JP2003524406A - Compositions and methods for inhibiting tumor cell growth - Google Patents

Abstract

(57) SUMMARY The present invention relates to methods and compositions for inhibiting tumor cell growth. In particular, the present invention relates to anti-tumor compositions and methods for treating tumors. The invention further relates to screening methods for identifying growth inhibitory, eg, antitumor, compounds. The present invention relates to novel polypeptides and nucleic acid molecules encoding these polypeptides. Here, vectors and host cells containing these nucleic acid sequences, chimeric polypeptide molecules containing the polypeptide of the present invention fused to a heterologous polypeptide sequence, antibodies binding to the polypeptide of the present invention, and polypeptides of the present invention There is also provided a method of producing

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to methods and compositions for inhibiting tumor cell growth. In particular, the invention relates to anti-tumor compositions and methods for treating tumors. The invention further relates to screening methods for identifying growth inhibitory, eg anti-tumor compounds.

BACKGROUND OF THE INVENTION Malignant tumors (cancers) are the second leading cause of death in the United States after heart disease (Boring et al., CA Cancel J. Clin., 43: 7 [1993]). Cancer is an increase in the number of abnormal or tumorigenic cells that are derived from normal tissue to form the tumor entity, invasion of adjacent tissues by these tumorigenic tumor cells, and ultimately the blood and lymphatic system. It is characterized by the generation of malignant cells that diffuse (metastasize) to local lymph nodes and distant sites through the. In a cancerous state, cells proliferate under conditions in which normal cells do not grow. Cancer itself manifests in a wide variety of forms characterized by different degrees of invasiveness and aggression. Despite recent advances in cancer therapy, there is a great need for new therapeutic agents capable of inhibiting tumor cell growth. Therefore, it is an object of the present invention to identify compounds capable of inhibiting the growth of tumor cells such as cancer cells.

(Outline of the Invention) 1. Embodiments The present invention relates to methods and compositions for inhibiting tumor cell growth. More particularly, the invention relates to methods and compositions for the treatment of tumors including cancers such as breast cancer, prostate cancer, rectal cancer, lung cancer, ovarian cancer, kidney cancer and CNS cancer in a mammalian patient, preferably a human. Regarding In one aspect, the invention provides a substance useful for inhibiting tumor cell growth comprising an effective amount of a PRO polypeptide as defined herein, or an agonist thereof, in admixture with a pharmaceutically acceptable carrier. The composition of In a preferred embodiment, the composition of matter comprises a growth inhibiting amount of the PRO polypeptide, or agonist thereof.
In another preferred embodiment, the composition contains a cytotoxic amount of the PRO polypeptide, or agonist thereof. In some cases, the composition of matter may contain one or more additional growth inhibitory and / or cytotoxic and / or other chemotherapeutic agents.

In a further aspect, the invention relates to a composition of matter useful for the treatment of tumors in mammals, comprising a therapeutically effective amount of a PRO polypeptide as defined herein, or an agonist thereof. The tumor is preferably cancer. In another aspect, the invention relates to a method of inhibiting the growth of tumor cells, comprising exposing the cells to an effective amount of a PRO polypeptide as defined herein, or an agonist thereof. In a particular embodiment, the agonist is an anti-PRO agonist antibody. In another embodiment, the agonist is a small molecule that mimics the biological activity of PRO polypeptides. This method can be performed in vitro or in vivo.

In yet a further aspect, the invention provides: (1) a container; (2) a composition comprising an active agent contained within the container, the composition comprising neoplastic cell growth, eg tumor cell growth. And the active agent in the composition is a PRO polypeptide as defined herein, or an agonist thereof; and (3) Use of the PRO polypeptide or agonist thereof for inhibiting tumor cell growth. A label attached to the container or a package insert enclosed in the container described above, wherein the agonist may be an antibody that binds to the PRO polypeptide.

In a particular embodiment, the agonist is an anti-PRO agonist antibody. In another embodiment, the agonist is a small molecule that mimics the biological activity of PRO polypeptides. Also within the scope of the invention is a similar product comprising a PRO polypeptide as defined herein, or an agonist thereof, in a therapeutically effective amount for the treatment of tumors. Also within the scope of the invention is an article of manufacture containing a PRO polypeptide as defined herein, or an agonist thereof, as well as an additional growth inhibitor, cytotoxic agent or chemotherapeutic agent.

2. Further Embodiments In another embodiment of the present invention, the invention provides an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a PRO polypeptide. In one aspect, the isolated nucleic acid molecule comprises (a) the extracellular sequence of a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, a transmembrane protein with or without a signal peptide disclosed herein. At least about 80% relative to a DNA molecule encoding a PRO polypeptide having a domain, or other specifically identified fragment of the full-length amino acid sequence disclosed herein, or (b) (a) the complement of the DNA molecule. Sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity. Sex, more preferably at least about 85% sequence identity, more preferably at least about 86% sequence identity, more preferably less. At least about 87% sequence identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably at least About 9
1% sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity, more preferably at least about 94% sequence identity, more preferably at least about 95%. Of sequence identity, more preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98% sequence identity, and more preferably at least about 99%. A nucleotide sequence having the sequence identity of

In another aspect, the isolated nucleic acid molecule comprises (a) a PR lacking the coding sequence of the full-length PRO polypeptide cDNA disclosed herein, the signal peptide disclosed herein.
O polypeptide coding sequence, the coding sequence of the extracellular domain of a transmembrane PRO polypeptide disclosed herein with or without a signal peptide, or the coding of other specifically identified fragments of the full length amino acid sequence disclosed herein. Molecule with a sequence
Or (b) at least about 80% sequence identity to the complement of the DNA molecule of (a), preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, and Preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity, more preferably at least about 85%.
Sequence identity, more preferably at least about 86% sequence identity, more preferably at least about 87% sequence identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity. Identity, more preferably at least about 90% sequence identity, more preferably at least about 91% sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity. , More preferably at least about 94% sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96.
% Sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98% sequence identity, and more preferably at least about 9%.
Includes nucleotide sequences with 9% sequence identity.

In a further aspect, the invention provides (a) a DNA molecule encoding the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein, or (b) ( At least about 80% sequence identity to the complement of the DNA molecule of a), preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83. %
Sequence identity, more preferably at least about 84% sequence identity, more preferably at least about 85% sequence identity, more preferably at least about 86% sequence identity, more preferably at least about 87% sequence identity. Identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 91% sequence identity. , More preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity, more preferably at least about 94%.
% Sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98%. It relates to an isolated nucleic acid molecule comprising a nucleotide sequence having sequence identity, and more preferably sequence identity of at least about 99%.

Another aspect of the invention is a nucleotide sequence encoding a PRO polypeptide having a deleted transmembrane domain or an inactivated transmembrane domain, or complementary to such a coded nucleotide sequence. Providing an isolated nucleic acid molecule comprising a specific nucleotide sequence, the transmembrane domain of such a polypeptide is disclosed herein. Therefore, the soluble extracellular domain of the PRO polypeptides described herein is considered.

Another embodiment is directed to fragments of the PRO polypeptide coding sequence, or complements thereof, which, for example, optionally encode a polypeptide which comprises a binding site for an anti-PRO antibody. It finds use as a hybridization probe for an encoding fragment of a PRO polypeptide or as an antisense oligonucleotide probe. Such nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, more preferably at least about 50 nucleotides in length, more preferably at least about 60 nucleotides in length, More preferably at least about 70 nucleotides long, more preferably at least about 80 nucleotides long, more preferably at least about 90 nucleotides long, more preferably at least about 10 nucleotides long.
0 nucleotides in length, more preferably at least about 110 nucleotides in length, more preferably at least about 120 nucleotides in length, more preferably at least about 13 in length.
0 nucleotides long, more preferably at least about 140 nucleotides long, more preferably at least about 150 nucleotides long, and more preferably at least about 16 nucleotides.
0 nucleotides long, more preferably at least about 170 nucleotides long, more preferably at least about 180 nucleotides long, more preferably at least about 19 nucleotides long.
0 nucleotides in length, more preferably at least about 200 nucleotides in length, more preferably at least about 250 nucleotides in length, more preferably at least about 30.
0 nucleotides in length, more preferably at least about 350 nucleotides in length, more preferably at least about 400 nucleotides in length, more preferably at least about 45.
0 nucleotides in length, more preferably at least about 500 nucleotides in length, more preferably at least about 600 nucleotides in length, more preferably at least about 70.
0 nucleotides in length, more preferably at least about 800 nucleotides in length, more preferably at least about 900 nucleotides in length, more preferably at least about 10 in length.
100 nucleotides in length, where the term "about" is meant to refer to a nucleotide sequence length that is plus or minus 10% of the referenced length. Novel fragments of the PRO polypeptide-encoding nucleotide sequence can be prepared by aligning the PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well-known sequence alignment programs. By determining whether the PRO polypeptide-encoding nucleotide sequence fragment is novel,
It may be identified by a routine method. All such PRO polypeptide-encoding nucleotide sequences are considered herein. Also contemplated are PRO polypeptides encoded by these nucleotide molecule fragments, preferably PRO polypeptide fragments that include a binding site for an anti-PRO antibody.

In another embodiment, the present invention provides an isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences identified above. In one aspect, the invention provides a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide disclosed herein, or disclosed herein. At least about 80 relative to the PRO polypeptide with other specifically identified fragments of the full-length amino acid sequence
% Sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence. Identity, more preferably at least about 85% sequence identity, more preferably at least about 86% sequence identity,
More preferably at least about 87% sequence identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably Is at least about 91%
Of sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity, more preferably at least about 94% sequence identity, more preferably at least about 95% sequence identity. Identity, more preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98% sequence identity, and more preferably at least about 99% sequence identity. It relates to an isolated PRO polypeptide comprising amino acid sequences having identity.

In a further aspect, the invention features at least about 80% sequence identity, preferably at least about 81, to the amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC disclosed herein. % Sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity, more preferably at least about 85%. Sequence identity, more preferably at least about 86% sequence identity, more preferably at least about 87% sequence identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity. Sex, more preferably at least about 90% sequence identity, more preferably at least about 9
1% sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity, more preferably at least about 94% sequence identity, more preferably at least about 95%. Of sequence identity, more preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98% sequence identity, and more preferably at least about 99%. Isolated PR containing amino acid sequences having the sequence identity of
O polypeptide.

In a further aspect, the invention provides a full-length amino acid sequence disclosed herein, an amino acid sequence lacking a signal peptide disclosed herein, an extracellular domain of a transmembrane protein with or without a signal peptide disclosed herein, or herein. At least about 80% positive, preferably at least about 81% positive, more preferably at least about 82% positive, and more preferably when compared to a PRO polypeptide having other specifically identified fragments of the full-length amino acid sequence disclosed in. Is at least about 83%
Positive, more preferably at least about 84% positive, more preferably at least about 85% positive, more preferably at least about 86% positive,
More preferably at least about 87% positive, more preferably at least about 8
8% positive, more preferably at least about 89% positive, more preferably at least about 90% positive, more preferably at least about 91% positive, more preferably at least about 92% positive, more preferably at least about 93% positive, and more. Preferably at least about 94% positive, more preferably at least about 95% positive, more preferably at least about 96% positive, more preferably at least about 97% positive, more preferably at least about 98% positive, and more preferably at least It relates to an isolated PRO polypeptide that comprises an amino acid sequence that scores about 99% positive.

In a particular embodiment, the invention provides an isolated PRO which is devoid of N-terminal signal sequence and / or initiation methionine and which is encoded by a nucleotide sequence encoding an amino acid sequence as described above. . Methods for producing them are also described herein, which involves culturing host cells containing a vector containing an appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, and removing PRO from the culture medium.
Including recovering the polypeptide. Another aspect of the invention provides an isolated PRO polypeptide having a transmembrane domain deleted or transmembrane domain inactivated. Methods for producing them are also described herein, which methods involve culturing host cells containing a vector containing an appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, and removing the PRO polypeptide from the culture medium. Including collecting.

In yet another embodiment, the invention relates to agonists of the native PRO polypeptide identified herein. In a particular embodiment, the agonist is an anti-PRO antibody or small molecule. In a further embodiment, the invention relates to a method of identifying an agonist of a PRO polypeptide, which comprises contacting the PRO polypeptide with a candidate molecule, said PRO
Monitoring the biological activity mediated by the polypeptide. Preferably, the PRO polypeptide is a native PRO polypeptide. In yet another embodiment, the invention relates to a composition of matter that comprises a PRO polypeptide, or an antagonist of a PRO polypeptide described herein, or an anti-PRO antibody, in combination with a carrier. In some cases, the carrier is a pharmaceutically acceptable carrier.

Another embodiment of the invention is useful in the treatment of a PRO polypeptide, or an antagonist thereof as described above, or an anti-PRO antibody, of a condition resulting from a PRO polypeptide, an antagonist thereof or an anti-PRO antibody. It is intended for use for the preparation of various medicines. In a further embodiment of the invention, the invention provides a vector comprising DNA encoding any of the polypeptides described herein. Host cells containing any of such vectors are also provided. By way of example, the host cell may be a CHO cell, E. coli, yeast, or a baculovirus infected insect cell. Further provided is a method of producing any of the polypeptides described herein, which comprises culturing a host cell under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture medium.

In another embodiment, the present invention provides a chimeric molecule comprising any of the polypeptides described herein fused to a heterologous polypeptide or amino acid sequence. Examples of such chimeric molecules include any of the polypeptides described herein fused to an epitope tag sequence or the Fc region of an immunoglobulin. In yet another embodiment, the invention provides an antibody that specifically binds to any of the above or below described polypeptides. In some cases, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single chain antibody. In yet another embodiment, the invention provides oligonucleotide probes useful for the isolation of genomic and cDNA nucleotide sequences or antisense probes, which probes are derived from any of the above or below nucleotide sequences. Can be done.

DETAILED DESCRIPTION OF THE INVENTION The terms “PRO polypeptide” and “PRO” as used herein refer to
Immediately after is a numerical symbol, which refers to various polypeptides, including the complete symbol (eg,
(PRO / number) refers to the particular polypeptide sequence described herein. As used herein, the terms “PRO / number polypeptide” and “PRO / number”, where “number” is given as the actual numerical symbol used herein, refer to native sequence polypeptides and variants (here Will be defined in more detail in). P described here
RO polypeptides may be isolated from a variety of sources, such as human tissue types or other sources, and may be prepared by recombinant or synthetic methods. A "native sequence PRO polypeptide" comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide of natural origin. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term “native sequence PRO polypeptide” specifically refers to naturally occurring truncated or secreted forms of a particular PRO polypeptide (eg,
Extracellular domain sequences), naturally-occurring mutant forms (eg, alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide. In various embodiments of the invention, the native sequence PRO polypeptide is a mature or full length native sequence polypeptide comprising the full length amino acid sequence shown in the accompanying figures. Start and stop codons are shown in bold or underlined in the figure. However, the PRO polypeptide disclosed in the accompanying figures is shown to begin with a methionine residue, designated herein as amino acid position 1 in the figures, although it may be located upstream or downstream of amino acid position 1 in the figures. It is conceivable and possible to use the methionine residue of E. coli as the starting amino acid residue of the PRO polypeptide.

The PRO polypeptide “extracellular domain” or “ECD” means a form of PRO polypeptide that is substantially free of transmembrane and cytoplasmic domains. Usually PR
O polypeptides ECD have less than 1% of their transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. PRO of the present invention
It will be appreciated that any transmembrane domain identified for a polypeptide will be identified according to the criteria routinely used in the art to identify that type of hydrophobic domain. The exact boundaries of the transmembrane domain may vary, but are likely not to exceed about 5 amino acids from either end of the first identified domain. Thus, a PRO polypeptide extracellular domain optionally comprises no more than about 5 amino acids from either side of the transmembrane domain and / or extracellular domain boundaries as identified in the Examples or specification. However, those polypeptides and their encoding nucleic acids, with or without a signal peptide, are contemplated by the present invention. The approximate location of the "signal peptides" of the various PRO polypeptides disclosed herein are shown in the accompanying figures. However, as noted, the C-terminal boundary of the signal peptide may vary, but is most likely to be less than about 5 amino acids on either side of the signal peptide C-terminal boundary as originally defined herein. High, the C-terminal boundary of the signal peptide can be identified according to the criteria routinely used to identify such types of amino acid sequence components (eg, Nielsen et al., Prot. Eng. 10: 1-
6 (1997) and von Heinje et al., Nucl. Acids. Res. 14: 4683-4690 (1986)). Furthermore, it is also recognized that in some cases cleavage of the signal peptide from the secreted polypeptide is not completely homogeneous, resulting in one or more secreted species. These mature polypeptides, and the polynucleotides encoding them, in which the signal peptide is cleaved within less than about 5 amino acids on either side of the C-terminal border of the signal peptide as defined herein, are contemplated by the present invention. It

A “PRO polypeptide variant” is a full-length native sequence PRO polypeptide disclosed herein, a full-length native sequence PRO polypeptide lacking the signal peptide disclosed herein, as defined above or below. An active PR having at least about 80% amino acid sequence identity with a sequence, the extracellular domain of a PRO disclosed herein with or without a signal peptide, or other fragments of the full-length PRO polypeptide disclosed herein.
O polypeptide. Such PRO polypeptide variants include, for example, PRO polypeptides in which one or more amino acid residues have been added or deleted at the N- or C-terminus of the full-length native amino acid sequence. Generally, a PRO polypeptide variant is a full length native amino acid sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, the extracellular domain of a PRO disclosed herein with or without a signal peptide. Or the full length PR disclosed herein
At least about 80% amino acid sequence identity with the other fragment of the O polypeptide, preferably at least about 81% amino acid sequence identity, more preferably at least about 82% amino acid sequence identity, more preferably at least about 83. % Amino acid sequence identity, more preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, more preferably at least About 87% amino acid sequence identity, more preferably at least about 88% amino acid sequence identity, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, more preferably Is at least about 91% amino acid sequence identity, more preferred Or at least about 92% amino acid sequence identity, more preferably at least about 93% amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity. , More preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity, and more preferably at least about 99%. Have amino acid sequence identity. Generally, a PRO variant polypeptide is at least about 10 amino acids in length, more at least about 20 amino acids in length, more at least about 30 amino acids in length, more at least about 40 amino acids in length, more at least about 50 amino acids in length. Long, more at least about 60 amino acids in length, more at least about 70 amino acids in length, more at least about 80 amino acids in length,
More than at least about 90 amino acids long, more than at least about 100 amino acids long, more at least about 150 amino acids long, and more at least about 20 amino acids long.
It is 0 amino acids long, more than at least about 300 amino acids long, or more.

“Percent (%) amino acid sequence identity”, as identified herein, relative to a PRO polypeptide as defined herein refers to the alignment of the sequences and if necessary to obtain maximum percent sequence identity. Defined as the percentage of amino acid residues in the candidate sequence that are identical to amino acid residues in the PRO sequence, introducing a gap and not considering any conservative substitutions as part of the sequence identity. Alignments for the purpose of determining percent amino acid sequence identity can be made by a variety of methods within the skill of the art, including publicly available BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. This can be achieved by using computer software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for the purposes herein, the% amino acid sequence identity values are shown in Table 1 below for the complete source code for the ALIGN-2 program.
It can also be obtained by using the sequence comparison program ALIGN-2 given in. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code shown in Table 1 below is submitted to the US Copyright Office, Washington DC, 20559 with user documentation and under US Copyright Registration No. TXU510087. It is registered in. ALIGN-2
The program is suitably available from Genentech, Inc., South San Francisco, California and may be compiled from the source code given in Table 1 below. The ALIGN-2 program is compiled for use with a UNIX® operating system, preferably Digital UNIX® V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

For purposes herein, the% amino acid sequence identity of a given amino acid sequence A, to or to a given amino acid sequence B (or to a given amino acid sequence B, or thereto) A given amino acid sequence A, which has or has some% amino acid sequence identity to it, may also be calculated) as: 100 times the fraction X / Y, where X is the sequence Alignment program ALIGN-2 is the number of amino acid residues with a score that was matched by the alignment of A and B, and Y is the total number of amino acid residues of B. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. As an example of calculating% amino acid sequence identity using this method, Tables 2A and 2B show the calculation of% amino acid sequence identity of the amino acid sequence referred to as "comparative protein" to the amino acid sequence referred to as "PRO". Show the method. Unless otherwise stated, all% amino acid sequence identity values used herein are obtained as described above using the ALIGN-2 sequence comparison computer program. However, the% amino acid sequence identity is determined by the sequence comparison computer program NCBI-B.
It may be determined using LAST-2 (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997)). NCBI-BLAST2 sequence comparison program is available at http: //ww.ncbi.nlm.nih.go
You can download it from v. NCBI-BLAST2 uses several search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrences = 10, minimum low compound length = 15/5 , Multipath e-value = 0.0
1, multipath constant = 25, final gap alignment dropoff = 2
5 and scoring matrix = BLOSUM62 included.

In the situation where NCBI-BLAST2 is used for amino acid sequence comparisons, the% amino acid sequence identity of a given amino acid sequence A with or to a given amino acid sequence B (or a given amino acid sequence B Or a certain percentage of it
A given amino acid sequence A with or containing amino acid sequence identity may also be calculated) as follows: 100 times the fraction X / Y, where X is A in the sequence alignment program NCBI-BLAST2. And the number of amino acid residues in the score that were matched by the alignment of B to be identical, where Y is B
Is the total number of amino acid residues. It will be appreciated that when the length of amino acid sequence A differs from the length of amino acid sequence B, the% amino acid sequence identity of A to B is different from the% amino acid sequence identity of B to A. In addition,% amino acid sequence identity values are calculated using the WU-BLAST-2 computer program (Al
tschul et al., Methods in Enzymology 266: 460-480 (1996)). Most WU-BLAST-2 search parameters are set to default values. Not set to default values, i.e. the adjustable parameters are set to the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. For purposes herein, the% amino acid sequence identity value is (a) the P of interest having a sequence derived from the native PRO polypeptide.
By WU-BLAST-2 between the amino acid sequence of the RO polypeptide and the comparative amino acid sequence of interest (ie the sequence which may be the PRO polypeptide variant with which the PRO polypeptide of interest is compared) The number of identical identical amino acid residues determined is determined by the quotient (b) divided by the total number of residues of the PRO polypeptide of interest. For example, in the expression "a polypeptide comprising an amino acid sequence A having or having at least 80% amino acid sequence identity to amino acid sequence B", amino acid sequence A is the target comparison amino acid sequence, Amino acid sequence B
Is the amino acid sequence of the target PRO polypeptide.

A “PRO variant polynucleotide” or “PRO variant nucleic acid sequence” is a nucleic acid molecule that encodes an active PRO polypeptide, as defined below, that is a full-length native sequence PRO poly disclosed herein. A peptide sequence, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, an extracellular domain of a PRO polypeptide disclosed herein with or without a signal peptide, or any other of the full length PRO polypeptide sequences disclosed herein. A nucleic acid sequence encoding a fragment of at least 8
It has 0% sequence identity. Generally, a PRO variant polypeptide nucleotide is a full length native sequence PRO polypeptide sequence disclosed herein, a full length native sequence PRO polypeptide sequence lacking the signal peptide disclosed herein, a PRO polypeptide disclosed herein with or without a signal peptide. At least about 80% nucleic acid sequence identity, preferably at least about 81% nucleic acid sequence identity with the nucleic acid sequence encoding the extracellular domain of the peptide, or any other fragment of the full-length PRO polypeptide disclosed herein.
More preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% nucleic acid sequence identity. Sex, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid. Sequence identity, more preferably at least about 90%
Nucleic acid sequence identity, more preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably It has at least about 98% nucleic acid sequence identity, and more preferably at least about 99% nucleic acid sequence identity. Variants do not include native nucleotide sequences. Generally, a PRO variant polynucleotide is at least about 30 nucleotides long, more at least about 60 nucleotides long, more at least about 90 nucleotides long, more at least about 120 nucleotides long, more at least about 150 nucleotides long. Long, more often at least about 180 nucleotides, more at least about 210 nucleotides, and more at least about 24
0 nucleotides, more at least about 270 nucleotides, more at least about 300 nucleotides, more at least about 450 nucleotides, more at least about 600 nucleotides, more at least about 900 nucleotides, or More than that.

“Percent (%) nucleic acid sequence identity” to a PRO-encoded nucleic acid sequence identified herein refers to aligning the sequences and introducing gaps if necessary to obtain maximal percent sequence identity, PRO It is defined as the percentage of nucleotides in the candidate sequence that are identical to the nucleotides in the polypeptide-encoding nucleic acid sequence. Alignment for the purpose of determining percent nucleic acid sequence identity can be performed by a variety of methods within the purview of those of skill in the art, such as publicly available computers such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. This can be achieved by using software. One of ordinary skill in the art can determine the appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. However, for purposes herein, the% nucleic acid sequence identity values are given in Table 1 as the sequence comparison program ALIGN-2, the complete source code for which is given in Table 1 as described below. Is obtained by using. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc. and the source code shown in Table 1 is the US Copyright Office, Washington DC,
Submitted with user documentation to 20559 and registered under US Copyright Registration Number TXU510087. ALIGN-2 is Genentech, South San Francisco, California
Are publicly available through and may be compiled from the source code given in Figures 2A-P. The ALIGN-2 program is compiled for use with a UNIX® operating system, preferably Digital UNIX® V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not change.

For purposes herein, the% nucleic acid sequence identity of a given nucleic acid sequence C with, or to, a given nucleic acid sequence D (or, with a given nucleic acid sequence D,
Or a given amino acid sequence C which has or contains some% nucleic acid sequence identity thereto) is calculated as follows: 100 times the fraction W / Z where W Is the number of nucleotides in the score that were matched by the C and D alignments of the sequence alignment program ALIGN-2, and Z is the total number of nucleotides in D. When the length of the nucleic acid sequence C is different from the length of the nucleic acid sequence D, C
It will be appreciated that the% nucleic acid sequence identity of D to C is different from the% nucleic acid sequence identity of D to C. As an example of calculating% nucleic acid sequence identity using this method, Tables 2C-D show the% nucleic acid sequence identity of the nucleic acid sequence referred to as "comparative DNA" to the nucleic acid sequence referred to as "PRO-DNA". The calculation method of is shown. Unless otherwise indicated, all% nucleic acid sequence identity values herein are ALIG as described above.
Obtained using the N-2 sequence comparison computer program. However,% nucleic acid sequence identity is determined by the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids R
es. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from http://ww.ncbi.nlm.nih.gov. NCBI-BLAST
2 uses some search parameters, all of which are set to initial values, eg unmask = ok, chains = all, expected occurrence = 10, minimum low compound length = 15/5, multi Includes path e-value = 0.01, multipath constant = 25, final gap alignment dropoff = 25, and scoring matrix = BLOSUM62. In the context where NCBI-BLAST2 is used for sequence comparisons, the% nucleic acid sequence identity of a given nucleic acid sequence C with, or to a given nucleic acid sequence D (or with a given nucleic acid sequence D or A given nucleic acid sequence C which has or contains a certain percentage of nucleic acid sequence identity to it can also be calculated) as: 100 times the fraction W / Z where W is the sequence Alignment program NCBI-BLAST2 C and D alignments are the number of nucleotides with a score that is identical and Z is D
Is the total number of nucleotides in. It will be appreciated that when the length of nucleic acid sequence C differs from the length of nucleic acid sequence D, the% nucleic acid sequence identity of C to D is different from the% nucleic acid sequence identity of D to C.

In addition,% nucleic acid sequence identity values are calculated using the WU-BLAST-2 computer program (Altsch
ul et al., Methods in Enzymology 266: 460-480 (1996)). Most WU-BLAST-2 search parameters are set to default values. Not set to default values, ie adjustable parameters set to the following values: overlap span =
1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. For purposes herein, the% nucleic acid sequence identity values are (
a) a nucleic acid sequence of a PRO polypeptide-encoding sequence of interest having a sequence derived from a native sequence PRO polypeptide-encoding nucleic acid and a comparative nucleic acid molecule of interest (ie, PRO polypeptide of interest-encoding) Sequence of the modified nucleic acid molecule (which may be a variant polynucleotide with which the sequence is compared), the number of matching identical nucleotides determined by WU-BLAST-2 is (b) the PRO polypeptide of interest. -Determined by the quotient divided by the total number of nucleotides of the encoded nucleic acid. For example, in the expression "an isolated nucleic acid molecule comprising a nucleic acid sequence A having or having at least 80% amino acid sequence identity with the nucleic acid sequence B", the nucleic acid sequence A is the subject comparison nucleic acid molecule. Sequence Nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest.

In another embodiment, the PRO variant polypeptide nucleotide encodes an active PRO polypeptide, preferably under stringent hybridization and wash conditions.
A nucleic acid molecule that hybridizes to the nucleotide sequence encoding the full-length PRO polypeptide shown in the accompanying drawings. The PRO variant polypeptide may be one encoded by the PRO variant polynucleotide. The term "positive" in the context of amino acid sequence identity comparisons performed as described above includes amino acid residues that are identical in the compared sequences, but also those that have characteristics. Amino acid residues that score a positive value for the target amino acid residue are the same as the target amino acid residue, or of the target amino acid residue (as specified in Table 6 below). ) Are preferred substitutions. For the purposes herein, the% positive value of a given amino acid sequence A, with or with respect to a given amino acid sequence B (or with respect to a given amino acid sequence B, or to a certain extent thereto). A given amino acid sequence with or including% positives (also referred to as A) can be calculated as follows: 100 times the fraction X / Y, where X is the sequence alignment program ALIGN-2 A and B. Is the number of amino acid residues that are scored as positive by the alignment, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of the amino acid sequence A differs from the length of the amino acid sequence B, the% positive of A to B is different from the% positive of B to A.

“Isolated”, when used to describe the various polypeptides disclosed herein, refers to the polypeptides identified, separated and / or recovered from the components of their natural environment. means. Preferably, the isolated polypeptide is free of all components that naturally accompany it. Contaminant components of its natural environment are materials that typically interfere with diagnostic or therapeutic uses for the polypeptide, and include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In a preferred embodiment, the polypeptide is (1) sufficient to obtain an N-terminal or internal amino acid sequence of at least 15 residues by using a spinning cup sequenator, or (2) Coomassie blue or It is preferably purified to homogeneity by SDS-PAGE under non-reducing or reducing conditions using silver staining. Isolated polypeptide includes protein in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step. An “isolated” nucleic acid molecule that encodes a PRO polypeptide or an “isolated” nucleic acid molecule that encodes an anti-PRO antibody has been identified and is a natural source of PRO-encoding nucleic acid or an anti-PRO-encoding nucleic acid. A nucleic acid molecule separated from at least one contaminating nucleic acid molecule normally associated with natural sources. Preferably, the isolated nucleic acid is free of all components that naturally accompany it. An isolated PRO-encoding nucleic acid molecule or anti-PRO-encoding nucleic acid molecule is in a form or setting other than that found in nature. Thus, isolated nucleic acid molecule is distinguished from the PRO-encoding nucleic acid molecule or anti-PRO-encoding nucleic acid molecule as it exists in natural cells. However, PR
An isolated nucleic acid molecule encoding an O polypeptide or an anti-PRO antibody may be, for example, one that normally expresses a PRO polypeptide whose nucleic acid molecule is in a chromosomal location different from that of a natural cell or expresses an anti-PRO antibody. And the anti-PRO nucleic acid molecule contained in the cells.

The expression “control sequences” refers to DNA sequences necessary to express an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers. Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, if the DNA of the presequence or secretory leader is expressed as a preprotein that participates in the secretion of the polypeptide, the DNA of that polypeptide
Is operably linked to; a promoter or enhancer is operably linked to the coding sequence if it affects the transcription of the sequence; or the ribosome binding site is such that it facilitates translation. Is operably linked to the coding sequence. Generally, "operably linked" means that D is bound to
It means that the NA sequences are contiguous and, in the case of a secretory leader, contiguous and in the reading phase. However, enhancers do not necessarily have to be in close proximity. Binding is accomplished by ligation at convenient restriction sites. If such sites do not exist, then synthetic oligonucleotide adapters or linkers are used in accord with conventional practice. The term "antibody" is used in the broadest sense, eg, a single anti-P
RO monoclonal antibody (including agonist antibody), anti-antigen with multi-epitope specificity
-PRO antibody compositions, single chain anti-PRO antibodies, and fragments of anti-PRO antibodies are included (see below). The term "monoclonal antibody" as used herein is a substantially homogeneous population of antibodies, ie, the individual antibodies that comprise them, are identical except for the naturally occurring mutations that may be present in small amounts. Refers to the antibody obtained from the population.

The “stringency” of a hybridization reaction is readily determined by one of ordinary skill in the art and is an empirical calculation that generally depends on probe length, wash temperature, and salt concentration. In general, longer probes have higher temperatures for proper annealing and shorter probes have lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment near, but below their melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures make the reaction conditions more stringent, while lower temperatures reduce stringency.
Moreover, stringency is inversely proportional to salt concentration. Further details and explanations of the stringency of the hybridization reaction can be found in Ausubel et al., Current Protocols in Molecular Biology, Wiley.
See Interscience Publishers, (1995). As defined herein, "stringent conditions" or "high stringency conditions" means (1) low ionic strength and high temperature for washing, eg, 0.015M sodium chloride / 0.0015M at 50 ° C. Using sodium citrate / 0.1% sodium dodecyl sulphate; (2) Denaturants such as formamide during hybridization, eg 50% (v / v) formamide and 0.1% bovine serum albumin at 42 ° C. /0.1% Ficoll / 0.1% Polyvinylpyrrolidone / 50 mM pH 6
． 5 sodium phosphate buffer, and 750 mM sodium chloride, 75 m
With M sodium citrate; (3) 50% formamide at 42 ° C., 5 × SSC (0.75M NaCl, 0.075M sodium citrate),
50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1%
High stringency consisting of SDS and 0.1% SSC with 10% dextran sulfate, 0.2x SSC (sodium chloride / sodium citrate) wash at 42 ° C and 50% formamide at 55 ° C, then EDTA at 55 ° C. Identified by those using sexual wash. “Moderate stringency conditions” are described in Sambrook et al., Molecular Cloning: A Laboratory.
Manual (Identified as described in New York: Cold Spring Harbor Laboratory Press, 1989, and involves the use of less stringent wash solutions and hybridization conditions (eg, temperature, ionic strength and% SDS) as described above. Moderate stringency conditions were: 20% formamide, 5xSSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 mg / mL. Denatured sheared salmon sperm DNA
Incubation in a solution containing at 37 ° C. overnight followed by 37-in 1 × SSC.
The condition is that the filter is washed at 50 ° C. One of ordinary skill in the art will recognize how to adjust temperature, ionic strength, etc. as needed to accommodate factors such as probe length.

The term “epitope tag” as used herein refers to a chimeric polypeptide that comprises a PRO polypeptide fused to a “tag polypeptide”. The tag polypeptide has a sufficient number of residues to provide an epitope for which the antibody can be produced, or an epitope identifiable by some other reagent, but whose length is of the PRO polypeptide of interest. Short enough not to interfere with the activity of the peptide. Also, the tag polypeptide is preferably fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least 6 amino acid residues, usually from about 8 to about 50 amino acid residues (preferably about 1 amino acid residue).
0 to about 20 residues). As used herein, the term "immunoadhesin" refers to an antibody-like molecule imparted with the binding specificity of a heterologous protein ("adhesin") that has effector functions for immunoglobulin constant domains. Structurally, the immunoadhesin is a fusion of an immunoglobulin constant domain sequence with an amino acid sequence (ie, "heterologous") that has the desired binding specificity other than the antibody's antigen recognition and binding sites. The adhesin portion of the immunoadhesin molecule is typically a contiguous amino acid sequence containing at least the binding site for the receptor or ligand. The immunoglobulin constant domain sequence of the immunoadhesin may be IgG-1, IgG-2, IgG-3, or IgG-4 subtype, IgA (Ig
A-1 and IgA-2), IgE, IgD or IgM.

As used herein, “active” and “activity” refer to natural or naturally occurring PRO.
By a form of PRO polypeptide that retains the biological and / or immunological activity / property of the polypeptide, "biological" activity is caused by a naturally occurring or naturally occurring PRO polypeptide (inhibitory or “Stimulatory” biological function, excluding the ability to generate antibodies against the antigenic epitopes of the native or naturally occurring PRO polypeptide, and “immunological” activity refers to natural Or naturally-occurring PR
It means the ability to generate antibodies against the antigenic epitope of the O polypeptide. "Biological activity" in the context of an antibody or other antagonist molecule (eg, organic or inorganic small molecule, peptide, etc.) that can be identified by the screening assays disclosed herein means that the molecule has a "therapeutically effective amount". By definition, it refers to the ability to induce one or more of the effects listed here. A preferred biological activity is inhibition, including retardation and complete arrest of growth of target tumor (eg, cancer) cells. Another preferred biological activity is a cytotoxic activity that results in the death of target tumor (eg cancer) cells. Yet another preferred biological activity is the induction of apoptosis of target tumor (eg, cancer) cells.

The term “immunological activity” means immunological cross-reactivity with at least one epitope of a PRO polypeptide. As used herein, "immunological cross-reactivity" refers to a polyclonal anti-body in which a candidate polypeptide has generated the qualitative biological activity of a PRO polypeptide having this activity against a known active PRO polypeptide. It means that it can be competitively inhibited with serum. Such antisera are prepared in a conventional manner, for example by subcutaneously injecting goats or rabbits with the well-known active analogue in complete Freund's adjuvant, followed by intraperitoneal or subcutaneous boosts in incomplete Freund's. It Immunological cross-reactivity is preferably "specific," because the binding affinity of the identified immunological cross-reactive molecule (eg, antibody) to the corresponding PRO polypeptide is any other of that molecule. Significantly higher than the binding affinity for a known natural polypeptide of (preferably at least about 2-fold, more preferably at least about 4-fold, even more preferably at least about 8-fold, and most preferably at least about 10-fold higher). Means

As used herein, “tumor” means all tumorigenic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, adenocarcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specific examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, ovarian cancer, cervical cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma. Cell tumors, liver cancer, bladder cancer, hepatocellular carcinoma, colorectal cancer, endometrial cancer, salivary gland cancer, kidney cancer, liver cancer, egg-mouth cancer, thyroid cancer, liver cancer and various types of head and neck cancer Is included.

“Treatment” is an intervention carried out by the present invention to prevent or alter the progression of disease pathology. Thus, “treatment” refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. In the treatment of tumors (eg cancer), the therapeutic agent may directly reduce the pathology of the tumor cells or it may make the tumor cells more sensitive to other therapeutic mediators such as radiation and / or chemotherapy. May be. The "pathology" of cancer includes all phenomena that compromise the good survival of a patient. This includes, but is not limited to, abnormal or uncontrolled cell growth, metastasis, inhibition of normal function of adjacent cells, release of cytokines or other secreted products at abnormal levels, suppression of inflammation or immune response or Including deterioration.

An “effective amount” of a polypeptide or agonist thereof disclosed herein, with respect to inhibiting neoplastic cell growth, is an amount that is capable of inhibiting target cell growth to some extent. The term includes amounts capable of inducing growth inhibition, cytostatic and / or cytotoxic effects and / or apoptosis of target cells. An "effective amount" of a PRO polypeptide or agonist thereof for the purpose of inhibiting neoplastic cell growth can be empirically determined by routine techniques. A "therapeutically effective amount" has the following effects with respect to the treatment of tumors: (1) some inhibition of tumor growth, including delay and complete growth arrest; (2) reduction in tumor cell number;
3) reduction of tumor size; (4) inhibition of invasion of tumor cells into peripheral organs (ie reduction, delay or complete arrest); (5) inhibition of metastasis (ie reduction, delay or complete arrest). ); (6) promoting an anti-tumor immune response, which may, but need not, result in tumor regression or rejection; and / or (7) having one or more of the symptoms associated with the disease. By an amount capable of inducing one or more of a degree of relief.
A "therapeutically effective amount" of a PRO polypeptide or agonist thereof for the purpose of treating a tumor can be empirically determined by routine techniques.

A “growth-inhibiting amount” of a PRO polypeptide or agonist thereof is an amount capable of inhibiting the growth of cells, particularly tumors, such as cancer cells, in vitro or in vivo. The "growth-inhibiting amount" of a PRO polypeptide or agonist thereof for the purpose of inhibiting neoplastic cell growth can be empirically determined by routine techniques. A "cytotoxic amount" of a PRO polypeptide or agonist thereof is an amount capable of destroying cells, particularly tumors, such as cancer cells, in vitro or in vivo. The "cytotoxic amount" of a PRO polypeptide or agonist thereof for the purpose of inhibiting neoplastic cell growth can be empirically determined by routine techniques.

The term “cytotoxic agent” as used herein means a substance that inhibits or suppresses the function of cells and / or causes destruction of cells. The term is meant to include radioisotopes (eg, I ¹³¹ , I ¹²⁵ , Y ⁹⁰ and Re ¹⁸⁶ ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof. To be done. A "chemotherapeutic agent" is a compound useful in the treatment of cancer. Examples of chemotherapeutic agents are adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids such as paclitaxel (Taxol, Bristol-). Mye
rs Squibb Oncology, Princeton, NJ) and doxetaxel (Taxotere, Rhone-P)
oulenc Rorer, Antony, France), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, aminopterin, aminopterin. Includes mycin, mitomycin, esperamicin (see US Pat. No. 4,675,187), melphalan, and other related nitrogen mustards. Also included within this definition are hormone-like agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapristone. As used herein, “growth inhibitor” means a compound or composition that inhibits the growth of cells, particularly tumors such as cancer cells, in vitro or in vivo. That is,
Growth inhibitors are those that significantly reduce the proportion of cells that overexpress such genes in S phase. Examples of growth inhibitory agents include agents that inhibit the cell cycle (at a position other than S phase), such as agents that induce G1 arrest or M phase arrest. Classical M-phase blockers include vincas (vincristine and vinblastine), taxol, and topo II, such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin. These agents that arrest G1 also spill over to S-phase arrest, such as DNA alkylating agents such as tamoxifen, prednisone,
Dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C. For more information, see The Molecular Basis of
Cancer, Mendelsohn and Israel, ed., Chapter 1, titled "Cell cycle reguration
, oncogene, and antineoplastic drugs '', Murakami et al., (WB Saunders: Philad
elphia, 1995), especially p13.

The term “cytokine” is a general term for proteins released by one cell population that act on another cell as intercellular mediators. Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones. Cytokines include growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoproteins such as follicle stimulating hormone (FSH). ), Thyroid stimulating hormone (T
SH) and luteinizing hormone (LH); liver growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factors-α and -β; Mueller inhibitor; mouse gonadotropin-related peptide; inhibin; activin; blood vessels Endothelial growth factor; Integrin; Thrombopoietin (TPO); Nerve growth factor such as NGF-β; Platelet growth factor; Transforming growth factor such as TGF-α and TGF-β; Insulin-like growth factor-I and II; Erythropoietin (EPO) ); Osteoinducing factors; interferons such as interferon-α, -β, and -γ; colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF); granulocyte-macrophage-CSF (GM-CSF); and Granulocyte-CSF (G-CSF); Interleukins (ILs), eg I -1, IL-1a, IL-2, IL-3, IL
-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12;
Tumor necrosis factors such as TNF-α and TNF-β; and other polypeptide factors including LIF and kit ligand (KL). As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture and is the biologically active equivalent of native sequence cytokines.

As used in this application, the term “prodrug” refers to a precursor of a pharmaceutically active substance that is less cytotoxic to tumor cells as compared to the parent drug and is enzymatically activated or converted to the more active parent form. It means a body or derivative form. For example, Wilman, “Prodrugs i
n Cancer Chemotherapy '', Biochemical Society Transactions, 14, pp. 375-3
82, 615th Meeting, Belfast (1986), and Stella et al., `` Prodrugs: A Chemical
Approach to Targeted Drug Delivery, Directed Drug delivery, Borchardt
(Eds.), Pp.147--267, Human Press (1985). The prodrug of the present invention is
Phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulphate-containing prodrugs, peptide-containing prodrugs, D
-To amino acid modified prodrugs, glycosylated prodrugs, β-lactam containing prodrugs, optionally substituted phenoxyacetamide containing prodrugs or optionally substituted phenylacetamide containing prodrugs, more active non-cytotoxic drugs Examples of cytotoxic drugs derivatizable to the prodrug forms used in the present invention include, but are not limited to, the convertible 5-fluorocytosine and other 5-fluorouridine prodrugs described above. Includes chemotherapeutic agents.

The term “agonist” is used in its broadest sense and includes any molecule that mimics the biological activity of the native PRO polypeptide disclosed herein. Suitable agonist molecules include, among others, agonist antibodies or antibody fragments, fragments or amino acid sequence variants of the native PRO polypeptide, peptides, small organic molecules and the like. Methods for identifying agonists of PRO polypeptides include exposing tumor cells to candidate agonist molecules,
It may include measuring inhibition of tumor cell growth. “Chronic” administration means administration of the drug in a continuous manner as opposed to an acute manner in order to maintain an initial therapeutic effect (activity) for a long period of time. "
An "intermittent" administration is a treatment that is essentially periodic rather than continuous without interruption. A "mammal" for purposes of treatment means any animal classified as a mammal, including humans, farm and farm animals, zoos, sports, or pet animals such as dogs, horses, cats, cattle, etc. including. Preferably the mammal is a human.

Administration of “in combination with” one or more additional therapeutic agents includes simultaneous (temporary) and sequential administration in any order. As used herein, "carrier" includes pharmaceutically acceptable carriers, excipients, or stabilizers, which are nontoxic to the cells or mammals exposed to them at the dosages and concentrations used. is there. The physiologically acceptable carrier is often a pH buffered aqueous solution. Examples of physiologically acceptable carriers are phosphates, citrate, and other organic acid buffers; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins such as Serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides such as glucose, mannose or dextran, disaccharides and other carbohydrates; such as EDTA Chelating agents; sugar alcohols such as mannitol or sorbitol; self-forming counterions such as sodium; and / or TWEEN (trade name), polyethylene glycol (PEG
), And nonionic surfactants such as PLURONICS (trade name).

“Native antibodies” and “natural immunoglobulins” are usually heterotetrameric sugars of about 150,000 daltons that consist of two identical light (L) chains and two identical heavy (H) chains. It is a protein. Each light chain is attached to the heavy chain by one covalent disulfide bond, and the number of disulfide bonds varies among heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced interchain disulfide bridges. Each heavy chain has at one end a variable domain ( _VH ) followed by a number of constant domains. Each light chain has a variable domain ( _VL ) at one end and a constant domain at the other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain and the variable domain of the light chain is the heavy chain. Aligned with the variable domain of. Particular amino acid residues are believed to form the interface between the light and heavy chain variable domains. The term "variable" refers to the fact that certain sites in the variable domain differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. To do. However, the variability is not evenly distributed over the variable domain of the antibody. It is concentrated in three or four segments called hypervariable regions or complementarity determining regions (CDRs) of both the light and heavy chain variable domains. The more highly conserved part of the variable domain is the framework
It is called the (FR) region. The variable domains of the natural heavy and light chains predominantly have a CDR-linked β-sheet arrangement that forms a loop bond that binds and in some cases forms a β-sheet structure. 4 It contains five FR regions each. The CDRs of each chain are bound closer to the FRs and, together with the CDRs of the other chain, contribute to the formation of the antigen-binding site of the antibody (Kabat et al., NIH Publ. No. 91-32.
42, Vol. I, pp. 647-669 [1991]). The constant domains are not directly involved in binding the antibody to the antigen, but exhibit various effector functions, such as the involvement of the antibody in antibody-dependent cytotoxic activity.

As used herein, the term “hypervariable region” refers to the amino acid residues of an antibody that produce antigen binding. The hypervariable region is a “complementarity determining region” or “C
DR "(ie, residues 24-34 of the light chain variable domain (L1
), 50-56 (L2) and 89-97 (L3) and 31-35 of the heavy chain variable domain (
H1), 50-65 (H2) and 95-102 (H3); Kabat et al., Sequences of Pro.
teins of Immunological Interest, 5th Edition, Public Health Service, National In
Institutes of Health, Bethesda, MD. (1991)) or residues from the "hypervariable loop" (ie residues 26-32 (L1), 50-52 (L2) of the light chain variable domain).
And 91-96 (L3) and residues 26-32 (H1), 53-5 of the heavy chain variable domain.
5 (H2) and 96-101 (H3); Chothia and Lesk J. Mol. Biol. 196: 901-917 (
1987)). "Framework" or "FR" residues are those variable domain residues other than the hypervariable region residues as defined herein. An "antibody fragment" comprises a portion of a native antibody, preferably the antigen binding or variable region of the native antibody. Examples of antibody fragments are Fab, Fab ′, F (ab ′) ₂ and Fv.
Fragment; diabody; linear antibody (Zapata et al., Protein Eng. 8 (10): 1
057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.

Papain digestion of antibodies is called "Fab" fragments, two identical antigen-binding fragments each with a single antigen-binding site, and the remaining "Fc" fragment, the name of which readily crystallizes. Generate, which reflects an ability. Pepsin treatment yields an F (ab ') ₂ fragment that has two antigen-combining sites but is still a cross-linked antigen. "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy and one light chain in tight, non-covalent association. In this arrangement, the three CDRs of each variable region interact to determine the antigen binding site on the surface of the _VH - _VL dimer. To be precise, the six CDRs confer the antigen binding specificity on the antibody. However, a single variable domain (or three C specific for an antigen)
Even half the Fv containing only DR) has the ability to recognize and bind antigen, but with a lower affinity than the entire binding site.

The Fab fragment also includes the constant domain of the light chain and the first constant domain (CH
Also includes 1). Fab fragments are produced by the addition of a few residues at the carboxyl terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.
It differs from the ab fragment. Fab'-SH is the designation herein for Fab 'in which the cysteine residues of the constant domains bear a free thiol group. F (ab ′) ₂ antibody fragments originally were produced as pairs of Fab ′ fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. "Light chains" of antibodies (immunoglobulins) from any species are classified into one or two distinct types called kappa (kappa) and lambda (lambda) based on the amino acid sequences of their constant domains. it can. Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins are divided into different classes. Five major classes of immunoglobulins: IgA, IgD
, IgE, IgG, and IgM, some of which are further subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA and I.
It is divided into gA2.

The term “monoclonal antibody” as used herein refers to a substantially homogeneous population of antibodies, ie, a population that is identical except for the naturally-occurring mutations in which the individual antibodies that make up the population are present in small amounts. Means an antibody obtained from Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, each monoclonal antibody is directed against a single determinant on the antigen, unlike conventional (polyclonal) antibodies, which typically include different antibodies directed against different determinants (epitopes). . In addition to their specificity, monoclonal antibodies are advantageous in that they are synthesized by hybridoma culture and are not contaminated with other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as obtained from a substantially homogeneous population of antibodies and not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibody used in accordance with the present invention is Kohler
Et al., Nature, 256: 495 [1975] and may be made by the hybridoma method, or recombinant DNA methods (see, eg, US Pat. No. 4,816,567).
May be created by. “Monoclonal antibodies” are also available from phage antibody libraries, for example, Clackson et al., Nature, 352: 624-628 [1991] and Marks et al., J. Mo.
It may be isolated using the technique described in I. Biol., 222: 581-597 (1991).

Here, the monoclonal antibody especially includes “chimeric” antibodies (immunoglobulins), which are antibodies in which part of the heavy or light chain is derived from a particular species or belongs to a particular antibody class or subclass. Antibodies that are identical or homologous to the corresponding sequences of, but the rest of the chains are identical or homologous to the corresponding sequences of antibodies derived from other species or belonging to a particular antibody class or subclass, as well as They are fragments of these antibodies as long as they exhibit the desired biological activity (US Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 [1984]). “Humanized” forms of non-human (eg, murine) antibodies are specific chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′) that contain minimal sequence derived from non-human immunoglobulin. , F (ab ′) ₂ or other antigen-binding sequence of an antibody). For the most part, humanized antibodies are human immunoglobulins (recipient antibodies) whose complementarity determining regions (CDRs).
) Is substituted with a residue having a desired specificity, affinity and capacity derived from a CDR (donor antibody) of a species other than human such as mouse, rat and goat. If there is,
The FvFR frame residues of human immunoglobulin are replaced with the corresponding non-human residues. Furthermore, humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the imported CDR or frame sequences. These modifications are made to further refine and optimize antibody performance. Generally, a humanized antibody corresponds to at least one of the CDR regions to that of a non-human immunoglobulin, and at least one of all or substantially all of the FR regions to a human immunoglobulin consensus sequence, typically Will contain substantially all of the two variable domains. Optimal humanized antibodies will also contain at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321: 5.
22 -525 (1986); Reichmann et al., Nature 332: 323-329 (1988); Presta, Curr. O.
See p. struct. Biol. 2: 593 -596 (1992). Humanized antibodies include primatized PRIMATIZED (trade name) antibodies in which the antigen binding region of the antibody is derived from an antibody produced by immunizing macaques with the antigen of interest.

“Single-chain Fv” or “sFv” antibody fragments include antibody fragments that comprise the V _H and V _L domains of an antibody, these domains being present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the _VH and _VL domains, which enables the sFv to form the desired structure for antigen binding.
For an overview of sFv, see The Pharmacology of Monoclonal Antibodies, vol.
113, Rosenburg and Moore, Springer-Verlag, New York, pp. 269-315 (1994).
See Pluckthun. The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a light chain variable domain (V _L in the same polypeptide chain (V _H -V _L)
) Is bound to the heavy chain variable domain (V _H ). A linker that is so short that it allows pairing of two domains on the same chain is used to force the domain to pair with the complementary domain of the other chain, creating two antigen binding sites. Diabodies are described, for example, in EP404097; WO93 / 11161; and Hollinger et al., Proc. Natl. Acad. Sci.
USA 90: 6444-6448 (1993). An "isolated" antibody means one that has been identified and separated or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that interfere with the diagnostic or therapeutic use of the antibody, including enzymes, hormones, and other nonproteinaceous solutes. In a preferred embodiment, the antibody is (1) up to 95 wt% or more, most preferably 99 wt% antibody, as determined by the Lowry method, (2)
By using a spinning cup sequenator, at least 15 N
To the extent sufficient to obtain the residues of the terminal or internal amino acid sequence, or (3)
Purified to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or preferably silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.

The term “label” as used herein refers to a detectable compound or composition that binds directly or indirectly to the antibody to produce a “labeled” antibody. The label may be detectable by itself (eg radioisotope label or fluorescent label)
Alternatively, in the case of enzymatic labeling, it may catalyze the chemical conversion of a detectable substrate compound or composition. The label may also be a non-detectable substance such as a toxin. By "solid phase" is meant a non-aqueous matrix to which the antibodies of the invention can adhere. Examples of solid phases included herein are those formed partly or wholly of glass (eg controlled pore glass), polysaccharides (eg agarose), polyacrylamides, polystyrenes, polyvinyl alcohols and silicones. including. In some embodiments, depending on the context, the solid phase can include the wells of an assay plate; otherwise, a purification column (eg, an affinity chromatography column). The term also includes a discontinuous solid phase of discrete particles as described in US Pat. No. 4,275,149.

“Liposomes” are various types of small vesicles containing lipids, phospholipids and / or surfactants that are useful for the delivery of drugs (such as PRO polypeptides or antibodies thereto) to mammals. . The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological members. A "small molecule" is defined herein as having a molecular weight of less than about 500 Daltons.

As shown below, Table 1 provides the complete source code for the ALIGN-2 sequence comparison computer program. This source code is routinely compiled for use on the UNIX® operating system to provide the ALIGN-2 sequence comparison computer program. In addition, Tables 2-5 show% using the ALIGN-2 sequence comparison computer program.
A hypothetical illustration for using the methods described below to determine amino acid identity (Table 2-3) and% nucleic acid sequence identity (Table 4-5) is provided, where "PRO" is the provisional PRO of interest.
It means the amino acid sequence of a polypeptide, and the “comparative protein” is the target “P
"RO" means the amino acid sequence of a polypeptide compared to the polypeptide, "PR
“O-DNA” means a provisional PRO-encoding nucleic acid sequence of interest, “Comparative D
"NA" means the nucleotide sequence of a nucleic acid molecule that is compared to the subject "PRO-DNA" nucleic acid molecule, where "X", "Y", and "Z" are each a different temporary amino acid sequence, and "N". ], "L" and "V" each refer to different temporary nucleotide sequences.

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

II. Compositions and Methods of the Invention A. Full Length PRO Polypeptides The present invention provides newly identified and isolated nucleic acid sequences that encode a polypeptide referred to herein as a PRO polypeptide. In particular, the cDNA encoding the PRO polypeptide has been identified and isolated, as described in further detail in the Examples below. A cDNA clone has been deposited with the ATCC, as disclosed in the Examples below. The exact nucleotide sequences of these clones can be readily determined by sequencing the deposited clones using methods routine in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For the PRO polypeptides and encoding nucleic acids described herein, Applicants have identified what is believed to be the reading frame that best matches the sequence information currently available.

B. PRO Variants In addition to the full-length native sequence PRO polypeptides described herein, PRO variants could also be prepared. PRO variants can be prepared by introducing appropriate nucleotide changes into PRO DNA, and / or by synthesizing the desired PRO polypeptide. One of ordinary skill in the art will appreciate that amino acid changes, such as changes in the number or position of glycosylation sites or changes in membrane anchoring properties, can alter PRO post-translational processes. Mutations in the native full-length sequence PRO polypeptide or in various domains of the PRO polypeptides described herein can be any of the techniques and guidelines for conservative and non-conservative mutations described, for example, in US Pat. No. 5,364,934. Can be done using. The mutation results in the PRO compared to the native sequence PRO polypeptide.
It may be a substitution, deletion or insertion of one or more codons encoding the PRO polypeptide, which changes the amino acid sequence of the polypeptide. In some cases, the mutation is by substitution of at least one amino acid in one or more domains of the PRO polypeptide with any other amino acid. A guideline for which amino acid residues are to be inserted, substituted or deleted without adversely affecting the desired activity is to compare the sequence of the PRO polypeptide with that of a protein molecule of known homology and It is found by minimizing the amino acid sequence changes made within the high region of Amino acid substitutions can be the result of substitutions of one amino acid for another amino acid with similar structural and / or chemical properties, eg, replacement of leucine with serine, a conservative amino acid substitution. Insertions and deletions can optionally be in the range of 1 to 5 amino acids. Permissible mutations are determined by systematically making amino acid insertions, deletions or substitutions in the sequence and testing the resulting mutants for activity exhibited by the full-length or mature native protein.

PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared to the full length native protein. Certain fragments lack amino acid residues that are not essential for the desired biological activity of the PRO polypeptide. PRO fragments may be prepared by any of many conventional techniques. The desired peptide fragment may be chemically synthesized. An alternative method is enzymatic digestion, for example by treating the protein with an enzyme known to cleave the protein at sites determined by specific amino acid residues, or by digesting the DNA with appropriate restriction enzymes. Including the generation of the PRO fragment by isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding the desired polypeptide fragment by polymerase chain reaction (PCR). Oligonucleotides that determine the desired ends of the DNA fragments are used in the 5'and 3'primers of PCR.
Preferably, PRO polypeptide fragments share at least one biological and / or immunological activity with the native PRO polypeptide. In a particular embodiment, the conservative substitutions of interest are shown in Table 3 under the heading of preferred substitutions. If such a substitution results in a change in biological activity, the product is screened for by introducing a more substitutional change, named exemplary substitutions in Table 6 or further described below in the amino acid taxonomy. To be done.

[0079]

Substantial modification of the function or immunological identity of a polypeptide may be (a) a structure of the polypeptide backbone of the substitution region, eg a sheet or helical arrangement, (b) a charge or hydrophobicity of the target site, or (C) It is achieved by selecting substituents that are substantially different in their effect, while maintaining the bulk of the side chains. Naturally occurring residues can be divided into groups based on common side chain properties: (1) Hydrophobicity: norleucine, met, ala, val, leu, ile; (2) Neutral hydrophilicity: cys, ser. , thr; (3) Acidity: asp, glu; (4) Basicity: asn, gln, his, lys, arg; (5) Residues affecting chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Residues so substituted may also be introduced at conservative substitution sites, preferably left-over (non-conserved) sites.

Mutations can be attributed to oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis [Carter et al., Nucl. Acids Res., 13: 4331.
(1986); Zoller et al., Nucl. Acids Res., 10: 6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34: 315 (1985)], restricted selective mutagenesis [Wells et al.
Philos. Trans. R. Soc. London SerA, 317: 415 (1986)] or any other known technique for cloning D.
It can also be performed on NA to generate PRO mutant DNA. Also, scanning amino acid analysis can be used to identify one or more amino acids along a flanking sequence. The preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine,
Contains serine and cysteine. Alanine is typically the preferred scanning amino acid in this group because it excludes side chains above the beta carbon and does not alter the backbone structure of the mutant [Cuningham and Wells, Science, 244: 1081-1085]. (198
9)]. Also, alanine is typically preferred because it is the most common amino acid. Moreover, it is often found in both buried and exposed locations [Crei
ghton, The Proteins, (WH Freeman & Co., NY); Chothia, J. Mol
Biol., 150: 1 (1976)]. If alanine substitution does not yield a sufficient amount of variant, an isoteric amino acid can be used.

C. Modifications of PRO Covalent modifications of PRO are included within the scope of this invention. One type of covalent modification involves reacting a targeted amino acid residue of a PRO polypeptide with an organic derivatizing reagent capable of reacting with a selected side chain or N- or C-terminal residue of the PRO polypeptide. Is. Derivatization with bifunctional reagents is useful, for example, to crosslink PRO to a water-insoluble support matrix or surface for use in a method of purifying anti-PRO antibodies or vice versa. Commonly used cross-linking agents are, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide ester such as 4-azidosalicylic acid, 3,3′-dithiobis (succinimidyl). Homobifunctional imide ester including disuccinimidyl ester such as propionate), bifunctional maleimide such as bis-N-maleimido-1,8-octane, and methyl-3-[(p-azidophenyl)- It includes reagents such as dithio] propioimidate. Other modifications include deamination of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, lysine, arginine, and histidine side chains. Methylation of α-amino groups of [TE Creighton, Proteins: Structur
e and Molecular Properties, WH Freeman & Cop, San Francisc
o, pp. 79-86 (1983)], acetylation of N-terminal amines, and amidation of any C-terminal carboxyl groups.

Other types of covalent modifications of the PRO polypeptide included within the scope of this invention include:
Includes alteration of the native glycosylation pattern of the polypeptide. By "altering the native glycosylation pattern" is intended herein a deletion of one or more carbohydrate moieties found in a native sequence PRO polypeptide (elimination of existing glycosylation sites or chemical and / or chemical moieties). Either by removal of glycosylation by enzymatic means) and / or addition of one or more glycosylation sites not present in the native sequence PRO. In addition, this clause includes qualitative changes in glycosylation of native proteins, including changes in the properties and properties of the various carbohydrate moieties present. Addition of glycosylation sites to the PRO polypeptide may be accomplished by altering the amino acid sequence. This modification may be made, for example, by the addition or substitution of one or more serine or threonine residues to the native sequence PRO polypeptide (O-linked glycosylation site). The PRO polypeptide amino acid sequence is optionally D
Changes at the NA level may be altered, particularly through mutation of the DNA encoding the PRO polypeptide at preselected bases to generate codons that are translated into the desired amino acid. Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, for example WO 87/05330, published September 11, 1987, and Aplin.
And Wriston, CRC Crit. Rev. Biochem., Pp. 259-306 (1981). Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically, or by mutational substitution of codons encoding amino acid residues presented as targets for glycosylation. Chemical deglycosylation techniques are known in the art, eg Hakimuddin et al., Arch. Biochem. Biophys., 259: 5.
2 (1987) and by Edge et al., Anal. Biochem., 118: 131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides is described by Thotakura et al., Meth.
This is accomplished by using various endo and exoglycosidases, as described in Enzymol. 138: 350 (1987).

Another type of covalent modification of the PRO polypeptide is to the PRO polypeptide to one of a variety of non-proteinaceous polymers, such as polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, US Pat. No. 4,640,835. issue;
No. 4,496,689; No. 4,301,144; No. 4,670,417; No. 4,791,192 or No. 4,179,33
Includes ligation in the manner described in No. 7. The PRO polypeptides of the invention may also be modified in a manner to form chimeric molecules containing PRO fused to other heterologous polypeptides or amino acid sequences. In one embodiment, such a chimeric molecule comprises a fusion of PRO polypeptide with a tag polypeptide that provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl-terminus of the PRO polypeptide. The presence of such epitope-tagged forms of PRO polypeptides can be detected using antibodies to the tag polypeptides. Also, provision of the epitope tag enables the PRO polypeptide to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-His) or poly-histidine.
Histidine-glycine (poly-His-gly) tag; flu HA-tagged polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8: 2159-2165 (1988)]; c-myc tag and 8F9 thereto. 3C7, 6E10, G4, B7 and 9E10 antibodies [
Evan et al., Molecular and Cellular Biology, 5: 3610-3616 (1985)]; and herpes simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein
Engineering, 3 (6): 547-553 (1990)]. Other tag polypeptides include flag peptides [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; KT3 epitope peptides [Martin et al., Science, 255: 192-194 (1992)]; α-tubulin epitope peptides. [Skinner et al., J. Biol. Chem., 266: 15163-15166 (1991)]; and T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. A.
cad. Sci. USA, 87: 6393-6397 (1990)]. In an alternative embodiment, the chimeric molecule may comprise a fusion of the PRO polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For the bivalent form of the chimeric molecule (also referred to as the "immunoadhesin"), such a fusion is Ig
It can be the Fc region of a G molecule. Ig fusions preferably include a soluble (transmembrane domain deleted or inactivated) form of the PRO polypeptide in place of at least one variable region within the Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and C of an IgG molecule.
Includes H3 region. See US Pat. No. 5,428,130 issued Jun. 27, 1995 for the preparation of immunoglobulin fusions.

D. Preparation of PRO Polypeptides The description below relates primarily to methods of producing PRO polypeptides by culturing cells transformed or transfected with a vector containing PRO polypeptide nucleic acid. Of course, using other methods well known in the art, P
It is believed that RO polypeptides can be prepared. For example, PRO polypeptide sequences, or portions thereof, may be produced by direct peptide synthesis using solid phase techniques [eg, Stewart et al., Solid-Phase Peptide Synthesis, WH Freem.
an Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc., 85: 2149.
-2154 (1963)]. In vitro protein synthesis may be performed by manual techniques or by automation. Automated synthesis may be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. PRO
Various portions of the polypeptide may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO polypeptide.

1. Isolation of DNA Encoding PRO Polypeptide DNA encoding PRO polypeptide can be obtained from a cDNA library prepared from tissue that possesses PRO mRNA and is suspected of expressing it at detectable levels. Therefore, human PRODNA can be conveniently obtained from a cDNA library prepared from human tissue, as described in the Examples. PRO-encoded genes can also be obtained from genomic libraries or by known synthetic methods (eg, automated nucleic acid synthesis). The library can be screened with a probe (such as an antibody to the PRO polypeptide or an oligonucleotide of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by the gene. Screening of cDNA or genomic libraries with selected probes is described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (New
York: Cold Spring Harbor Laboratory Press, 1989) can be carried out using standard procedures. Another method of isolating the gene encoding PRO is to use the PCR method [Sambrook et al., Supra; Dieffenbach et al.,
PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 199
Five)].

The following example describes techniques for screening a cDNA library. The oligonucleotide sequence selected as a probe should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably detectably labeled upon hybridisation with the DNA in the library to be screened. Methods of labeling are well known in the art and include the use of radiolabels such as ³² P labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate and high stringency, are given in Sambrook et al., Supra. Sequences identified in such library screening methods are Genban
It can be compared and aligned with known sequences that have been deposited in public databases such as k or private sequence databases and are available to the public. Within a defined region of the molecule or over its entire length (either at the amino acid or nucleic acid level)
Sequence identity can be determined using methods known in the art and described herein. Nucleic acids having protein-encoding sequences are used for the first time using the deduced amino acid sequences disclosed herein and, if necessary, to detect intermediates and precursors of mRNA that have not been reverse transcribed into cDNA, Sambrook et al., Supra. It can be obtained by screening the selected cDNA or genomic library using conventional primer extension methods as described in.

2. Selection and Transformation of Host Cells Host cells are transfected or transformed with an expression or cloning vector for the production of PRO polypeptides described herein, a promoter is induced, transformants are selected, or the desired sequence is selected. It is cultured in a conventional nutrient medium which has been appropriately modified to amplify the gene encoding Culture conditions such as medium, temperature, pH, etc. can be selected by those skilled in the art without undue experimentation. In general, the principles, protocols, and practical techniques for maximizing cell culture productivity are described in Mammalian Cell Biote
chnology: a Practical Approach, edited by M. Butler (IRL Press, 1991) and Sambrook
Etc. can be found above. Methods of prokaryotic and eukaryotic cell transfection, such as CaCl ₂ , CaPO ₄ , liposome-mediated and electroporation are known to those of skill in the art. Depending on the host cell used, transformation is done using standard methods appropriate to the cell. Calcium treatment with calcium chloride or electroporation as described in Sambrook et al., Supra, is generally used for prokaryotes. Infection by Agrobacterium tumefaciens was reported by Shaw et al., Ge
ne, 23: 315 (1983) and WO 89/05859 published June 29, 1989 and used for the transformation of certain plant cells. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52: 456-457 (1978) is preferred. General aspects of mammalian cell host system transformations have been described in US Pat. No. 4,399,216. Transformation into yeast is typically performed by Van solingen et al., J. Bact., 130: 946 (1977) and Hsiao et al., Proc. Nat.
l. Acad. Sci. USA, 76: 3829 (1979). However, other methods of introducing DNA into cells, such as nuclear microinjection,
Electroporation, intact cells, or polycations such as polybrene,
Bacterial protoplast fusion, such as with polyornithine, can also be used.
For various techniques for transforming mammalian cells, see Keown et al., Methods i.
n Enzymology, 185: 527-537 (1990) and Mansour et al., Nature, 336: 348-352 (198).
See 8).

Suitable host cells for cloning or expressing the DNA in the vectors described herein are prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, for example E. coli K12 strain MM294 (ATCC31,446); E. coli X1776.
(ATCC31,537); E. coli strains W3110 (ATCC27,325) and K5772 (ATCC53,6)
35). Other preferred prokaryotic host cells are E. coli, such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus (
Proteus), Salmonella, for example, Salmonella typhimurium, Serratia, for example, Serratia marcescans, and Shigella, and bacilli, for example, B. subtilis and B. licheniformis (
Examples include Bacillus licheniformis 41P), described in DD 266,710, published April 12, 1989), Pseudomonas, such as Enterobacteriaceae such as Pseudomonas aeruginosa and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host as it is a common host strain for recombinant DNA production and publishing. Preferably, the host cell secretes a minimal amount of proteolytic enzyme.
For example, strain W3110 may be modified to make a genetic mutation in a gene encoding a protein that is foreign to the cell, and examples of such hosts include E. coli W3110 strain 1A2 with the complete genotype tonA; Genotype tonA
E. coli W3110 strain 9E4 carrying ptr3; complete genotype tonA pr
t3 phoA E15 (argF-lac) 169 degP ompT ka
E. coli W3110 strain 27C7 (ATCC 55,244) with n ^r ; complete genotype t
onA ptr3 phoA E15 (algF-lac) 169 degP
E. coli W3110 strain 37D6 having ompT rbs7 ilvG kan ^r ;
Escherichia coli W3110 which is a 37D6 strain having a non-kanamycin resistant degP deletion mutation
Strain 40B4; and the E. coli strain having a mutant periplasmic protease disclosed in US Pat. No. 4,946,783 issued Aug. 7, 1990. Alternatively, in vitro methods of cloning such as PCR or other nucleic acid polymerase polymerase reactions are preferred.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO-encoding vectors. Saccharomyces
Cerevisia is a commonly used lower eukaryotic host microorganism. In addition, Schizosaccharomyces prombe (Beach and Nurse, Nature
, 290: 140 [1981]; EP 139,383 issued May 2, 1985); Kluveromyces Hosts (
Kluveromyces hosts) (U.S. Pat.No. 4,943,529; Fleer et al., Bio / Technology, 9:
968-975 (1991)), for example K. lactis (MW98-8C, CBS683, CBS457)
4; Louvencourt et al., J. Bacteriol. 737 [1983]), K. fragilis.
) (ATCC 12,424), Cable Garix (K. bulgaricus) (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC)
56,500), K. drosophilarum (ATCC 36,906; Van den B
erg et al., Bio / Technology, 8: 135 (1990)), K. themotoler.
ans) and K. marxianus; yarrowia (EP 402,2
26); Pichia pastoris (EP 183,070; Sheekrishna et al., J.
Basic Microbiol, 28: 265-278 [1988]); Candida; Trichoder Malaysia (r
eesia) (EP 244,234); Panax mold (Case et al., Proc. Natl. Acad. Sci. USA,
76: 5259-5263 [1979]); Schwanniomyces, eg Schwanniomyces occidentalis (EP 394,5, issued October 31, 1990).
38); and filamentous fungi such as Neurospora, Penicillium, Tolypocladium (WO 91/00357, issued January 10, 1991); .Biophys. Res. Commun., 112: 284-2
89 [1983]; Tilburn et al., Gene, 26: 205-221 [1983]; Yelton et al., Proc. Natl. Ac
ad. Sci. USA, 81: 1470-1474 [1984]) and black mold (Kelly and Hynes, EMBO J
., 4: 475-479 [1985]). The preferred methylotropic (methylo
tropic yeasts include, but are not limited to, Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis.
psis), and a yeast capable of growing on methanol selected from the genus consisting of Rhodotorula. A list of specific species that is exemplary of this yeast taxonomy is C. Ant.
hony, The Biochemistry of Methylotrophs, 269 (1982). Suitable host cells for the expression of glycosylated PRO polypeptide are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodaspera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese Hamster Ovary (CHO) and COS cells. A more detailed example is the monkey kidney CV1 strain transformed with SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. US
A, 77: 4216 (1980)); mouse Sertoli cells (TM4, Mather, Biol. Reprod., 23:
243-251 (1980)) human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8
065); and mouse breast tumor cells (MMT 060562, ATTC CCL51). Selection of the appropriate host cell is within the skill of the art.

3. Selection and Use of Replicable Vectors A nucleic acid encoding a PRO polypeptide (eg, cDNA or genomic DNA) is inserted into a replicable vector for cloning (amplification of DNA) or expression. Various vectors are publicly available. The vector can be in the form of, for example, a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. Generally, the DNA is inserted into the appropriate restriction endonuclease sites using techniques well known in the art. Vector components generally include, but are not limited to, one or more signal sequences, origins of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Construction of suitable vectors containing one or more of these components employs standard ligation techniques known to those of ordinary skill in the art. The PRO polypeptide is not only directly produced by recombinant techniques,
It is also produced as a fusion peptide with a heterologous polypeptide which is a signal sequence or a mature protein or another polypeptide having a specific cleavage site at the N-terminus of the polypeptide. Generally, the signal sequence is a component of the vector or part of the PRO-encoding DNA that is inserted into the vector. The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or thermostable enterotoxin II leaders. For yeast secretion, the signal sequence includes yeast invertase leader, alpha factor leader (Yeast (Saccharomyces) and Kluyveromyces (Kluyveromyces).
) alpha factor leader, the latter of which is described in U.S. Pat.No. 5,010,182), or an acid phosphatase leader, a C. albicans glucoamylase leader (199
It may be the signal described in EP 362179) issued on Apr. 4, 009 or in WO 90/13646 published on Nov. 15, 1990. In mammalian cell expression, mammalian signal sequences may be used for the direct secretion of proteins such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are common to many bacteria,
It is well known for yeasts and viruses. The origin of replication derived from plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are mammalian. It is useful as a cloning vector in animal cells. Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. Typical selection genes are (a) ampicillin, neomycin,
Not resistant to antibiotics or other toxins such as methotrexate or tetracycline, (b) supplementing auxotrophic defects, or (c) obtained from complex media such as the gene code D-alanine racemase for Bacillus It encodes a protein that supplies important nutrients.

Examples of suitable selectable markers for mammalian cells are those that can identify cellular components, such as DHFR or thymidine kinase, that are capable of incorporating PRO-encoding nucleic acid. Suitable host cells using wild type DHFR are:
CHO cell line deficient in DHFR activity prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). A preferred selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282: 39 (1979); Kingman et al.,
Gene, 7: 141 (1979); Tschemper et al., Gene, 10: 157 (1980)]. The trp1 gene provides a selectable marker for mutant strains of yeast lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)]. Expression and cloning vectors usually contain a promoter operably linked to the PRO-encoding nucleic acid sequence to control mRNA synthesis. Suitable promoters recognized by a variety of possible host cells are known. Suitable promoters for use in prokaryotic hosts include the β-lactamase and lactose promoter systems [Cahng
Et al., Nature, 275: 615 (1978); Goeddel et al., Nature, 281: 544 (1979)], alkaline phosphatase, tryptophan (trp) promoter system [Goeddel, Nucleic Ac
ids Res., 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80: 21-25 (1
983)] is included. Promoters used in bacterial systems also have a Shine-Dalgarno (SD) sequence operably linked to the DNA encoding the PRO polypeptide.

Examples of suitable promoter sequences for use with yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem., 255: 2073 (1980)] or other glycolytic enzymes [Hess et al. , J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochem.
istry, 17: 4900 (1987)], for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, Pyruvate kinase, trioselate isomerase, phosphoglucose isomerase, and glucokinase are included. Other yeast promoters are inducible promoters that have the additional effect of transcription being regulated by growth conditions, such as alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glycerin. There are promoter regions for aldehyde-3-phosphate dehydrogenase and enzymes that control the utilization of maltose and galactose. Vectors and promoters suitable for expression in yeast are further described in EP 73,657.

PRO transcription from vectors in mammalian host cells can be performed, for example, by polyoma virus, infectious epithelioma virus (UK 2,211,504 published Jul. 5, 1989), adenovirus (eg adenovirus 2), bovine papilloma. Virus, avian sarcoma virus,
Cytomegalovirus, retrovirus, hepatitis B virus and simian virus 4
0 (SV40), promoters derived from viral genomes, heterologous mammalian promoters such as actin or immunoglobulin promoters, and promoters derived from heat shock promoters make such promoters compatible with host cell systems. Controlled as much as you can. Transcription of DNA encoding PRO by higher eukaryotes can be enhanced by inserting an enhancer sequence into the vector. An enhancer is usually about 10 to 300 base pairs and acts on a promoter to enhance its transcription.
It is the cis-acting element of A. Many enhancer sequences from mammalian genes are currently known (globin, elastase, albumin, α-fetoprotein and insulin). However, typically enhancers from eukaryotic viruses will be used. Examples include the SV40 enhancer on the late side of the replication origin (100-270 base pairs), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancer. Enhancers are 5'or 3 of the PRO polypeptide coding sequence.
May be spliced into the vector at the'position, but preferably 5 from the promoter
It is located in the 'position. Expression vectors for use in eukaryotic host cells (yeast, fungi, insects, plants, animals, humans, or nucleated cells from other multicellular organisms) also include termination of transcription and mRNA.
It also contains the sequences required for the stabilization of Such sequences are used in eukaryotic or viral DNs.
It can be obtained from the A or cDNA, usually 5'and sometimes 3'untranslated regions. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO polypeptide. Other methods, vectors and host cells suitable for adapting the synthesis of PRO polypeptides in recombinant vertebrate cell culture are described in Gething et al., Nature, 293: 620-625 (1981).
); Mantei et al., Nature, 281: 40-46 (1979); EP 117,060; and EP 117,058.

4. Detection of Gene Amplification / Expression Amplification and / or expression of a gene can be carried out using appropriately labeled probes based on the sequence provided herein, for example, conventional Southern blotting, Northern quantifying mRNA transcription. Blotting [Thomas, Proc. Natl. Acad. Sci. USA, 77:52
01-5205 (1980)], the dot blot method (DNA analysis), or the in situ hybridization method, and can be directly measured in the sample. Alternatively, DNA
Antibodies capable of recognizing specific double strands, including double strands, RNA double strands and DNA-RNA hybrid double strands or DNA-protein double strands can also be used. The antibody can then be labeled and the assay performed, wherein the duplex is surface bound, such that the antibody bound to the duplex at the time of surface duplex formation. Presence can be detected. Alternatively, gene expression can also be measured by immunological methods that directly quantitate the expression of the gene product, such as immunohistochemical staining of cells or tissue sections and cell culture or body fluid assays. Antibodies useful for immunohistochemical staining and / or assay of sample fluids may be monoclonal or polyclonal and can be prepared in any mammal. Conveniently, the antibody is directed against the native sequence PRO polypeptide, or against a synthetic peptide based on the DNA sequences provided herein, or against an exogenous sequence fused to PRODNA and encoding a specific antibody epitope. Can be prepared.

5. Purification of PRO Polypeptide Forms of PRO polypeptide can be recovered from the culture medium or lysates of host cells. If membrane-bound, it can be detached from the membrane using a suitable wash (eg Triton-X100) or enzymatic cleavage. The cells used to express PRO can be disrupted by various chemical or physical means such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents. It may be desirable to purify PRO polypeptides from recombinant cell proteins or polypeptides. Purified by the following procedure, which is an example of a suitable purification procedure: fractionation on an ion exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or cation exchange resins such as DEAE; chromatofocusing; SDS-. PAGE; ammonium sulfate precipitation; eg Sephadex G-75
Gel filtration using; a protein A sepharose column to remove contaminants such as IgG; and a metal chelation column that binds the epitope-tagged form of PRO polypeptides. Known in the art, for example Deutcher, Methodes in Enzymology
, 182 (1990) ； Scopes, Protein Purification: Principles and Practice, Spr
Many protein purification methods described in inger-Verlag, New York (1982) can be used. The purification process chosen will depend, for example, on the production method used and the nature of the particular PRO polypeptide produced.

E. Antibodies Some of the candidate agents for use in the compositions and methods of the invention are antibodies and antibody fragments that mimic the biological activity of PRO polypeptides. 1. Polyclonal Antibodies Methods of preparing polyclonal antibodies are known to those of skill in the art. Polyclonal antibodies in mammals can be generated by one or more injections of, for example, an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include the PRO polypeptide or a fusion protein thereof. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to,
Includes keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate). The immunization protocol will be selected by one of ordinary skill in the art without undue experimentation.

2. Alternatively, the antibody may be a monoclonal antibody. Monoclonal antibodies can be prepared using the hybridoma method as described by Kohler and Milstein, Nature, 256: 495 (1975). In the hybridoma method, mice, hamsters or other suitable host animals are typically immunized with an immunizing agent to produce lymphocytes that produce or are capable of producing antibodies that specifically bind to the immunizing agent. Induce. The lymphocytes can also be immunized in vitro. The immunizing agent will typically include the PRO polypeptide, including fragments, or a fusion protein of a protein or fragment thereof. Generally, peripheral blood lymphocytes ("PBLs") are used when cells of human origin are desired, or spleen cells or lymph node cells are used when non-human mammalian sources are desired. . The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent such as polyethylene glycol,
Formation of hybridoma cells [Goding, Monoclonal Antibodies: Principles
and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells are preferably cultured in a suitable medium that contains one or more substances that inhibit the survival or growth of the unfused, immortalized cells. For example, when the parental cell lacks the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the hybridoma's medium typically contains hypoxatin, aminoputilin and thymidine ("HAT medium"). , This substance blocks the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. A more preferred immortalized cell line is the mouse myeloma line, which includes, for example, the Salk Institute Cell Distribution Center in San Diego, Calif. And the American Type Culture Collection in Manassas, Virginia (
Available from the ATCC). Human myeloma and mouse-human heterologous myeloma cell lines for producing human monoclonal antibodies have also been disclosed [Kozbor, J. Immuno.
l., 133: 3001 (1984), Brodeur et al., Monoclonal Antibody Production Technique.
s and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63]. The culture medium in which the hybridoma cells are cultured is then assayed for the presence of monoclonal antibodies directed against the PRO polypeptide. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is measured by immunoprecipitation or an in vitro binding assay such as radioimmunoassay (RIA) or enzyme-linked immunoassay (ELISA). Such techniques and assays are known in the art. The binding affinity of a monoclonal antibody can be determined, for example, by Munson and Pollard, Anal.
It can be measured by the Scatchard analysis method by Biochem., 107: 220 (1980).

After the desired hybridoma cells have been identified, clones can be subcloned by a limiting dilution step and grown by standard methods [Goding, supra].
Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal. The monoclonal antibody secreted by the subclone is, for example, protein A
-Isolated or purified from culture medium or ascites fluid by conventional immunoglobulin purification methods such as Sepharose method, hydroxylapatite chromatography method, gel electrophoresis method, dialysis method or affinity chromatography. Monoclonal antibodies are also prepared by recombinant DNA methods, such as US Pat. No. 4,816,567.
It can be prepared by the method described in No. The DNA encoding the monoclonal antibody of the present invention can be easily prepared using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention are a preferred source of such DNA. Once isolated, DNA
Can be placed in an expression vector, which is transfected into a host cell, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, in a recombinant host cell. Monoclonal antibody can be synthesized with. In addition, DNA can be prepared, for example, by substituting the coding sequences for human heavy and light chain constant domains in place of homologous mouse sequences [US
Patent No. 4,816,567; Morrison et al., Supra], or by covalently linking a part or all of the coding sequence of the non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such a non-immunoglobulin polypeptide is
Substitution in place of the constant domain of the antibody of the present invention or in place of the variable domain of one antigen binding site of the antibody of the present invention can produce a chimeric bivalent antibody. Such non-immunoglobulin polypeptides can be substituted for the constant domain of the antibodies of the invention or for the variable domain of one of the antigen binding sites of the antibodies of the invention to produce chimeric, bivalent antibodies.

The antibody may be a monovalent antibody. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residue is replaced or deleted with another amino acid residue to prevent cross-linking. In vitro methods are also suitable for preparing monovalent antibodies. Generation of fragments thereof, particularly Fab fragments, by digestion of the antibody can be accomplished using conventional techniques known in the art.

3. Human and Humanized Antibodies The antibodies of the present invention may further include humanized antibodies or human antibodies. Humanized forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, Fab, Fab ′, F (ab ′) ₂ or other antigen-binding subsequences of antibodies). It contains a minimal sequence derived from non-human immunoglobulin. Humanized antibodies are those in which the residues in the complementarity determining region (CDR) of the recipient are those in the CDRs of a non-human species (donor antibody) that has the desired specificity, affinity and capacity, such as mouse, rat or rabbit. Human immunoglobulin (recipient antibody) replaced by In some examples, human immunoglobulin Fv framework residues are replaced by corresponding non-human residues. In addition, humanized antibodies
It may contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has at least one, and typically no, at least one, where all or almost all CDR regions correspond to those of a non-human immunoglobulin and all or almost all FR regions are of human immunoglobulin consensus sequences. Contains substantially all of the two variable domains. The humanized antibody optimally comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321: 522-525 (19
86); Riechmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op Struc.
t. Biol., 2: 593-596 (1992)].

Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues of non-human origin introduced. These non-human amino acid residues are often referred to as "import" residues, which typically result from an "import" variable domain. Humanization is basically done by replacing the corresponding sequence of the human antibody with a rodent CDR or CDR sequences by winter and coworkers [
Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1).
988); Verhoeyen et al., Science, 239: 1534-1536 (1988)] by replacing the rodent CDRs or CDR sequences with the corresponding sequences of human antibodies. Thus, such "humanized" antibodies are chimeric antibodies in which substantially less than the intact human variable domain has been replaced with the corresponding sequence from a non-human species (US Pat.
, 816, 567). In fact, humanized antibodies are typically human antibodies in which some CDR residues and optionally some FR residues have been replaced by residues from similar sites in rodent antibodies. Human antibodies are also available in phage display libraries [Hoogenboom and Winter, J. Mol.
Biol., 227: 381 (1992); Marks et al., J. Mol. Biol., 222: 581 (1991)], and can be prepared using various methods known in the art. Further, the techniques of Cole et al. And Boerner et al. Can also be used for the preparation of human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. P. 77 (1
985) and Boerner et al., J. Immunol., 147 (1): 86-95 (1991)]. Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, eg, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon administration, production of human antibodies is observed that is very similar to that found in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in US Pat. Nos. 5,545,807;
No. 45,806; No. 5,569,825; No. 5,625,126; No. 5,633,425; No. 5,661,0
16 and the following scientific literature: Marks et al., Bio / Technology 10, 779-783 (1992); Lonb
erg et al., Nature 368 856-859 (1994); Morrison, Nature 368, 812-13 (1994); F
ishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Bio
technology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 136.
5-93 (1995).

4. Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized antibodies, that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the PRO polypeptide and the other one is for any other antigen, preferably a cell surface protein or receptor or receptor subunit. Methods of making bispecific antibodies are well known in the art. Traditionally, recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy / light chain pairs in which the two heavy chains have different specificities [Milstein and Cuello, Nature,
305: 537-539 (1983)]. Due to the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the correct bispecific structure. Purification of the correct molecule is usually accomplished by affinity chromatography steps. A similar procedure is WO 93/08829 published May 13, 1993, and Traunecker et al., EMBO J., 10: 3655-.
3656 (1991).

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion is preferably with an immunoglobulin heavy chain constant domain, comprising at least the hinge region, and portions of the CH2 and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light-chain binding present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion and, if desired, the immunoglobulin light chain are inserted into separate expression vectors and cotransfected into a suitable host organism. For more details on making bispecific antibodies, see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).
Please refer to. According to another approach described in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers recovered from recombinant cell culture. it can. The preferred interface comprises at least part of the CH3 domain of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). A complementary “cavity” of the same or smaller size as the large side chain is created at the interface of the second antibody molecule by replacing the large amino acid side chain with the smaller one (alanine or threonine). This provides a mechanism to increase the yield of heterodimers relative to other unwanted end products such as homodimers.

Bispecific antibodies can be prepared as full length antibodies or antibody fragments (eg F (ab ′) ₂ bispecific antibodies). Techniques for producing bispecific antibodies from antibody fragments have also been described in the literature. For example, chemical coupling can be used to prepare bispecific antibodies. Brennan et al., Science, 229: 81 (1985) describe a procedure for the proteolytic cleavage of intact antibodies to produce F (ab ') ₂ fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab 'fragments produced are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to Fab'-thiol by reduction with mercaptoethylamine and mixed with an equimolar amount of another Fab'-TNB derivative to form the bispecific antibody. The produced bispecific antibody can be used as a drug for selective immobilization of an enzyme. The Fab 'fragment can be recovered directly from E. coli, which can be chemically coupled to form bispecific antibodies. Shalaby et al., J. Exp. Med., 175: 217-225.
(1992) describes the preparation of fully humanized bispecific antibody F (ab ') ₂ molecules. Each Fab 'fragment is separately secreted from E. coli and undergoes directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed is capable of binding to normal human T cells and cells overexpressing the ErbB2 receptor and induces cytolytic activity of human cytotoxic lymphocytes against human breast tumor targets. Become. Various methods for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al., J. Immunol. 148 (5): 1547-1553 (1992).
. Leucine zipper peptides from the Fos and Jun proteins are linked by gene fusion to the Fab ′ portions of two different antibodies. The antibody homodimer is reduced at the hinge region to form a monomer and then reoxidized to form the antibody heterodimer. This method can also be used for the production of antibody homodimers. The "diabody" technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993) provided another mechanism for making bispecific antibody fragments. Fragments consist of a heavy chain variable domain ( _VH ) linked to a light chain variable domain ( _VL ) with a linker short enough to allow pairing between two domains on the same chain. Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of the other fragment,
It forms two antigen binding sites. Other strategies for producing bispecific antibody fragments by the use of single chain Fv (sFv) dimers have also been reported. See Gruber et al., J. Immunol. 152: 5368 (1994).

Antibodies with more than two valencies are also contemplated. For example, trispecific antibodies can be prepared. Tutt et al. J. Immunol. 147: 60 (1991). Exemplary bispecific antibodies can bind to two different epitopes on the proteins provided herein. Alternatively, the anti-polypeptide arm is a trigger molecule on leukocytes, such as a T cell receptor molecule (eg CD2, CD3, CD28 or B7), or FcγRI (CD64), FcγRII (CD32) and FcγRIII (C
D16) or the like, which binds to an Fc receptor (FcγR) -binding arm of IgG,
The cell defense mechanism may be focused on cells expressing a specific protein.
Bispecific antibodies may be used as local cytotoxic agents against cells expressing a particular polypeptide. These antibodies include polypeptide binding arms and cytotoxic or chelating agents such as EOTUBE, DPTA, DOTA, or TET.
It has an arm that connects to A. Other bispecific antibodies of interest bind to the polypeptide and also to tissue factor (TF).

5. Heteroconjugate Antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies may be used, for example, to target immune system cells to unwanted cells [US Pat. No. 4,676,980] and for the treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. Proposed. It is believed that this antibody can be prepared in vitro using known methods in synthetic protein chemistry, including those associated with cross-linking agents. For example, immunotoxins can be made using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and for example US Pat. No. 4,6767,980.
Include those disclosed in the issue.

6. Effector Function Design It may be desirable to modify the antibody of the invention with respect to effector function, eg to enhance the efficacy of the antibody in treating cancer. For example, cysteine residue (s) are introduced in the Fc region to allow interchain disulphide bond formation in this region. The homodimeric antibody thus produced may have improved internalization capacity and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC).
Caron et al., J. Exp. Med. 176: 1191-1195 (1992) and Shopes, BJ Immunol. 148.
: 2918-2922 (1992). Homodimeric antibodies with enhanced antitumor activity can also be prepared using a heterobifunctional crosslinker as described by Wolff et al., Cancer Research 53: 2560-2565 (1993). Alternatively, antibodies can be designed that have dual Fc regions and thus have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti-cancer Drug Design 3: 219-230 (1989).

7. Immune Conjugates The present invention also relates to chemotherapeutic agents, cytotoxic agents such as toxins (eg, enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof) or radioisotopes (ie, radioconjugates). It also relates to an immunoconjugate comprising the conjugated antibody. Chemotherapeutic agents useful in the formation of such immune complexes have been described above. Enzymatically active toxins and fragments thereof that can be used are diphtheria A chain, non-binding active fragments of diphtheria toxin, cholera toxin, botulinum toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A.
Chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana protein (PAPI)
, PAPII, and PAP-S), momordica charancia (momordica char
antia inhibitor, curcin, crotin, sapaonaria oficinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin
mycin), enomycin and trichothecene. Various radionucleotides are available for the production of radioconjugated antibodies. Examples include ^{2 12} Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y and ¹⁸⁶ Re.

Conjugates of antibodies and cytotoxic agents can be conjugated to various bifunctional protein coupling agents,
For example, N-succinimidyl-3- (2-pyridyldithiol) propionate (S
PDP), iminothiolane (IT), bifunctional derivative of imide ester (dimethyl adipimidate HCL, etc.), active ester (disuccinimidyl suberate, etc.), aldehyde (glutaraldehyde, etc.), bis-azide compound (bis (p-azidobenzoyl) hexanediamine, etc., bis-diazonium derivative (bis- (p-diazoniumbenzoyl) -ethylenediamine, etc.), diisocyanate (triene 2)
, 6-diisocyanate, etc.) and bis-active fluorine compounds (1,5-difluoro-
2,4-dinitrobenzene etc.). For example, a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an example of a chelating agent for conjugation of radionucleotide to the antibody. See WO 94/11026. In another embodiment, the antibody may be conjugated to a "receptor" (such as streptavidin) for use in tumor pre-targeting, and the antibody-receptor complex is administered to a patient, followed by a clarifier. It is used to remove unbound complex from the circulation and then administer a "ligand" (eg, avidin) conjugated to a cytotoxic drug (eg, a radionucleotide).

8. Immunoliposomes The antibodies disclosed herein may also be prepared as immunoliposomes. Liposomes containing antibodies are described by Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985).
Hwang et al., Proc. Natl. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat.
Prepared by methods known in the art, such as those described in 485,045 and 4,544,545. Liposomes with improved circulation time are disclosed in US Pat. No. 5,013,556. Particularly useful liposomes are phosphatidylcholine, cholesterol and PEG.
-Produced by the reverse phase evaporation method with a lipid composition containing derivatized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of a given size to produce liposomes with the desired size. Fab of the antibody of the present invention
The'fragment can be conjugated to liposomes via a disulfide exchange reaction as described by Martin et al., J. Biol. Chem. 257: 286-288 (1982). Chemotherapy (
Doxorubicin, etc.) is optionally contained within the liposome. Gabizon etc.,
See J. National Cancer Inst. 81 (19) 1484 (1989).

F. Identification of Proteins That Can Inhibit Neoplastic Cell Growth or Proliferation The proteins disclosed in this application are assayed in a panel of 60 tumor lines currently used in the National Cancer Institute (NCI) experimental, disease-directed, in vitro drug screening. did. The purpose of this screen is to determine cytotoxicity and / or different types of tumors.
Or to identify a molecule having a cytostatic activity. NCI is 10,000 each year
Screening for more than 30 new molecules (Monks et al., J. Natl. Cancer Ins
t., 83: 757-766 (1991); Boyd, Cancer: Princ. Pract. Oncol. Update, 3 (10).
: 1-12 [1989]). The tumor cell lines used in this experiment are described in Monks et al., Supra. Cell lines whose growth was significantly inhibited by the proteins of the present application were identified in the examples. The results revealed that the tested proteins show cytostatic and in some cases and concentrations cytotoxic activity in various cancer cell lines. Other cell-based assays and animal models for tumors (eg cancer) have also been reported
It can be used to support the findings of the CI cancer screen and to further understand the relationship between the proteins identified herein and tumor sperm cell growth progression and pathogenic equivalents. For example, primary media from tumors in transgenic animals (as described below) can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques for deriving continuous cell lines from transgenic animals are known in the art (see, eg, Small et al., Mol. Cell. Biol., 5: 642-648 [1985]).

G. Animal Models To further understand the role of the genes identified herein in tumor progression and cause, and to test the efficacy of candidate therapeutic agents including antibodies and other agonists of natural polypeptides, including small molecule agonists. For this purpose, various well-known animal models can be used. The in vivo nature of these models can predict response, especially in human patients. Tumors and cancers (eg breast cancer, colon cancer, prostate cancer, lung cancer, etc.)
Animal models of both include both non-recombinant and recombinant (transgenic) animals. Non-recombinant animal models include, for example, rodent, eg mouse models. Such models are based on standard techniques, such as subcutaneous injection, tail vein injection, spleen transplantation, intraperitoneal transplantation, subrenal capsule implantation, or orthopin transplantation, such as colon cancer cells transplanted into colon tissue. , By introducing tumor cells into syngeneic mice. (See PCT Publication WO 97/33551 published September 18, 1997.) Probably the most often used animal species for oncogene studies are immunodeficient mice, especially nude mice. The observation that nude mice with hypo / dysplasia act as hosts for human tumor xenografts has led to widespread use for this purpose. Autosomal recessive nu genes include, for example, ASW, A / He, AKR, BALB /
c, B10. LP, C17, C3H, C57BL, C57, CBA, DBA, D
DD, I / st, NC, NFR, NFS, NFS / N, NZB, NZC, NZW
, P, RIII and SJL were introduced into a large number of different congenic strains of nude mice. In addition, a wide variety of other animals than nude mice with genetic immunodeficiency have been grown and used as recipients for tumor xenografts. For more details, see The Nude Mouse in Oncology Research, E. Boven and B. Wi.
See nograd edition, CRC Press, Inc., 1991.

Cells introduced into these animals include well-known tumor / cancer cell lines such as those listed above, and, eg, the B104-1-1 cell line (stable NIH transfected with the neu proto-oncogene. -3T3 cell line); ras-transfected NIH-3T3
Cells: Can be derived from Caco-2 (ATCC HTB-37), a moderately well differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCC HTB-38) or from tumors and cancer. Tumor or cancer cell samples can be obtained from patients undergoing surgery using standard conditions, including freezing and storage in liquid nitrogen (Karmali
Et al., Br. J. Cancer 48, 689-696 [1983]). Tumor cells can be introduced into animals such as nude mice by various techniques. The subcutaneous (sc) space of mice is highly preferred for tumor implantation. Tumors were s.c. as solid blocks, needle biopsies using trochar, and cell suspensions. c. Can be transplanted. For solid block or trochar implants, tumor tissue fragments of suitable size are s.c. c. Introduced into space. Cell suspensions are freshly prepared from primary tumor or stable tumor cell lines and injected subcutaneously. Tumor cells can also be injected as a subcutaneous implant. In this position, the inoculum is s. c. Precipitated between tissues. Boven and Winograd (1991), supra.
Animal models of breast cancer are basically based on, for example, transplantation of neuroblastoma cells (from which the neu oncogene is first isolated) or neu-transfected NIH-3T3 cells into nude mice, such as Drebin et al., PNAS Produced as described in USA 83, 9129-9133 (1986).

Similarly, animal models of colon cancer are generated by passage of colon cancer cells into animals, eg nude mice, and directing the development of tumors in these animals. Orthotopic transplant models of human colon cancer in nude mice are described, for example, in Wang et al., Cancer Resea.
rch 54, 4726-4728 (1994) and Too et al., Cancer Research 55, 681-684 (1995). This model is based on the so-called AntiCancer, Inc. (SanDiego, Califo
based on "METAMOUSE (trade name)" commercially available from rnia). Tumors generated in animals can be removed and cultured in vitro. Cells from the in vitro medium can then be passaged to animals. These tumors
It can serve as a target for further testing and drug screening. Alternatively, tumors from passage can be isolated and RNA of pre-passage cells and cells isolated after one or more passages is analyzed for discernible expression of the gene of interest. Such passaging techniques can be performed on well-known tumor or cancer cell lines. For example, Meth A, CMS4, CMS5, CMS21, and WEHI-16
4 was introduced into the fibrosarcoma of BALB / c female mice (DeLeo et al., J. Exp. Med. 146,
720 [1977]), which provides a highly controllable model system for the study of anti-tumor activity of various antigens (Palladino et al., J. Immunol. 138, 4023-4032 [1987]).
. Conveniently, tumor cells are grown in vitro in cell culture medium. Prior to injection into animals, the cell lines are washed and buffered with about 10 × 10 ⁶ to 10 × 10 ⁷ cells / buffer.
Suspend at a cell density of ml. The animals are then subcutaneously infected with 10 to 100 μl of cell suspension and left for 1 to 3 weeks until tumors appear.

Furthermore, one of the most thoroughly studied experimental tumors, the mouse Lewis lung (3
LL) carcinoma can be used as a tumor model for research. Efficacy in this tumor model correlated with beneficial effects in the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL). This tumor can be introduced into normal mice upon injection of tumor fragments from affected mice or cells left in culture (Zupi et al., Br. J.
Cancer 41, suppl. 4, 309 [1980]), evidence indicates that tumors start with injection of only one cell and that a very high population of infected tumor cells survives. For more information on this tumor model, see Zacharski, Haemostasis 16,
See 300-320 [1986]. One way to assess the efficacy of test compounds in an animal model of transplanted tumor is to measure tumor size before and after treatment. Traditionally, the size of transplanted tumors is measured with two or three dimensional slide calipers. Measurements limited to two dimensions do not accurately reflect the size of the tumor and are therefore usually converted to the corresponding volumes using mathematical formulas. However, tumor size measurements are extremely inaccurate. The therapeutic effect of a candidate drug can be better described as a treatment-induced growth retardation and a specific growth retardation. Another important variable in describing tumor growth is tumor volume doubling time. Rygaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immun
Computer programs for calculating and describing tumor growth are also available, such as the program reported by e-Deficient Animals, Wu and Sheng, Ed., Basel, 1989, 301. However, it is noted that the necrotic and inflammatory response that follows the tumor can actually increase the tumor size, at least initially. Therefore, these changes are
A combination of morphological methods and flow cytometric analysis should be carefully monitored.

Recombinant (transgenic) animal models are engineered by introducing the coding portion of the gene identified herein into the genome of the animal of interest using standard techniques for making transgenic animals. it can. Transgenic animals
A “transgene” or one that has genetic material introduced into the genome at the prenatal stage (eg embryonic stage) in the animal itself or in the ancestry of the animal. Animals that can serve as targets for transgenic manipulation include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates such as baboons, chimpanzees and monkeys. Techniques known in the art for introducing transgenes into these animals are whole-nuclear microinjection (Hoppe and Wanger, US Pat. No. 4,873,191); retrovirus-mediated gene transfer to the embryonic line (eg Van der Putten et al., Pr
oc. Natl. Acad. Sci. USA 82, 6148-615 [1985]); gene targeting in embryonic liver cells (Thompson et al., Cell 56, 313-321 [1989]); embryo electroporation (L
o, Mol. Cel. Biol. 3, 1803-1814 [1983]); sperm-mediated gene transfer (Lavitrano)
Et al., Cell 57, 717-73 [1989]). For review, see, for example, U.S. Pat.
See issue 736,866. For the purposes of the present invention, transgenic animals include those which carry the transgene only in part thereof ("mosaic animals"). The transgene is integrated as a single transgene or as a concatemer, eg, head-to-head or head-to-tail tandem. Selective introduction of transgenes into specific cell types is also described, for example, in Lasko et al., P.
It is possible according to the technique of roc. Natl. Acad. Sci. USA 89, 6232-636 (1992). Expression of the transgene in transgenic animals can be monitored by standard techniques. For example, Southern blot analysis or PC for confirmation of transgene integration.
R amplification is used. The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, or immunohistochemistry. Animals are further tested for signs of tumor or cancer development.

The efficacy of antibodies that specifically bind the polypeptides identified herein, and other drug candidates, in the treatment of spontaneous animal tumors can also be tested. A suitable target for such studies is cat oral squamous cell carcinoma (SCC). Feline oral SCC is a highly invasive malignancy and the most common oral malignancy in cats, accounting for over 60% of oral tumors reported in this species. Although it rarely metastasizes to distant sites, the low incidence of this metastasis merely reflects the short survival time of the cat-bearing cat. These tumors are usually inoperable, but primarily due to the anatomy of the cat's oral cavity. Currently, there is no effective treatment for this tumor. Prior to the study, each cat undergoes a complete clinical and biopsy examination and computed tomography (CT).
). Cats diagnosed with sublingual oral squamous cell tumors were excluded from the study. The tongue begins to become paralyzed due to this tumor, and the animals will not be able to feed themselves even after treatment kills the tumor. Treat each cat repeatedly over time. Tumor pictures were taken daily during the treatment period and at the time of subsequent rechecks. After treatment, each cat was given another CT scan. CT scans and radiographs were evaluated every 8 weeks thereafter. The data were evaluated for differences in viability, reactivity and toxicity compared to the control group. Positive reaction is
There is a need for tumor shrinkage, preferably improved survival quality or extended survival. In addition, other spontaneous animal tumors, such as dog, cat, and baboon fibrosarcoma, adenocarcinoma, lymphoma, chrondroma, leiomyosarcoma can also be tested. Breast adenocarcinoma in these dogs and cats is a preferred model because its expression and behavior are very similar to those in humans. However, the use of this model is limited by the incidence of this type of tumor in animals.

H. Screening Assays for Candidate Drugs Screening assays for drug candidates inhibit compounds that bind or conjugate to the polypeptides encoded by the genes identified herein, or the interaction of the encoded polypeptides with other cellular proteins. Designed to identify compounds.
Such screening assays include those that follow high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules are considered to include synthetic organic or inorganic compounds, which include peptides, preferably soluble peptides, (poly) peptide-immunoglobulin fusions, including but not limited to poly- and monoclonal antibodies and antibody fragments, It includes single chain antibodies, anti-idiotype antibodies, and chimeric or humanized forms of those antibodies or fragments, as well as antibodies, including human antibodies and antibody fragments. Assays can be performed in a variety of formats and include protein-protein binding assays, biochemical screening assays, immunoassays and cell-based assays that are well characterized in the art. In the binding assay, the interaction is binding and the complex formed is isolated or detected in the reaction mixture. In a particular embodiment, the receptor or candidate drug for the polypeptide encoded by the gene identified herein is covalently or non-covalently immobilized to a solid phase, eg, a microtiter plate. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody specific for the peptide to be immobilized, eg a monoclonal antibody, can be used to anchor the peptide to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled with a detectable label, to the immobilized component, eg, the coated surface containing the anchored component. When the reaction is complete, unreacted components are removed, for example by washing, and the complex adhered to the solid surface is detected. When the first non-immobilized component carries a detectable label, detection of the label immobilized on the surface indicates that complex formation has occurred. If the first non-immobilized component has no label, complex formation can be detected, for example, by a labeled antibody that specifically binds to the immobilized complex.

If the candidate compound interacts with, but does not bind, the particular PRO polypeptide encoded by the gene identified herein, that interaction is a well-known method for detecting protein-protein interactions. Can be assayed by. Such assays include traditional techniques such as cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. Furthermore, protein-protein interactions have been reported by Fields and coworkers [Fiels and Song, Nature (London) 34
0, 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA 88, 9578-9582 (199
By using the yeast-based gene system described in 1)], Chevray and Nat
hans [Proc. Natl. Acad. Sci. USA 89, 5789-5793 (1991)]. Many transcriptional activators, such as yeast GAL4, consist of two physically distinct modular domains, one acting as a DNA binding domain and the other functioning as a transcriptional activation domain. The yeast expression system described in the previous literature (generally referred to as the "2-hybrid system") takes advantage of this property and uses two hybrid proteins, while the target protein is the GAL4 DNA binding domain. On the other hand, the candidate activating protein is fused to the activation domain. G of GAL1-lacZ reporter gene
Expression under the control of the AL4-activated promoter depends on the reconstitution of GAL4 activity via protein-protein interactions. Colonies containing interacting polypeptides are detected with a chromogenic substance for β-galactosidase. A complete kit (MATCHMAKER®) for identifying protein-protein interactions between two specific proteins using 2-hybrid technology is commercially available from Clontech. This system can be extended to the mapping of protein domains involved in a particular protein interaction, as well as the identification of amino acid residues important for this interaction.

I. Pharmaceutical Compositions Polypeptides of the invention, agonist antibodies that specifically bind the proteins identified herein, as well as other molecules identified in the screening assays disclosed above, may be used as pharmaceutical agents for the treatment of tumors, including cancer. It can be administered in the form of a composition. When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is usually preferred. For example, peptide molecules can be designed that retain the ability to bind to target protein sequences based on the variable region sequences of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology (eg, Marasco et al., Proc. Natl. Acad. Sci. USA 90, 7889-7893 [1993].
). The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may include, for example, a cytotoxic drug, a cytokine,
It may also include chemotherapeutic agents or agents that enhance its function, such as growth inhibitors. These molecules are suitably present in combination in amounts that are effective for the purpose intended.

The therapeutic formulations of the polypeptides identified herein, or their agonists, comprise any desired pharmaceutically acceptable active ingredient having the desired degree of purity, in the form of a lipophilic formulation or an aqueous solution. Prepared and stored by mixing with a carrier, excipient or stabilizer (Remington's Pharmaceutical Science 16th edition, Osol, A. Ed.
[1980]). Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the doses and concentrations used and include buffers such as phosphoric acid, citric acid, and other organic acids; including ascorbic acid and methionine. Antioxidants; preservatives (octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol; butyl or benzyl alcohol; alkylparabens such as methyl or propylparaben; catechol; resorcinol; cyclohexanol 3-pentanol; and m-cresol, etc.); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine, glutamic acid , Amino acids such as asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates containing glucose, mannose, or dextrin, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose, or sorbitol; sodium; Salt-forming counterions such as; metal complexes (eg Zn-protein complexes) and / or TWEEN
(Trade name), PLURONICS (trade name), and nonionic surfactants such as polyethylene glycol (PEG) are included. The formulation herein comprises one or more active compounds as necessary for the particular indication being treated,
Those having complementary activities that preferably do not adversely affect each other may also be included. Alternatively, or in addition, the composition may include a cytotoxic drug, cytokine or growth inhibitor. These molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active ingredient may also be colloidal drug delivery in microcapsules prepared eg by coacervation techniques or by interfacial polymerization, eg hydroxymethylcellulose or gelatin-microcapsules and poly (methylmethacrylate) microcapsules, respectively. It may be entrapped in a system (eg liposomes, albumin globules, microemulsions, nanoparticles and nanocapsules) or in microemulsions. These technologies are based on Remington's Pharmaceutical Science 16t
h edition, Osol, A. Ed. (1980). The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane. Therapeutic antibody compositions are generally packaged in a container with a sterile access port, such as an intravenous solution bag or a bag or vial with a stopper pierceable by a hypodermic injection needle.

Sustained-release preparations may be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are shaped articles,
For example, in the form of a film or microcapsules. Examples of sustained release matrices are polyester hydrogels (eg poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polyactides (US Pat. No. 3,773,919).
L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, LUPRON DEPOT (trade name) (injectable globules of lactic acid-glycolic acid copolymer and leuprolide acetate) Acid Copolymer, Poly- (D)
Contains 3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When the encapsulated antibodies remain in the body for a long time, they are denatured or aggregated by exposure to water at 37 ° C, resulting in reduced biological activity and possible altered immunogenicity. . Rational methods can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism was found to be intermolecular SS bond formation through thio-disulfide exchange, stabilization could be modification of sulfhydryl residues, lyophilization from acidic solutions, control of water content, appropriate Can be achieved by the addition of various additives and the development of specific polymer matrix compositions.

J. Methods of Treatment The polypeptides and antibodies of the invention, peptides and agonists thereof, including small molecule agonists, may be used to treat a variety of tumors, such as cancer. Examples of conditions or diseases to be treated include benign or malignant tumors (e.g., renal, liver, kidney (
kidney), bladder, breast, stomach, ovary, colorectal, prostate, pancreas, lung, vulva, thymus, hepatic carcinoma; sarcoma; glioblastoma; and various tumors of the head and neck); Leukemia and lymphoid malignancies; diseases such as neurons, glia, stellates, hypothalamus and glands, macrophages, epithelium, stromal and blastocoel diseases; and inflammation, angiogenesis and immunological diseases. The anti-tumor agents of the present invention, including the polypeptides disclosed herein and agonists similar to their activity, including antibodies, peptides and small organic molecules, can be administered to mammals, preferably humans, by well-known methods, eg, bolus. Or by intravenous infusion by continuous infusion over a predetermined time, or intramuscularly, intraperitoneally, intracranial, intraocular, intraarterial, intralesional, subcutaneous, interarticular, synovial, intrathecal, oral, topical, or It is administered by the inhalation route. Other therapeutic regimens may be combined with the administration of the anti-cancer agents of the invention. For example, patients treated with such anti-cancer agents may receive radiation therapy. Alternatively, or in addition, the patient may be administered a chemotherapeutic agent. The method of preparation and dose schedule for such chemotherapeutic agents will be used according to the manufacturer's instructions or empirically determined by the skilled practitioner. Preparations and dose schedules for such chemotherapy are also described in Chemotherapy Service MC Perry, Ed., Williams & amp.
Wilkins, Baltimore, MD (1992). The chemotherapeutic agent may be administered prior to, following the administration of the antitumor agent of the present invention, or may be administered simultaneously therewith. The anti-cancer agents of the present invention may be combined with doses of anti-estrogen compounds such as tamoxifen or anti-progesterone such as onapristone (see EP 616812) known for these molecules.

Also, antibodies against tumor-associated antigens such as ErB2, EGFR, ErB3, E
It is also preferred to administer an antibody that binds rB4, or vascular endothelial factor (VEGF). Sometimes it is also advantageous to administer the cytokine to the patient. In a preferred embodiment, the anti-cancer agent herein is co-administered with a growth inhibitor. For example, the growth inhibitor is administered first, followed by the anticancer agent of the invention. However, simultaneous administration,
Alternatively, it may be possible to administer the anticancer agent of the present invention first. Appropriate doses for growth inhibitors are those currently used, but may be reduced by the combined (synergistic) effect of the growth inhibitor and this antibody. An appropriate dose of an anti-tumor agent herein for the prevention or treatment of a disease is the type of disease treated as defined above, the severity and course of the disease, the agent being administered for the purpose of prevention or treatment. Whether or not done, depending on prior treatment, patient clinical history and response to medication, and the discretion of the attending physician. The drug is suitably administered to the patient over a single treatment or course of treatment. Animal studies provide reliable guidance in determining the effective therapeutic doses in humans. Interspecies scaling of effective doses is described, for example, in Mordenti J.
And Chappell. W. "The Use of Interspecies Scaling in Toxicokinetics", To
xicokinetics and New Drug Development, Yacobi et al. Ed., Pergamon Press, New Y
It can be carried out according to the principles as disclosed in ork 1989, 42-46.

For example, depending on the type and severity of the disease, about 1 μg / kg to 15 mg / kg (
For example, 0.1-20 mg / kg of antineoplastic agent is the first candidate dose for administration to a patient, eg, by one or more separate doses or continuous infusion.
A typical daily dosage might range from about 1 μg / kg to 100 mg / kg, depending on the factors mentioned above.
Will be more than kg. For repeated administrations over several days or longer, depending on the condition, the treatment is continued until the desired suppression of symptoms of the disease appears. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays. Guidance on dosages and delivery methods in particular is provided in the literature; see, eg, US Pat. Nos. 4,657,760, 5,206,344 or 5,255,212. That different preparations are effective for different therapeutic compounds and different diseases, for example administration targeted to one organ or tissue may require different modes of delivery than other organs or tissues. is expected.

K. Articles of Manufacture In another embodiment of the invention, an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above is provided. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The container may be formed from a material such as glass or plastic. The container holds a composition effective for diagnosing and treating the condition and may have a sterile access port (for example, the container may be an intravenous solution bag or vial having a stopper pierceable by a hypodermic needle). May be). The active agent in the composition is the antitumor agent of the present invention. The label on or on the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container containing a pharmaceutically acceptable buffer such as phosphate buffered saline, Ringer's solution and dextrose solution. In addition, it may include other buffers, diluents, filters, needles, syringes, and other materials desirable from a commercial and user standpoint, including package inserts with instructions for use. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way. The entirety of all patents and literature references cited in this specification are hereby incorporated by reference.

EXAMPLES All other commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated. The source of cells identified by the ATCC Registry Number throughout the examples and throughout the specification is American Type Culture Collection, Manassas, VA.

Example 1 Extracellular Domain Homology Screens to Identify Novel Polypeptides and the cDNAs Encoding them Extracellular domains (ECD) from approximately 950 known secreted proteins from the Swiss-Prot public database. The sequence (including the secretory signal sequence, if any)
It was used to search the T database. The EST database is a public database (
For example, Dayhoff, GenBank) and corporate databases (eg, LIFESEQ (trade name)
), Incyte Pharmaceuticals, Palo Alto, CA). The search is performed by the computer program BLAST or BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480.
(1996)) as a comparison with the 6-frame translation of the EST sequence of the ECD protein sequence. Does not encode a known protein and has a BLAST score of 70 (90
, Or higher) is a program "phrap" (Phil Gree
n, University of Washington, Seattle, WA)
The sequence was constructed.

This extracellular domain homology screen was used to construct consensus DNA sequences against other identified EST sequences using phrap. Furthermore, the consensus DNA sequences obtained are often (but not always) BLAST or BLAST-2 and
Elongated using repeated cycles of phrap and consensus sequences discussed above E
The ST sequence source was used to extend as much as possible. Based on the consensus sequence obtained as described above, oligonucleotides are then synthesized, and PCR is used to identify a cDNA library containing the sequence of interest and a clone of the full-length coding sequence for the PRO polypeptide is isolated. Used as a probe. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55b
It is p-long. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. To screen several libraries for full length clones, DNA from the libraries was
Screened by PCR with PCR primer pairs as in Subel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and the primer pair. The cDNA library used for the isolation of the cDNA clone is Invitrogen, San Di
Prepared by standard methods using commercially available reagents such as those from ego, CA. cd
NA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (pRKB or pRKD, etc .; p
RK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Scie.
nce, 253: 1278-1280 (1991)) at the unique XhoI and NotI sites.

Example 2 Isolation of cDNA clones by amylase screening 1. Preparation of oligo dT primed cDNA library mRNA was isolated from human tissues of interest using reagents and protocols from Invitrogen, San Diego, CA (Fast Track 2). This RNA is called Life Technologies
, Gaithersburg, MD (Super Script Plasmid system) and used to generate oligo dT-primed cDNA in vector pRK5D using protocols and protocols. In this method, double-stranded cDNA was size-classified to over 1000 bp and SalI / NotI binding cDNA was cloned into XhoI / NotI digested vector. pRK5D was cloned into a vector having an sp6 transcription start site, followed by a SfiI restriction enzyme site, and an XhiI / NotI cDNA cloning site.

2. Preparation of Random Primed cDNA Library A secondary cDNA library was created to favorably represent the 5'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (above) and this RNA was generated by Life Technologies in the vector pSST-AMY.0 (Super Script Plasmid referenced above).
System) was used to generate a random primed cDNA library using reagents and pro value calls. In this method, double-stranded cDNA was sized to 500-1000 bp, blunt-ended with a NotI adapter, cleaved at the SfiI site, and SfiI / N
It was cloned into the otI cut vector. pSST-AMY.0 is a cloning vector with a yeast alcohol dehydrogenase promoter in front of the cDNA cloning site and a mouse amylase sequence (mature sequence with no secretory signal) followed by an alcohol dehydrogenase transcription terminator after the cloning site. Thus, a cDNA cloned into this vector fused in frame with an amylase sequence will direct the secretion of amylase from appropriately transfected yeast colonies.

3. Transformation and Detection DNA from the library described in paragraph 2 above was chilled on ice and electrocompetent DH10B bacteria (Life Technoligies, 20 ml) were added. The mixture of bacteria and vector was then electroporated as recommended by the manufacturer. SOC medium (Life Technplogies, 1 ml) was then added and the product was incubated at 37 ° C for 30 minutes. Transformants were then 20 standard 150 mm LB containing ampicillin
Plates were plated and incubated for 16 hours (37 ° C). Discard the positive colonies from the plate and from the bacterial pellet using standard methods, e.g. CsCl-gradient D
NA was isolated. The purified DNA was then loaded into the yeast protocol below. Yeast methods can be divided into three categories: (1) transformation of yeast with plasmid / cDNA binding vectors; (2) detection and isolation of yeast clones secreting amylase;
And (3) PCR amplification of inserts directly from yeast colonies and purification of DNA for sequencing and further analysis. The yeast strain used was HD56-5A (ATCC-90785). This strain has the following genotypes: MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, a yeast mutant having an incomplete post-translational pathway can be used ,. Such variants have translocation-deficient alleles at sec71, sec72, sec62, with truncated sec71 being most preferred. Alternatively, antagonists (including antisense nucleotides and / or ligands) that inhibit the normal manipulation of these genes, other proteins involved in this post-translational pathway (eg, SEC61p
, SEC72p, SEC62p, SEC63p, TDJ1p, SSA1p-4p) or complex formation of these proteins is also preferably used in combination with the amylase-expressing yeast.

Transformation was performed based on the protocol outlined in Gietz et al., Nucl. Acid. Res., 20: 1425 (1992). The transformed cells were then seeded from agar into YEPD complex medium broth (100 ml) and grown overnight at 30 ° C. YEPD Bros, Kaiser
Et al, Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Har
bor, NY, p. 207 (1994). The overnight medium was then diluted to approximately 2x10 ⁶ cells / ml (approximately OD ₆₀₀ = 0.1) in fresh YEPD broth (500 ml) and regrown to 1x10 ⁷ cells / ml (approximately OD ₆₀₀ = 0.4-0.5). . The cells were then harvested, transferred to a GS3 rotor bottle in a Sorval GS3 rotor at 5,000 rpm for 5 minutes, discarded for supernatant and then prepared for transformation by resuspending in sterile water, and in a 50 ml Falcon tube. In the Beckman GS-6KR centrifuge
Centrifuged again at 500 rpm. Discard the supernatant and transfer the cells to LiAc / TE (10 ml, 10 mM Tris-
Wash successively with HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and LiAc / TE (2.5 ml).
).

For the transformation, the prepared cells (100 μl) were added to fresh denatured single-stranded salmon sperm DNA (Lofstrand Labs, Gaitherburg, MD) and transformed DNA in a microtube.
It was caused by mixing with (1 μg vol. <10 μl). The mixture was vortexed briefly and then 40% PEG / TE (600 μl, 40% polyethylene glycol
-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li ₂ OOCCH ₃ , pH 7.5) was added. The mixture was gently agitated and incubated at 30 ° C. with agitation for 30 minutes. The cells were then heat shocked at 42 ° C for 15 minutes and the reaction vessel was placed in a microtube at 12,000 rp.
Centrifuge at m for 5-10 seconds, decant and TE (500 μl, 10 mM Tris-HCl, 1 mM
Resuspension in EDTA pH 7.5) followed by centrifugation. The cells were then diluted in TE (1 ml) and aliquots (200 μl) were spread on 150 mm growth plates (VWR) in pre-prepared selective medium. Alternatively, the transformations were performed in one large reaction rather than multiple small reactions, but the amount of quiche was scaled up accordingly. The selection medium used was Kaiser et al., Methods in Yeast Genetics, Cold Spring Har.
Uracil-free synthetic complete dextrose agar (SCD-Ura) prepared as described in Bor Press, Cold Spring Harbor, NY, p. 208-210 (1994).
The transformants were grown at 30 ° C for 2-3 days.

Detection of amylase secreting colonies was performed by the inclusion of red starch in the selective growth medium. Starch was coupled to a red dye (reactive Red-120, Sigma) according to the method described by Biely et al., Anal. Biochem., 172: 176-179 (1988). Bound starch was introduced onto SCD-Ura agar plates at a final concentration of 0.15% (w / v) and buffered to pH 7.0 with potassium phosphate (final concentration 50-100 mM). Positive colonies were picked and streaked on fresh selection medium (150 mm plate) to give well isolated and identifiable single colonies. Well-isolated colonies positive for amylase secretion were detected by direct introduction of the red dye group into buffered SCD-Ura agar. Positive colonies were determined by their ability to degrade starch and form visible halos directly around the positive colonies.

4. Isolation of DNA by PCR Amplification When positive colonies were isolated, a portion was picked with a toothpick and diluted in sterile water (30 μl) in a 96-well plate. At this point, positive colonies are either frozen and either stored for subsequent analysis or immediately amplified. Aliquots of cells (5 μl) into 0.5 μl Klentaq (Clontech, Palo Alto, CA); 4.
0 μl 10 mM dNTP (Perkin Elmer-Cetus); 2.5 μl Kentaq buffer (Clontech
); 0.25 μl forward oligo 1; 0.25 μl reverse oligo 2; used as template for PCR reaction in 25 μl volume containing 12.5 μl distilled water. The sequence of the forward oligonucleotide 1 was: 5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT -3 '(SEQ ID NO: 57). The sequence of reverse oligonucleotide 2 was: 5'-CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT -3 '(SEQ ID NO: 58). PCR was then performed as follows: a. Denaturation 92 ° C, 5 minutes b. Next 3 cycles Denaturation 92 ° C, 30 seconds Annealing 59 ° C, 30 seconds Extension 72 ° C, 60 seconds c. Next 3 cycles Denaturation 92 ℃, 30 seconds Anneal 57 ℃, 30 seconds Extension 72 ℃, 60 seconds d. Next 25 cycles Denaturation 92 ° C, 30 seconds Anneal 55 ° C, 30 seconds Extension 72 ° C, 60 seconds e. Hold 4 ° C

The underlined regions anneal to the ADH promoter region and the amylase region, respectively, and amplify the 307 bp region from vector pSST-AMY.0 in the absence of insert. Typically, the first 18 nucleotides at the 5'end of these oligonucleotides contained the sequence primer annealing site. That is, the total product of the PCR reaction from the empty vector was 343 bp. However, the signal sequence fusion cDNA resulted in a rather long nucleotide sequence. Following PCR, an aliquot (5 μl) of the reaction was agarose gel electrophoresis using a Tris-borate-EDTA (TBE) buffer system in a 1% agarose gel as described by Sambrook et al., Supra. Tested. Clones yielding a single, strong PCR product larger than 400 bp were cloned into a 96 Qiaquick PCR cleaning column (Quagen Inc., Chars
Further analysis by DNA sequence after purification in Worth, CA.

Example 3 Isolation of cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences are described in Genentech, Inc. (South San
The proprietary sequence-finding algorithms developed by Francisco, CA) are publicly (eg, GenBank) and / or private (LIFESEQ®, Incyte Pharmaceuticals
, Inc., Palo Alto, Calif.) Database and identified by applying to the EST fragments assembled and assembled. The signal sequence algorithm is
A secretory signal score based on the letters of the DNA nucleotides surrounding the first, and optionally the second, methionine codon (ATG) at the 5'-end of the sequence or sequence fragment under consideration is calculated. The nucleotides following the first ATG must encode at least 35 unambiguous amino acids with no stop codon. First
If the ATG of A has the required amino acids, the second is not tested. If neither met the requirements, the candidate sequences were not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA surrounding the ATG codon and the corresponding amino acid sequence were analyzed using a set of seven sensors (evaluation parameters) known to be associated with the secretory signal. Used to score. The use of this algorithm has led to the identification of many polypeptide-encoding nucleic acid sequences.

Example 4 Isolation of a cDNA clone encoding human PRO240 As described in Example 1, conrap was used to construct consensus DNA sequences for other EST sequences. This consensus sequence is now DNA30873
To name. Based on the DNA30873 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO24.
Oligonucleotides were synthesized for use as probes to isolate 0 full length coding sequence clones. PCR primers (forward and reverse) were synthesized: Forward PCR primer: 5'-TCAGCTCCAGACTCTGATACTGCC-3 '(SEQ ID NO: 59) Reverse PCR primer: 5'-TGCCTTTCTAGGAGGCAGAGCTCC-3' (SEQ ID NO: 60) , A DNA30873 consensus sequence was made into a synthetic oligonucleotide hybridization probe, which had the following nucleotide sequence: Hybridization probe: 5'-GGACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAG-3 '(SEQ ID NO: 61
)

To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO240 gene with one of the primer pairs. RNA for the construction of the cDNA library was isolated from human fetal liver tissue.
The cDNA library used to isolate the cDNA clones is Invitrogen, San Diego, C
Prepared by standard methods using commercially available reagents such as those from A. The cDNA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (such as pRKB or pRKD; pRK5B is pRK5D without SfiI site
, Holmes et al., Science, 253: 1278-1280 (1991)).
The XhoI and NotI sites were cloned in the specified orientation. DNA sequencing of the clones isolated as described above revealed that the full-length DNA sequence for the PRO240 polypeptide (herein, DNA34387-1138 [FIG.
, SEQ ID NO: 1]) and the derived protein sequence of PRO240 was obtained. The full-length clone identified above contains a single open reading frame with an apparent translational initiation site at nucleotide positions 12-14 and a stop signal at nucleotide positions 699-701 (Figure 1, SEQ ID NO: 1). The predicted polypeptide precursor is 229 amino acids long and is shown in Figure 2 (SEQ ID NO: 2). Figure 2
Analysis of the full-length PRO240 sequence shown in (SEQ ID NO: 2) reveals the presence of various important polypeptide domains shown in FIG. 2 and the positions given to those important polypeptide domains are as described above. It is approximate. Full length PRO
Analysis of the 240 sequence revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 30 and a transmembrane domain from about amino acid 198 to amino acid 212. Clone DNA34387-1138 was deposited with the ATCC on September 16, 1997 and was assigned ATCC deposit no. Based on the Dayhoff database (version 35.45, SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full length sequence shown in Figure 2 (SEQ ID NO: 2), PRO
Sequence identity was revealed between the 240 amino acid sequence and the serrated protein precursor from Drosophilia melanogaster and the C-serrated-1 protein from Gallus gallus (30% and 35%, respectively).

Example 5 Isolation of a cDNA Clone Encoding Human PRO381 A consensus DNA sequence was constructed using phrap with other EST sequences as described in Example 1. This consensus sequence is now in DNA39651
To name. Based on the DNA39651 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO38.
Oligonucleotides were synthesized for use as probes to isolate one full length coding sequence clone. PCR primers (forward and reverse) were synthesized: Forward PCR primer (39651.f1): 5'-CTTTCCTTGCTTCAGCAACATGAGGC-3 '(SEQ ID NO: 62) Reverse PCR primer (39651.r1): 5'-GCCCAGAGCAGGAGGAATGATGAGC. -3 '(SEQ ID NO: 63) In addition, a synthetic oligonucleotide hybridization probe was made from the DNA39651 consensus sequence and had the following nucleotide sequence: Hybridization probe (39651.p1): 5'-GTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTTG- 3 '(SEQ ID NO: 64
)

To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO381 gene with one of the primer pairs. RNA for the construction of the cDNA library was isolated from human fetal kidney tissue (LIB227). By DNA sequencing of the clones isolated as described above, DNA44194-
The full-length DNA sequence of 1317 [FIG. 3, SEQ ID NO: 3]; and the derived protein sequence of PRO381 were obtained. The entire coding sequence of DNA44194-1317 is included in Figure 3 (SEQ ID NO: 3). Clone DNA44194-1317 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 174-176 and an apparent stop codon at nucleotide positions 807-809. The predicted polypeptide precursor is 211 amino acids long. Analysis of the full-length PRO381 sequence shown in Figure 4 (SEQ ID NO: 4) reveals the presence of various important polypeptide domains and the positions given to those important polypeptide domains are approximately as described above. belongs to. Analysis of the full-length PRO381 polypeptide shown in Figure 4 revealed the presence of the following: a signal peptide of about amino acids 1 to about amino acids 20; a potential N-glycosylation site of about amino acids 176 to 180; about amino acids 208. An endoplasmic reticulum targeting sequence of about amino acids 212; about amino acids 78 to about amino acids 115, and about amino acids 118 to about amino acids 132 to FKBP-type peptidyl-prolyl cis-trans isomerase sites; about amino acids 140 to about amino acids 160, about EF-hand calcium binding domain from amino acid 184 to about amino acid 204, and about amino acid 191 to about amino acid 204; and about amino acid 183 to
S-100 / ICaBp-type calcium binding domain at about amino acid 201. Clone DNA44194-1317 was deposited with the ATCC on April 28, 1998
C deposit number 209808 has been assigned. The full-length PRO381 protein shown in Figure 4 has an estimated molecular weight of approximately 24,172 daltons and a pI of approximately 5.99. Analysis of the amino acid sequence of the full-length PRO381 polypeptide suggested that it has significant sequence similarity to the FKBP immunophilin protein, thus PRO381 is a novel FKBP immunophilin homolog. More specifically, by analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 4 (SEQ ID NO: 4), P
Sequence homology was found between the RO381 amino acid sequence and the Dayhoff sequence shown below: AF040252_1, I49669, P_R93551, S71238, CELC05C8_1, CEU27353_1, MI.
P_TRYCR, CEZC455_3, FKB4_HUMAN and I40718.

Example 6 Isolation of a cDNA Clone Encoding Human PRO534 As described in Example 1, conrap was used to construct consensus DNA sequences for other EST sequences. This consensus sequence is now DNA43048
To name. Based on the DNA43048 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO53.
Oligonucleotides were synthesized for use as probes to isolate 4 full length coding sequence clones. PCR primers (forward and reverse) were synthesized: Forward PCR primer: 5'-CACAGAGCCAGAAGTGGCGGAATC-3 '(SEQ ID NO: 65) Reverse PCR primer: 5'-CCACATGTTCCTGCTCTTGTCCTGG-3' (SEQ ID NO: 66) , A synthetic oligonucleotide hybridization probe was made from the DNA43048 consensus sequence and had the following nucleotide sequence: Hybridization probe: 5'-CGGTAGTGACTGTACTCTAGTCCTGTTTTACACCCCGTGGTGCCG-3 '(SEQ ID NO: 67).

To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO534 gene using one of the primer pairs. RNA for the construction of a cDNA library is a human fetal lung tissue (
LIB26). By DNA sequencing of the clones isolated as described above, DNA48333-
1321 [FIG. 5, SEQ ID NO: 5]; and the derived protein sequence of PRO534 were obtained. The entire coding sequence of DNA48333-1321 is shown in Figure 5 (SEQ ID NO: 5). Clone DNA48333-1321 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 87-89 and an apparent stop codon at nucleotide positions 1167-1169 (Figure 5). The predicted polypeptide precursor is 360 amino acids long (Figure 6). Full length PR shown in FIG.
The O534 protein has an estimated molecular weight of approximately 39,885 daltons and approximately 4.79.
Has a pI of Clone DNA48333-1321 was AT on March 26, 1998
It has been deposited with the CC and has been assigned ATCC deposit no. 2097001. The deposited clone contains the correct sequence and it is understood that the sequences provided herein are representative based on current sequencing technology. Analysis of the amino acid sequence of the full-length PRO534 polypeptide revealed that some of it had significant sequence similarity to the protein disulfide isomerase and thus PRO5
It was suggested that 34 is a novel disulfide isomerase. Further analysis of the amino acid sequence of PRO534 reveals that the signal peptide is present at about amino acids 1-25 of SEQ ID NO: 6. The transmembrane domain exists from about amino acids 321 to 340 of SEQ ID NO: 6. The disulfide isomerase equivalent region exists at about amino acids 212 to 302 of SEQ ID NO: 6. The thioredoxin domain is located at about amino acids 211-228 of SEQ ID NO: 6. The N-glycosylation site is about amino acids 165-169, 181-185, 187-191, 19 of SEQ ID NO: 6.
4-198, 206-210, 278-282, and 293-297. N
-Myristoylation sites are about amino acids 32-38, 70-76, 1 of SEQ ID NO: 6.
11-117, 115-121, 118-124, and 207-213.
The amidation site exists at about amino acids 5-9 of SEQ ID NO: 6. Corresponding nucleotides can be routinely determined from the amino acid sequences provided herein. PRO534, like other protein disulfide isomerases, has a transmembrane domain rather than an ER-retaining polypeptide. In addition, PRO534 can have an intron at the 5 prime end.

Example 7 Isolation of a cDNA Clone Encoding Human PRO540 Consensus DNA sequences were constructed against other EST sequences using phrap as described in Example 1. This consensus sequence is now DNA39631
To name. Based on the DNA39631 consensus sequence, 1) to identify a cDNA library containing the sequence of interest by PCR, and 2) PRO54
Oligonucleotides were synthesized for use as probes to isolate 0 full length coding sequence clones. PCR primers (forward and reverse) were synthesized: Forward PCR primer (39631.f1): 5'-CTGGGGCTACACACGGGGTGAGG-3 '(SEQ ID NO: 68) Reverse PCR primer (39631.r1): 5'-GGTGCCGCTGCAGAAAGTAGAGCG -3 '(SEQ ID NO: 69) Hybridization probe (39631.p1): 5'-GCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGCGAGATG-3' (SEQ ID NO: 70)

To screen several libraries for a source of full length clones, DNA from the libraries was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate clones encoding the PRO540 gene with one of the primer pairs. RNA for the construction of the cDNA library was isolated from human fetal kidney tissue (LIB227). The cDNA library used for the isolation of the cDNA clone was Invitrogen, Sa
Made by standard methods using commercially available reagents such as those from Diego, CA.
The cDNA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain an SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) and was cloned in specific orientations at unique XhoI and NotI sites. By DNA sequencing of the clones isolated as described above, DNA44
The full length DNA sequence for the PRO540 polypeptide designated 189-1322 (SEQ ID NO: 7) was obtained. Clone DNA44189-1322 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 21-23 and ending at the stop codon at nucleotide positions 1257-1259 (FIG. 7). The predicted encoded polypeptide precursor is 412 amino acids long (Figure 8, SEQ ID NO: 8). The full-length PRO540 protein shown in Figure 8 has an estimated molecular weight of approximately 46,658 daltons and a pI of approximately 6.65. PR
Important regions of the amino acid sequence of O540, including approximate positions, are the signal peptide (residues 1-28), the potential N-glycosylation site (residues 99-103, 27).
3-277, 289-293, 398-402), potential lipid substrate binding sites (residues 147-164), typical sequences of lipase and serine proteins (residue 189).
-202), the tyrosine kinase phosphorylation site (residues 165-174 and 178-).
186), the beta transduction family Trp-Asp repeat (residues 353-366).
) And N-myristoylation sites (residues 200-206, 227-233, 232
-238 and 316-322). Clone DNA44189-1322 is 1998
It was deposited with the ATCC on March 26 and was assigned ATCC deposit no. 209699.

Example 8 Isolation of cDNA Clones Encoding Human PRO698 A yeast screening assay was used to identify cDNAs encoding potential secreted proteins. By using this yeast screen, DN
A single cDNA designated A39906 was identified. Oligonucleotides were synthesized based on the DNA39906 sequence for 1) identification of a cDNA library containing the sequence of interest by PCR and 2) use as a probe to isolate clones of the PRO698 full length coding sequence. . DNA from libraries to screen several libraries for full-length clones
PCR as in Ausubel et al., Current Protocols in Molecular Biology,
Screened by PCR with primer pairs. Positive library,
It was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and the primer pair. PCR primers (forward and reverse) were synthesized: Forward PCR primer: 5'-AGCTGTGGTCATGGTGGTGTGGTG-3 '(SEQ ID NO: 71) Reverse PCR primer: 5'-CTACCTTGGCCATAGGTGATCCGC-3' (SEQ ID NO: 72) , A synthetic oligonucleotide hybridization probe was made from the DNA39906 sequence and had the following nucleotide sequence: Hybridization probe: 5'-CATCAGCAAACCGTCTGTGGTTCAGCTCAACTGGAGAGGGTT-3 '(SEQ ID NO: 73) Some sources of full length clones. DNA from the library was PCR amplified with the PCR primer pair identified above. The positive library is then loaded with probe oligonucleotides and PCR.
It was used to isolate a clone encoding the PRO698 gene with one of the primer pairs. RNA for the construction of a cDNA library was prepared from human bone marrow tissue (LI
B255). The cDNA library used to isolate the cDNA clone is Invi
Prepared by standard methods using commercially available reagents such as those from trogen, San Diego, CA. The cDNA was primed with an oligo dT containing the NotI site and SalI at the blunt end.
It was ligated to a hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB or pRKD etc .; pRK5B
It is a precursor of pRK5D that does not contain the I site; Holmes et al., Science, 253: 1278-1280 (1
991)) and cloned in the specified orientation at the unique XhoI and NotI sites.

A full-length clone (herein DNA48320-1433 [SEQ ID NO: 9]) was identified, which contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 14-16, and nucleotide positions 1544-
A stop codon was found at 1546. The predicted polypeptide precursor is 510 amino acids long, has a calculated molecular weight of approximately 57,280 daltons and an estimated pI of approximately 5.61. Analysis of the full-length PRO698 sequence shown in Figure 10 (SEQ ID NO: 10) revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20; about amino acid 72 to amino acid 76, about amino acid 136 to about amino acid. Amino acid 1
40, about amino acid 193 to about amino acid 197, about amino acid 253 to about amino acid 2
57, about amino acids 352 to about amino acids 356, about amino acids 411 to about amino acids 4
N-glycosylation site of 15; tyrosine kinase phosphorylation site of about amino acid 449 to about amino acid 457; amino acid block having homology to plant lectin beta chain protein of about amino acid 20 to about amino acid 40; about amino acid 16 to about amino acid 22 About amino acid 39 to about amino acid 45, about amino acid 53 to about amino acid 59, about amino acid 61 to about amino acid 67, about amino acid 63 to about amino acid 69, about amino acid 81 to about amino acid 87, about amino acid 249 to about amino acid 255, about Amino acid 32
6 to about amino acid 332, about amino acid 328 to about amino acid 334 and about amino acid 4
N-myristoylation site from 38 to about amino acid 444; an amino acid block with homology to the HBGF / FGF family from about amino acid 338 to about amino acid 366.
Clone DNA48320-1433 was deposited with the ATCC on May 27, 1998,
ATCC Deposit No. 209904 has been assigned. Analysis of the amino acid sequence of the full-length PRO698 polypeptide reveals that it has significant sequence similarity to the olfactomedin protein and thus P
It was suggested that RO698 is a novel olfactmedin homolog. More specifically, analysis of the Dayhoff database (version 35.45 SwissProt 35) found sequence homology between the PRO698 amino acid sequence and the Dayhoff sequence shown below: OLFM_RANCA, I73637, AB006686S3_1, RNU78105_1, RNU72487_1, P_
R98225, CELC48E7_4, CEF11C3_3, XLU85970_1 and S42257.

Example 9 Isolation of cDNA Encoding Human PRO982 D applying the corporate signal sequence discovery algorithm described in Example 3 above.
NA57700-1408 was identified. The use of the signal sequence algorithm described above enabled the identification of an EST cluster sequence, here designated Incyte EST cluster number 43715, from the Incyte database. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA.
Existing homologies were identified by comparison with various expressed sequence tag (EST) databases, including databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul
Et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56095. In view of the observed sequence homology between the DNA56095 consensus sequence and Merck EST number AA024389 from the Merck database, Merck EST number AA024389.
Was purchased and the cDNA insert was obtained and sequenced. Here, it was found that the cDNA insert encoded the full length protein. The sequence of this cDNA insert is shown in FIG.
(SEQ ID NO: 11), and is herein designated as DNA57700-1408. Clone DNA57700-1408 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 26-28 and ending at the stop codon at nucleotide positions 401-403 (FIG. 11; SEQ ID NO: 1).
1). The predicted polypeptide precursor is 125 amino acids long (Figure 12), has a calculated molecular weight of approximately 14,198 daltons and an estimated pI of approximately 9.01 (Figure 12). Further, by analysis of full-length PRO982 (SEQ ID NO: 12) shown in FIG. 12, a signal peptide of about amino acids 1 to about amino acids 21; an N-myristoylation site of about amino acids 33 to 39 and about amino acids 70 to about amino acids 76; and A potential anaphylatoxin domain of about amino acid 50 to about amino acid 60 was revealed. Clone DNA57700-1408 was deposited with the ATCC on January 12, 1999 and was assigned ATCC deposit no. 203583.

Example 10 Isolation of cDNA Encoding Human PRO1005 D was obtained by applying the corporate signal sequence discovery algorithm described in Example 3 above.
NA57708-1411 was identified. The use of the signal sequence algorithm described above allowed the identification of an EST cluster sequence, herein designated Incyte EST cluster number 49243, from the Incyte database. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA.
Existing homologies were identified by comparison with various expressed sequence tag (EST) databases, including databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul
Et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56095. In view of the observed sequence homology between the DNA56095 consensus sequence and the Merck EST number AA256657 from the Merck database, the Merck EST number AA256657.
Was purchased and the cDNA insert was obtained and sequenced. Here, it was found that the cDNA insert encoded the full length protein. The sequence of this cDNA insert is shown in FIG.
(SEQ ID NO: 13), and is herein designated as DNA57708-1411. Clone DNA57708-1411 (FIG. 13; SEQ ID NO: 13) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 30-32 and ending at the stop codon at nucleotide positions 585-587 ( Figure 13; SEQ ID NO: 13). The predicted polypeptide precursor is 185 amino acids long (Figure 14), has an estimated molecular weight of about 20,331 daltons and about 5.
It has a pI of 85 (Figure 14). Analysis of the full-length PRO1005 sequence shown in Figure 14 (SEQ ID NO: 14) reveals the presence of various important polypeptide domains shown in Figure 14, and the positions given to those important polypeptide domains are as described above. So it's about. Analysis of the full-length PRO1005 sequence shown in Figure 14 revealed the presence of the following: a signal peptide of about amino acids 1 to about amino acids 20; about amino acids 67 to about amino acids 73, about amino acids 118 to about amino acids 12;
4, and an N-myristoylation site from about amino acids 163 to about amino acids 169; a flavodoxin homologue from about amino acids 156 to about amino acids 175. Clone DNA57
708-1411 was deposited with the ATCC on June 23, 1998, and has been assigned ATCC Deposit No. 2
03021 was assigned. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full length sequence shown in Figure 14 (SEQ ID NO: 14) revealed sequence homology between the PRO1005 amino acid sequence and the Dayhoff sequence shown below. Sex was found: DDU07187_1, DDU87912_1, CELD1007_14, A42239, DDU42597_1,
CYAG_DICDI, S50452, MRKC_KLEPN, P_R41998, and XYNA_RUMFL.

Example 11 Isolation of a cDNA clone encoding human PRO1007 The consensus DNA sequence was compared to other EST sequences as described in Example 1.
It was created using phrap. The EST sequence derived from human liver tissue (clone 83012 from library 341) and identified as Merck EST T70513 was identified using the ECD homology approach described above. Merck EST T70513 was obtained and further examined and sequenced, the full length DNA sequence designated herein as DNA57690-1374 (FIG. 15, SEQ ID NO: 15) and the derived PRO1007 native sequence polypeptide (FIG. 16, SEQ ID NO: 15). 16) was isolated. Clone DNA57690-1374 contains a single open reading frame reading frame with nucleotide positions 16-1 as indicated by underlining.
It terminates at the apparent translational initiation site at 8 and a stop codon (TGA) at nucleotide positions 1054-1056 (FIG. 15). The predicted PRO1007 polypeptide precursor is 346 amino acids long (Figure 16), has an estimated molecular weight of approximately 35,917 daltons and a pI of approximately 8.17. A clone containing DNA57690-1374 has been deposited with the ATCC on June 9, 1998 and is assigned deposit number 209950. Analysis of the amino acid sequence of PRO1007 polypeptide (SEQ ID NO: 16) shows a putative signal peptide at amino acid residues about 1-30; amino acid residues at about 325-3.
46 transmembrane domains; about amino acid residues 118-121, 129-132, 13
6-166, 176-179, 183-186 and 227-130 N-glycosylation sites; Ly-6 / u-Pa at amino acid residues approximately 17-36 and 209-222.
r domain protein homologue; amino acid residues approximately 26-32, 43-49, 57-
63, 66-72, 81-87, 128-134, 171-171, 218-2
24, 298-304 and 310-316 N-myristoylation sites; and prokaryotic membrane lipoprotein lipid adhesion sites at amino acid residues approximately 205-216 were revealed. Corresponding nucleotides can be routinely determined given the sequences provided herein.

Example 12 Isolation of a cDNA clone encoding human PRO1131 cD isolated in the amylase screen described in Example 2 above.
The NA sequence is designated herein as DNA43546. The DNA43546 sequence is then compared to various expressed sequence tags (ESTs), including public EST databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). , Identified existing homologues. Homolog search is performed by the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymol
ogy 266: 460-480 (1996)). Those comparisons that scored a BLAST score of 70 (or in some cases 90) or higher that did not encode a known protein were assembled into a "phrap" program (Phil Green, University of Washingt
on Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained is herein designated DNA45627. Based on the DNA45627 sequence, an oligonucleotide probe was produced and used to screen the human library described in the first paragraph of Example 2 above. The cloning vector is pRK5B (pRK5B does not contain the SfiI site.
The precursor of RK5D; Holmes et al., Science 253: 1278-1280 (1991)), the cleaved cDNA size was less than 2800 bp. PCR primers (forward and two reverse) were synthesized: Forward PCR primer: 5'-ATGCAGGCCAAGTACAGCAGCAC-3 '(SEQ ID NO: 74) Reverse PCR primer 1: 5'-CATGCTGACGACTTCCTGCAAGC-3' (SEQ ID NO: 75) Inverse PCR Primer 2: 5'-CCACACAGTCTCTGCTTCTTGGG-3 '(SEQ ID NO: 76) Furthermore, a synthetic oligonucleotide hybridization probe was made from the DNA45627 sequence having the following nucleotide sequence: Hybridization probe: 5'- ATGCTGGATGATGATGGGGACACCACCATGAGCCTGCATT-3 '(SEQ ID NO: 77)

To screen several libraries against a source of full-length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to isolate clones encoding the PRO1131 gene using one of the probe oligonucleotides and PCR primers. A full length clone was identified containing a single open reading frame with an apparent translational initiation site at nucleotide positions 144-146 and a stop signal at nucleotide positions 984-986 (FIG. 17; SEQ ID NO: 17). The predicted polypeptide precursor is 280 amino acids long, has a calculated molecular weight of approximately 31,966 daltons and approximately 6.26.
With an estimated pI of The transmembrane domain is about 49-amino acid residues of SEQ ID NO: 18.
74; the N-glycosylation site is at about amino acid residues 95-98 of SEQ ID NO: 18.
And 169-172; the tyrosine kinase phosphorylation site is at amino acid residues 142-150 and 156-164 of SEQ ID NO: 18; the N-myristoylation site is 130-136, 214-220 of SEQ ID NO: 18. And 242-248; the region having sequence identity with the LDL receptor is about 50- of SEQ ID NO: 18.
At 265. Clone DNA59777-1480 was cloned into ATC on August 11, 1998.
C has been deposited with ATCC deposit no. 203111. Analysis of the Dayhoff database (version 35.45, SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full-length sequence shown in FIG.
053, I49115, RNU56863_1, LY4A_MOUSE, I55686, MMU56404_1, I49361, AF03031
Certain sequence identity between 3_1 and MMU09739_1 was demonstrated.

Example 13 Isolation of cDNA Encoding Human PRO1157 D was obtained by applying the corporate signal sequence discovery algorithm described in Example 3 above.
NA60292-1506 was identified. The use of the signal sequence algorithm described above allowed the identification of an EST cluster sequence, herein designated Incyte EST cluster number 49243, from the Incyte database. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA.
Existing homologies were identified by comparison with various expressed sequence tag (EST) databases, including databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul
Et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56095. In view of the observed sequence homology between the DNA56095 consensus sequence and Merck EST number AA516481 from the Merck database, Merck EST number AA516481.
Was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 19 (SEQ ID NO: 19) and is herein designated as DNA60292-1506.

Clone DNA60292-1506 (FIG. 19; SEQ ID NO: 19) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 56-58, and a stop codon at nucleotide positions 332-334. Terminate (FIG. 19). The predicted polypeptide precursor is 92 amino acids long (Figure 2).
0; SEQ ID NO: 20). The full-length PRO1157 protein shown in FIG.
It has an estimated molecular weight of 360 daltons and a pI of about 9.17. Analysis of the full-length PRO1157 sequence shown in Figure 20 (SEQ ID NO: 20) reveals the presence of various important polypeptide domains, and the positions given to those important polypeptide domains are approximately as described above. It is a thing. Full length PRO1 shown in FIG.
Analysis of the 157 sequence revealed the presence of the following: a signal peptide of about amino acids 1 to about amino acids 18; a putative transmembrane domain of about amino acids 51 to about amino acids 70; a glycosaminoglycan of about amino acids 40 to about amino acids 44. Adhesion site; N-myristoylation site of about amino acid 34 to about amino acid 40, about amino acid 37 to about amino acid 43 and about amino acid 52 to about amino acid 58; and prokaryotic membrane lipoprotein lipid adhesion site of about amino acid 29 to about amino acid 40. . Clone DNA60292-
1506 was deposited with the ATCC on Dec. 15, 1998, ATCC Deposit No. 20354
0 was given. Analysis of the Dayhoff database (version 35.45, SwissProt35) using the WU-BLAST2 sequence alignment analysis method for the full length sequence shown in FIG.
251, I51419, AF019562_1, AF019563_1, C211_HUMAN, I37577, A39171, GAT5_MO
Certain sequence identity was demonstrated between USE, ACR3_MOUSE, 5H6_RAT, P_W31512, and S58082.

Example 14 Isolation of cDNA Encoding Human PRO1199 The publicly expressed sequence tag (EST) DNA database (GenBank) was cloned into full length mouse m-.
By searching with FIZZ1 DNA (DNA53517), EST showing a homology with m-FIZZ1 DNA was named [AA311232, renamed as DNA53028]. Oligonucleotides were synthesized based on the EST sequences for 1) identification of a cDNA library containing the sequence of interest by PCR, and 2) use as a probe to isolate clones of the PRO1199 full length coding sequence. .. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to yield PCR products of about 100-1000 bp in length. The probe sequence is typically 40-55 bp long. DNA from libraries to screen several libraries for full-length clones
Were screened by PCR amplification with PCR primer pairs according to Ausubel et al., Current Protocols in Molecular Biology. The positive library was then used to isolate clones encoding the gene of interest using one of the probe oligonucleotides and the primer pair. The oligonucleotide probes used were as follows: Forward PCR primer (h-FIZZ3.f): 5'-GGATTTGGTTAGCTGAGCCCACCGAGA-3 '(SEQ ID NO: 78) Reverse PCR primer (h-FIZZ3.r): 5'- GCACTGCGCGCGACCTCAGGGCTGCA-3 '(SEQ ID NO: 79) Probe (h-FIZZ3.p): 5'-CTTATTGCCCTAAATATTAGGGAGCCGGCGACCTCCTGGATCCTCTCATT-3' (SEQ ID NO: 80)
)

To screen several libraries against a source of full length clones, DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. The positive library was then used to probe PRO1 using one of the probe oligonucleotides and PCR primers.
A clone encoding the 199 gene was isolated. Used to isolate cDNA clones
The cDNA library was created by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and the appropriate cloning vector (pRKB
Or pRKD etc .; pRK5B is a precursor of pRK5D that does not contain SfiI site; Holmes et al., Scie
nce, 253: 1278-1280 (1991)) at the unique XhoI and NotI sites. Full-length clone DNA65351-1366-1 was identified, which contains a single open reading frame, has an apparent translational initiation site at nucleotide positions 25-27, and a stop codon at nucleotide positions 349-351 ( Figure 21; SEQ ID NO: 21). The predicted polypeptide precursor is 108 amino acids long, has a calculated molecular weight of approximately 11,419 daltons and an estimated pI of approximately 7.05. Analysis of the full-length PRO1199 sequence shown in Figure 22 (SEQ ID NO: 22) reveals the presence of various important polypeptide domains and the positions assigned to those important polypeptide domains are approximately as described above. belongs to. Analysis of the full-length PRO1199 sequence shown in Figure 22 (SEQ ID NO: 22) revealed that
The presence of the following has been revealed: a signal peptide of about amino acids 1 to about amino acids 18; a cell adhesion sequence motif (RGD) of about amino acids 57 to 60 amino acids; about amino acids 13 to about amino acids 19, about amino acids 71 to about amino acids 77. , About amino acid 75
~ About amino acid 81, about amino acid 95 to about amino acid 101, and about amino acid 100
~ N-myristoylation site at about amino acid 106. Clone DNA65251-1
366-1 was deposited with the ATCC on May 12, 1998 and has been assigned ATCC deposit no.
56 was awarded.

Example 15 Isolation of a cDNA Clone Encoding Human PRO1265 D Applying the corporate signal sequence discovery algorithm described in Example 3 above, D
NA60764-1533 was identified. The use of the signal sequence algorithm described above enabled the identification of EST cluster sequences from the LIFESEQ database, which is named Incyte EST cluster number 86995. This EST cluster sequence is then converted into a public EST database (eg GenBank) and a company ES.
T DNA database (LIFESEQ (trade name), Incyte Pharmaceuticals, Palo Alt
existing homology was identified by comparison to various expressed sequence tag (EST) databases, including o, CA). The homology search is performed by the computer program BLAST or BLAST2.
(Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those that have the program "phrap" (Phil Green, University of
(Washington, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA55717. In light of the sequence homology between the DNA55717 sequence and Incyte EST No. 20965, Incyte EST No. 20965 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 7 (SEQ ID NO: 23), where DNA6076.
It is named 4-1533.

The entire coding sequence of DNA60764-1533 is included in Figure 23 (SEQ ID NO: 23). Clone DNA60764-1533 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 79-81,
And terminates at the stop codon at nucleotide positions 1780-1782 (Figure 23)
. The predicted polypeptide precursor is 567 amino acids long (Figure 24; SEQ ID NO: 24). The full-length PRO1265 polypeptide shown in Figure 24 has about 62,881.
With an estimated molecular weight of and a pI of about 8.97. Analysis of the full-length PRO1265 sequence shown in Figure 24 (SEQ ID NO: 24) reveals the presence of various important polypeptide domains, and the positions assigned to those important polypeptide domains are approximately as described above. belongs to. Analysis of the full-length PRO1265 sequence shown in Figure 24 revealed the presence of the following: about amino acid 1 to about amino acid 21.
A signal peptide of about amino acid 54 to about amino acid 58, about amino acid 134 to about amino acid 138, about amino acid 220 to about amino acid 224, and about amino acid 559.
~ N-glycosylation site of about amino acid 563; about amino acid 35 to about amino acid 43
And a tyrosine kinase phosphorylation site of about amino acids 161 to about amino acids 169; about amino acids 52 to about amino acids 58, about amino acids 66 to about amino acids 74, about amino acids 71 to about amino acids 77, about amino acids 130 to about amino acids 136, about amino acids 13;
2 to about amino acid 138, about amino acid 198 to about amino acid 204, and about amino acid 371 to about amino acid 377 N-myristoylation site; and about amino acid 61 to about amino acid 81 D-amino acid oxidase protein site. Clone DNA60
764-1533 deposited with the ATCC on November 10, 1998, ATCC Deposit No. 2
03452 was awarded. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 24 (SEQ ID NO: 24) revealed a significant difference between the PRO1265 amino acid sequence and Dayhoff SEQ ID NO: MMU70429_1. The sequence identities were revealed. Sequence homology was also found to exist between the full length sequence shown in Figure 24 (SEQ ID NO: 24) and the following Dayhoff sequence: BC542.
A_1, E69899, S76290, MYV014_14, AOFB_HUMAN, ZMJ002204_1, S45812_1, DBRNA
PD_1, and CRT1_SOYBN.

Example 16 Isolation of a cDNA Clone Encoding Human PRO1286 DNA64903-1553 was identified using the proprietary signal sequence algorithm described in Example 3 above. The use of the signal sequence algorithm described above enabled the identification of EST cluster sequences from the LIFESEQ database named EST cluster number 86809. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA databases (LIFESEQ®, Incyte Pharmaceuticals, Palo).
Existing homology was identified by comparison with various expressed sequence tag (EST) databases, including Alto, CA). The homology search is performed by the computer program BLAST or BLAST.
2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those that have the program "phrap" (Phil Green, University of
(Washington, Seattle, Washington) to construct a consensus DNA sequence. ESTs in the assembly included those identified from tumors, cell lines, or diseased tissue. One or more of the ESTs was obtained from a cDNA library made from RNA isolated from diseased colon tissue. The consensus sequence obtained therefrom is herein designated DNA58822. In view of the sequence homology between the DNA58822 sequence and the EST sequence contained in Incyte's EST number 1695434, EST clone number 1695434 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 25 (SEQ ID NO: 25).
), And is herein designated as DNA64903-1553.

The entire coding sequence of DNA64903-1553 is included in Figure 25 (SEQ ID NO: 25). Clone DNA64903-1553 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 93-95,
And terminates with a stop codon found at nucleotide positions 372-374 (
Figure 25). The predicted polypeptide precursor is approximately 93 amino acids long (Figure 26;
SEQ ID NO: 26). The full-length PRO1286 protein shown in FIG.
A molecular weight of 111 Daltons and a pI of about 9.70 was estimated. Analysis of the full-length PRO1286 sequence shown in Figure 26 (SEQ ID NO: 26) reveals the presence of various important polypeptide domains and the positions assigned to those important polypeptide domains are approximately as described above. belongs to. Full length PR shown in FIG.
Analysis of the O1286 sequence revealed the presence of the following: a signal peptide of about amino acids 1 to about amino acids 18; about amino acids 15 to about amino acids 21, about amino acids 17 to about amino acids 23, about amino acids 19 to about amino acids 25, About amino acids 83-
N-myristoylation site at about amino acid 89, and about amino acid 86 to about amino acid 92. Clone DNA64903-1553 was deposited with the ATCC on September 15, 1998 and was assigned ATCC deposit no. By analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 26 (SEQ ID NO: 26), the PRO1286 amino acid sequence and the following Dayhoff sequences: SR5C_ARATH, CELC17H.
12_11, MCPD_ENTAE, JQ2283, INVO_LEMCA, P_R07309, ADEVBCAGN_4, AF020947_1
, Some homology between CELT23H2_1, and MDH_STRAR was revealed.

Example 17 Isolation of a cDNA Clone Encoding Human PRO1313 As described in Example 1, conrap was used to construct consensus DNA sequences for other EST sequences. This consensus sequence is now DNA64876
To name. Based on a search for sequence homology with the DNA64876 consensus sequence and the EST sequence originally developed by Genentech called DNA57711, the Merck / Washington University EST sequence (designated R80613) has significant homology with DNA64876 and DNA57711. It turned out to have sex. Therefore, the Merck / Washington University EST clone number R80613 was purchased and the insert obtained and sequenced to give the DNA64966-1575 sequence shown in Figure 31 (SEQ ID NO: 31) and the derived protein sequence for PRO1313. . The entire coding sequence of DNA64966-1575 is included in Figure 27 (SEQ ID NO: 27). Clone DNA64966-1575 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 115-117 and an apparent stop codon at nucleotide positions 1036-1038. The predicted polypeptide precursor is 307 amino acids long, has an estimated molecular weight of approximately 35,098 daltons and a pI of approximately 8.11. Analysis of the full-length PRO1313 sequence shown in Figure 88 (SEQ ID NO: 216) revealed the presence of various important polypeptide domains and the positions given to those important polypeptide domains were approximately as described above. Is. Analysis of the full-length PRO1313 polypeptide shown in Figure 28 revealed the presence of the following: a signal sequence of about amino acids 1 to about amino acids 15; about amino acids 134 to about amino acids 157, about amino acids 169 to about amino acids 189, about. Amino acid 230 to about amino acid 248, about amino acid 271 to about amino acid 185 transmembrane domain; about amino acid 34 to about amino acid 38, about amino acid 135 to about amino acid 139, and about amino acid 203 to about amino acid 207 N-glycosylation site; Tyrosine kinase phosphorylation site from about amino acid 59 to about amino acid 67; about amino acid 165 to amino acid 171, about amino acid 196 to about amino acid 20
2, about amino acid 240 to about amino acid 246 and about amino acid 247 to about amino acid 2
53 N-myristoylation site; ATP / G from about amino acid 53 to about amino acid 61
TP binding site motif A (P-loop). Clone DNA64966-1575
Was deposited with the ATCC on January 12, 1999 and was assigned ATCC deposit no. 203575. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST-2 sequence alignment analysis of the full length sequence shown in Figure 28 (SEQ ID NO: 28) revealed a significant difference between the PRO1313 amino acid sequence and the following Dayhoff sequences. Homology revealed: CELT27A1_3, CEF09C06_7, U93688_9, H64896, YDCX_ECOLI,
And RNU06101_1.

Example 18 Isolation of a cDNA clone encoding human PRO1338 A yeast screen was used to obtain the EST sequence, which was then published under ECD homology in a manner similar to that described above (Example 1). And IncyteEST, an EST obtained from gallbladder tissue with cholecystitis, in comparison with various private EST databases
2615184 was identified. Analysis of the corresponding full-length sequence revealed that DNA66667 (SEQ ID NO: 29, FIG. 29) and derived PRO1338 native sequence protein (SEQ ID NO: 30).
, Figure 30) was isolated. The DNA66667 (SEQ ID NO: 29) shown in Figure 29 contains a single open reading frame with a translation initiation site at approximately nucleotide residues 115-117 and termination at the stop codon (TAA) at nucleotide positions 2263-2265. To do
Underlined. Predicted PRO1338 polypeptide precursor (SEQ ID NO: 30)
Is 716 amino acids long (FIG. 30) and has a calculated molecular weight of 80,716 daltons and 6.
It has a pI of 06. Figure 30. Analysis of the PRO1313 polypeptide (SEQ ID NO: 30) shows a signal peptide at about amino acid residues 1-25, a transmembrane domain at about amino acid residues 629-648, about amino acid residues 69-73, 96-100, 106. ~ 11
0, 117-121, 385-389, 517-521, 582-586 and 6
N-glucosylation site at 11-615, tyrosine kinase phosphorylation site at about residues 573-582, and about amino acid residues 16-22, 224-230, 4
It was revealed that there are N-myristoylation sites at 64-470, 637-643 and 698-704. CDNA containing DNA66667 was deposited with the ATCC on September 22, 1998,
TCC Deposit No. 203267 has been assigned.

Example 19 Isolation of a cDNA clone encoding human PRO1375 The Merck / Wash.U. Database was searched to identify the Merk EST. This sequence is then transferred to the Swiss-Prot public database, public EST database (eg GenBan
k, Merck / Wash. U.) and corporate EST database (LIFESEQ (trade name), Incyte P
harmaceuticals, Palo Alto, CA) into the program that aligns it with other sequences. The search was carried out in the extracellular domain with 6-frame translation of the EST sequence (
ECD) as a comparison of protein sequences the computer program BLAST or BLAST2 [
Altshul et al., Methods in Enzymology 266: 460-480 (1996)]. 70 (or 90 in some cases) BLAST that did not encode a known protein
The "phrap" program (Phil Green, Uni
A consensus DNA sequence was constructed at Versity of Washington, Seattle, Washington). Consensus DNA sequences were constructed against other EST sequences using phrap. This consensus sequence is designated herein as "DNA67003". A nucleic acid (SEQ ID NO: 417) was identified in a human pancreas library based on the DNA67003 consensus sequence. PR by clone DNA sequencing
The full length DNA sequence for O1375 and the derived protein sequence for PRO1375 were obtained.

The entire coding sequence of PRO1375 is shown in Figure 31 (SEQ ID NO: 31). Clone DNA6704-1614 has a single open reading frame with an apparent translational initiation site at nucleotide positions 104-106 and an apparent stop codon at nucleotide positions 698-700. The predicted polypeptide precursor is 198 amino acids long and is shown in Figure 32 (SEQ ID NO: 32). The transmembrane domain is at amino acids 11-28 (type II) and 103-125; the N-glycosylation site is at amino acids 60-64; the tyrosine kinase phosphorylation site is at amino acids 78-86; N- The myristoylation site is at about amino acids 12-18. Clone DNA6704-1614 was deposited with the ATCC on August 11, 1998 and is assigned ATCC deposit no. 203115. Full length PR shown in FIG. 32
The O1375 protein has an estimated molecular weight of approximately 22,531 daltons and approximately 8.47.
Has a pI of D using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in FIG.
By analyzing the ayhoff database (version 35.45 SwissProt35), PRO1
375 amino acid sequence and the following Dayhoff sequence: AF026198_5, CELR12C12_5, S73465, Y0
The sequence identity among 11_MYCPN, S64538_1, P_P8150, MUVSHPO10_1, VSH_MUMPL and CVU59751_5 was revealed.

Example 20 Isolation of a cDNA clone encoding human PRO1410 DNA68874-1622 was identified by using the proprietary signal sequence discovery algorithm described in Example 3 above. The use of the signal sequence algorithm described above allowed the identification of the EST cluster sequence from the Incyte database, which was named Incyte EST cluster SEQ ID NO: 98502. This EST cluster sequence is then converted into a public EST database (eg GenBank
) And the company's EST DNA database (LIFESEQ (trade name), Incyte Pharmaceut
existing homology was identified by comparison with various expressed sequence tag (EST) databases, including icals, Palo Alto, CA). The homologue search is a computer program BL
It was performed using AST or BLAST2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher can be found in the program “phrap” (Phil Green, U.
Niversity of Washington, Seattle, Washington)
The NA sequence was constructed. The consensus sequence obtained from it is
It is named 451. ES contained within DNA56451 sequence and Incyte EST clone number 1257046
Considering the sequence homology with the T sequence, we purchased IncyteEST clone 1257046,
The cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 33 (SEQ ID NO: 33) and is herein designated as DNA68874-1622.

Clone DNA68874-1622 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 152-154 and ending at the stop codon at nucleotide positions 866-868 (FIG. 33). The predicted polypeptide precursor is 238 amino acids long (Figure 34; SEQ ID NO: 34).
. The full-length PRO1410 protein shown in Figure 34 has an estimated molecular weight of approximately 25,262 and a pI of approximately 6.44. Analysis of the full-length PRO1410 sequence shown in Figure 34 (SEQ ID NO: 34) revealed the presence of various important polypeptide domains, and the positions assigned to those important polypeptide domains were approximately as described above. It is a thing. Analysis of the full-length PRO1410 sequence shown in Figure 34 demonstrated the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20; a transmembrane domain from about amino acid 194 to about amino acid 220;
A potential N-glycosylation site at about amino acid 135; and about amino acid 121 to about amino acid 127, about amino acid 142 to about amino acid 148, about amino acid 171 to about amino acid 177, about amino acid 201 to about amino acid 207 and about amino acid 203 to
N-myristoylation site at about amino acid 209. Clone DNA68874-16
22 was deposited with the ATCC on September 22, 1998, and was assigned ATCC deposit no. 203277. Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 34 (SEQ ID NO: 34).
The amino acid sequence of PRO1410 and the following Dayhoff sequence: I48652, P
_R76466, HSMHC3W36A_2, EPB4_HUMAN, P_R14256, EPA8_MOUSE, P_R77285, P_W13
Significant homology was demonstrated between 569, AF000560_1, and ASF1_HELAN.

Example 21 Isolation of a cDNA Clone Encoding Human PRO1488 Expression Sequence Tag (EST) DNA Database (LIFESEQ®, Incyte Phar)
maceuticals, Palo Alto, CA) and identified EST # 3639112H1 as having homology with CPE-R. The EST number 36391112H1 is here "DNA69
562 ". EST clone 3639112H1 was obtained from a lung tissue library of a 20-week-old fetus who died of Pateau's syndrome, was purchased, and had cDNA
The A insert was obtained and sequenced in its entirety. The entire nucleotide sequence of PRO1488 is contained in Figure 189 (SEQ ID NO: 329), wherein DNA73736-
It was named 1657. DNA73736-1657 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 6-8,
And has an apparent stop codon at nucleotide positions 666-668 (FIG. 35;
SEQ ID NO: 35). The predicted polypeptide precursor is 220 amino acids long. The full-length PRO1488 protein shown in Figure 36 has a predicted molecular weight of approximately 23,292 daltons and a pI of approximately 8.43. Four transmembrane domains were identified to be located at about amino acid positions 8-30, 82-102, 121-140, and 166-186. Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 36 (SEQ ID NO: 36).
Analysis revealed a significant homology between the amino acid sequence of PRO1488 and the Dayhoff sequence AB000712_1. Homology also refers to the PRO1488 amino acid sequence and the following Dayhoff sequences: AB000714_1, AF007189_1, AF000959_1, P_W63697, MMU82758_1,
AF072127_1, AF072128_1, HSU89916_1, AF068863_1, CEAF000418_1, and AF077
It was also found with 739_1. Clone DNA73736-1657 was deposited with the ATCC on November 17, 1998 and was assigned ATCC deposit no. 203466.

Example 22 Isolation of cDNA encoding human PRO3438 Applying the corporate signal sequence discovery algorithm described in Example 3 above, D
NA82364-2538 was identified. The use of the signal sequence algorithm described above allowed the identification of an EST cluster sequence, herein designated Incyte EST cluster number 49243, from the Incyte database. This EST cluster sequence is then translated into public databases (eg GenBank) and corporate EST DNA.
Existing homologies were identified by comparison with various expressed sequence tag (EST) databases, including databases (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The homology search is performed by the computer program BLAST or BLAST2 (Altschul
Et al., Methods in Enzymology 266: 460-480 (1996)). Comparables that do not encode a known protein and have a BLAST score of 70 (sometimes 90) or higher are those of the program "phrap" (Phil Green, University of Washingto
n, Seattle, Washington) to construct a consensus DNA sequence. The consensus sequence obtained therefrom is herein designated DNA56095. In view of the observed sequence homology between the DNA56095 consensus sequence and the Merck EST number AA256657 from the Merck database, the Merck EST number AA256657.
Was purchased and the cDNA insert was obtained and sequenced. Here, it was found that the cDNA insert encoded the full length protein. The sequence of this cDNA insert is shown in FIG.
(SEQ ID NO: 13), and is herein designated as DNA82364-2538.

Clone DNA82364-2538 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 50-52 and ending at the stop codon at nucleotide positions 647-649 (Figure 37). The predicted polypeptide precursor is 199 amino acids long (Figure 38; SEQ ID NO: 38). The full-length PRO3438 protein shown in Figure 38 has an estimated molecular weight of approximately 21,323 daltons and a pI of approximately 5.05. Analysis of the full-length PRO3438 sequence shown in Figure 38 (SEQ ID NO: 38) reveals the presence of various important polypeptide domains shown in Figure 38, and the positions given to those important polypeptide domains are described above. So it's about. Analysis of the full-length PRO3438 sequence shown in Figure 38 revealed the presence of the following: a signal peptide of about amino acids 1 to about amino acids 15; a transmembrane domain of about amino acids 161 to about amino acids 181; about amino acids 17 to about amino acids 23; N- from about amino acid 172 to about amino acid 178
Myristoylation site; an amidation site from about amino acid 73 to about amino acid 79. Clone DNA82364-2538 was deposited with the ATCC on January 20, 1999
C deposit number 203603 has been assigned. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 38 (SEQ ID NO: 38) revealed a sequence homology between the PRO3438 amino acid sequence and the Dayhoff sequence shown below. Sex was found: S48841, P_W03179, P_W03178, PIGR_HUMAN, HGS_A215, AB00
1489_1, HGS_B471, P_W61380, P_R15068 and MML1L_1.

Example 23 Isolation of a cDNA Clone Encoding Human PRO4302 The EST sequence was obtained using the amylase screening procedure described in Example 2 above on tissues isolated from human tissues, which were then transformed into various ESTs. A consensus sequence was generated by the method described above under the amylase screening procedure and / or ECD homology approach in comparison to the database. This consensus sequence is designated herein as DNA78875. DNA78875 consensus sequence and Incyte
Incyte EST No. 2408081H1 was purchased based on its homology with EST No. 2408081H1 and its insert was obtained and sequenced. The sequence of this cDNA insert is shown in FIG.
SEQ ID NO: 39) and is designated herein as DNA92218-2554 and designated PRO
The 4302 full length native sequence protein (SEQ ID NO: 40) was derived. As indicated by bold underline, full-length clone DNA92218-2 shown in FIG. 39.
554 (SEQ ID NO: 39) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 174-176 and nucleotide position 76.
It has a stop signal (TAG) at 8-770. The predicted PRO4302 polypeptide precursor is 198 amino acids long, has a calculated molecular weight of approximately 22,285 daltons and an estimated pI of approximately 9.35. Full length PRO shown in FIG. 40 (SEQ ID NO: 40)
Analysis of the 4302 polypeptide sequence revealed a signal peptide at about amino acid residues about 1 to 23; a transmembrane domain at about amino acid residues 111 to 130; a cAMP- and cGMP-dependent protein kinase phosphorus at about amino acid residues 26-30. Oxidation site; tyrosine kinase phosphorylation site at amino acid residues about 36-43; and N-myristoylation site at amino acid residues about 124-130, 144-150 and 189-195. A cDNA clone containing DNA92218-2554 was prepared on March 9, 1999 by ATC.
It has been deposited with C and is given the deposit number 203834.

Example 24 Isolation of a cDNA clone encoding human PRO4400 As described in Example 1, conrap was used to construct consensus DNA sequences for other EST sequences. The EST database includes public databases (for example, GenBank) and corporate EST DNA databases (LIFESEQ (trade name), Incyte
Pharmaceuticals, Palo Alto, CA) and Genentech's proprietary ESTs. This consensus sequence is designated herein as DNA77634. D
Based on the NA77634 consensus sequence, oligonucleotides were synthesized for 1) identification of a cDNA library containing the sequence of interest by PCR and 2) use as a probe to isolate a clone of the PRO4400 full length coding sequence. did. A pair of PCR primers (forward and reverse) was synthesized: Forward PCR primer: 5'-GCTGCTGCCGTCCATGCTGATG-3 '(SEQ ID NO: 81) Reverse PCR primer: 5'-CTCGGGGAATGTGACATCGTCGC-3' (SEQ ID NO: 82) ) In addition, a synthetic oligonucleotide hybridization probe was made from the DNA77634 consensus sequence, which had the following nucleotide sequence: Hybridization probe: 5'-GCTGCCGTCCATGCTGATGTTTGCGGTGATCGTGG-3 '(SEQ ID NO: 83) Construction of a cDNA library RNA was isolated from human fetal liver tissue.
The cDNA library used to isolate the cDNA clones is Invitrogen, San Diego, C
Prepared by standard methods using commercially available reagents such as those from A. The cDNA was primed with an oligo dT containing a NotI site, blunt-ended with a SalI hemikinase adapter, cut with NotI, roughly sized by gel electrophoresis, and a suitable cloning vector (such as pRKB or pRKD; pRK5B is pRK5D without SfiI site
, Holmes et al., Science, 253: 1278-1280 (1991)).
The XhoI and NotI sites were cloned in the specified orientation.

By DNA sequencing of the clones isolated as described above, the full-length DNA sequence for the PRO4400 polypeptide (wherein DNA87974-2609 [Figure 41, SEQ ID NO: 41]) and the derived protein sequence of the PRO4400 polypeptide were determined. was gotten. The full length coding sequence of DNA87974-2609 is shown in Figure 41 (SEQ ID NO: 41).
include. Clone DNA87974-2609 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 27-29 and an apparent stop codon at nucleotide positions 1026-1028. The predicted polypeptide precursor is 333 amino acids long, has an estimated molecular weight of approximately 38,618 and a pI of approximately 9.27. Full length PR shown in FIG. 42 (SEQ ID NO: 42)
Analysis of the O4400 sequence reveals the presence of various important polypeptide domains, and the positions given to those important polypeptide domains are approximate as described above. Analysis of the full-length PRO4400 sequence revealed the presence of the following: a signal peptide of about amino acids 1 to about amino acids 23; about amino acids 6
7 to about amino acid 71 and about amino acid 325 to about amino acid 329 N-glycosylation site; about amino acid 152 to about amino acid 159 and about amino acid 183 tyrosine kinase phosphorylation site; and about amino acid 89 to about amino acid 95 and about amino acid 1
N-myristoylation site from 28 to about amino acid 134. Clone DNA87974
-2609 was deposited with the ATCC on April 27, 1999, with ATCC deposit no.
63 was awarded. By the Dayhoff database (version 35.45, SwissProt 35) using WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 42 (SEQ ID NO: 42),
Sequence identity between the PRO4400 amino acid sequence and the following Dayhoff sequence was revealed: AF033827_1, AF070594_1, AF022729_1, CEC34F6_4, SYFB_THETH, G70405, SD_DR.
OME, S64023, ALK1_YEAST and VG04_HSVII.

Example 25 Isolation of cDNA Encoding Human PRO5725 Expression Sequence Tag (EST) DNA database (LIFESEQ (trade name), Incyte Phar
ESTs having homology with neuritin were identified by searching maceuticals, Palo Alto, CA). IncyteEST Clone No. 3705684 is LIFESEQ (trade name), In
purchased from cyte Pharmaceuticals, Palo Alto, CA, where DNA92265-
The cDNA insert of that clone, designated 2669, was obtained and sequenced in its entirety [
Figure 43; SEQ ID NO: 43]. Full-length clone DNA92265-2669 (SEQ ID NO: 43) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 27-29 and an apparent stop signal at nucleotide positions 522-524 ( Figure 43; SEQ ID NO: 43). 165 predicted polypeptide precursors
It is amino acid long, has a calculated molecular weight of about 17,786 and a pI of about 8.43. Analysis of the full-length PRO5725 sequence shown in Figure 44 (SEQ ID NO: 44) revealed the presence of various important polypeptide domains shown in Figure 44, and the positions given to those important polypeptide domains are described above. Is approximate. Analysis of the full-length PRO5725 sequence shown in Figure 44 revealed the presence of the following: a signal peptide from about amino acid 1 to about amino acid 35;
1 to about amino acid 157 transmembrane domain; about amino acid 127 to about amino acid 133
N-myristoylation site of: a prokaryotic membrane lipoprotein lipid binding site from about amino acid 77 to about amino acid 88. Clone DNA92265-2669 was deposited with the ATCC on June 22, 1999 and was assigned ATCC deposit no. PTA-256. Analysis of the Dayhoff database (version 35.45 SwissProt 35) using the WU-BLAST2 sequence alignment analysis of the full length sequence shown in Figure 44 (SEQ ID NO: 44) revealed a homology between the PRO5725 amino acid sequence and the following Dayhoff sequence. Revealed: RNU88958_1, P_W37859, P_W37858, JC6305, HGS_RE778, HGS_RE777
, P_W27652, P_W44088, HGS_RE776, and HGS_RE425.

Example 26 In Situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations. It includes, for example, identification of gene expression sites, analysis of tissue distribution of transcripts, identification and localization of viral infections, specific mRN.
Useful for tracing in A synthesis and chromosome mapping. In situ hybridization was performed by Lu and Gillett, Cell Vision 1: 169-176 (1
PCR is performed with ³³ P-labeled riboprobes according to an optimal modification of the protocol of 994). Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinized with proteinase K (20 g / ml) for 15 minutes at 37 ° C. and further as described by Lu and Gillett supra. In-situ hybridize. A [ ^33- P] UTP-labeled antisense riboprobe is generated from the PCR product and hybridized overnight at 55 ° C. The slides are immersed in Kodak NTB2 (trade name) nuclear track emulsion and exposed for 4 weeks.

³³ P-riboprobe synthesis 6.0 μl (125 mCi) of ³³ P-UTP (Amersham BF 1002, SA <2000 Ci / mmol)
Was speed vacuum dried. The following components were added to a tube containing dry ³³ P-UTP: 2.0 μl 5x transcription buffer 1.0 μl DTT (100 mM) 2.0 μl NTP mixture (2.5 mM: 10 μl; 10 mM GTP, CTP and ATP + 10 μl H ₂ O) 1.0 μl UTP (50 μM) 1.0 μl RNAsin 1.0 μl DNA template (1 μg) 1.0 μl H ₂ O 1.0 μl RNA pomerase (T3 = AS, T7 = S, normal for PCR products) Incubated at 37 ° C. for 1 hour, added 1.0 μl of RQ1 DNase, then incubated at 37 ° C. for 15 minutes. 90μl TE (10mM Tris pH7.6 / 1m
M EDTA pH 8.0) was added and the mixture was pipetted onto DE81 paper. The remaining solution is Mi
The crocon-50 ultrafiltration unit was loaded and spun using program 10 (6
Minutes). The filtration unit was converted to a second tube and spun using program 2 (3 minutes). After the final recovery spin, 100 μl TE was added. 1 μl of final product was pipetted onto DE81 paper and counted with 6 ml Biofluor II. The probe was run on a TBE / urea gel. 1-3 μl probe or 5 μl RN
A MrkIII was added to 3 μl of loading buffer. 95 ° C on heating block
After heating for 3 minutes, the gel was immediately placed on ice. The gel wells were flushed, loaded with sample, and run at 180-250 volts for 45 minutes. The gel was wrapped in Saran wrap and exposed to XAR film with a reinforcing screen in a -70 ° C freezer for 1 hour to overnight.

³³ P-Hybridization A. Frozen Section Pretreatment: Slides were removed from the freezer, placed in aluminum trays and thawed at room temperature for 5 minutes. The trays were placed in a 55 ° C. incubator for 5 minutes to reduce condensation. The slides were fixed in 4% paraformaldehyde for 5 minutes in a steam hood and washed with 0.5xSSC for 5 minutes at room temperature (25 ml 20xSSC + 9
75 ml SQ H ₂ O). After deproteinization in 0.5 μg / ml proteinase for 10 minutes at 37 ° C. (12.5 μl of a 10 mg / ml stock in 250 ml pre-heated RNase buffer without RNase), sections were washed with 0.5 × SSC for 10 minutes at room temperature. 70%, 95%
, And dehydrated in 100% ethanol for 2 minutes each. B. Pretreatment of paraffin-embedded sections: slides were deparaffinized and SQ H ₂
Placed in O and rinsed twice with 2x SSC for 5 minutes each at room temperature. 20 sections
μg / ml proteinase K (1 in 250 ml RNase buffer without RNase
500 mg of 0 mg / ml; 37 ° C, 15 minutes) -human embryo or 8x proteinase K (250
100 μl in ml RNase buffer, 37 ° C., 30 minutes) -deproteinized with formalin tissue. Subsequent rinsing with 0.5 × SSC and dehydration were performed as described above. C. Prehybridization: Slides were placed in plastic boxes lined with Box buffer (4xSSC, 50% formamide) -saturated filter paper. Tissue 50
μl Hybridization buffer (3.75g dextran sulfate + 6ml SQ H2O)
Coated, vortexed, capped and microwaved for 2 minutes. After cooling on ice, 18.75 ml formamide, 3.75 ml 20xSSC and 9 ml SQ.
H2O was added and the tissue vortexed well and incubated at 42 ° C for 1-4 hours.

D. Hybridization: 1.0 × 10 ⁶ cpm probe and 1.0 μl per slide
TRNA (50 mg / ml stock) was heated at 95 ° C. for 3 minutes. The slides were cooled on ice and 48 μl of hybridization buffer was added per slide. After vortexing, 50 μl of ³³ P mixture was added to 50 μl of prehybrid on slide. Slides were incubated overnight at 55 ° C. E. Washing: Washing was performed at room temperature in 2xSSC, EDTA for 2x10 minutes (400m
l 20x SSC + 16 ml 0.25 M EDTA, Vf = 4 L), then RNase A treatment 37
30 minutes at ℃ (10mg / ml in 250ml RNase buffer 500μl = 20μg / m
l). The slides were washed 2 x 10 minutes with EDTA at room temperature. Stringent wash conditions are as follows: 55 ° C. for 2 hours, 0.1 × SSC, EDTA (20 ml 20 × SSC + 16 ml
EDTA, Vf = 4 L).

F. Oligonucleotide in situ hybridization was performed on 6 of the DNAs disclosed herein. The oligonucleotides used for these analyzes are as follows: (1) DNA34387-1138 (PRO240) (serrated / EGF homolog).
Oligo B-231W48mer: 5'-GGATTCTAATACGACTCACTATAGGGCCCGAGATATGCACCCAATGTC-3 '(SEQ ID NO: 84
) Oligo B-231W47mer: 5'-CTATGAAATTAACCCTCACTAAAGGGATCCCAGAATCCCGAAGAACA-3 '(SEQ ID NO: 85)
(2) DNA57708-1411 (PRO1005) (a novel secreted CA-related tag
Quality) 678. p1: 5'-GGATTCTAATACGACTCACTATAGGGCCCTCTGTCCACTGCTTTCGTG-3 '(SEQ ID NO: 86
) 678. p2: 5'-CTATGAAATTAACCCTCACTAAAGGGAGTTCTCCACCGTGTCTCCACA-3 '(SEQ ID NO: 87
) (3) DNA60764-1533 (PRO1265) (Fig-1 homolog) DNA60764-p1: 5'-GGATTCTAATACGACTCACTATAGGGCCGCGCTGTCCTGCTGTCACCA-3 '(SEQ ID NO: 88)
) DNA60764-p2: 5'-CTATGAAATTAACCCTCACTAAAGGGAGTTCCCCTCCCCGAGAAGATA-3 '(SEQ ID NO: 89)
) (4) DNA28498 (PRO183) (FHF-2) DNA28498-p1: 5'-GGATTCTAATACGACTCACTATAGGGCCAGCAAAAGAAGCGGTGGTG-3 '(SEQ ID NO: 90)
DNA28498-p1: 5'-CTATGAAATTAACCCTCACTAAAGGGATTCAGCACGCCAGAGACACTT-3 '(SEQ ID NO: 91)
)

G. Results In situ analysis was performed on the above four DNAs disclosed herein. The results from these analyzes are as follows: (1) DNA34387-1138 (PRO240) (serrated / EGF homolog).
Expression patterns in human adult and fetal tissues Increased signals were observed at the following sites: Fetal tissues: thyroid epithelium, small intestinal epithelium, gonads, pancreatic epithelium, liver parenchymal cells in kidney and renal tubules; expression in developing blood vessels Also seen in organizations. Adult tissues: Moderate signals in placental cell trophoblasts, renal tubules, bladder epithelium, parathyroid gland and epithelial tumors. Expression in lung adenocarcinoma and squamous cell carcinoma Expression was observed in all 8 squamous cell carcinomas and 6 of 8 adenocarcinomas. Expression was seen in situ and in infiltrated components. Expression levels were low to moderate in adenocarcinoma. In general, expression was higher in squamous cell carcinomas and
The expression was strong in one. No expression was found in the tumor stroma, alveoli and normal respiratory epithelium. There could be low levels of expression in lymph nodes. (2) DNA57708-1411 (PRO1005) (a novel secreted CA-related tag
Protein) very strong expression was observed in the mucous neck cells (chimpanzees) and sinuses (human) whole mucosa of the gastrointestinal folds. These cells are important in proliferation and gastric mucosal regeneration. It was also found throughout fetal and adult hepatocytes at the margin of the sclerotic nodule. Possible expression appeared in fetal extraocular muscles and throughout skeletal muscles of the lower limbs. Tested 1
No significant expression was observed in any of the 6 primary lung cancers (8 squamous cell carcinomas and 8 adenocarcinomas).

(3) DNA60764-1533 (PRO1265) (Fig-1 homolog) 15 of the 16 lung tumors tested were suitable for analysis (8 adenocarcinomas and 7 squamous cell carcinomas). Most tumors showed some expression of DNA60764. Expression was highly localized to mononuclear cells adjacent to the invasive tumor. In one squamous cell carcinoma, expression was found in malignant epithelium. Expression was also found throughout the cells of fetal thymic medulla with unknown histogenesis. The expression is
It was found throughout the injured renal interstitial mononuclear cells and intimal cells of renal cell carcinoma. Expression is also found throughout the germinal center cells, consistent with the fact that most Fig-1 positive cells are probably inflammatory in development. (4) Expression of DNA28498 (PRO183) (FHF-2) was observed on the entire inner surface of the fetal retina. Strong expression was found throughout the dorsal root ganglia and throughout neurons in the anterior horn of the human fetal spinal cord. Although no significant expression was observed in human fetal brain, high expression was found throughout neurons in rhesus brain, including hippocampal neurons. Expression was also found in the spinal cord and developing hindbrain of rat embryos.

Example 27 Use of PRO as a Hybridization Probe The following method describes the use of a nucleic acid sequence encoding PRO as a hybridization probe. DNAs containing coding sequences for full-length or mature PRO or fragments thereof as disclosed herein are screened for homologous DNA in human tissue cDNA libraries or human tissue genomic libraries (such as those encoding naturally occurring variants of PRO). Can be used as a probe for. Hybridization and washing of filters containing either library is performed under the following high stringency conditions. Hybridization of radiolabeled probes derived from the PRO polypeptide-encoding gene to filters was performed using 50% formamide, 5xSSc, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2
x Denhard's solution and a solution of 10% dextran sulfate were carried out at 42 ° C for 20 hours. Washing of filters was performed at 42 ° C. in 0.1 × SSC and 0.1% SDS aqueous solution. DNAs with the desired identity to the DNA encoding the full length native sequence PRO can then be identified using standard techniques known in the art.

Example 28 Expression of PRO in E. coli This example illustrates preparation of a non-glycosylated form of PRO by recombinant expression in E. coli. The DNA sequence encoding PRO was first amplified using selected PCR primers. The primer must have a restriction enzyme site corresponding to the restriction enzyme site of the selected expression vector. Various expression vectors are used. An example of a suitable vector is pBR322 (derived from E. coli; Bolivar et al., Gene,
2:95 (1977)) and contains genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzymes and dephosphorylated. The PCR amplified sequence is then ligated into the vector. The vector is preferably an antibiotic resistance gene, a trp promoter, a poly his leader (including the first 6 STII codons, a poly his sequence and an enterokinase cleavage site), a PRO coding region, a lambda transcription terminator, and the argU gene. including.

The ligation mixture is then used to transform selected E. coli using the method described by Sambrook et al., Supra. Transformants are identified by their ability to grow on LB plates and then antibiotic resistant clones are selected.
Plasmid DNA is isolated and confirmed by restriction analysis and DNA sequencing. Selected clones can be grown overnight in liquid media such as LB broth supplemented with antibiotics. The overnight medium is subsequently used to seed large-scale medium.
The cells are then grown at optimal density during which the expression promoter operates. After culturing for a few more hours, the cells can be harvested and centrifuged. The cell pellet obtained by centrifugation was solubilized using various reagents known in the art, and solubilized P
RO protein was purified using metal chelation columns under conditions that allowed for tight binding of the protein.

PRO was expressed in poly-His tagged form in E. coli using the following procedure. DNA encoding PRO was first amplified using selected PCR primers. Primers provide restriction enzyme sites corresponding to those of the selected expression vector, and efficient and reliable translation initiation, rapid purification on metal chelate columns, and proteolytic removal with enterokinase. Includes other useful sequences. The PCR-amplified poly-His tag sequence was then ligated into an expression vector which was used to strain 52 (W3110 fuhA (tonA) lon galE rpoHts (htpRts) cllpP (lac
It was used to transform E. coli hosts based on Iq)). Transformants are initially 50 mg / ml
3-5 OD 600 in LB containing carbenicillin at 30 ° C with shaking.
Grow until it reaches. Then, the medium was changed to CRAP medium (3.57 g of (NH ₄ ) ₂ S
O ₄ , 0.71 g sodium citrate 2H ₂ O, 1.07 g KCl, 5.36 g Difco yeast extract, 5.36 g Shefield hycase SF in 500 mL water, and 110 mM MPOS, pH 7.3.
, Prepared with a mixture of 0.55% (w / v) glucose and 7 mM MgSO ₄ ) and grown for about 20-30 hours at 30 ° C. with shaking. Take out the sample and S
Expression was confirmed by DS-PAGE and the bulk medium was centrifuged to pellet the cells. Cells Cell pellets were frozen before purification and refolding.

E. coli paste from 0.5 to 1 L of fermentation (6-10 g pellets) was resuspended at 10 volumes (w / v) in 7M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfate and sodium tetrathionate were added to give final concentrations of 0.1M and 0.02, respectively.
M and the solution was stirred at 4 ° C. overnight. This step resulted in a denatured protein with cysteine residues blocked by sulfite. Beckman Ultr
Concentrate in acentrifuge at 40,000 rpm for 30 minutes. The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6M guanidine, 20 mM Tris, pH 7.4) and clarified by filtration through a 0.22 micron filter. The clarified extract was loaded onto a 5 ml Qiagen Ni ²⁺ -NTA metal chelate column equilibrated with the metal chelate column buffer. The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein was eluted with a buffer containing 250 mM imidazole. Fractions containing the desired protein were pooled and stored at 4 ° C. Protein concentration is calculated using the extinction coefficient calculated based on its amino acid sequence.
Estimated by its absorption at 280 nm.

The sample is gradually diluted in a freshly prepared refolding buffer consisting of 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA. This caused the protein to refold.
The refolding capacity is such that the final protein concentration is 50-100 micrograms /
Selected to be ml. The refolding solution was gently stirred at 4 ° C for 12-36 hours. The refolding reaction was stopped by adding TFA at a harvest concentration of 0.4% (pH of about 3). Prior to further purification of the protein, add 0.22 solution.
Filtered through a micron filter and added acetonitrile to a final concentration of 2-10%. The refolded protein was chromatographed on a Poros R1 / H reverse phase column using a migration buffer of 0.1% TFA and elution with a 10-80% acetonitrile gradient. Aliquots of fractions with A ₂₈₀ absorption were analyzed on SDS polyacrylamide gels and fractions containing homologous refolded proteins were pooled.
In general, the correctly refolded species of most proteins elute at the lowest concentration of acetonitrile because these species are the most compact and their hydrophobic inner surface is shielded from interaction with reverse phase resin. To be done. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to removing the misfolded form of the protein from the desired form, the reverse phase step also removes endotoxin from the sample. Fractions containing the desired folded PRO were pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins were subjected to dialysis or gel filtration on G25 Superfine (Pharmacia) resin equilibrated with preparation buffer and sterile filtration to 20 mM HEPES containing 0.14 M sodium chloride and 4% mannitol.
, PH 6.8.

Example 29 Expression of PRO in Mammalian Cells This example demonstrates recombinant expression of glycosylated forms of PRO in mammalian cells.
The preparation of is illustrated. The vector pRK5 (see EP 307,247 published on Mar. 15, 1989) was used as an expression vector. In some cases, PRODNA is ligated to pRK5 with a selected restriction enzyme and PRODNA is inserted using the ligation method as described in Sambrook et al., Supra. The resulting vector is called pRK5-PRO. In one embodiment, the host cell selected can be 293 cells. Human 293 cells (ATCC CCL 1573) were grown to confluence in tissue culture plates in media such as DMEM supplemented with fetal bovine serum and optionally nutrients or antibiotics. About 10 μg of pRK5-PRO DNA was added to about 1 μg of VA RNA.
DNA encoding the gene [Thimmappaya et al., Cell, 31: 543 (1982))] was mixed and dissolved in 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl ₂ . To this mixture, drop-wise, 500 μl of 50 mM HEPES (pH 7.35), 280 mM
m NaCl, 1.5 mM NaPO ₄ was added and a precipitate was formed at 25 ° C. for 10 minutes. The precipitate was suspended, added to 293 cells, and fixed at 37 ° C. for about 4 hours. The culture medium was aspirated and 2 ml of 20% glycerol in PBS was added for 30 seconds. 293 cells are
Then washed with serum free medium, fresh medium was added and cells were incubated for about 5 days.

Approximately 24 hours after transfection, the culture medium is removed and the culture medium (only) or 200 μCi /
The medium was replaced with culture medium containing ³⁵ S-cysteine and 200 μCi / ml of ³⁵ S-methionine. After a 12 hour incubation, the conditioned medium was harvested, concentrated on a spin filter and loaded on a 15% SDS gel. The treated gel was dried and exposed to film for a selected time that revealed the presence of PRO polypeptide. The medium containing the transformed cells is subjected to a further incubation (in serum-free medium),
The medium was tested in selected bioassays. In an alternative technique, PRO is based on Somparyac et al., Proc. Natl. Acad. Sci.
., 12: 7575 (1981) and transiently introduced into 293 cells using the dextran sulfate method. 293 cells were grown to maximum density in spinner flasks,
Add 700 μg of pRK5-PRODNA. The cells were first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for 4 hours. Cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, tissue culture medium, 5 μg / ml bovine insulin and
The spinner flask containing 0.1 μg / ml bovine transferrin was reintroduced. About 4
After days, the conditioned medium was centrifuged and filtered to remove cells and cell debris. The sample containing the expressed PRO was then concentrated and purified by a selected method such as dialysis and / or column chromatography.

In another embodiment, PRO can be expressed in CHO cells. pRK5
-PRO is C using known reagents such as CaPO ₄ or DEAE-dextran.
HO cells can be transfected. As described above, the cell culture medium can be incubated and the medium replaced with culture medium (only) or medium containing a radiolabel such as ³⁵ S-methionine. After identifying the presence of PRO polypeptide, the culture medium may be replaced with serum-free medium. Preferably, the medium is incubated for about 6 days and then the conditioned medium is collected. The medium containing the expressed PRO polypeptide can then be concentrated and purified for the method of choice. The epitope tag PRO may also be expressed in host CHO cells.
PRO may be subcloned from the pRK5 vector. The subclone insert can then be subjected to PCR to fuse in frame with a selected epitope tag such as a poly-his tag in a baculovirus expression vector. Poly-his tag PR
The O insert can then be subcloned into an SV40 driven vector containing a selectable marker such as DHFR for selection of stable clones. Finally, CHO cells were transfected with the SV40 inducible vector (as above). Labeling may be performed as described above to confirm expression. The culture medium containing the expressed poly-his tagged PRO can then be concentrated and purified by a selected method such as Ni ²⁺ -chelate affinity chromatography. PRO may also be expressed in CHO and / or COS cells by a transient expression procedure or in CHO cells by another stable expression procedure.

Stable expression in CHO cells was performed using the following method. A protein is a hinge of IgG1 where the coding sequence (eg, extracellular domain) of the soluble and / or poly-His tagged form of the corresponding protein is IgG1, CH2 and CH.
It was expressed as an IgG construct (immunoadhesin) fused to a constant region sequence containing 2 domains. Following PCR amplification, the corresponding DNA was prepared using Ausubel et al., Current Protocols of
Subcloned into CHO expression vector using standard techniques as described in Molecular Biology, Unit 3.26, John Wiley and Sons (1997). The CHO expression vector has restriction sites compatible with the 5'and 3'of the DNA of interest, and has a cD
It is created so that NA can be conveniently shuttled. Vectors are Lucas et al., Nuc
cDNAs of interest and dihydrofolate reductase (DHFR) using expression in CHO cells as described in L. Acids res. 24: 9, 1774-1779 (1996).
The SV40 early promoter / enhancer is used to control the expression of (1). DHFR
Expression allows selection for stable maintenance of the plasmid following transfection.

Twelve micrograms of the desired plasmid DNA was added to the commercial transfection reagent Superfec.
t® (Quiagen), Dosper® and Fugene® (Boehringer M
annheim) was introduced into about 10 million CHO cells. Cells were grown as described in Lucas et al., Supra. About 3 × 10 ⁷ cells were frozen in ampoules for further growth and production as described below. The ampoule containing the plasmid DNA was placed in a water bath, thawed, and mixed by vortexing. The contents were pipetted into a centrifuge tube containing 10 mL of medium and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and the cells are mixed with 10 mL of selective medium (0.2 μm filtered PS20, 5%
0.2 μm diafiltered fetal bovine serum) was added). The cells were then split into a 100 ml spinner containing 90 ml of selective medium for 1-2 days, then the cells were transferred to a 250 ml spinner filled with 150 ml of selective medium and incubated at 37 ° C. After another 2-3 days, 250 mL
, 500 mL and 2000 mL spinner were seeded at 3 × 10 ⁵ cells / mL. The cell medium was replaced with fresh medium by centrifugation and resuspended in production medium. Although any suitable CHO medium may be used, in practice the production medium described in US Pat. No. 5,122,469 issued Jun. 16, 1992 was used. A 3 L production spinner was seeded at 1.2 × 10 ⁶ cells / mL. On day 0, cell number and pH were measured. On day 1, spinners were sampled and sparged with filtered air. On the second day, sample the spinner, change the temperature to 33 ° C, and add 500 g / L glucose and 0.6 mL 10% antifoam (eg 35% polydimethylsiloxane emulsion, 30 mL of Dow Corning 365 Medical Grade Emulsion). did.
The pH was adjusted and maintained at around 7.2 throughout the production. After 10 days or until viability falls below 70%, the cell culture medium was collected by centrifugation and filtered through a 0.22 μm filter. The filtrate was either stored at 4 ° C or immediately loaded on the purification column.

For poly-His tagged constructs, proteins were purified using a Ni ²⁺ -NTA column (Qiagen). Prior to purification, imidazole was added to the conditioned medium to a concentration of 5 mM. Conditioned medium is 20 mM Hepe containing 0.3 M NaCl and 5 mM imidazole.
s, 6 ml Ni-NTA column equilibrated with pH 7.4 buffer was pumped at 4 ° C. at a flow rate of 4-5 ml / min. After loading, the column was further washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25M imidazole. The highly purified protein was subsequently desalted with 25 ml G25 Superfine (Pharmacia) in a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol and stored at -80 ° C. The immunoadhesin (Fc containing) construct was purified from conditioned medium as follows. Conditioned medium was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer and then eluted with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions in a tube containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted in storage buffer as described above for poly-His tagged proteins. Homogeneity was tested on SDS polyacrylamide gels and N-terminal amino acid sequenced by Edman degradation. Many of the PROs disclosed herein have been successfully expressed as described above.

Example 30 Expression of PRO in Yeast The following method describes recombinant expression of PRO in yeast. First, create a yeast expression vector for intracellular production or secretion of PRO from the ADH2 / GAPDH promoter. DNA encoding PRO and a promoter are inserted into the appropriate restriction enzyme sites of the selected plasmid to direct intracellular expression of PRO. For secretion, a DNA encoding PRO is selected on a selected plasmid, DNA encoding the ADH2 / GAPDH promoter, the native PRO signal peptide or other mammalian signal peptides, or, for example, the yeast alpha factor secretion signal / leader sequence, and It can be cloned (if necessary) with a linker sequence for the expression of PRO. Yeast cells, such as yeast strain AB110, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining the gel with Coomassie blue stain. Recombinant PRO can then be isolated and purified by removing yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO may be further purified using a selected column chromatography resin. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 31 Expression of PRO in Baculovirus-Infected Insect Cells The following method describes recombinant expression in Baculovirus-infected insect cells. The coding sequence for PRO was fused upstream of an epitope tag contained in a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (such as the Fc region of IgG). pVL1393 (Navo
Various plasmids can be used, including plasmids derived from commercially available plasmids such as gen). Briefly, a portion of PRO or the coding sequence for PRO (such as the sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers complementary to the 5'and 3'regions. The 5'primer may include flanking (selected) restriction enzyme sites. The product is then digested with the selected restriction enzymes and subcloned into the expression vector. Recombinant baculovirus was obtained by using Spodoptera frugiperda (“Sf9”) cells (ATCC) containing the above-mentioned plasmid and BaculoGold (trade name) viral DNA (Pharmingen).
CRL 1711) by co-transfection with lipofectin (commercially available from GIBCO-BRL). After incubation at 28 ° C for 4-5 days, released virus was collected and used for further amplification. Viral infection and protein expression
O'Reilley et al., Baculovirus expression vectors: A laboratory Manual, Oxford
: Performed as described in Oxford University Press (1994).

The expressed poly-his tagged PRO is then purified, for example, by Ni ²⁺ -chelate affinity chromatography as follows. The extract is Rupe
Prepared from virus-infected recombinant Sf9 cells as described by rt et al., Nature, 362: 175-179 (1993). Briefly, Sf9 cells were washed and sonicated buffer (25 ml Hepes, pH 7.9; 12.5 mM MgCl ₂ ; 0.1 mM EDT).
A; 10% glycerol; 0.1% NP-40; 0.4M KCl) and sonicated twice on ice for 20 seconds. The sonicate was clarified by centrifugation and the supernatant was loaded with loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8).
It was diluted twice and filtered through a 0.45 μm filter. A Ni ²⁺ -NTA agarose column (commercially available from Qiagen) was prepared with a total volume of 5 ml, washed with 25 ml water and equilibrated with 25 ml loading buffer. The filtered cell extract was loaded onto the column at 0.5 ml / min. The column was washed with loading buffer to the baseline of A ₂₈₀ , which is the point where fraction collection begins. The column is then loaded with a secondary wash buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) that elutes non-specifically bound proteins.
) Was washed with. After reaching the A ₂₈₀ baseline again, the column was developed with a 0 to 500 mM imidazole gradient in secondary wash buffer. Collect 1 ml fractions,
Analyzed by SDS-PAGE and silver staining or Western blot with Ni ²⁺ -NTA conjugated to alkaline phosphatase (Qiagen). Eluted _{His 10} - Fractions containing the tagged PRO are pooled and dialyzed against loading buffer. Alternatively, purification of IgG tag (or Fc tag) PRO can be performed using known chromatographic techniques, including, for example, protein A or protein G column chromatography. Many of the PRO polypeptides disclosed herein have been successfully expressed as described above.

Example 32 Preparation of Antibodies that Bind PRO This example illustrates preparation of monoclonal antibodies that can specifically bind PRO. Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in Goding, supra. Immunogens that can be used are purified PRO or PR
Fusion proteins containing O, including cells expressing recombinant PRO on the cell surface. The choice of immunogen can be made by one of ordinary skill in the art without undue experimentation. Mice such as Balb / c are immunized with PRO immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally at 1-100 micrograms. Alternatively, the immunogen is treated with MPL-TDM adjuvant (Ribi Immunochemical Researh, H
amilton, MT) and injected into the hind footpads of animals. The immunized mice are then boosted 10-12 days later with an additional immunogen emulsified in the selected adjuvant. The mice are then boosted with additional immunization injections for several weeks. Anti
-Serum samples from retro-orbital bleeds may be taken periodically from mice for testing in an ELISA assay for detection of PRO antibodies.

After a suitable antibody titer has been detected, animals “positive” for antibodies can be given a final infusion of an intravenous injection of PRO. After 3 to 4 days, the mice were sacrificed and the spleens were removed. Then splenocytes (using 35% polyethylene glycol)
P3X63AgU.A., Available from ACTT under the number CRL1597. Fused to selected mouse myeloma cell lines such as 1. Hybridoma cells were generated by the fusion and then plated onto 96-well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to unfuse cells, myeloma hybrids,
And inhibited the growth of spleen cell hybrids. Hybridoma cells are screened in an ELISA for reactivity against PRO. The determination of "positive" hybridoma cells secreting a monoclonal antibody against the desired PRO is within the skill of the art. Positive hybridoma cells were injected intraperitoneally into syngeneic Balb / c mice,
Ascites fluid containing anti-PRO monoclonal antibody is generated. Alternatively, hybridoma cells can be grown in tissue culture flasks or roller bottles.
Purification of the monoclonal antibody produced in the ascites can be performed using ammonium sulfate precipitation followed by gel exclusion chromatography. Alternatively, affinity chromatography based on the affinity of the antibody for protein A or protein G can be used.

Example 33 Purification of PRO Polypeptides Using Specific Antibodies Native or recombinant PRO polypeptides can be purified by a variety of standard protein purification methods in the art. For example, the pro-PRO polypeptide, mature polypeptide, or pre-PRO polypeptide is purified by immunoaffinity chromatography using an antibody specific for the PRO polypeptide of interest. In general, immunoaffinity columns are made by covalently attaching an anti-PRO polypeptide antibody to an activated chromatography resin. Polyclonal immunoglobulins are prepared from immune sera by either precipitation with ammonium sulfate or purification with immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, NJ). Similarly, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A. The partially purified immunoglobulin is covalently bound to a chromatography resin such as CnBr-activated Sepharose (trade name) (Pharmacia LKB Biotechnology). The antibody is bound to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions.

Such immunoaffinity columns are utilized in the purification of PRO polypeptide by preparing fractions from cells containing soluble form of PRO polypeptide. This preparation is derived by the addition of detergents or the solubilization of whole cells or subcellular fractions obtained via differential centrifugation by methods known in the art. Alternatively, soluble PRO polypeptide containing a signal sequence is secreted in useful quantity into the medium in which the cells are grown. The solubilized PRO polypeptide-containing preparation is passed through an immunoaffinity column and the column is washed under conditions that allow for favorable adsorption of PRO polypeptide (eg, high ionic strength buffer in the presence of detergent). The column is then eluted under conditions that cleave the antibody / PRO polypeptide bond (eg, a low pH such as about 2-3, a high concentration of chaotrope such as urea or thiocyanate ion) and the PRO polypeptide is recovered. .

Example 34 Drug Screening The present invention is particularly useful for screening compounds by using PRO polypeptides or binding fragments thereof in various drug screening techniques. The PRO polypeptide or fragment used in such a test may be free in solution, immobilized on a solid support, carried on the cell surface or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells that are stably transfected with recombinant nucleic acids expressing PRO polypeptides or fragments. Agents are screened against such transfected cells in a competitive binding assay. Such cells, either in viable or immobilized form, can be used for standard binding assays. For example, the formation of complexes between the PRO polypeptide or fragment and the reagent being tested may be measured. Alternatively, one can test the reduction in complex formation between the PRO polypeptide and its target cells caused by the reagent being tested. Thus, the invention provides a method of screening for agents or any other reagents that can affect PRO polypeptide-related diseases or disorders. These methods involve contacting the reagent with a PRO polypeptide or fragment, (I) for the presence of a complex between the reagent and the PRO polypeptide or fragment, or (ii) between the PRO polypeptide or fragment and the cell. Including assaying for the presence of a complex between. In these competitive binding assays, the PRO polypeptide or fragment is typically labeled. After appropriate incubation, the free PRO polypeptide or fragment is separated from the bound form and the amount of free or unconjugated label is such that the particular reagent binds to the PRO polypeptide or PRO polypeptide / cell complex. Is a measure of the ability to inhibit.

Other techniques for drug screening provide high throughput screening for compounds with suitable binding affinity for the polypeptide, 1984 9
It is described in detail in WO84 / 03564 published on March 13. Briefly, a number of different small peptide test compounds are synthesized on a solid support such as plastic pins or some other surface. When applied to a PRO polypeptide, the peptide test compound is reacted with the PRO polypeptide and washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the drug screening techniques described above. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support. The present invention also contemplates competitive drug screening assays in which a neutralizing antibody capable of binding to a PRO polypeptide specifically competes with a test compound for a PRO polypeptide or fragment thereof. In this way, the antibody can be used to detect the presence of any peptide in the PRO polypeptide which carries one or more antigenic determinants.

Example 35 Rational Drug Design The purpose of rational drug design is to identify biologically active polypeptides of interest (eg, P
RO polypeptides) or small molecules with which they interact, eg, structural analogs of agonists, antagonists, or inhibitors. Any of these examples can be used to create more active and stable forms of the PRO polypeptide or to create agents that enhance or inhibit the function of the PRO polypeptide in vivo (reference,
Hodgson, Bio / Technology, 9: 19-21 (1991)). In one method, the three-dimensional structure of a PRO polypeptide, or PRO polypeptide-inhibitor complex, is determined by x-ray crystallography, computer modeling, and most typically by a combination of the two methods. Both the shape and charge of the PRO polypeptide must be confirmed in order to elucidate the structure of the molecule and determine the active site. Although small in number, useful information regarding the structure of PRO polypeptides may sometimes be obtained by modeling based on the structure of homologous proteins. In both cases, the relevant structural information is used to design similar PRO polypeptide-like molecules or to identify effective inhibitors. Useful examples of rational drug design include molecules with improved activity or stability as shown in Braxton and Wells, Biochemistry, 31: 7796-7801 (1992), or Athauda et al., J. Biochem. , 113:
742-746 (1993), including molecules that act as inhibitors, agonists, or antagonists of natural peptides.

Further, the target-specific antibody selected by the functional assay as described above can be isolated and its crystal structure can be elucidated. This method in principle produces a pharmacore upon which subsequent drug design can be based. Protein crystallography can be bypassed by generating anti-idiotypic antibodies (anti-ids) to functional, pharmacologically active antibodies. As a mirror image of a mirror image, the binding site of anti-ids can be expected to be an analog of the first receptor. Anti-id
Can then be used to identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptide will function as the pharmacore. In accordance with the present invention, sufficient amounts of PRO polypeptides are available to carry out analytical experiments such as X-ray crystallography. Furthermore, the knowledge of the PRO polypeptide amino acid sequences provided herein provides the knowledge used in computer modeling techniques in place of, or in addition to, X-ray crystallography.

Example 36 In Vitro Anti-Tumor Assay PRO240, PRO381, PRO534, PRO540, PRO698,
PRO982, PRO1005, PRO1007, PRO1131, PRO11
57, PRO1199, PRO1265, PRO1286, PRO1313, P
RO1338, PRO1375, PRO1410, PRO1488, PRO34
38, PRO4302, PRO4400, PRO5725, PRO183, PR
The antiproliferative activity of O202, PRO542, PRO861, PRO1096 or PRO3562 polypeptides was determined by the method of Skehan et al., J. Natl. Cancer Inst., 82: 1107-1112 (
Was determined in a National Cancer Institute (NCI) clinical disease-directed in vitro anti-cancer drug discovery assay using a sulforhodamine B (SRB) staining binding assay essentially as described by (1990). The 60 tumor cell lines ("NCI panel") used in this study, as well as in vitro maintenance and culture conditions, were reviewed by Monks et al., J. Na.
tl. Cancer Inst., 83: 757-766 (1991). The purpose of this screen is to first assess the cytotoxic and / or cytostatic activity of test compounds against different types of tumors (Monks et al., Supra; Boyd, Cancer:
Princ. Pract. Oncol. Update, 3 (10): 1-12 [1989]).

Cells from approximately 60 human tumor cell lines were harvested with trypsin / EDTA (Gibco), washed once, resuspended in IMEM and their viability determined. The cell suspension was pipetted (100 μl volume) into separate 96-well microtiter plates. To prevent overgrowth, the cell density for the 6-day incubation was less than that for the 2-day incubation. Pre-incubation time of 24 hours at 37 ° C allowed for seeding for stabilization. A 2-fold dilution of the intended test concentration was added to the microtiter plate wells in 100 μl aliquots at time zero (1: 2 dilution). Test compounds were evaluated at a 5-fold and a half-logarithmic dilution (1000 to 100,000 fold). Incubations were performed for 2 and 6 days in a 5% CO ₂ atmosphere and 100% humidity.

After incubation, the medium was removed and the cells fixed at 40 ° C. in 0.1 ml of 10% trichloroacetic acid. Plates were washed 5 times with deionized water, dried, stained with 0.1 ml of 0.4% sulforhodamine B dye (Sigma) in 1% acetic acid for 30 minutes, washed 4 times with 1% acetic acid and unbound dye. Remove, dry and dry with 0.1 ml of 10 mM Tris base [
The dyed product was extracted with tris (hydroxymethyl) aminomethane], pH 10.5 for 5 minutes.
The absorbance (OD) of sulforhodamine B at 429 nm was measured using a 96-well macrotiter plate reader connected to a computer. A test sample is considered positive if it exhibits a growth inhibitory effect of at least 40% at one or more concentrations. The results are shown below in Table 7, where the tumor cell type abbreviations are: NSCL = non-small cell lung cancer; CNS = central nervous system.

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

Deposit of Materials The following cell lines were purchased from American Type Culture Collection, 10801.
University Boulevard Manassas, Virginia, 20110-220
9 Deposited in the United States (ATCC):

This deposit was made in accordance with the provisions of the Budapest Treaty and its Regulations (Budapest Treaty) on the international recognition of deposits of microorganisms under the patent procedure. This guarantees that the viable culture of the deposit will be maintained for 30 years from the date of deposit.
Deposits may be obtained from the ATCC in accordance with the terms of the Budapest Treaty and in accordance with the agreement between Genentech and ATCC, whichever is first, at the time of issuance of the relevant U.S. patent or at any time. At the time of publication of a U.S. or foreign patent application, it is guaranteed that the progeny of the deposited culture will be permanently and unrestrictedly available, and will be subject to United States Patent Law Section 122 and the Patent Office Commissioner Regulations accordingly (especially reference numeral 886OG638).
It guarantees that the descendants will be available to those who have been determined by the US Patent Office Commissioner to have rights in accordance with 7 CFR Article 1.14).

The assignee of the present application is that if the deposited culture dies or is lost or destroyed if it has been cultivated under appropriate conditions, the material will be immediately replaced with another of the same upon notice. I agree with that. The availability of deposited material is not to be construed as a license to practice the invention in breach of any rights recognized under any governmental authority under patent law. The written specification given above is considered sufficient to enable one skilled in the art to practice the invention. The deposited embodiment is intended as an illustration of one of the aspects of the invention and any functionally equivalent construct is within the scope of the invention, so that the deposited deposits may It is not limited. No deposit of material herein is admitted that the written description contained therein is sufficient to enable the practice of any aspect of the invention, including its best mode. It is not to be construed as limiting the scope of the claims to the particular illustrations presented. Indeed, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

[Brief description of drawings]

1 is the nucleotide sequence of the native sequence PRO240 cDNA (SEQ ID NO:
1) is a diagram showing 1), and SEQ ID NO: 1 is a clone herein designated as DNA34387-1138.

FIG. 2 shows the amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in FIG.

FIG. 3 Nucleotide sequence of native sequence PRO381 cDNA (SEQ ID NO:
3) is a diagram showing SEQ ID NO: 3 is a clone designated herein as DNA44194-1317.

FIG. 4 shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in FIG.

FIG. 5 Nucleotide sequence of native sequence PRO534 cDNA (SEQ ID NO:
5) is a diagram showing SEQ ID NO: 5 and is a clone designated here as DNA48333-1321.

FIG. 6 shows the amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in FIG.

FIG. 7: Nucleotide sequence of native sequence PRO540 cDNA (SEQ ID NO:
7), where SEQ ID NO: 7 is the clone designated herein as DNA44189-1322.

FIG. 8 shows the amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in FIG.

FIG. 9 Nucleotide sequence of native sequence PRO698 cDNA (SEQ ID NO:
9) is a diagram showing 9), wherein SEQ ID NO: 9 is a clone designated herein as DNA48320-1433.

FIG. 10 shows the amino acid sequence (SEQ ID NO: 10) derived from the coding sequence of SEQ ID NO: 9 shown in FIG.

FIG. 11 shows the nucleotide sequence of the native sequence PRO982 cDNA (SEQ ID NO: 11), where SEQ ID NO: 11 is DNA57700-1408.
Is a clone named.

FIG. 12 shows the amino acid sequence (SEQ ID NO: 12) derived from the coding sequence of SEQ ID NO: 11 shown in FIG.

FIG. 13 shows the nucleotide sequence of the native sequence PRO1005 cDNA (SEQ ID NO: 13), wherein SEQ ID NO: 13 is here DNA57708-141.
It is a clone named 1.

FIG. 14 shows the amino acid sequence (SEQ ID NO: 14) derived from the coding sequence of SEQ ID NO: 13 shown in FIG.

FIG. 15 shows the nucleotide sequence of the native sequence PRO1007 cDNA (SEQ ID NO: 15), wherein SEQ ID NO: 15 is herein DNA57690-137.
It is a clone named 4.

FIG. 16 shows the amino acid sequence (SEQ ID NO: 16) derived from the coding sequence of SEQ ID NO: 15 shown in FIG.

FIG. 17 shows the nucleotide sequence of the native sequence PRO1131 cDNA (SEQ ID NO: 17), wherein SEQ ID NO: 17 is herein DNA59777-148.
It is a clone named 0.

FIG. 18 shows the amino acid sequence (SEQ ID NO: 18) derived from the coding sequence of SEQ ID NO: 17 shown in FIG.

FIG. 19 shows the nucleotide sequence of the native sequence PRO1157 cDNA (SEQ ID NO: 19), wherein SEQ ID NO: 19 is herein DNA60292-150.
This is a clone named 6.

FIG. 20 shows the amino acid sequence (SEQ ID NO: 20) derived from the coding sequence of SEQ ID NO: 19 shown in FIG.

FIG. 21 shows the nucleotide sequence of the native sequence PRO1199 cDNA (SEQ ID NO: 21), where SEQ ID NO: 21 is DNA65351-136.
It is a clone named 6-1.

FIG. 22 shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in FIG.

FIG. 23 shows the nucleotide sequence of the native sequence PRO1265 cDNA (SEQ ID NO: 23), wherein SEQ ID NO: 23 is herein DNA60764-153.
It is a clone named 3.

FIG. 24 shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in FIG.

FIG. 25 shows the nucleotide sequence of the native sequence PRO1286 cDNA (SEQ ID NO: 25), wherein SEQ ID NO: 25 is herein DNA64903-155.
It is a clone named 3.

FIG. 26 shows the amino acid sequence (SEQ ID NO: 26) derived from the coding sequence of SEQ ID NO: 25 shown in FIG.

FIG. 27 shows the nucleotide sequence of the native sequence PRO1313 cDNA (SEQ ID NO: 27), wherein SEQ ID NO: 27 is DNA64966-157.
This is a clone named 5.

FIG. 28 shows the amino acid sequence (SEQ ID NO: 28) derived from the coding sequence of SEQ ID NO: 27 shown in FIG. 27.

FIG. 29 shows the nucleotide sequence of the native sequence PRO1338 cDNA (SEQ ID NO: 29), SEQ ID NO: 29 is a clone herein designated DNA66667.

FIG. 30 shows the amino acid sequence (SEQ ID NO: 30) derived from the coding sequence of SEQ ID NO: 29 shown in FIG. 29.

FIG. 31 shows the nucleotide sequence of native sequence PRO1375 cDNA (SEQ ID NO: 31), wherein SEQ ID NO: 31 is herein DNA67004-161.
It is a clone named 4.

FIG. 32 shows the amino acid sequence (SEQ ID NO: 32) derived from the coding sequence of SEQ ID NO: 31 shown in FIG.

FIG. 33 shows the nucleotide sequence of the native sequence PRO1410 cDNA (SEQ ID NO: 33), wherein SEQ ID NO: 33 is herein DNA68874-162.
It is a clone named 2.

FIG. 34 shows the amino acid sequence (SEQ ID NO: 34) derived from the coding sequence of SEQ ID NO: 33 shown in FIG. 33.

FIG. 35 shows the nucleotide sequence of the native sequence PRO1488 cDNA (SEQ ID NO: 35), wherein SEQ ID NO: 35 is herein DNA73736-165.
It is a clone named 7.

FIG. 36 shows the amino acid sequence (SEQ ID NO: 36) derived from the coding sequence of SEQ ID NO: 35 shown in FIG.

FIG. 37 shows the nucleotide sequence of the native sequence PRO3438 cDNA (SEQ ID NO: 37), wherein SEQ ID NO: 37 is herein DNA82364-253.
It is a clone named 8.

38 shows the amino acid sequence (SEQ ID NO: 38) derived from the coding sequence of SEQ ID NO: 37 shown in FIG. 37.

FIG. 39 shows the nucleotide sequence of native sequence PRO4302 cDNA (SEQ ID NO: 39), wherein SEQ ID NO: 39 is herein DNA92218-255.
It is a clone named 4.

FIG. 40 shows the amino acid sequence (SEQ ID NO: 40) derived from the coding sequence of SEQ ID NO: 39 shown in FIG. 39.

FIG. 41 shows the nucleotide sequence of the native sequence PRO4400 cDNA (SEQ ID NO: 41), wherein SEQ ID NO: 41 is herein DNA87974-260.
It is a clone named 9.

FIG. 42 shows the amino acid sequence (SEQ ID NO: 42) derived from the coding sequence of SEQ ID NO: 41 shown in FIG. 41.

FIG. 43 shows the nucleotide sequence of the native sequence PRO5725 cDNA (SEQ ID NO: 43), wherein SEQ ID NO: 43 is herein DNA92265-266.
It is a clone named 9.

FIG. 44 shows the amino acid sequence (SEQ ID NO: 44) derived from the coding sequence of SEQ ID NO: 43 shown in FIG. 43.

FIG. 45 shows the nucleotide sequence of native sequence PRO183 cDNA (SEQ ID NO: 45), SEQ ID NO: 45 is the clone herein designated DNA28498.

FIG. 46 shows the amino acid sequence (SEQ ID NO: 46) derived from the coding sequence of SEQ ID NO: 45 shown in FIG. 45.

FIG. 47 shows the nucleotide sequence of the native sequence PRO202 cDNA (SEQ ID NO: 47), SEQ ID NO: 47 is the clone designated herein as DNA30869.

FIG. 48 shows the amino acid sequence (SEQ ID NO: 48) derived from the coding sequence of SEQ ID NO: 47 shown in FIG. 47.

FIG. 49 shows the nucleotide sequence of the native sequence PRO542 cDNA (SEQ ID NO: 49), SEQ ID NO: 49 is the clone designated herein as DNA56505.

FIG. 50 shows the amino acid sequence (SEQ ID NO: 50) derived from the coding sequence of SEQ ID NO: 49 shown in FIG. 49.

FIG. 51 shows the nucleotide sequence of native sequence PRO861 cDNA (SEQ ID NO: 51), SEQ ID NO: 51 is the clone designated herein as DNA50798.

52 shows the amino acid sequence (SEQ ID NO: 52) derived from the coding sequence of SEQ ID NO: 51 shown in FIG. 51.

FIG. 53 shows the nucleotide sequence (SEQ ID NO: 53) of native sequence PRO1096 cDNA, SEQ ID NO: 53 is the clone designated herein as DNA61870.

FIG. 54 shows the amino acid sequence (SEQ ID NO: 54) derived from the coding sequence of SEQ ID NO: 53 shown in FIG.

FIG. 55 shows the nucleotide sequence of native sequence PRO3562 cDNA (SEQ ID NO: 55), SEQ ID NO: 55 is the clone designated herein as DNA96791.

FIG. 56 shows the amino acid sequence (SEQ ID NO: 56) derived from the coding sequence of SEQ ID NO: 53 shown in FIG. 55.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 48/00 A61P 35/02 4C087 A61P 35/00 C07K 14/47 4H045 35/02 16/18 C07K 14 / 47 19/00 16/18 C12N 1/19 19/00 1/21 C12N 1/19 C12P 21/02 C 1/21 A61K 35/76 5/10 C12P 21/08 C12P 21/02 C12N 15/00 ZNAA / / A61K 35/76 5/00 B C12P 21/08 A61K 37/02 (31) Priority claim number 60 / 141,037 (32) Priority date June 23, 1999 (1999.6.23) (33) ) Priority claiming country United States (US) (31) Priority claiming number 60 / 144,758 (32) Priority date July 20, 1999 (July 20, 1999) (33) Priority claiming country United States (US ) (31) Priority claim number US9920111 (32) Priority date September 1, 1999 (September 1, 1999) (33) Priority claiming country United States (US) (31) Priority claim number US9920594 (32) Priority date September 8, 1999 (1999.9.8) (33) Priority claim country United States (US) (31) Priority claim number 60 / 162,506 (32) Priority date October 29, 1999 (1999.10.29) ( 33) Priority claiming United States (US) (31) Priority claiming number US9928313 (32) Priority date November 30, 1999 (November 30, 1999) (33) Priority claiming United States (US) (31) ) Priority claim number US9928634 (32) Priority date December 1, 1999 (December 1, 1999) (33) Priority claiming country United States (US) (31) Priority claim number US9928551 (32) Priority date Heisei December 2, 2011 (December 2, 1999) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 170,262 (32) Priority date December 9, 1999 (1999) 12.9) (33) Priority claiming countries United States (US) (31) Priority Claim number US9930095 (32) Priority date December 16, 1999 (December 16, 1999) (33) Priority claiming country United States (US) (31) Priority claim number US9930999 (32) Priority date 1999 December 20th (1999.12.20) (33) Priority claiming country United States (US) (31) Priority claim number US0000376 (32) Priority date January 6, 2000 (2000.1.6) (33) ) Priority claiming United States (US) (31) Priority claiming number US0003565 (32) Priority date February 11, 2000 (February 11, 2000) (33) Priority claiming United States (US) (31) Priority claim number US0004341 (32) Priority date February 18, 2000 (February 18, 2000) (33) Priority claiming country United States (US) (31) Priority claim number US0004342 (32) Priority date 2000 February 18, 2000 (February 18, 2000) (33) Priority claiming country United States (US) (31) Priority claim number US0005841 (32) Priority date March 2, 2000 (March 2, 2000) (33) Priority holder Country United States (US) (31) Priority claim number 60 / 187,202 (32) Priority date March 3, 2000 (2000.3.3) (33) Priority claim country United States (US) (31) Priority claim number US0006319 (32) Priority date March 10, 2000 (March 10, 2000) (33) Country of priority claim United States (US) (31) Priority claim number US0006884 (32) Priority date 2000 March 15, 2000 (March 15, 2000) (33) Priority claiming country United States (US) (31) Priority claim number US0008439 (32) Priority date March 30, 2000 (March 30, 2000) (33) Priority claiming United States (US) (31) Priority claiming number US0013705 (32) Priority date May 17, 2000 (May 17, 2000) (33) Priority claiming United States (US) ( 81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, I, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW) , EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH , CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, K G, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Goddard, Audrey United States California 94131, San Francisco, Congo Street 110 (72) Inventor Gurney, Austin, El. United States California 94002, Belmont, Debbie Lane 1 (72) Inventor Hebert, Caroline United States California 94703, Berkeley, Vin Street 1809 (72) Inventor Hansel, William United States California 94030, San Mateo, Southwood Drive 3724 (72) Inventor Kabakov, Lorna, Sea. United States California 94044, Pacifica, Granada Drive 1084 (72) Inventor Shelton, David, El. United States California 94618, Oakland, Clover Drive 5845 (72) Inventor Smith, Victoria United States California 94010, Burlingame, Dwight Road 19 (72) Inventor Watanabe, Colin, Kay. United States California 94556, Moraga, Corris Drive 128 (72) Inventor Wood, William, Ai. United States California 94010, Hillsboro, Southdown Court 35F Term (reference) 4B024 AA01 BA41 BA80 CA04 DA03 DA06 DA12 EA04 FA18 GA07 GA11 4B064 AG01 AG27 CA02 CA06 CA10 CA19 CC24 DA01 DA13 4B065 AA26 CA25 CAAX BAA93 CA02 CAABAXAA93A02A24AAB93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02AA93A02. CA46 4C084 AA02 AA03 AA07 AA13 BA01 BA02 BA22 CA53 NA14 ZB262 4C085 AA14 4C087 AA01 AA02 BC83 CA12 NA14 ZB26 ZB27 4H045 AA10 AA11 AA20 AA30 BA41 CA40 DA75 DA76 EA28

Claims (40)

[Claims] 1. A composition of matter useful for inhibiting tumor cell growth, comprising:
PRO240, PRO381, PRO53 mixed with a pharmaceutically acceptable carrier
4, PRO540, PRO698, PRO982, PRO1005, PRO10
07, PRO1131, PRO1157, PRO1199, PRO1265, P
RO1286, PRO1313, PRO1338, PRO1375, PRO14
10, PRO1488, PRO3438, PRO4302, PRO4400, P
RO5725, PRO183, PRO202, PRO542, PRO861, P
A composition of matter containing a RO1096 or PRO3562 polypeptide, or an agonist thereof. 2. PRO240, PRO381, PRO534, PRO540
, PRO698, PRO982, PRO1005, PRO1007, PRO11
31, PRO1157, PRO1199, PRO1265, PRO1286, P
RO1313, PRO1338, PRO1375, PRO1410, PRO14
88, PRO3438, PRO4302, PRO4400, PRO5725, P
A composition of matter according to claim 1 which contains a growth inhibitory amount of a RO183, PRO202, PRO542, PRO861, PRO1096 or PRO3562 polypeptide, or agonist thereof. 3. PRO240, PRO381, PRO534, PRO540
, PRO698, PRO982, PRO1005, PRO1007, PRO11
31, PRO1157, PRO1199, PRO1265, PRO1286, P
RO1313, PRO1338, PRO1375, PRO1410, PRO14
88, PRO3438, PRO4302, PRO4400, PRO5725, P
A composition of matter according to claim 1 which contains a cytotoxic amount of a RO183, PRO202, PRO542, PRO861, PRO1096 or PRO3562 polypeptide, or agonist thereof. 4. A composition of matter according to claim 1, further comprising an additional growth inhibitor, cytotoxic agent or chemotherapeutic agent. 5. A composition of matter useful for the treatment of tumors in mammals, which comprises PRO240, PRO381, PRO534, PRO540, PRO698,
PRO982, PRO1005, PRO1007, PRO1131, PRO11
57, PRO1199, PRO1265, PRO1286, PRO1313, P
RO1338, PRO1375, PRO1410, PRO1488, PRO34
38, PRO4302, PRO4400, PRO5725, PRO183, PR
A composition of matter comprising a therapeutically effective amount of an O202, PRO542, PRO861, PRO1096 or PRO3562 polypeptide, or agonist thereof. 6. The composition of matter according to claim 5, wherein the tumor is cancer. 7. The cancer is selected from the group consisting of breast cancer, ovarian cancer, kidney cancer, colorectal cancer, uterine cancer, prostate cancer, lung cancer, bladder cancer, central nervous system cancer, myeloma and leukemia. A composition of matter as described in. 8. A method for inhibiting the growth of tumor cells, wherein the tumor cells are P
RO240, PRO381, PRO534, PRO540, PRO698, PR
O982, PRO1005, PRO1007, PRO1131, PRO1157
, PRO1199, PRO1265, PRO1286, PRO1313, PRO
1338, PRO1375, PRO1410, PRO1488, PRO3438
, PRO4302, PRO4400, PRO5725, PRO183, PRO2
02, PRO542, PRO861, PRO1096 or PRO3562 polypeptide, or a method comprising exposing to an effective amount of an agonist thereof. 9. The agonist is an anti-PRO240, an anti-PRO381, an anti-PRO240.
-PRO534, anti-PRO540, anti-PRO698, anti-PRO982, anti-P
RO1005, anti-PRO1007, anti-PRO1131, anti-PRO1157,
Anti-PRO1199, Anti-PRO1265, Anti-PRO1286, Anti-PRO131
3, anti-PRO1338, anti-PRO1375, anti-PRO1410, anti-PRO1
488, anti-PRO3438, anti-PRO4302, anti-PRO4400, anti-PR
O5725, anti-PRO183, anti-PRO202, anti-PRO542, anti-PRO
The method according to claim 8, which is an 861, anti-PRO1096 or anti-PRO3562 agonist antibody. 10. The agonist is PRO240, PRO381, PRO.
534, PRO540, PRO698, PRO982, PRO1005, PRO
1007, PRO1131, PRO1157, PRO1199, PRO1265
, PRO1286, PRO1313, PRO1338, PRO1375, PRO
1410, PRO1488, PRO3438, PRO4302, PRO4400
, PRO5725, PRO183, PRO202, PRO542, PRO861
9. The method of claim 8 which is a small molecule that mimics the biological activity of a PRO1096 or PRO3562 polypeptide. 11. The method of claim 8, wherein the exposing step is performed in vitro. 12. The method of claim 8, wherein the exposing step is performed in vivo. 13. A container; and a composition containing an active agent contained in the container, wherein the active agent in the composition is PRO240, PRO381, PRO534, PRO540, PRO698.
, PRO982, PRO1005, PRO1007, PRO1131, PRO1
157, PRO1199, PRO1265, PRO1286, PRO1313,
PRO1338, PRO1375, PRO1410, PRO1488, PRO3
438, PRO4302, PRO4400, PRO5725, PRO183, P
RO202, PRO542, PRO861, PRO1096 or PRO3562
A manufactured product which is a polypeptide or an agonist thereof. 14. A use of the composition for inhibiting tumor cell growth is described.
14. The product of claim 13, further comprising a label affixed to the container or a packaging insert enclosed within the container. 15. The agonist is anti-PRO240, anti-PRO381,
Anti-PRO534, Anti-PRO540, Anti-PRO698, Anti-PRO982, Anti-
PRO1005, anti-PRO1007, anti-PRO1131, anti-PRO1157
, Anti-PRO1199, anti-PRO1265, anti-PRO1286, anti-PRO13
13, anti-PRO1338, anti-PRO1375, anti-PRO1410, anti-PRO
1488, anti-PRO3438, anti-PRO4302, anti-PRO4400, anti-P
RO5725, Anti-PRO183, Anti-PRO202, Anti-PRO542, Anti-PR
The article of manufacture according to claim 13, which is an O861, anti-PRO1096 or anti-PRO3562 agonist antibody. 16. The agonist is PRO240, PRO381, PRO.
534, PRO540, PRO698, PRO982, PRO1005, PRO
1007, PRO1131, PRO1157, PRO1199, PRO1265
, PRO1286, PRO1313, PRO1338, PRO1375, PRO
1410, PRO1488, PRO3438, PRO4302, PRO4400
, PRO5725, PRO183, PRO202, PRO542, PRO861
14. The article of manufacture of claim 13, which is a small molecule that mimics the biological activity of a PRO1096 or PRO3562 polypeptide. 17. The article of manufacture of claim 13, wherein the active agent is present in an amount effective to treat a tumor in a mammal. 18. The article of manufacture of claim 13, wherein the composition further comprises an additional growth inhibitor, cytotoxic agent or chemotherapeutic agent. 19. FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG.
8 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22)
24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), and FIG. 28 (SEQ ID NO:
28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG.
(SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44),
Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 5)
0), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), and FIG. 56 (SEQ ID NO: 56), and at least a nucleotide sequence encoding an amino acid sequence selected from the group consisting of amino acid sequences. An isolated nucleic acid having 80% nucleic acid sequence identity. 20. FIG. 1 (SEQ ID NO: 1), FIG. 3 (SEQ ID NO: 3), FIG. 5 (SEQ ID NO: 5), FIG. 7 (SEQ ID NO: 7), FIG. 9 (SEQ ID NO: 9), FIG. 11 (SEQ ID NO: 11), FIG. 13 (SEQ ID NO: 13), FIG. 15 (SEQ ID NO: 15), FIG. 17 (
SEQ ID NO: 17), FIG. 19 (SEQ ID NO: 19), FIG. 21 (SEQ ID NO: 21), FIG. 23 (SEQ ID NO: 23), FIG. 25 (SEQ ID NO: 25), FIG. 27 (SEQ ID NO: 27)
), FIG. 29 (SEQ ID NO: 29), FIG. 31 (SEQ ID NO: 31), FIG. 33 (SEQ ID NO: 33), FIG. 35 (SEQ ID NO: 35), FIG. 37 (SEQ ID NO: 37), FIG. SEQ ID NO: 39), FIG. 41 (SEQ ID NO: 41), FIG. 43 (SEQ ID NO: 43), FIG.
5 (SEQ ID NO: 45), FIG. 47 (SEQ ID NO: 47), FIG. 49 (SEQ ID NO: 49)
51 (SEQ ID NO: 51), FIG. 53 (SEQ ID NO: 53), and at least 80% nucleic acid sequence identity with a nucleotide sequence selected from the group consisting of the nucleotide sequences shown in FIG. 55 (SEQ ID NO: 55). Isolated nucleic acid having. 21. FIG. 1 (SEQ ID NO: 1), FIG. 3 (SEQ ID NO: 3), FIG. 5 (SEQ ID NO: 5), FIG. 7 (SEQ ID NO: 7), FIG. 9 (SEQ ID NO: 9), FIG. 11 (SEQ ID NO: 11), FIG. 13 (SEQ ID NO: 13), FIG. 15 (SEQ ID NO: 15), FIG. 17 (
SEQ ID NO: 17), FIG. 19 (SEQ ID NO: 19), FIG. 21 (SEQ ID NO: 21), FIG. 23 (SEQ ID NO: 23), FIG. 25 (SEQ ID NO: 25), FIG. 27 (SEQ ID NO: 27)
), FIG. 29 (SEQ ID NO: 29), FIG. 31 (SEQ ID NO: 31), FIG. 33 (SEQ ID NO: 33), FIG. 35 (SEQ ID NO: 35), FIG. 37 (SEQ ID NO: 37), FIG. SEQ ID NO: 39), FIG. 41 (SEQ ID NO: 41), FIG. 43 (SEQ ID NO: 43), FIG.
5 (SEQ ID NO: 45), FIG. 47 (SEQ ID NO: 47), FIG. 49 (SEQ ID NO: 49)
, A nucleotide sequence selected from the group consisting of the full-length coding sequences of the nucleotide sequence shown in FIG. 51 (SEQ ID NO: 51), FIG. 53 (SEQ ID NO: 53), and FIG. 55 (SEQ ID NO: 55). An isolated nucleic acid having the nucleic acid sequence identity of. 22. ATCC registration numbers 209260, 209808, 2097
01, 209699, 209904, 203583, 203021, 20995
0, 203111, 203540, 209856, 203452, 203223
, 203575, 203267, 203115, 203277, 203466,
An isolated nucleic acid having at least 80% nucleic acid sequence identity with the full length coding sequence of the DNA deposited under 203603, 203834, 203963, or PTA-256. 23. A vector comprising the nucleic acid according to any one of claims 19 to 22. 24. The vector of claim 23 operably linked to a control sequence recognized by a host cell transformed with the vector. 25. A host cell containing the vector of claim 23. 26. The host cell of claim 25, wherein the cell is a CHO cell. 27. The host cell of claim 25, wherein the cell is E. coli. 28. The host cell of claim 25, wherein the cell is a yeast cell. 29. The host cell of claim 25, wherein the cell is a baculovirus-infected insect cell. 30. PRO240, PRO381, PRO534, PRO54
0, PRO698, PRO982, PRO1005, PRO1007, PRO1
131, PRO1157, PRO1199, PRO1265, PRO1286,
PRO1313, PRO1338, PRO1375, PRO1410, PRO1
488, PRO3438, PRO4302, PRO4400, PRO5725,
26. In a method for producing a PRO183, PRO202, PRO542, PRO861, PRO1096 or PRO3562 polypeptide, the host cell of claim 25 is cultured under conditions suitable for expressing the polypeptide, and the polypeptide is removed from the cell culture medium. A method comprising recovering. 31. Figure 2 (SEQ ID NO: 2), Figure 4 (SEQ ID NO: 4), Figure 6 (SEQ ID NO: 6), Figure 8 (SEQ ID NO: 8), Figure 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG.
8 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22)
24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), and FIG. 28 (SEQ ID NO:
28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG.
(SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44),
Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 5)
0), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), and the amino acid sequence selected from the group consisting of the amino acid sequences shown in FIG. 56 (SEQ ID NO: 56) and at least 80% amino acid sequence. An isolated polypeptide having identity. 32. (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG.
8 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22)
24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), and FIG. 28 (SEQ ID NO:
28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), FIG.
(SEQ ID NO: 40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44),
Figure 46 (SEQ ID NO: 46), Figure 48 (SEQ ID NO: 48), Figure 50 (SEQ ID NO: 5)
0), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), and FIG. 56 (SEQ ID NO: 56), when compared to an amino acid sequence selected from the group consisting of amino acid sequences, at least 80 An isolated polypeptide that is scored as% positive. 33. ATCC registration numbers 209260, 209808, 2097
01, 209699, 209904, 203583, 203021, 20995
0, 203111, 203540, 209856, 203452, 203223
, 203575, 203267, 203115, 203277, 203466,
An isolated polypeptide having at least 80% amino acid sequence identity with the amino acid sequence encoded by the full length coding sequence of DNA deposited under 203603, 203834, 203963, or PTA-256. 34. A chimeric molecule comprising a polypeptide according to any one of claims 31 to 33 linked to a heterologous amino acid sequence. 35. The heterologous amino acid sequence is an epitope tag sequence.
Chimeric molecule according to. 36. The chimeric molecule of claim 34, wherein the heterologous amino acid sequence is the Fc region of an immunoglobulin. 37. An antibody that specifically binds to the polypeptide of any one of claims 31-33. 38. The antibody according to claim 37, wherein the antibody is a monoclonal antibody, a humanized antibody or a single chain antibody. (A) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 8) 10), FIG.
2 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16)
, FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), and FIG. 22 (SEQ ID NO:
22), FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG.
(SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38),
Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 4)
4), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), or FIG. 5
6 (SEQ ID NO: 56), which encodes the polypeptide lacking the associated signal peptide; (b) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. (SEQ ID NO: 6)
8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12)
), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG.
0 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34)
36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), and FIG. 40 (SEQ ID NO:
40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG.
(SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), or FIG. 56 (SEQ ID NO: 56)
(C) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6; (SEQ ID NO: 6)
8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12)
), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG.
0 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34)
36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), and FIG. 40 (SEQ ID NO:
40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG.
(SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), or FIG. 56 (SEQ ID NO: 56)
An isolated nucleic acid having at least 80% nucleic acid sequence identity with the nucleotide sequence encoding the extracellular domain of the polypeptide set forth in (1), which lacks the signal peptide associated therewith; 40. (a) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6), FIG. 8 (SEQ ID NO: 8), FIG. 10), FIG.
2 (SEQ ID NO: 12), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16)
, FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), and FIG. 22 (SEQ ID NO:
22), FIG. 24 (SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG. 30 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG.
(SEQ ID NO: 34), FIG. 36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38),
Figure 40 (SEQ ID NO: 40), Figure 42 (SEQ ID NO: 42), Figure 44 (SEQ ID NO: 4)
4), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG. 52 (SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), or FIG. 5
6 (SEQ ID NO: 56) lacking the associated signal peptide; (b) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6) )
8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12)
), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG.
0 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34)
36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), and FIG. 40 (SEQ ID NO:
40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG.
(SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), or FIG. 56 (SEQ ID NO: 56)
Extracellular domain of the polypeptide shown in (4) and having a signal peptide associated therewith; or (c) FIG. 2 (SEQ ID NO: 2), FIG. 4 (SEQ ID NO: 4), FIG. 6 (SEQ ID NO: 6) )
8 (SEQ ID NO: 8), FIG. 10 (SEQ ID NO: 10), FIG. 12 (SEQ ID NO: 12)
), FIG. 14 (SEQ ID NO: 14), FIG. 16 (SEQ ID NO: 16), FIG. 18 (SEQ ID NO: 18), FIG. 20 (SEQ ID NO: 20), FIG. 22 (SEQ ID NO: 22), FIG. SEQ ID NO: 24), FIG. 26 (SEQ ID NO: 26), FIG. 28 (SEQ ID NO: 28), FIG.
0 (SEQ ID NO: 30), FIG. 32 (SEQ ID NO: 32), FIG. 34 (SEQ ID NO: 34)
36 (SEQ ID NO: 36), FIG. 38 (SEQ ID NO: 38), and FIG. 40 (SEQ ID NO:
40), FIG. 42 (SEQ ID NO: 42), FIG. 44 (SEQ ID NO: 44), FIG. 46 (SEQ ID NO: 46), FIG. 48 (SEQ ID NO: 48), FIG. 50 (SEQ ID NO: 50), FIG.
(SEQ ID NO: 52), FIG. 54 (SEQ ID NO: 54), or FIG. 56 (SEQ ID NO: 56)
An isolated domain having at least 80% amino acid sequence identity with the extracellular domain of the polypeptide set forth in (1) above, which lacks the signal peptide associated therewith;