT);

(c) human disease tissue:

The synovial membrane and joints of patients with arthritis and degenerative joint disease;

Colon of a patient with inflammatory bowel disease such as ulcerative colitis and Crohn's disease;

Skin lesions with psoriasis and other forms of dermatitis;

Lung tissue such as chronic and acute bronchitis, pneumonia, pulmonary interstitial, BALT with pleurisy and tissue lymph nodes;

Lung tissue such as BALT with asthma and tissue lymph nodes; ;

Nasal and venous sinus duct tissue in patients with rhinitis or sinusitis;

Brain and spinal cord with multiple sclerosis, Alzheimer's disease and ataxia. ;

Kidney with nephritis, glomerulonephritis and systemic lupus erythematosus;

Liver with infectious and non-infective hepatitis and cirrhosis induced with acetaminophen;

Neoplasm / cancer tissue.

Expression has been observed in one or more cells or tissues, indicating that the therapeutic effect of the compounds of the invention (and agonists or antagonists thereof) is exhibited in diseases associated with the cells or tissue samples.

The oligonucleotide sequences used for expression in the overlapping non-disease tissue distributions reported above are cited in Example 6.

DNA30942 :

IS98-021 :

Expression was observed not only in normal chimp thymus but also in monocytes of gastric carcinoma (1/1), colorectal cancer (1/1), breast cancer (2/5), and lung cancer (1/4). In osteosarcomas and poorly differentiated liposarcomas, they were expressed by malignant cells. Possible signals were observed in malignant cells of testicular teratoma and breast cancer (1/5). In one of the lung cancers, a scattered signal was observed in the high endothelial vein in the lymphoid tissue of the lung. Fetal (week E12-E16) tissues were examined, including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower limbs. Adult human tissue was examined, including: liver, kidney, adrenal gland, myocardium, aorta, spleen, lung, skin, chondroma, eye, stomach, gastric carcinoma, colon, colon carcinoma, renal cell carcinoma, prostate, bladder mucosa And gallbladder. In addition, tissues with hepatic damage and cirrhosis induced by acetaminophen were also investigated. Rhesus macaque tissue was examined, including: cerebral cortex (Rhesus monkey) and seahorse (Rhesus monkey). Chimpanzee tissue was examined, including: thyroid, parathyroid, ovary, nerves, tongue, thymus, adrenal glands, gastric mucosa and salivary glands.

IS98-085:

Expression was observed in eight adenocarcinomas and seven squamous lung carcinomas. Actin was strongly positive in all tumors, indicating that all of them were suitable for in situ hybridization assays. Expression of DNA30942 was observed in six tumors as follows:

6727-95 / squamous carcinoma-strongly expressed in neoplastic epithelium;

9558-95 / squamous carcinoma-expressed in neoplastic epithelium;

12235-95 / Adenocarcinoma-expressed in situ and invasive tumor cells;

6545-95 and 4187-96 / squamous carcinoma-expressed in cells of tumor epilepsy, not at all in tumor cells;

12954-94 / Squamous carcinoma-weak expression in stromal cells.

IS99-112:

In situ expression of DNA30942 (SEQ ID NO: 13) was evaluated in several chronic inflammatory conditions and lymphoid organs. In summary, DNA30942 (SEQ ID NO: 13) was strongly expressed in the amygdala with chronic asthma, pulmonary lymph nodes, high endothelial vein (HEV) of bronchial mucosa-associated lymphoid tissue (BALT), and colon mucosa Was expressed in patches and weak and irregular in the intestinal-mucosa-associated lymphoid tissue (GALT) HEV.

In lymphoid tissue, for chronic asthma, strong and specific in tonsils, pulmonary lymph nodes, single sections of bronchial mucosa-associated lymphoid tissue (BALT), and intestinal mucosa-associated lymphoid tissue of IBD (GALT / MALT) sections. Expression was observed. In each of these lymphoid organs, expression was specifically present in high endothelial venous (HEV).

In chronic asthmatic lung tissues, specific expression was observed not only in BALT HEV but also in small capillaries connected with high swelling or reactive swelling endothelial cells in submucosal tissue of inflammatory bronchus. This region was not intimately associated with BALT but was specific to the submucosal site for inflammatory cell traffic to the bronchus. There was significant submucosal infiltration of eosinophils in this area. In other sections of the lung with disease (COPD and chronic interstitial pneumonia), DNA30942 (SEQ ID NO: 13) was not expressed at all, and there were some artificial losses in these sections (tissue loss from the slide).

In psoriasis tissues, there was a weak expression in some small skin capillaries in psoriasis plaques. In tonsil tissues, not only were they expressed in HEVs linked to follicles, but they were also strongly expressed in reticular amygdala and epithelium. There was also expression in the blood vessels of small intraepithelial capillaries. There was also expression in some epithelial cells. It is an important immunological site and is involved in antigen presentation and can function in inducing resistance.

In tissues isolated from patients with Crohn's disease and ulcerative colitis, expression in the colon was present in the mucosa as a patch distribution in some but not all cases. The expression of GALT in HEV was significantly weaker than the signal observed in other lymphoid tissues, and was not consistently strong even in mucosal sections with patch expression.

In tissues isolated from acetaminophen-induced liver injury and cirrhosis, there was weak expression in small capillaries in the portal area with chronic lymphocytic inflammation.

DNA33460 (IS98-015) :

Expression of DNA33460 (SEQ ID NO: 20) was observed in cells of plastic connective tissue immediately adjacent to the developing external eye muscle in the fetal eye. Soft tissue sarcoma had moderate expression. Fetal (week E12-E16) tissues were examined, including: placenta, umbilical cord, liver, kidney, adrenal gland, thyroid gland, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye , Spinal cord, body wall, pelvis and lower limbs. The adult tissues examined were liver, kidney, renal cell carcinoma, adrenal gland, aorta, spleen, lymph node, pancreas, lung, myocardium, skin, cerebral cortex (Rhesus monkey), hippocampus (Rhesus monkey), cerebellum (Rhesus monkey), Bladder, prostate, stomach, gastric carcinoma, colon, colon carcinoma, thyroid gland (chimpanch), parathyroid gland (chimpanch) ovary (chimpanch) and chondrosarcoma. In addition, tissues extracted from hepatic injury and cirrhosis induced by acetaminophen were also investigated.

The probes used in this method were as follows:

DNA33460-p1 (SEQ ID NO: 204):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG CAC TGC CGG GAT GTC AAC-3 '

DNA33460-p2 (SEQ ID NO: 205):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTT TGG GCC TCG GAG CAC TG-3 '

DNA34387 (IS98-083):

Expression was observed in lung cancer tumors and was positive in all 8 squamous carcinomas and 6 of 8 adenocarcinomas. Expression was low to moderate in adenocarcinoma and very strong in squamous carcinoma. No expression was observed in tumor epilepsy, alveoli, or normal respiratory epithelium. Low levels of expression were possible in lymph nodes.

Expression was observed in lung cancer. This gene was amplified by the Taqman assay of a lung tumor panel. Expression was observed in 8 squamous carcinomas and 6 of 8 adenocarcinomas. Expression was observed in situ and infiltration components. Expression was low to moderate in adenocarcinoma. In general, the expression was more common in squamous carcinoma, and the expression was strong in two. Low levels of expression were possible in lymph nodes.

DNA35638 :

IS98-124 :

In this study, we investigated the expression of DNA35638 (SEQ ID NO: 35) in human inflammatory tissues (psoriasis, IBD, inflammatory kidneys, inflammatory lungs, hepatitis (liver block), normal tonsils, adult and chimpanzee multiblocks). Other portions of the present specification showed that DNA35638 (SEQ ID NO: 35) has immunostimulatory properties (enhancing T lymphocyte proliferation and costimulation in MLR) and proinflammatory properties (inducing neutrophil infiltration in vivo).

In this study, we evaluated the differential expression of these molecules in blood vessels in human inflammatory tissues and compared them with non-inflammatory tissues. In summary, expression is expressed in capillaries, including the endothelial / endothelium of the large vessels in the lungs of chronic inflammation, the superficial skin vessels of psoriasis skin, the arteries of chronic sclerosis nephritis samples, and the sinus around the amygdala vesicles. woke up. DNA35638 (SEQ ID NO: 35) was not expressed in normal skin (human foreskin specimens), normal lung, inflammatory (8 IBD specimens) or normal colon, chronic inflammatory or cirrhosis liver, normal adult heart tissue, or adrenal gland (in this way, Not detectable).

DNA39523 :

I98-052 :

DNA39523 (SEQ ID NO: 45) exhibited particularly strong expression in the basal epithelial cells-monolayers along the basement membrane, progenitors to both the epidermal cells above, in normal human skin (foreskin of newborn) and adult psoriasis skin.

There was no expression in epidermal cells in the overlying layer (polar layer, granule layer, etc.). The signal intensity increased somewhat in psoriasis skin. Expression was also evident in the dermis (connective tissue directly below the epidermis) in both normal and psoriasis skin. The expression was most evident in spindle cells in the collagen matrix-interstitial fibroblasts.

Inflammatory and normal bowel: In normal human colon and Crohn's or ulcerative colitis, there were moderate to strong specific manifestations of villus plaques in multivary patterns. In situ labeled cells were spindloid stromal cells best described as fibroblasts. There was no expression in intestinal epithelial cells, and no significant increase in expression (intensity or frequency) in the diseased intestine. Specifically, there was no correlation between expression and lesions in the inflammatory bowel.

The expression of DNA39523 (SEQ ID NO: 45) in the skin and particularly ubiquitous of basal epithelial cells of epidermal cells suggests that this plays a potential role in the differentiation / maintenance of basal epidermal cells. This expression pattern, along with the fact that it expresses in cells immediately adjacent to the base plate, suggests that these cells regulate the trafficking of white blood cells to the epidermis. As a result, DNA39523 (SEQ ID NO: 45) may be a structurally expressed signal for the transport of dendritic cells / langerhan cells or leukocytes to the epidermis. This traffic is a normal physiological event that occurs in normal skin and is considered an event involved in the skin's immune surveillance.

In inflammatory bowel disease, the expression of DNA39523 (SEQ ID NO: 45) was not increased than in normal tissues, and there was no correlation between inflammatory lesions and their expression. Similarly, its expression in basal epidermal cells in psoriasis skin lesions was equivalent or only slightly higher than that observed in normal newborn skin (but age-matched control adult skin was not available at the time of this study).

DNA45416 (IS98-140):

Expression of DNA45416 (SEQ ID NO: 79) was evaluated in various human and non-human primate tissues and found to be very specific. It was expressed only in alveolar macrophages in the lung and Kupffer cells in the hepatic vascular tube. Expression in these cells was significantly increased when these distinct cell populations were activated. Although the two subpopulations of these tissue macrophages are located in different organs, they have similar biological functions. These two types of phagocytes act as biological filters to remove substances such as pathogens, aged cells and proteins from the bloodstream or airways, and both can secrete a wide variety of important preinflammatory cytokines.

In inflammatory lungs (samples of seven patients), expression was pronounced in reactive alveolar macrophage populations or intra-alveolar aggregates, often defined as large, thin and alone vacuolated cells, and normal, nonreactive macrophages. (Single dispersed cells of normal size) were weak to negative expression. Expression in alveolar macrophages increased during inflammation, increasing both the number and size of these cells (activation). The interstitial inflammation and peribronchial lymphoid hyperplasia in this tissue also contain histocytes, but expression is restricted to alveolar macrophages. In addition, many inflammatory lungs also had some degree of purulent inflammation; There was no expression in neutrophil granulocytes.

In the liver, there was strong expression in the responsive / activated Cooper cells of the liver with acute lobular center necrosis (acetaminophen toxicity) or very prominent periportal inflammation. However, the expression was weak or absent in normal liver or liver cells with only mild inflammation or liver with mild to moderate lobular hyperplasia / hypertrophy. Therefore, as in the lung, there was an increase in expression in activated / reactive cells.

There was no expression of this molecule in histiocytes / macrophages present in the inflammatory bowel, hyperplastic / reactive tonsils or normal lymph nodes. The absence of expression in these tissues, all of which include histocytic inflammation or residual macrophage populations, strongly supports the limited expression in the only macrophage subset populations limited to alveolar macrophages and liver cells of the liver. However, expression of DNA454216 (SEQ ID NO: 79) could not be assessed in the spleen or bone marrow.

Human tissues evaluated with no detectable expression included: inflammatory bowel disease (samples of 7 patients with moderate to severe disease), tonsils with reactive hyperplasia, peripheral lymph nodes, psoriasis skin (slight to moderate) Samples of two patients with a degree of disease), heart, peripheral nerves. Chimpanzee tissues assessed as having no detectable expression included: tongue, stomach, thymus.

The probes used in this study were as follows:

628.p1 (SEQ ID NO: 212):

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAA GCC CAC AGT GAC AA-3 '

628.p2 (SEQ ID NO: 213):

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCT CCA CAT TTC CTG CCA GTA-3 '

DNA41374 :

IS-98-077 :

DNA41374 (SEQ ID NO: 248) expressed in T lymphocytes of the thymus.

Summary: In several tissues evaluated, expression was detected only with weak diffuse expression in T lymphocytes of the thymus. This limited distribution pattern suggests expression by T lymphocytes, or cells that are closely related to T lymphocytes, such as antigen presenting cells (such as dendritic cell populations). There was no detectable expression in regions containing significant T lymphocytes in inflammatory tissues of humans with significant lymphocytic inflammation and reactive vesicle formation (inflammatory bowel disease and chronic lymphocytic interstitial pneumonia / bronchitis). Tissues tested with no detectable expression included: normal human tissue: placenta, lung, spleen, adrenal gland, skin, kidney, eye, liver; Diseased human tissue: liver disease: chronic hepatitis, chronic cholangitis, acute lobular center necrosis (acetaminophen toxicity); Neoplasia (tumor multiblock): osteosarcoma, squamous cell carcinoma; Human fetal tissue: brain, spinal cord, lung, heart, kidney, axis and limb musculoskeletal vessels, umbilical cord; Non-human primates: tongue, thyroid gland, parathyroid gland, stomach and salivary glands.

IS98-125 .

DNA41374 (SEQ ID NO: 248) was expressed at low levels in human amygdala and non-human primate thymus in the T lymphocyte specific region. This limited distribution pattern suggests expression by T lymphocytes, or cells that are closely related to T lymphocytes, such as antigen presenting cells (such as dendritic cell populations). There was no detectable expression in areas that could contain a significant number of T lymphocytes in inflammatory tissues of humans with significant lymphocytic inflammation and reactive vesicle formation (inflammatory bowel disease and chronic lymphocytic interstitial pneumonia / bronchitis).

Inflammatory Lung: (chronic lymphocytic and granulomatous pulmonary interstitial): Sense probes were adjusted compared to weak to negative signals in interstitium. There was weak expression in the normal chimpanzee thymus (the human thymus was not available) and in the human amygdala. The expression in the human amygdala was mainly T lymphocytes of this structure, including the marginal zone of the perivesicle. Occurred in the area and in bulk.

There was no detectable expression in the following human tissues: inflammatory bowel disease (8 patients sample), chronic inflammatory and normal lung (6 patients sample), chronic sclerosis (1), chronic and acute inflammatory and transgenic liver ( 10 sample multiblock), normal and psoriasis skin, peripheral lymph nodes (non-responsive).

The probes used in this method were as follows:

41374.p1 (C337-G): (SEQ ID NO: 306)

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAC AGA ACC TCG CCA TCA-3 '

41374.p2 (C337-H): (SEQ ID NO: 307)

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TGG GGC AAG ACT CAC AAG CAG-3 '

DNA53517 :

IS98-070:

Expression of DNA53517 (SEQ ID NO: 255) in patches of normal adult murine lung was patchy, resulting in a subset of mucosal epithelial cells in the atmosphere (bronchi / bronchioles). In addition, they were expressed in distinct cells rarely found in the epilepsy of submucosal tissue adjacent to the atmosphere. These cells, typically 1-3 of the benign lesions, are adjacent to the large vessel and may be smooth muscle cells, peripheral nerve or schwann cells, or lymphatic vessels.

In murine adult lungs with allergic inflammation (eosinophilic, lymphocytic vasculitis, bronchiolitis and pulmonary interstitial), they strongly diffused and expressed in all mucosal epithelial cells of all airways (bronchi / bronchioles) of the lung. There was also strong expression in discrete cells, a subset of the epithelial cells connecting the alveoli; These cells were type II alveolar cells. In addition, they were expressed in distinct cells rarely found in the epilepsy of submucosal tissue adjacent to the atmosphere.

In normal adult murine small and large intestines, there was strong expression in several multipathogenic single cells present in the submucosal tissue, muscle layer and mesentery. Cells expressing the signal were almost always associated with the triple structure of nerves, veins, and arteries in this region. These cells are in spindle form and may be peripheral nerves, Schwann cells connected to the nerves, or some type of support cells connected to blood vessels or lymphatic vessels. Interestingly, there was no expression in the sympathetic myofascial plexus in the muscle layer.

In inflammatory bowel (obtained from IL10R KO mice), expression patterns were similar but expression levels were significantly reduced.

IS98-135 :

DNA53715 (SEQ ID NO: 255, mouse FIZZ-1) was used as a detection probe in the following human tissues: gastric carcinoma, inflammatory lung (3 patients) (vessels, alveoli, airway and mucus), aorta, heart , Placenta and gallbladder.

Mouse DNA53715 (SEQ ID NO: 255) was expressed in normal mouse lungs in the airway epithelium and markedly increased expression in inflammatory murine lungs (airway epithelium, type II alveolar cells). It was also expressed in separate cells in the submucosal tissue of the large intestine around the vascular passage.

DNA84210 :

The following probes were used in the in-situ studies shown below:

84210.p1 (F-79619): (SEQ ID NO: 310)

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GCG GTC GCA GGA CAT TCA GTA-3 '

84210.p2 (F-79620): (SEQ ID NO: 311)

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA ACT CTT TGG GTT CCA GCA CAC-3 '

DNA84210 (SEQ ID NO: 285) was expressed in fetal kidneys, mainly in the developing glomeruli and tubules of the cortical region, and also weakly in the fetal lung and spinal cord. It was also expressed in stromal cells adjacent to developing cartilage and bone. In adult tissues, weak expression was observed in the epithelium of normal bronchus, one of five lung tumors (two squamous and three adenocarcinomas) and cartilage sarcoma. Expression in the skin and its appendages is also possible, but these sections are folded and difficult to examine.

IS99-102 :

DNA84210 (SEQ ID NO: 285) was expressed in malignant melanoma, lung tumor, colon tumor, cell pellet, mouse tissue, and fetal tissue.

Expression of DNA84210 (SEQ ID NO: 285) has been observed in several adult (neoplastic and non-neoplastic) and fetal tissues. With respect to normal adult tissues, DNA84210 (SEQ ID NO: 285) has been observed in the skin's epidermis (usually the underlying cell) and skin appendages such as hair follicles and sebaceous glands connected to them. In addition, it was observed in the bronchial gland of the bronchial epithelium and submucosa. In human fetal tissues, expression of DNA84210 (SEQ ID NO: 285) was observed in the skin and skin appendages, lungs, kidney cortex and pancreatic duct. It was also observed in mesenchymal cells adjacent to developing bone and cartilage. There was no hybridization signal in mouse embryos. DNA84210 (SEQ ID NO: 285) was expressed in 1 of 6 colorectal adenocarcinomas (weak), and in 2 of 3 lung adenocarcinomas (one strong but very locally expressed and one very weak positive). It was not expressed in three lung squamous cell carcinomas, but was expressed (weak) in one chondrosarcoma. In addition, they were expressed in 5 of 5 malignant melanoma and the range of expression intensity was very weak to strong. In addition, these fragments demonstrated that DNA84210 (SEQ ID NO: 285) is expressed in normal epidermal and dermal appendages.

Example 8

Use of PRO Polypeptides as Hybridization Probes of Nucleic Acids

The following method describes the use of a nucleotide sequence encoding PRO as a hybridization probe.

As a probe for screening homologous DNA (eg, encoding a native variant) in a human tissue cDNA library or human tissue genome library, DNA comprising the coding sequence of a full length or mature PRO polypeptide is used.

Hybridization and washing of filters comprising these library DNAs is performed under the following high stringency conditions. Radially labeled PRO induction probes (e.g., PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531) , PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205 50% at 42 ° C with hybridization of filters (PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727) Perform for 20 hours in formamide, 5 × SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2 × Denhardt's solution and 10% dextran sulfate solution. Washing of the filter is carried out at 42 ° C. in an aqueous solution of 0.1 × SSC and 0.1% SDS.

Thereafter, the DNA encoding the full-length native sequence PRO polypeptide and the DNA having the desired sequence identity are identified by standard methods known in the art.

Example 9

Expression of PRO Polypeptides in E. Coli

This example describes a method for preparing PRO polypeptides in aglycosylated form by recombinant expression in E. coli.

First, the selected PCR primers are used to amplify the DNA sequence encoding the PRO polypeptide. The primer must include a restriction enzyme site corresponding to the restriction enzyme site on the selected expression vector. Various expression vectors can be used. Examples of suitable vectors are pBR322 (derived from E. coli; see Bolivar et al., Gene 2:95 (1977)) comprising ampicillin and tetracycline resistance genes. The vector is cleaved with restriction enzymes and dephosphorylated. Thereafter, PCR amplified sequences are ligated to the vector. The vector preferably comprises an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first six STII codons, a polyhis sequence and an enterokinase cleavage site), a PRO coding region, a lambda transcription terminator and a sequence encoding the argU gene. something to do.

The ligation mixture is then used to transform the E. coli strain selected by the method described in Sambrook et al., Supra. Transformants are identified by their growth capacity in LB plates and colonies with antibiotic resistance are selected. Plasmid DNA can be isolated and identified using restriction assays and DNA sequencing.

Selected clones are incubated overnight in liquid culture medium such as LB broth supplemented with antibiotics. This overnight culture can be inoculated in larger media. The cells are then incubated to the desired optical density while the expression promoter is running.

After culturing the cells for several hours or more, the cells can be recovered by centrifugation. The cell pellet obtained by centrifugation can be lysed using various reagents known in the art, and the lysed PRO polypeptide protein can be purified using a metal chelate column under conditions that allow the protein to bind strongly.

The following methods can be used to express PRO polypeptides in E. coli in the form of poly-his tags. First, the selected PCR primers are used to amplify the DNA sequence encoding the PRO polypeptide. Primers will include restriction enzyme sites corresponding to restriction enzyme sites on the selected expression vector, and other useful sequences that provide efficient and reliable initiation of translation, rapid purification through metal chelate columns, and proteolytic removal with enterokinase. . The PCR amplified, poly-his tagged sequences are then ligated to the expression vector and used to transform the E. coli host (strain 52 (W3110fuhA (tonA) lon galE rpoHts (htpRts) clpP (lacIq)). The transformants are first shaken in LB containing 50 mg / ml carbenicillin until the OD600 reaches 3 to 5 at 30 ° C. The culture is then cultured with CRAP medium (500 ml of water). 110 mM MPOS as well as 3.57 g (NH ₄ ) ₂ SO ₄ , 0.71 g sodium citrate.2H ₂ O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF. , prepared by mixing pH 7.3, 0.55% (w / v) glucose and 7 mM MgSO ₄ ), and dilute 50-100 times and shake incubate at 30 ° C. for about 20-30 hours. Assay confirms expression and centrifuge the bulk culture to pellet the cells. Freeze the cell pellet until refolding.

E. coli paste (pellets 6-10 g) obtained from 0.5-1 L fermentation is resuspended in 10-fold volume (w / v) of 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium tetrathionate are added to final concentrations of 0.1 M and 0.02 M, respectively, and the solution is stirred at 4 ° C. overnight. This step produces a denatured protein in which all cysteine residues are blocked by sulfites. The solution is centrifuged for 30 minutes at 40,000 rpm with a Beckman ultracentrifuge. The supernatant is diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and clarified by filtration with a 0.22 micron filter. Depending on the conditions, the clarified extracts are loaded onto a 5 ml Qiagen Ni-NTA metal chelate column equilibrated with metal chelate column buffer. The column is washed with additional buffer (pH 7.4) containing 50 mM imidazole (Calbiochem, Utrol grade). The protein is eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein are collected and stored at 4 ° C. Protein concentration is determined by absorbance at 280 nm using the extinction coefficient calculated on the basis of the amino acid sequence.

The protein is refolded by slowly diluting the sample with freshly prepared refolding buffer (consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA). The refolding volume is set so that the final protein concentration is between 50 and 100 μg / ml. The refolding solution is gently stirred at 4 ° C. for 12-36 hours. The refolding reaction is stopped by adding TFA so that the final concentration is 0.4% (about pH 3). Before further purification of the protein, the solution is filtered through a 0.22 micron filter and acetonitrile is added to a final concentration of 2-10%. The refolded protein is chromatographed on a Poros R1 / H reversed phase column using a 0.1% TFA transfer buffer and eluted with a 10-80% acetonitrile gradient. Aliquots of fractions showing A280 absorbance are analyzed by SDS polyacrylamide gels to collect fractions containing homogeneously refolded proteins. In general, because refolded proteins have the most compacted hydrophobic interior that is masked from interaction with reversed phase resins, properly refolded protein species among most proteins elute at the lowest concentrations of acetonitrile. do. Aggregated species are usually eluted at higher acetonitrile concentrations. The reverse phase step not only separates the misfolded form of protein from the desired form, but also removes endotoxins from the sample.

Fractions containing the desired folded PRO polypeptide are pooled and nitrogen stream is flowed into this solution to remove acetonitrile. Proteins were purified to 20 mM Hepes, pH 6.8, containing 0.14 M sodium chloride and 4% mannitol using dialysis or gel filtration using sterile filtered G25 Superfine (Pharmacia) resin equilibrated with formulation buffer. Formulate.

Example 10

Expression of PRO Polypeptides in Mammalian Cells

This example describes a method for preparing a potential glycosylated form of PRO polypeptide by recombinant expression in mammalian cells.

Vector pRK5 (see EP 307,247 published March 15, 1989) is used as expression vector. If desired, PRO DNA is ligated to pRK5 using a selected restriction enzyme, such as the ligation method as described in Sambrook et al., Supra, to insert each PRO DNA. The production vector is called for example pRK5-PRO.

In an embodiment, the selected host cell can be 293 cells. Human 293 cells (ATCC CCL 1573) are incubated in media such as DMEM supplemented with fetal bovine serum and optionally nutrients and / or antibiotics until full growth on tissue culture plates. About 10 μg of pRK5-PRO DNA is mixed with about 1 μg of DNA encoding a VA RNA gene (Thimmappaya et al., Cell, 31: 543 (1982)) and 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl ₂ Dissolve in 500 μl. 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ was added dropwise to the mixture and allowed to form a precipitate at 25 ° C. for 10 minutes. The precipitate is suspended and added to 293 cells and allowed to settle for about 4 hours at 37 ° C. The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. Thereafter, 293 cells are washed with serum free medium and incubated for about 5 days with the addition of fresh medium.

After transfection approximately 24 hours the culture medium is removed and replaced with culture medium containing a culture medium (alone) or 200 μCi / ㎖ ³⁵ S- cysteine and 200 μCi / ㎖ ³⁵ S- methionine. After 12 hours of incubation, the conditioned medium is collected, concentrated with a spin filter and loaded onto a 15% SDS gel. The treated gel can be dried and exposed to the film for a suitable time to confirm the presence of this polypeptide in the polypeptide of the invention. Cultures containing the transfected cells can be further incubated (in serum-free medium) and the medium is tested by the chosen bioassay.

As an alternative technique, pRK5-PRO is transiently introduced into 293 cells using the dextran sulfate method described in Somparyrac et al., Proc. Natl. Acad. Sci., 12: 7575 (1981). You can also 293 cells are cultured to the highest density in spin flasks and 700 μg of pRK5-PRO DNA is added. First, cells are centrifuged to concentrate from spin flasks and washed with PBS. DNA-dextran precipitates are incubated on cell pellets for 4 hours. Cells were treated with 20% glycerol for 90 seconds and washed with tissue culture medium and then placed back into the spin flask containing tissue culture medium, 5 μg / ml bovine insulin and 0.1 μg / ml bovine transferrin. After about 4 days, the medium is centrifuged and filtered to remove cells and debris. Samples containing the expressed polypeptides of the invention can be concentrated and purified by selected methods (eg dialysis and / or column chromatography).

In other embodiments, polypeptides of the invention can be expressed in CHO cells. pRK5-PRO can be transfected into CHO cells using known reagents (eg CaPO ₄ or DEAE-dextran). As mentioned above, the cell culture can be incubated and the medium can be replaced with a culture medium (alone) or a medium containing a radiolabel such as ³⁵ S-methionine. After confirming the presence of the polypeptide of the invention, the culture medium can be replaced with a serum-free medium. Preferably, the culture is incubated for about 6 days and the conditioned medium is recovered. The medium containing the expressed polypeptide of the invention can be concentrated and purified by any method chosen.

Epitope tagged polypeptides of the invention can also be expressed in CHO host cells. DNA encoding the desired polypeptide of the invention can be subcloned from the pRK5 vector. Subclonal inserts can be fused to baculovirus expression vectors in the form of attached epitope tags, such as poly-his tags, by PCR. Polypeptide inserts of the invention tagged with the poly-his tag can be subcloned into an SV40 induction vector comprising a selection marker such as DHFR for stable clone selection. Finally, CHO cells can be transfected with SV40 induction vectors (as above). Labeling can be performed in the same manner as above to confirm expression. Thereafter, the culture medium containing the expression of the polypeptide of the present invention with the poly-his tag can be concentrated and purified by any method selected, such as Ni ²⁺ -chelate affinity chromatography.

Example 11

Expression of PRO Polypeptides in Yeast

The following method describes the recombinant expression of the desired PRO in yeast.

First, yeast expression vectors are constructed to intracellularly produce or secrete PRO polypeptides from the ADH2 / GAPDH promoter. DNA encoding the polypeptides and promoters of the invention is inserted into a suitable restriction enzyme site of the plasmid selected for intracellular expression of PRO. In the case of secretion, the DNA encoding the PRO may be converted into an ADH2 / GAPDH promoter, a native sequence PRO signal peptide or other mammalian signal peptide or for example a yeast alpha-factor or invertase secretion signal / leader sequence for expression of the polypeptide of the invention, And the plasmid selected with the DNA encoding the linker sequence (if required).

Yeast cells (eg yeast strain AB110) can then be transformed with the expression plasmids described above and cultured in selected fermentation medium. Transformed yeast supernatants can be precipitated with 10% trichloroacetic acid and separated by SDS-PAGE and analyzed by staining the gel with Coomassie Blue.

The yeast cells can then be removed from the fermentation medium by centrifugation and the medium concentrated using a selected cartridge filter to isolate and purify the recombinant PRO. Concentrates comprising the polypeptides of the invention can be further purified using selected column chromatography resins.

Example 12

Expression of PRO in Insect Cells Infected with Baculovirus

The following method describes recombinant expression of PRO in insect cells infected with baculovirus.

The sequence encoding the PRO is fused upstream of the epitope tag included in the baculovirus expression vector. The epitope tag includes a poly-his tag and an immunoglobulin tag (such as the Fc region of IgG). Various plasmids can be used, including commercially available plasmids, for example plasmids derived from pVL1393 (Novagen). Briefly, if a desired portion of a sequence encoding a polypeptide of the invention or a DNA coding sequence encoding a PRO polypeptide (e.g., a sequence or protein encoding an extracellular domain of a transmembrane protein is an extracellular protein, Sequence) is amplified by PCR using primers complementary to the 5 'and 3' regions. The 5 'primer may comprise contiguous (selected) restriction enzyme sites. The product is then cleaved with the selected restriction enzymes and subcloned into the expression vector.

Recombinant baculoviruses use the lipofectin (obtained from Gibco-BRL) to transfer the plasmid and BaculoGold ™ viral DNA (Phamingen) to Spodoptera frugiperda ( "Sf9") cells (ATCC CRL 1711) are simultaneously transfected. After incubation at 28 ° C. for 4-5 days, the released virus is recovered and used for subsequent amplification. Viral infection and protein expression are performed as described in O'Reilley et al., Baculovirus Expression vectors: A laboratory Manual, Oxford: Oxford University Press (1994).

The polypeptide of the invention with the poly-his tag can then be purified, for example by Ni ²⁺ -chelate affinity chromatography. Extracts are prepared from Sf9 cells infected with recombinant virus as described in Rupert et al., Nature , 362 : 175-179 (1993). Briefly, Sf9 cells were washed and resuspended in sonication buffer (25 ml Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M KCl) and 20 seconds on ice. Sonicate twice during. The sonicate is removed by centrifugation and the supernatant diluted 50-fold in loading buffer (50 mM phosphoric acid, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. A Ni ²⁺ -NTA agarose column (purchased from Quiagen) is prepared in a 5 ml fill volume, washed with 25 ml of water and equilibrated with 25 ml of loading buffer. The filtered cell extracts are loaded into the column at 0.5 ml per minute. The column is washed with loading buffer until A ₂₈₀ reaches baseline and starting point fraction recovery. Next, the column is washed with secondary wash buffer (50 mM phosphoric acid; 300 mM NaCl, 10% glycerol, pH 6.0) to elute nonspecifically bound protein. Once A ₂₈₀ reaches baseline again, the column is developed with an imidazole gradient of 0 to 500 mM in secondary wash buffer. 1 ml fractions were collected and analyzed by Western blotting with SDS-PAGE and silver staining or Ni ²⁺ -NTA (Qiagen) bound to alkaline phosphatase. Fractions comprising the polypeptide of the present invention with the eluted His ₁₀ tag are collected and dialyzed with loading buffer.

Alternatively, purification of an IgG tagged (or Fc tagged) PRO polypeptide may be performed using known chromatography techniques (eg, Protein A or Protein G column chromatography).

Example 13

Preparation of Antibodies That Bind to PRO

This example describes a method of making a monoclonal antibody that can specifically bind to a polypeptide of the invention.

Techniques for producing monoclonal antibodies are known in the art and are described in, for example, Goding, supra. Immunogens that can be used include the purified polypeptide of the invention itself, a fusion protein comprising each of the polypeptide of the invention, and a cell expressing the polypeptide of the invention on the cell surface. One skilled in the art can select immunogens without undue trial and error.

Mice (eg Balb / c) are immunized by subcutaneous or intraperitoneal injection of polypeptide immunogens of the invention emulsified in Freund's complete adjuvant in an amount of 1-100 μg. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, Montana, USA) and injected into the hind paw of the animal. Immunized mice are boosted with additional immunogen emulsified in selected adjuvants after 10-12 days. Thereafter, the mice may be boosted with further immunization injections for several weeks. Serum samples may be taken periodically from mice by retro-orbital bleeding and tested for ELISA assays to detect antibodies specific for each of the polypeptides of the invention.

Once a suitable antibody titer is detected, each animal of the polypeptide of the invention is finally injected intravenously into an animal that is "positive" to the antibody. After 3-4 days, the mice are sacrificed to recover the spleen cells. The splenocytes are then fused with selected rat myeloma cell lines (eg P3X63AgU.1 available from ATCC No. CRL 1597) (using 35% polyethylene glycol). The fusions yield hybridoma cells that can be plated in 96 well tissue culture plates containing HAT (Hipoxanthin, aminopterin and thymidine) media that inhibit the proliferation of non-fusion cells, myeloma hybrids and splenocyte hybrids. Create

Hybridoma cells are screened by ELISA for reactivity to each of the polypeptides of the invention. Methods of determining "positive" hybridoma cells that secrete the desired monoclonal antibodies to the polypeptides of the present invention are well known to those skilled in the art.

Winter-type Balb / c mice are anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti-PRO272 Anti-PRO332, Anti-PRO526, Anti-PRO701, Anti-PRO361, Anti-PRO362, Anti-PRO363, Anti-PRO364, Anti-PRO356, Anti-PRO531, Anti-PRO533, Anti-PRO1083, Anti-PRO865, Anti -PRO770, anti-PRO769, anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246 Anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344, anti -PRO333, anti-PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333 Positive hybridoma cells can be injected intraperitoneally to produce ascites, including anti-PRO4302, anti-PRO4430 or anti-PRO5727 monoclonal antibodies. Alternatively, the hybridoma cells may be cultured in tissue culture flasks or roller bottles. Ammonium sulfate precipitation followed by gel exclusion chromatography can be used to purify the monoclonal antibodies produced in the ascites. Alternatively, affinity chromatography based on the binding of the antibody to Protein A or Protein G may be employed.

Deposit of matter

The following materials have been deposited in the American Type Culture Collection (ATCC), Manassas University Boulevard 10801, Virginia, USA: 20110-2209.

Substance UNQ PRO ATCC # ATCC Deposit Date

DNA29101-1276 174 200 209653 March 5, 1998

DNA30871-1157 178 204 209380 Oct 16, 1997

DNA30942-1134 186 212 209 254 September 16, 1997

DNA33087-1158 190 216 209381 Sep 16, 1997

DNA33460-1166 200 226 209376 Oct 16, 1997

DNA34387-1133 214 240 209260 Sep 16, 1997

DNA35558-1167 209 235 209374 October 16, 1997

DNA35638-1141 219 245 209265 September 16, 1997

DNA35916-1161 146 172 209419 Oct 28, 1997

DNA39523-1192 240 273 209424 October 31, 1997

DNA40620-1183 239 272 209388 October 17, 1997

DNA40982-1235 293 332 209433 November 7, 1997

DNA44184-1319 330 526 209704 March 26, 1998

DNA44205-1285 365 701 209720 March 31, 1998

DNA45410-1250 316 361 209621 February 5, 1998

DNA45416-1251 317 362 209620 February 5, 1998

DNA45419-1252 318 363 209616 February 5, 1998

DNA47365-1206 319 364 209436 November 7, 1997

DNA47470-1130 313 356 209422 Oct 28, 1997

DNA48314-1320 332 531 209702 March 26, 1998

DNA49435-1219 334 533 209480 November 21, 1997

DNA50921-1458 540 1083 209859 May 12, 1998

DNA53974-1401 434 865 209774 April 14, 1998

DNA54228-1366 408 770 209801 April 23, 1998

DNA54231-1366 407 769 209804 April 23, 1998

DNA56405-1357 430 788 209849 May 6, 1998

DNA57033-1403 557 1114 209905 May 27, 1998

DNA57690-1374 491 1007 209950 June 9, 1998

DNA59220-1514 598 1184 209962 June 9, 1998

DNA59294-1381 516 1031 209866 May 14, 1998

DNA59776-1600 701 1346 203 128 Aug 18, 1998

DNA59849-1504 585 1155 209986 June 16, 1998

DNA60775-1532 633 1250 203173 1 September 1998

DNA61873-1574 678 1312 203132 Aug 18, 1998

DNA62814-1521 606 1192 203093 August 4, 1998

DNA64885-1529 630 1246 203457 Nov 3, 1998

DNA65404-1551 653 1283 203244 9 September 1998

DNA65412-1523 608 1195 203094 August 4, 1998

DNA66675-1587 698 1343 203282 September 22, 1998

DNA68864-1629 732 1418 203276 September 22, 1998

DNA68872-1620 722 1387 203160 Aug 25, 1998

DNA68874-1622 728 1410 203277 September 22, 1998

DNA76 400-2528 900 1917 203573 Jan 12, 1999

DNA77624-2515 859 1868 203553 December 22, 1998

DNA30868-1156 179 205 ----- March 2, 2000

DNA36638-1056 21 21 209456 November 12, 1997

DNA38260-1180 236 269 209397 October 17, 1997

DNA40592-1242 303 344 209492 November 21, 1997

DNA41374-1312 294 333 ----- -------------

DNA44194-1317 322 381 209808 April 28, 1998

DNA53517-1366 388 720 209802 April 23, 1998

DNA53971-1359 435 866 209750 April 7, 1998

DNA53987-1438 433 840 209858 May 12, 1998

DNA57700-1408 483 982 203583 January 12, 1999

DNA59620-1463 545 836 209989 June 16, 1998

DNA60627-1508 589 1159 203092 August 4, 1998

DNA64890-1612 707 1358 203131 August 18, 1998

DNA66659-1593 685 1325 203269 September 22, 1998

DNA66667-1596 693 1338 203267 September 22, 1998

DNA68818-2536 739 1434 203657 February 9, 1999

DNA84210-2576 1888 4333 203818 March 2, 1999

DNA92218-2554 1866 4302 203834 9 March 1999

DNA96878-2626 1947 4430 23-PTA May 4, 1999

DNA98853-1739 2448 5727 203906 April 6, 1999

These deposits were made under the provisions of the Budapest Treaty and its rules (Budapest Treaty) on the international approval of microbial deposits under the patent procedure. This ensures maintenance of the viable culture of the deposit for 30 years from the date of deposit. The deposit will be distributed from ATCC to the agreement between Genentech, Inc. and ATCC under the Convention of the Budapest Treaty, which will be made public upon the granting of the relevant U.S. patent or the publication of a U.S. or foreign patent application, whichever comes first. To ensure the permanent and non-limiting distribution of deposits of progeny, and by the US Patent and Trademark Commissioner, see 35 USC §122 and the rules of the US Patent and Trademark Commissioner (including 37 CFR §1.14, in particular 886 OG 638). Progenie's sale is assured to those who decide to have a right.

The assignee of the present application agrees that upon incubation under appropriate conditions, if the culture of the deposited material is killed, lost or damaged, the material will be replaced immediately with another identical material upon notification. The sale of deposited materials should not be construed as an authorization of the governments to carry out the invention in violation of the rights granted under the patent law.

The foregoing description is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not intended to be limited to the scope of the deposited structure as the deposited embodiments are intended as an illustration of certain aspects of the present invention, and any structure that is functionally equivalent is within the scope of the present invention. The deposit of a substance herein does not mean that the disclosure contained herein is inappropriate for carrying out any aspect, including the best mode of the invention, and is intended to limit the scope of the claims to the specific description set forth in the specification. It should not be interpreted. Indeed, various modifications of the invention in addition to those shown and described herein above are apparent to those skilled in the art, which will be within the scope of the appended claims.

Claims (44)

PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptide, agonists or fragments thereof, and carriers or excipients, (a) inflammatory cells into tissues To increase inflammatory cell infiltration into the tissue from a mammal in need of increased infiltration, (b) to stimulate or enhance an immune response in a mammal that needs to stimulate or enhance an immune response, or (c) Proliferation of T-lymphocytes in response to antigen A composition useful for the treatment of an immune related disease, having the property of increasing the proliferation of T-lymphocytes in response to an antigen in a mammal in need thereof. The effective amount of PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, A composition comprising a PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptide, an agonist, antagonist or fragment thereof. The composition of claim 2 further comprising a growth inhibitory agent, a cytotoxic agent or a chemotherapeutic agent. PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, (A) Inflammatory cell infiltration into tissues of PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptides, agonists or fragments thereof, need to be increased To increase inflammatory cell infiltration into the tissue from a living mammal, (b) to stimulate or enhance an immune response in a mammal that needs to stimulate or enhance an immune response, or (c) to respond to an antigen. Mammals need to increase lymphocyte proliferation In reaction to the antigen for the manufacture of a composition having the property of increasing the proliferation of T- lymphocytes. The effective amount of PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, Use of a PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, PRO5727 polypeptides, agonists, antagonists or fragments thereof. The composition of claim 2 further comprising a growth inhibitory agent, a cytotoxic agent or a chemotherapeutic agent. In mammals in need of treatment for an immune related disorder, an effective amount of PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptides, agonist antibodies thereof, A method of treating an immune related disorder, such as a T cell mediated disorder, comprising administering an antagonist antibody, or fragment. The method of claim 7, wherein the disorder is systemic lupus erythematosus, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, spondyloarthropathy, systemic sclerosis, idiopathic inflammatory muscle disorder, Sjoegren's syndrome, systemic vasculitis, sarcoidosis, autoimmunity Central and peripheral such as hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immune-mediated kidney disease, multiple sclerosis, idiopathic demyelinating polyneuritis or Guillain-Barre syndrome and chronic inflammatory demyelinating polyneuritis Hepatobiliary diseases such as demyelinating diseases of the nervous system, infectious and autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis and sclerosing cholangitis, inflammatory bowel disease, gluten-sensitive bowel disease and whiff (Whipple's diesase), bullous Autoimmune or immune mediated skin such as skin disorders, polymorphic erythema and contact dermatitis Allergic diseases such as lungs, psoriasis, asthma, allergic rhinitis, atopic dermatitis, food intolerance and urticaria, immune diseases of the lung such as eosinophilic pneumonia, idiopathic pulmonary fibroids and irritable pneumonia, graft rejection and graft-versus-host disease The method selected from transplant related diseases. The composition according to any one of claims 1 to 8, wherein the agonist or antagonist is a monoclonal antibody or a use thereof. The composition or use thereof according to any one of claims 1 to 9, wherein said agonist or antagonist is an antibody fragment or a single chain antibody. The composition of claim 9 or 10, wherein said antibody has a non-human complementarity determining region (CDR) residue and a human framework region (FR) residue. PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, The cells suspected to contain the PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, PRO5727 polypeptides were identified as anti-PRO200, anti-PRO204, anti-PRO212, anti -PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti-PRO272, anti-PRO332, anti-PRO526, anti-PRO701, anti-PRO361, anti-PRO362 Anti-PRO363, Anti-PRO364, Anti-PRO356, Anti-PRO531, Anti-PRO533, Anti-PRO1083, Anti-PRO865, Anti-PRO770, Anti-PRO769, Anti-PRO788, Anti-PRO1114, Anti-PRO1007, Anti -PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, Anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti- PRO205, anti-PRO21, anti-PRO269, anti-PRO344, anti-PRO333, anti-PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, The presence of the polypeptide comprising exposing to an anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333, anti-PRO4302, anti-PRO4430, or anti-PRO5727 antibody and determining whether the antibody binds to the cell How to measure it. (a) a test sample of tissue cells obtained from a mammal, and (b) a control sample of known normal tissue cells of the same cell type, PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, Measuring the expression level of a gene encoding a PRO4333, PRO4302, PRO4430, or PRO5727 polypeptide, wherein a higher or lower expression level in the test sample compared to the control sample is immunorelevant in mammals that obtained the test tissue cell. To indicate the presence of the disease Phosphorus, diagnosis of immune-related diseases in mammals. (a) Anti-PRO200, Anti-PRO204, Anti-PRO212, Anti-PRO216, Anti-PRO226, Anti-PRO240, Anti-PRO235, Anti-PRO245, Anti-PRO172, Anti-PRO273, Anti-PRO272, Anti-PRO332 Anti-PRO526, Anti-PRO701, Anti-PRO361, Anti-PRO362, Anti-PRO363, Anti-PRO364, Anti-PRO356, Anti-PRO531, Anti-PRO533, Anti-PRO1083, Anti-PRO865, Anti-PRO770, Anti -PRO769, anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246, anti-PRO1283 Anti-PRO1195, Anti-PRO1343, Anti-PRO1418, Anti-PRO1387, Anti-PRO1410, Anti-PRO1917, Anti-PRO1868, Anti-PRO205, Anti-PRO21, Anti-PRO269, Anti-PRO344, Anti-PRO333, Anti -PRO381, anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333, anti-PRO4302 Contacting a test sample of tissue cells obtained from a mammal with an anti-PRO4430 or anti-PRO5727 antibody and (b) detecting complex formation between the antibody and the PRO polypeptide in the test sample. , Diagnosis of immune related disease in a mammal comprising a. Anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti-PRO272, anti-PRO332, anti- PRO526, anti-PRO701, anti-PRO361, anti-PRO362, anti-PRO363, anti-PRO364, anti-PRO356, anti-PRO531, anti-PRO533, anti-PRO1083, anti-PRO865, anti-PRO770, anti-PRO769, Anti-PRO788, anti-PRO1114, anti-PRO1007, anti-PRO1184, anti-PRO1031, anti-PRO1346, anti-PRO1155, anti-PRO1250, anti-PRO1312, anti-PRO1192, anti-PRO1246, anti-PRO1283, anti- PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344, anti-PRO333, anti-PRO381, Anti-PRO720, anti-PRO866, anti-PRO840, anti-PRO982, anti-PRO836, anti-PRO1159, anti-PRO1358, anti-PRO1325, anti-PRO1338, anti-PRO1434, anti-PRO4333, anti-PRO4302, anti- A diagnostic kit for an immune related disease comprising the PRO4430 or anti-PRO5727 antibody or fragment thereof and a carrier in a suitable package. The method of claim 15, wherein PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, Kit further comprising instructions on how to use antibodies to detect PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptide. Vessel, Courageous guidelines, and An active agent-containing composition contained in the container, The composition is effective for the suppression or alleviation of an immune response in a mammal, and the guiding instructions for the container can be used for the treatment of an immune related disease, wherein the active agent in the composition is PRO200, PRO204, PRO212, PRO216, PRO226, PRO240. , PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346 , PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159 , PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, or PRO5727 an article of manufacture that indicates an agent that inhibits the expression and / or activity of a polypeptide. 18. The method of claim 17, wherein the active agent is anti-PRO200, anti-PRO204, anti-PRO212, anti-PRO216, anti-PRO226, anti-PRO240, anti-PRO235, anti-PRO245, anti-PRO172, anti-PRO273, anti -PRO272, anti-PRO332, anti-PRO526, anti-PRO701, anti-PRO361, anti-PRO362, anti-PRO363, anti-PRO364, anti-PRO356, anti-PRO531, anti-PRO533, anti-PRO1083, anti-PRO865 Anti-PRO770, Anti-PRO769, Anti-PRO788, Anti-PRO1114, Anti-PRO1007, Anti-PRO1184, Anti-PRO1031, Anti-PRO1346, Anti-PRO1155, Anti-PRO1250, Anti-PRO1312, Anti-PRO1192, Anti -PRO1246, anti-PRO1283, anti-PRO1195, anti-PRO1343, anti-PRO1418, anti-PRO1387, anti-PRO1410, anti-PRO1917, anti-PRO1868, anti-PRO205, anti-PRO21, anti-PRO269, anti-PRO344 Anti-PRO333, Anti-PRO381, Anti-PRO720, Anti-PRO866, Anti-PRO840, Anti-PRO982, Anti-PRO836, Anti-PRO1159, Anti-PRO1358, Anti-PRO1325, Anti-PRO1338, Anti-PRO1434, Anti An article of manufacture that is -PRO4333, anti-PRO4302, anti-PRO4430 or anti-PRO5727 antibody. Candidate compounds and PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770 , PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333 , Contacting these two components under time and conditions sufficient for the interaction of the PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptides, A method for identifying a compound capable of inhibiting the expression or activity of the PRO polypeptide. The method of claim 19, wherein the candidate compound or the PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531 , PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205 , PRO21, PRO269, PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430 or PRO5727 polypeptide is immobilized on a solid support. The method of claim 20, wherein the non-fixed component has a detectable label. FIG. 1 (SEQ ID NO: 1), FIG. 3 (SEQ ID NO: 11), FIG. 5 (SEQ ID NO: 13), FIG. 7 (SEQ ID NO: 18), FIG. 9 (SEQ ID NO: 20), FIG. 11 (SEQ ID NO: 25), FIG. 13 (SEQ ID NO: 30), FIG. 15 (SEQ ID NO: 35), FIG. 17 (SEQ ID NO: 40), FIG. 19 (SEQ ID NO: 45), FIG. 21 (SEQ ID NO: 50), FIG. 23 (SEQ ID NO: 56), FIG. 25 (SEQ ID NO: 61), FIG. 27 (SEQ ID NO: 66), FIG. 29 (SEQ ID NO: 71), Figure 31 (SEQ ID NO: 79), Figure 33 (SEQ ID NO: 86), Figure 35 (SEQ ID NO: 91), Figure 37 (SEQ ID NO: 101), Figure 39 (SEQ ID NO: 106), Figure 41 (SEQ ID NO: 111), Figure 43 ( SEQ ID NO: 116, FIG. 45 (SEQ ID NO: 123), FIG. 47 (SEQ ID NO: 133), FIG. 49 (SEQ ID NO: 139), FIG. 51 (SEQ ID NO: 141), FIG. 53 (SEQ ID NO: 143), FIG. 55 (SEQ ID NO: 145), FIG. 147, Figure 59 (SEQ ID NO: 149), Figure 61 (SEQ ID NO: 151), Figure 63 (SEQ ID NO: 156), Figure 65 (SEQ ID NO: 158), Figure 67 (SEQ ID NO: 160), Figure 69 (SEQ ID NO: 162), Figure 71 (SEQ ID NO: 167). ), FIG. 73 (SEQ ID NO: 169), FIG. 75 (SEQ ID NO: 177), FIG. 77 (SEQ ID NO: 179), FIG. 79 (SEQ ID NO: 184), FIG. 81 (SEQ ID NO: 186), FIG. 83 (SEQ ID NO: 188), FIG. 85 (SEQ ID NO: 190). 87 (SEQ ID NO: 192), FIG. 89 (SEQ ID NO: 228), FIG. 91 (SEQ ID NO: 230), FIG. 93 (SEQ ID NO: 232), FIG. 95 (SEQ ID NO: 240), FIG. 97 (SEQ ID NO: 24). 8), Figure 99 (SEQ ID NO: 250), Figure 101 (SEQ ID NO: 255), Figure 103 (SEQ ID NO: 257), Figure 105 (SEQ ID NO: 266), Figure 107 (SEQ ID NO: 268), Figure 109 (SEQ ID NO: 270), Figure 111 (SEQ ID NO: 272). ), FIG. 113 (SEQ ID NO: 274), FIG. 115 (SEQ ID NO: 276), FIG. 117 (SEQ ID NO: 278), FIG. 119 (SEQ ID NO: 280), FIG. 121 (SEQ ID NO: 285), FIG. 123 (SEQ ID NO: 292), FIG. 125 (SEQ ID NO: 294). Or an isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence encoding an amino acid sequence selected from the group consisting of amino acid sequences shown in FIG. 127 (SEQ ID NO: 296). FIG. 1 (SEQ ID NO: 1), FIG. 3 (SEQ ID NO: 11), FIG. 5 (SEQ ID NO: 13), FIG. 7 (SEQ ID NO: 18), FIG. 9 (SEQ ID NO: 20), FIG. 11 (SEQ ID NO: 25), FIG. 13 (SEQ ID NO: 30), FIG. 15 (SEQ ID NO: 35), FIG. 17 (SEQ ID NO: 40), FIG. 19 (SEQ ID NO: 45), FIG. 21 (SEQ ID NO: 50), FIG. 23 (SEQ ID NO: 56), FIG. 25 (SEQ ID NO: 61), FIG. 27 (SEQ ID NO: 66), FIG. 29 (SEQ ID NO: 71), Figure 31 (SEQ ID NO: 79), Figure 33 (SEQ ID NO: 86), Figure 35 (SEQ ID NO: 91), Figure 37 (SEQ ID NO: 101), Figure 39 (SEQ ID NO: 106), Figure 41 (SEQ ID NO: 111), Figure 43 ( SEQ ID NO: 116, FIG. 45 (SEQ ID NO: 123), FIG. 47 (SEQ ID NO: 133), FIG. 49 (SEQ ID NO: 139), FIG. 51 (SEQ ID NO: 141), FIG. 53 (SEQ ID NO: 143), FIG. 55 (SEQ ID NO: 145), FIG. 147, FIG. 59 (SEQ ID NO: 149), FIG. 61 (SEQ ID NO: 151), FIG. 63 (SEQ ID NO: 156), FIG. 65 (SEQ ID NO: 158), FIG. 67 (SEQ ID NO: 160), FIG. 69 (SEQ ID NO: 162), FIG. 71 (SEQ ID NO: 167). ), FIG. 73 (SEQ ID NO: 169), FIG. 75 (SEQ ID NO: 177), FIG. 77 (SEQ ID NO: 179), FIG. 79 (SEQ ID NO: 184), FIG. 81 (SEQ ID NO: 186), FIG. 83 (SEQ ID NO: 188), FIG. 85 (SEQ ID NO: 190). 87 (SEQ ID NO: 192), FIG. 89 (SEQ ID NO: 228), FIG. 91 (SEQ ID NO: 230), FIG. 93 (SEQ ID NO: 232), FIG. 95 (SEQ ID NO: 240), FIG. 97 (SEQ ID NO: 24). 8), Figure 99 (SEQ ID NO: 250), Figure 101 (SEQ ID NO: 255), Figure 103 (SEQ ID NO: 257), Figure 105 (SEQ ID NO: 266), Figure 107 (SEQ ID NO: 268), Figure 109 (SEQ ID NO: 270), Figure 111 (SEQ ID NO: 272). ), FIG. 113 (SEQ ID NO: 274), FIG. 115 (SEQ ID NO: 276), FIG. 117 (SEQ ID NO: 278), FIG. 119 (SEQ ID NO: 280), FIG. 121 (SEQ ID NO: 285), FIG. 123 (SEQ ID NO: 292), FIG. 125 (SEQ ID NO: 294). Or an isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of nucleotide sequences shown in FIG. 127 (SEQ ID NO: 296). FIG. 1 (SEQ ID NO: 1), FIG. 3 (SEQ ID NO: 11), FIG. 5 (SEQ ID NO: 13), FIG. 7 (SEQ ID NO: 18), FIG. 9 (SEQ ID NO: 20), FIG. 11 (SEQ ID NO: 25), FIG. 13 (SEQ ID NO: 30), FIG. 15 (SEQ ID NO: 35), FIG. 17 (SEQ ID NO: 40), FIG. 19 (SEQ ID NO: 45), FIG. 21 (SEQ ID NO: 50), FIG. 23 (SEQ ID NO: 56), FIG. 25 (SEQ ID NO: 61), FIG. 27 (SEQ ID NO: 66), FIG. 29 (SEQ ID NO: 71), Figure 31 (SEQ ID NO: 79), Figure 33 (SEQ ID NO: 86), Figure 35 (SEQ ID NO: 91), Figure 37 (SEQ ID NO: 101), Figure 39 (SEQ ID NO: 106), Figure 41 (SEQ ID NO: 111), Figure 43 ( SEQ ID NO: 116, FIG. 45 (SEQ ID NO: 123), FIG. 47 (SEQ ID NO: 133), FIG. 49 (SEQ ID NO: 139), FIG. 51 (SEQ ID NO: 141), FIG. 53 (SEQ ID NO: 143), FIG. 55 (SEQ ID NO: 145), FIG. 147, FIG. 59 (SEQ ID NO: 149), FIG. 61 (SEQ ID NO: 151), FIG. 63 (SEQ ID NO: 156), FIG. 65 (SEQ ID NO: 158), FIG. 67 (SEQ ID NO: 160), FIG. 69 (SEQ ID NO: 162), FIG. 71 (SEQ ID NO: 167). ), FIG. 73 (SEQ ID NO: 169), FIG. 75 (SEQ ID NO: 177), FIG. 77 (SEQ ID NO: 179), FIG. 79 (SEQ ID NO: 184), FIG. 81 (SEQ ID NO: 186), FIG. 83 (SEQ ID NO: 188), FIG. 85 (SEQ ID NO: 190). 87 (SEQ ID NO: 192), FIG. 89 (SEQ ID NO: 228), FIG. 91 (SEQ ID NO: 230), FIG. 93 (SEQ ID NO: 232), FIG. 95 (SEQ ID NO: 240), FIG. 97 (SEQ ID NO: 24). 8), Figure 99 (SEQ ID NO: 250), Figure 101 (SEQ ID NO: 255), Figure 103 (SEQ ID NO: 257), Figure 105 (SEQ ID NO: 266), Figure 107 (SEQ ID NO: 268), Figure 109 (SEQ ID NO: 270), Figure 111 (SEQ ID NO: 272). ), FIG. 113 (SEQ ID NO: 274), FIG. 115 (SEQ ID NO: 276), FIG. 117 (SEQ ID NO: 278), FIG. 119 (SEQ ID NO: 280), FIG. 121 (SEQ ID NO: 285), FIG. 123 (SEQ ID NO: 292), FIG. 125 (SEQ ID NO: 294). Or an isolated nucleic acid having at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of full length coding sequences of the nucleotide sequences shown in FIG. 127 (SEQ ID NO: 296). ATCC deposit number 209653, 209380, 209254, 209381, 209376, 209260, 209374, 209265, 209419, 209424, 209388, 209433, 209704, 209720, 209621, 209620, 209616, 209436, 209422, 209702, 209480, 209859, 209774, 209774 , 209802, 209849, 209905, 209950, 209962, 209866, 203128, 209986, 203173, 203132, 203093, 203457, 203244, 203094, 203282, 203276, 203160, 203277, 203573, 203553, --------- Deposited as 209456, 209397, 209492, ---------, 209808, 209802, 209750, 209858, 203583, 209989, 203092, 203131, 203269, 203267, 203657, 203818, 203834, 23-PTA, 203906 An isolated nucleic acid having at least 80% nucleic acid sequence identity with the full length coding sequence of the isolated DNA. A vector comprising a nucleic acid according to any one of claims 22 to 25. 27. The vector of claim 26 operably linked to regulatory sequences recognized by said host cell transformed with said vector. A host cell comprising the vector of claim 26. The host cell of claim 28, which is a CHO cell. The host cell of claim 28 which is E. coli. The host cell of claim 28 which is a yeast cell. The host cell of claim 28 is PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, Proliferate under conditions suitable for the expression of PRO344, PRO333, PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, or PRO5727 polypeptides and A method for producing the polypeptide, comprising recovering it. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO: 21), Figure 12 (SEQ ID NO: 26), Figure 14 (SEQ ID NO: 31), and FIG. 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62), Figure 28 (SEQ ID NO: 67), Figure 30 (SEQ ID NO: 72), Figure 32 (SEQ ID NO: 80), Figure 34 (SEQ ID NO: 87), Figure 36 (SEQ ID NO: 92), Figure 38 (SEQ ID NO: 102), Figure 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 ( SEQ ID NO: 117, FIG. 46 (SEQ ID NO: 124), FIG. 48 (SEQ ID NO: 134), FIG. 50 (SEQ ID NO: 140), FIG. 52 (SEQ ID NO: 142), FIG. 54 (SEQ ID NO: 144), FIG. 56 (SEQ ID NO: 146), FIG. 148, FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. 70 (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168). ), Figure 74 (SEQ ID NO: 170), Figure 76 (SEQ ID NO: 178), Figure 78 (SEQ ID NO: 180), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ID NO: 187), Figure 84 (SEQ ID NO: 189), Figure 86 (SEQ ID NO: 191) 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 94 (SEQ ID NO: 233), FIG. 96 (SEQ ID NO: 241), FIG. 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273). ), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286), FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295). Or an isolated polypeptide having at least 80% amino acid sequence identity with an amino acid sequence selected from the group consisting of amino acid sequences shown in FIG. 128 (SEQ ID NO: 297). Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO: 21), Figure 12 (SEQ ID NO: 26), Figure 14 (SEQ ID NO: 31), and FIG. 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62), Figure 28 (SEQ ID NO: 67), Figure 30 (SEQ ID NO: 72), Figure 32 (SEQ ID NO: 80), Figure 34 (SEQ ID NO: 87), Figure 36 (SEQ ID NO: 92), Figure 38 (SEQ ID NO: 102), Figure 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 ( SEQ ID NO: 117, FIG. 46 (SEQ ID NO: 124), FIG. 48 (SEQ ID NO: 134), FIG. 50 (SEQ ID NO: 140), FIG. 52 (SEQ ID NO: 142), FIG. 54 (SEQ ID NO: 144), FIG. 56 (SEQ ID NO: 146), FIG. 148, FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. 70 (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168). ), Figure 74 (SEQ ID NO: 170), Figure 76 (SEQ ID NO: 178), Figure 78 (SEQ ID NO: 180), Figure 80 (SEQ ID NO: 185), Figure 82 (SEQ ID NO: 187), Figure 84 (SEQ ID NO: 189), Figure 86 (SEQ ID NO: 191) 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 94 (SEQ ID NO: 233), FIG. 96 (SEQ ID NO: 241), FIG. 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273). ), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286), FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295). Or an isolated polypeptide that records 80% or more when compared to an amino acid sequence selected from the group consisting of amino acid sequences shown in FIG. 128 (SEQ ID NO: 297). ATCC deposit number 209653, 209380, 209254, 209381, 209376, 209260, 209374, 209265, 209419, 209424, 209388, 209433, 209704, 209720, 209621, 209620, 209616, 209436, 209422, 209702, 209480, 209859, 209774, 209774 , 209802,209849, 209905, 209950, 209962, 209866, 203128, 209986, 203173, 203132, 203093, 203457, 203244, 203094, 203282, 203276, 203160, 203277, 203573, 203553, --------- Deposited as 209456, 209397, 209492, ---------, 209808, 209802, 209750, 209858, 203583, 209989, 203092, 203131, 203269, 203267, 203657, 203818, 203834, 23-PTA, 203906 An isolated polypeptide having an amino acid sequence identity of at least 80% with an amino acid sequence encoded by the full-length coding sequence of the synthesized DNA. A chimeric molecule comprising the polypeptide of any one of claims 33-35 fused to a heterologous amino acid sequence. The chimeric molecule of claim 36, wherein the heterologous amino acid sequence is an epitope tag sequence. The chimeric molecule of claim 36, wherein the heterologous amino acid sequence is an Fc region of an immunoglobulin. 36. An antibody that specifically binds to a polypeptide according to any one of claims 33 to 35. The antibody of claim 39 which is a monoclonal antibody, humanized antibody or single chain antibody. (a) no signal peptide bound, Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO: 21), Figure 12 (SEQ ID NO: 26). ), Figure 14 (SEQ ID NO: 31), Figure 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62) 28 (SEQ ID NO: 67), FIG. 30 (SEQ ID NO: 72), FIG. 32 (SEQ ID NO: 80), FIG. 34 (SEQ ID NO: 87), FIG. 36 (SEQ ID NO: 92), FIG. 38 (SEQ ID NO: 102), FIG. 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), FIG. 58 (SEQ ID NO: 148), FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168), FIG. 74 (SEQ ID NO: 170), FIG. 76 (SEQ ID NO: 178), FIG. 78 (SEQ ID NO: 180), FIG. 80 (SEQ ID NO: 185), FIG. 82 (SEQ ID NO: 187), FIG. SEQ ID NO: 189), FIG. 86 (SEQ ID NO: 191), FIG. 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 233, FIG. 96 (SEQ ID NO: 241), FIG. 98 (SEQ ID NO: 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269). ), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286). , Nucleotide sequence encoding the polypeptide shown in FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295) or 128 (SEQ ID NO: 297), or (b) having the bound signal peptide, FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 12), FIG. 6 (SEQ ID NO: 14), FIG. 8 (SEQ ID NO: 19), FIG. 10 (SEQ ID NO: 21), FIG. 12 (SEQ ID NO: 26). ), Figure 14 (SEQ ID NO: 31), Figure 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62) 28 (SEQ ID NO: 67), FIG. 30 (SEQ ID NO: 72), FIG. 32 (SEQ ID NO: 80), FIG. 34 (SEQ ID NO: 87), FIG. 36 (SEQ ID NO: 92), FIG. 38 (SEQ ID NO: 102), FIG. 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), FIG. 58 (SEQ ID NO: 148), FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168), FIG. 74 (SEQ ID NO: 170), FIG. 76 (SEQ ID NO: 178), FIG. 78 (SEQ ID NO: 180), FIG. 80 (SEQ ID NO: 185), FIG. 82 (SEQ ID NO: 187), FIG. SEQ ID NO: 189), FIG. 86 (SEQ ID NO: 191), FIG. 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 233, FIG. 96 (SEQ ID NO: 241), FIG. 98 (SEQ ID NO: 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269). ), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286). Nucleotide sequence encoding the extracellular domain of the polypeptide shown in FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295) or 128 (SEQ ID NO: 297), or (c) no signal peptide bound, Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO: 21), Figure 12 (SEQ ID NO: 26). ), Figure 14 (SEQ ID NO: 31), Figure 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62) 28 (SEQ ID NO: 67), FIG. 30 (SEQ ID NO: 72), FIG. 32 (SEQ ID NO: 80), FIG. 34 (SEQ ID NO: 87), FIG. 36 (SEQ ID NO: 92), FIG. 38 (SEQ ID NO: 102), FIG. 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), FIG. 58 (SEQ ID NO: 148), FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168), FIG. 74 (SEQ ID NO: 170), FIG. 76 (SEQ ID NO: 178), FIG. 78 (SEQ ID NO: 180), FIG. 80 (SEQ ID NO: 185), FIG. 82 (SEQ ID NO: 187), FIG. SEQ ID NO: 189), FIG. 86 (SEQ ID NO: 191), FIG. 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 233, FIG. 96 (SEQ ID NO: 241), FIG. 98 (SEQ ID NO: 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269). ), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286). , Isolated nucleic acid having at least 80% nucleic acid sequence identity with the nucleotide sequence encoding the extracellular domain of the polypeptide shown in FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295) or 128 (SEQ ID NO: 297). (a) no signal peptide bound, Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO: 21), Figure 12 (SEQ ID NO: 26). ), Figure 14 (SEQ ID NO: 31), Figure 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62) 28 (SEQ ID NO: 67), FIG. 30 (SEQ ID NO: 72), FIG. 32 (SEQ ID NO: 80), FIG. 34 (SEQ ID NO: 87), FIG. 36 (SEQ ID NO: 92), FIG. 38 (SEQ ID NO: 102), FIG. 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), FIG. 58 (SEQ ID NO: 148), FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168), FIG. 74 (SEQ ID NO: 170), FIG. 76 (SEQ ID NO: 178), FIG. 78 (SEQ ID NO: 180), FIG. 80 (SEQ ID NO: 185), FIG. 82 (SEQ ID NO: 187), FIG. SEQ ID NO: 189), FIG. 86 (SEQ ID NO: 191), FIG. 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 94 (SEQ ID NO: 2). 33 (SEQ ID NO: 241), FIG. 98 (SEQ ID NO: 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269). ), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286). , The polypeptide shown in FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295) or 128 (SEQ ID NO: 297), or (b) having the bound signal peptide, FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 12), FIG. 6 (SEQ ID NO: 14), FIG. 8 (SEQ ID NO: 19), FIG. 10 (SEQ ID NO: 21), FIG. 12 (SEQ ID NO: 26). ), Figure 14 (SEQ ID NO: 31), Figure 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62) 28 (SEQ ID NO: 67), FIG. 30 (SEQ ID NO: 72), FIG. 32 (SEQ ID NO: 80), FIG. 34 (SEQ ID NO: 87), FIG. 36 (SEQ ID NO: 92), FIG. 38 (SEQ ID NO: 102), FIG. 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), FIG. 58 (SEQ ID NO: 148), FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168), FIG. 74 (SEQ ID NO: 170), FIG. 76 (SEQ ID NO: 178), FIG. 78 (SEQ ID NO: 180), FIG. 80 (SEQ ID NO: 185), FIG. 82 (SEQ ID NO: 187), FIG. SEQ ID NO: 189), FIG. 86 (SEQ ID NO: 191), FIG. 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 233, FIG. 96 (SEQ ID NO: 241), FIG. 98 (SEQ ID NO: 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269). ), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286). , The extracellular domain of the polypeptide shown in FIG. 124 (SEQ ID NO: 293), FIG. 126 (SEQ ID NO: 295) or 128 (SEQ ID NO: 297), or, (c) no signal peptide bound, Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 12), Figure 6 (SEQ ID NO: 14), Figure 8 (SEQ ID NO: 19), Figure 10 (SEQ ID NO: 21), Figure 12 (SEQ ID NO: 26). ), Figure 14 (SEQ ID NO: 31), Figure 16 (SEQ ID NO: 36), Figure 18 (SEQ ID NO: 41), Figure 20 (SEQ ID NO: 46), Figure 22 (SEQ ID NO: 51), Figure 24 (SEQ ID NO: 57), Figure 26 (SEQ ID NO: 62) 28 (SEQ ID NO: 67), FIG. 30 (SEQ ID NO: 72), FIG. 32 (SEQ ID NO: 80), FIG. 34 (SEQ ID NO: 87), FIG. 36 (SEQ ID NO: 92), FIG. 38 (SEQ ID NO: 102), FIG. 40 (SEQ ID NO: 107), Figure 42 (SEQ ID NO: 112), Figure 44 (SEQ ID NO: 117), Figure 46 (SEQ ID NO: 124), Figure 48 (SEQ ID NO: 134), Figure 50 (SEQ ID NO: 140), Figure 52 (SEQ ID NO: 142), Figure 54 (SEQ ID NO: 144), Figure 56 (SEQ ID NO: 146), FIG. 58 (SEQ ID NO: 148), FIG. 60 (SEQ ID NO: 150), FIG. 62 (SEQ ID NO: 152), FIG. 64 (SEQ ID NO: 157), FIG. 66 (SEQ ID NO: 159), FIG. 68 (SEQ ID NO: 161), FIG. (SEQ ID NO: 163), FIG. 72 (SEQ ID NO: 168), FIG. 74 (SEQ ID NO: 170), FIG. 76 (SEQ ID NO: 178), FIG. 78 (SEQ ID NO: 180), FIG. 80 (SEQ ID NO: 185), FIG. 82 (SEQ ID NO: 187), FIG. SEQ ID NO: 189), FIG. 86 (SEQ ID NO: 191), FIG. 88 (SEQ ID NO: 193), FIG. 90 (SEQ ID NO: 229), FIG. 92 (SEQ ID NO: 231), FIG. 233, FIG. 96 (SEQ ID NO: 241), FIG. 98 (SEQ ID NO: 249), FIG. 100 (SEQ ID NO: 251), FIG. 102 (SEQ ID NO: 256), FIG. 104 (SEQ ID NO: 258), FIG. 106 (SEQ ID NO: 267), FIG. 108 (SEQ ID NO: 269). ), FIG. 110 (SEQ ID NO: 271), FIG. 112 (SEQ ID NO: 273), FIG. 114 (SEQ ID NO: 275), FIG. 116 (SEQ ID NO: 277), FIG. 118 (SEQ ID NO: 279), FIG. 120 (SEQ ID NO: 281), FIG. 122 (SEQ ID NO: 286). 124 (SEQ ID NO: 293), 126 (SEQ ID NO: 295), or an isolated polypeptide having at least 80% amino acid sequence identity with the extracellular domain of the polypeptide shown in FIG. 128 (SEQ ID NO: 297). Effective amount of PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO333, Contacting the PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, or PRO5727 polypeptides with PBMC cells and measuring T cell proliferation changes with control levels. To affect T cell proliferation. Effective amount of PRO200, PRO204, PRO212, PRO216, PRO226, PRO240, PRO235, PRO245, PRO172, PRO273, PRO272, PRO332, PRO526, PRO701, PRO361, PRO362, PRO363, PRO364, PRO356, PRO531, PRO533, PRO1083, PRO865, PRO770, PRO769, PRO788, PRO1114, PRO1007, PRO1184, PRO1031, PRO1346, PRO1155, PRO1250, PRO1312, PRO1192, PRO1246, PRO1283, PRO1195, PRO1343, PRO1418, PRO1387, PRO1410, PRO1917, PRO1868, PRO205, PRO21, PRO269, PRO344, PRO333, PRO333, Blood vessels, comprising injecting a PRO381, PRO720, PRO866, PRO840, PRO982, PRO836, PRO1159, PRO1358, PRO1325, PRO1338, PRO1434, PRO4333, PRO4302, PRO4430, or PRO5727 polypeptide to a test animal, and thereby measuring the degree of vascular permeability How to affect permeability.