KR20010086226A - Genetic Immunization with Nonstructural Proteins of Hepatitis C Virus - Google Patents

Abstract

The present invention specifically discloses nucleic acid molecules comprising hepatitis C virus non-structural proteins comprising the disclosed DNA sequences. The present invention encompasses a nucleotide sequence encoding NS3, NS4 and / or NS5 or a combination thereof operably linked to a regulatory factor that functions in a human cell, a hepatitis C virus non-structural protein comprising this sequence, ≪ / RTI > nucleic acid molecules. The present invention discloses a method of immunizing an individual susceptible or susceptible to hepatitis C virus, comprising administering said pharmaceutical composition.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention [0001] The present invention relates to genetic immunization using nonstructural proteins of hepatitis C virus,

Hepatitis C virus (HCV) is a major etiologic factor for non-A and non-B hepatitis infections due to transfusion, causing approximately 150,000 acute viral hepatitis in the United States each year [Choo et al. , Science, 1989, 244, 359-362]. In advanced countries 0.6 to 2.0%, and in some less developed countries 15% [Heintges, et al., Hepatology, 1997, 26, 521-526]. Half of these infections progress to chronic infections that can be associated with cirrhosis and / or hepatocellular carcinoma (Alter, et al., Science, 1992, 258, 135-140; And Alter, et al., New Eng. J. Med., 1992,327, 1899-1905]. In addition, as shown in the dissemination of anti-HCV antibodies, HCV infection has become an independent risk factor for hepatocellular carcinoma development (Colombo, et al., Lancet, 1989, ii, 1006-1008; Saito, et al. , Proc Natl Acad Sci., 1990, 87, 6547-6549, Simonetti, et al., An. Int. Med., 1992, 116, 97-102, and Tsukuma, et al., New Eng. J Med., 1993, 328, 1797-1801).

HCV is an enveloped, positive-stranded RNA virus that has a length of about 9,500 nucleotides and is classified as a distinct genus within the Flavivirus family [Heinz, Arch. Virol. (Suppl.), 1992,4, 163-171). Other donors exhibit a large diversity of nucleotide sequences, whereby the HCV genome is subdivided into more than eight genotypes [Simmonds, et al., J. Gen. Virol., 1993, 74, 2391-2399]. In all genotypes, the viral genome contains a large open reading frame (ORF) encoding a polyprotein precursor of 3010 to 3033 amino acids of about 330 Kd (Choo, et al., Proc. Natl. Acad. Sci. USA, 1991, 88, 2451-2455; Inchauspe, et al., Proc. Natl. Acad. Sci. USA, 1991, 88, 10292-10296; Kato, et al., Pro. Natl. Aca. Sci. USA, 1990, 87, 9524-9528; Okamoto, et al., J. Gen. Virol., 1991, 72, 2697-2704; And Takamizawa. et al., J. Gen. Virol., 1991, 65,1105-1113]

Each HCV polypeptide is produced by proteolytic processing of a precursor polypeptide that produces core (C), envelope (E1, E2) and nonstructural protein (NS2-NS5) [Bartenschlager, et al., J. Gen. Virol., 1993, 67, 3835-3844; Grakoui, et al., J. Gen. Virol., 1993, 67, 2823-2843; And Selby et al., J. Gen. Virol., 1993, 74,1103-1113]. Such proteolysis is catalyzed by the combination of cells and proteases encoded by the virus. The NS3 gene encodes a serine protease that cleaves the virus polyprotein precursor at various functional groups after transcription and also acts as a viral helicase. The NS5 site encodes the RNA-dependent RNA polymerase of the virus.

In addition to the translated site, the HCV genome contains a 5 'untranslated region (5'UTR) and a 3' untranslated region (3'UTR). The 5'UTR of 324 to 341 nucleotides shows the highest conservation among all HCV isolates reported so far [Han, et al., Proc. Natl. Acad. Sci. USA, 1991, 88, 1711-1715; And Bukh, et al., Proc. Natl. Acad. Sci. USA, 1992, 89, 4942-4946]. It has been speculated that this 5'UTR contains important regulatory elements for replication and / or translation of HCV RNA. The 5'UTR also contains several small open reading frames (ORFs), but there is no evidence to suggest that these ORF sequences are actually translated.

The cellular immune system associated with liver damage and viral clearance during HCV infection is only partially identified. Koziel et al. Investigated the cytotoxic T lymphocyte (CTL) response of these cells to determine the possible pathological role of hepatocyte infiltrating lymphocytes in patients with chronic HCV infection and found that HLA class I-restricted CD8 + CTL response [Koziel, et al., J. Virol., 1993, 67, 7522-7532; And Koziel, et al., J. Immunol., 1992, 149, 3339-3344). In addition, other investigators have shown that CTL is present in peripheral blood mononuclear cells that recognize epitopes on the core and other viral-related proteins upon chronic HCV infection [Kita, et al., Hepatol., 1993, 18, 1039-1044; And Cerny, et al., Intl. Symp. Viral Hepatitis Liver Dis., 1993, 83 (abstr.)]. [Ferrari, et al., Hepatol., 1994, 19, 286-295] have reported that HCV infection in patients with chronic HCV infection is different from that of other HCV infected patients [Botarelli et al., Gastroenterol., 1993, 104, 580-587] HLA class II-restricted CD4 + T cell-mediated proliferative response to several recombinant proteins derived from the site.

In active HCV infections, humoral and cellular immune responses have been found to be polyclonal and multispecific, suggesting that host immune responses induced by latent HCV infection are partly responsible for liver cell damage. However, such an immune response is not sufficiently broad or is not active enough to promote viral clearance and may not result in protective immunity to chronic HCV infections [Chisari, J. Clin. Invest., 1997,99, 1472-1477]. Recently, it has recently been shown that in individuals recovering from acute HCV infection, a CD4 + T cell response occurs which strongly proliferates against peptides derived from nonstructural proteins [Missale, et al., J. Clin. Invest., 1996, 98, 706-714; And Diepolder, et al., Lancet, 1995, 346, 1006-1007). More importantly, the occurrence of HCV-specific CTL activity is thought to be related to the viral replication control of chronic hepatitis individuals [Rehermann, et al., J. Clin. Invest., 1996,98, 1432-1440; And Nelson, et al., J. Immunol., 1997, 158, 1473-1481].

However, it has not been revealed that the non-structural proteins NS3, NS4 and NS5 have sufficient immunogenicity to cause extensive and active CTL-responses in vivo.

Currently, there is no general and highly effective treatment for chronic HCV infection. The development of a vaccine against HCV is very complicated due to the large heterogeneity between the HCV isolates and the heterogeneous genome mix in the isolate [Martell, et al., J. Virol., 1992, 66, 3225] Lt; RTI ID = 0.0 > cortical < / RTI > Effective therapies are limited to the use of interferon [Carithers, et al., Hepatology, 1997, 26, 83S-88S]. In fact, about 8 to 10% of the individuals treated with the above agonists have removed HCV from the liver in response to HCV. However, recent studies have shown that individuals recovering from acute HCV infection exhibit a large CD4 + T-cell proliferative response to nonstructural proteins compared to individuals infected with latent HCV [Missale, et al., J. Clin. Invest., 1996,98, 706-714; And Diepolder, et al., Lancet, 1995, 346, 006-1007).

Direct injection of DNA into animals is a promising way to deliver specific antigens for immunization [Barry, et al., Bio Techniques, 1994, 16, 616-619; Davis, et al., Hum. Mol. Genet., 1993, 11, 1847-1851; Tang, et al., Nature, 1992, 356, 152-154; Wang, et al., J. Virol., 1993, 67, 3338-3344; And Wolff, et. al., Science, 1990, 247, 1465-1468). This method has been successfully used to induce protective immunity against influenza viruses in mice and chickens, bovine herpesvirus 1 in mice and cattle, and rabies virus in mice [Cox, et al., J. Virol., 1993, 67, 5664-5667; Fynan, et al., DNA and Cell Biol., 1993,12, 785-789; Ulmer, et al., Science, 1993, 259, 1745-1749; And Xiang, et al., Virol., 1994, 199, 132-140). In most cases, a strong, highly diverse, antibody and cytotoxic T-cell response is associated with infection control. Indeed, compared with methods involving death vaccines to prevent acute infection and to induce a CTL response that is beneficial in eliminating latent viral infections, this method leads to long-lasting memory CTLs without the use of liver vectors Which is of particular interest because of its potency to induce apoptosis [Wolff, et al., Science, 1990, 247, 1465-1468; Wolff, et al., Hum. Mol. Genet., 1992, 1, 363-369; Manthorpe, et al., Human Gene Therapy, 1993, 4, 419-431; Ulmer, et al., Science, 1993, 259, 1745-1749; Yankauckas, et al., DNA and Cell Biol., 1993, 12, 7997-783; Montgomery, et al., DNA and Cell Biol., 1993, 12, 777-783; Fynan, et al., DNA and Cell Biol., 1993,12, 785-789; Wang, et al., Proc. Natl. Acad. Sci. USA, 1993, 90, 4156-4160; Wang, et al., DNA and Cell Biol., 1993, 12, 799-805; Xiang, et al., Virol., 1994, 199, 132-140; Davis et al., Hum. Mol. Genet., 1993, 11, 1847-1851; Donelly, et al., Nat. Med., 1995, 1, 583-587; Boyer, et al., Nat. Med., 1997, 3, 526-532; Tascon, et al., Nat. Med., 1996, 2, 888-892; And Huygen, et al., Nat. Med., 1996, 2, 893-898]. Compared to immunological methods using soluble recombinant proteins or peptides, this method is not only a cytotoxic T cell activity as it is presented in MHC class I molecules in transfected cells after viral proteins are treated in the cells as peptides Has the advantage of inducing strong inflammatory CD4 + T cell responses and exhibiting limited interaction with antigen presenting cells. On the other hand, immunological methods using soluble proteins are mainly processed through the MHC class II pathway, leading mainly to humoral immune responses. Immunization with synthetic peptides has several disadvantages because of the limited number of epitopes available for inducing host immune responses. On the other hand, all native B and T cell epitopes encoded by each protein by the desired DNA construct are presumed to be conserved for recognition by T cell receptors and thus will lead to a very wide range of humoral and cellular immune responses [McDonnell , et al., N. Eng. J. Med., 1996, 334, 42-45].

In general, vaccination and immunization refers to the introduction of non-toxic agents that can cause an immune system in an individual to initiate an immune response to defend against the invasion of pathogens. The immune system recognizes exogenous compositions and agents that invade by recognizing proteins and other macromolecules that are not normally present in the individual. The outer protein suggests a target that induces an immune response.

PCT Patent Application No. PCT / US90 / 01348 discloses a method for producing and using a composition containing an anti-HCV vaccine, comprising the sequence information of the HCV genomic clone, the amino acid sequence of the HCV viral protein, the HCV protein and peptides derived therefrom .

U.S. Patent Nos. 5,830,876, 5,593,972, 5,739,118, and PCT Patent Application No. PCT / US94 / 00899, filed in 1994. 1.26, which are incorporated herein by reference, disclose gene immunization methods, respectively. Vaccines against HCV are also disclosed.

There is a need for a vaccine useful for protecting individuals against hepatitis C virus infection and a method for protecting individuals against hepatitis C virus infection is required.

The present invention relates to a recombinant nucleic acid molecule, for example a pharmaceutical composition comprising said molecule useful as a constituent of an anti-C hepatitis virus vaccine in genetic immunization, a method of inducing an immune response to hepatitis C virus infection, and C The present invention relates to a method for treating an individual infected with hepatitis virus.

SUMMARY OF THE INVENTION [

The present invention relates to a recombinant nucleic acid molecule comprising a nucleotide sequence encoding a hepatitis C virus nonstructural protein, for example NS3, NS4 or NS5, or a combination thereof.

The present invention relates to a pharmaceutical composition comprising a recombinant nucleic acid molecule comprising a nucleotide sequence encoding a hepatitis C virus nonstructural protein. A nucleotide coding sequence that encodes a hepatitis C virus non-structural protein is operably linked to a regulatory factor that functions in human cells. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or diluent and optionally an accelerator, for example a bulk biocaine.

The invention provides a method of immunizing a subject susceptible to hepatitis C virus comprising administering to the subject a pharmaceutical composition comprising a recombinant nucleic acid molecule comprising a nucleotide coding sequence encoding a hepatitis C virus non- . The nucleotide coding sequence encoding the hepatitis C virus nonstructural protein is operably linked to regulatory elements that function in human cells. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or diluent. The subject is administered an effective amount to induce a protective immune response against hepatitis C virus infection.

The present invention is directed to a method of treating a subject suffering from hepatitis C virus comprising administering to a subject having hepatitis C virus a pharmaceutical composition comprising a recombinant nucleic acid molecule comprising a nucleotide coding sequence encoding a hepatitis C virus non- . The nucleotide coding sequence encoding the hepatitis C virus nonstructural protein is operably linked to regulatory elements that function in human cells. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or diluent. The subject is administered an effective amount to induce a therapeutic immune response against hepatitis C virus infection.

BRIEF DESCRIPTION OF THE DRAWINGS [

Figure 1A is a schematic diagram showing one large ORF of HCV, which is expressed by the signal of the host and by the protease of the virus, the polyprotein of about 3011 to 3030 amino acids cleaved into the respective structural and nonstructural proteins, Lt; / RTI > Figure Ib is a radiographic assay showing the transient transfection of HuH-7 and the expression of nonstructural proteins after stable transfection of SP2 / 0 cells. Lanes 1, 3, and 5 are negative controls with cells transfected with mock DNA (Mock). Lanes 2, 4, and 6 show a specific band of about 70 kD for NS3, about 30 kD for NS4, and about 125 kD for NS5. Lanes 7 to 10 represent SP2 / 0 cells transfected with a nucleic acid construct containing genes for NS3, NS4 and NS5, respectively. Lanes 7 and 9 represent cell lysates of cells stably expressing HCV-core protein (SP2-10) as negative controls, and lanes 8 and 10 represent specific expression of NS3 and NS5.

Figure 2a is a bar graph showing the humoral immune response to NS3, NS4 and NS5 produced by DNA-based immunoassay. Levels of anti-autoantibody antibodies were measured by ELISA (n = 5 in each group). Figure 2B is a bar graph showing T-cell proliferation measured 3 days after in vitro stimulation with specific or non-specific recombinant protein. Figures 2c, 2d and 2e are histograms showing secretion of cytokines, IFN-y, IL-2 and IL-4, respectively, as supernatants, measured 48 hours after in vitro stimulation.

Figures 3a and 3b show cytotoxic T-cell (CTL) responses to NS3 and NS5 at different ratios of the effector and target cells (100: 1, 30: 1, 10: 1, 3: It is a bar graph. Figure 3c shows a bar graph showing the chromium release assay for a target cell line stably transfected.

4A is a table showing the results of a tumor model for measuring CTL activity. Figure 4b shows, from the left, 1) immunization with simulated DNA, SP2 / NS5-21 cell administration; 2) immunization with pApNS5, SP2 / NS5-21 cell administration; 3) immunization with pApNS5, SP2-19 (stably expressing the HCV core); And 4) immunizing the recombinant NS5 protein with three intraperitoneal administrations and showing the animals to which SP2 / NS5-21 cells were administered.

DISCLOSURE OF THE INVENTION <

The present invention provides compositions and methods for immunizing or treating individuals from HCV infection prophylactically and / or therapeutically. A recombinant nucleic acid molecule comprising a nucleotide coding sequence encoding non-structural proteins of HCV, e.g., NS3, NS4 or NS5, or a combination thereof, is administered to the subject. Proteins encoded by recombinant nucleic acid gene constructs are expressed in individual cells and serve as targets of immunogenicity leading to anti-HCV immunoreactivity. The resulting immune response is extensive and leads to cellular immune responses as well as humoral immune responses. The methods of the present invention are useful for imparting prophylactic and therapeutic immunity. In addition, the invention may be practiced in mammals for biomedical research as well as in humans. Thus, the methods of the invention can be used not only to treat HCV-infected individuals, but also to immunize individuals from HCV entry.

As used herein, "HCV nonstructural protein" refers to HCV nonstructural proteins NS3, NS4 and NS5 and equivalents thereof. Equivalent proteins include peptide fragments of NS3, NS4 and NS5 that retain viability as disclosed herein. In addition, the term HCV nonstructural protein refers to the corresponding HCV nonstructural protein of another HCV isolate, which may differ in sequence. One skilled in the art can easily identify HCV nonstructural proteins in other HCV isolates. Nucleotide substitutions of codons are acceptable when coding the same amino acid. It is also understood that even if the result of nucleotide substitution is conservative amino acid substitution (s), nucleotide changes are possible. In addition, " HCV nonstructural protein " includes a fusion protein comprising a nonstructural protein and a fragment thereof that is therapeutically or prophylactically active.

As used herein, " gene construct " refers to an initiation and termination signal operably linked to a regulatory factor comprising a promoter and a polyadenylation signal capable of directing expression in a cell of the vaccinated individual, and a HCV non- &Lt; RTI ID = 0.0 &gt; nucleotide &lt; / RTI &gt; In some embodiments, the gene construct also comprises one or more fragments of an enhancer, Kozak sequence (GCCGCCATG; SEQ ID NO: 1) and HCV 5'UTR.

As used herein, " gene vaccine " means a pharmaceutical formulation comprising a gene construct. Gene vaccines include pharmaceutical agents useful for inducing a prophylactic and / or therapeutic immune response against HCV.

As used herein, "nucleic acid" refers to DNA, RNA or chimeric forms thereof.

According to the present invention, the gene construct is introduced into the cells of the individual to be expressed to produce one or more HCV nonstructural proteins. Preferably, the regulatory element of the gene construct of the invention can direct expression in a mammal, preferably a human cell. Regulatory factors include promoters and polyadenylation signals. In addition, other elements, such as enhancers and Koza sequences, may also be included in the gene construct.

The gene construct of the present invention can exist as a molecule functioning extracellularly in a cell or can be introduced into chromosomal DNA of a cell. Nucleic acids, such as DNA, can be introduced into cells and exist as separate genetic material in plasmid form. Alternatively, a linear nucleic acid can be introduced into the cell and introduced into the chromosome. When a nucleic acid is introduced into a cell, a reagent that promotes the introduction of the nucleic acid into the chromosome may be added. In addition, DNA sequences useful for promoting such introduction may be included in the DNA molecule. Alternatively, the RNA may be administered intracellularly. It is contemplated to provide the gene construct as a linear mini-chromosome containing a centromere, endoplasmic reticulum or origin of replication.

The gene construct of the present invention comprises a recombinant nucleic acid molecule comprising a nucleotide coding sequence encoding an HCV nonstructural protein. In some preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes NS3. In another preferred embodiment, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes an HCV nonstructural protein comprising NS4. In another preferred embodiment, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes an HCV nonstructural protein comprising NS5. In another preferred embodiment, the recombinant nucleic acid molecule comprises a nucleotide coding sequence encoding all combinations of HCV nonstructural proteins including NS3, NS4 and NS5.

In some preferred embodiments, the recombinant nucleic acid molecule comprises a nucleotide coding sequence that encodes an HCV nonstructural protein comprising a fragment of the HCV NS3, NS4, or NS5 protein, or a combination thereof. Fragments can be obtained from the corresponding nonstructural proteins at 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, But are not limited to, &lt; RTI ID = 0.0 &gt; 1000 &lt; / RTI &gt; amino acids. In addition, the fragment may comprise a carboxy terminal, amino terminal portion, or a portion in between, of the protein. One skilled in the art can fully prepare a fusion protein comprising an immunogenic fragment of an HCV nonstructural protein or an immunogenic fragment of any combination of nonstructural proteins. Thus, a recombinant nucleic acid molecule comprising a nucleotide coding sequence that encodes an HCV nonstructural protein may comprise less than the entire HCV nonstructural gene product without significant changes in the efficacy of the vaccine. One or more nucleotides may be substituted for the nucleotide coding sequence without affecting the amino acid sequence of the protein. Also, multiple substitutions and one or more conservative amino acid substitutions can be made throughout the protein without a significant reduction in the immunogen activity of the HCV nonstructural protein.

In some embodiments of the invention, the recombinant nucleic acid molecule comprises the last 9 nucleotides of HCV 5'UTR, the last 25 nucleotides of HCV 5'UTR, the last 50 nucleotides of HCV 5'UTR, the last 75 nucleotides of HCV 5'UTR Nucleotides, the last 100 nucleotides of HCV 5'UTR, the last 150 nucleotides of HCV 5'UTR, the last 200 nucleotides of HCV 5'UTR, the last 250 nucleotides of HCV 5'UTR or the last 300 nucleotides of HCV 5'UTR Lt; RTI ID = 0.0 &gt; 5'UTR &lt; / RTI &gt; comprising nucleotides. In some preferred embodiments, the gene construct comprises the entire HCV 5'UTR. In some preferred embodiments, the gene construct comprises nine 3 'nucleotides of HCV 5'UTR. Total HCV 5'UTR in a preferred embodiment is a GCCAGCCCCCGATTGGGGGCGACACTCCACCATAGATC ACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC (SEQ ID NO: 2).

Regulatory factors necessary for gene expression of DNA molecules include promoters, initiation codons, termination codons, and polyadenylation signals. In addition, enhancers may be required for gene expression. These factors should be operably linked to a sequence encoding an HCV nonstructural protein, and the regulatory factor should be operable in the individual to be administered. The initiation codon and termination codon are generally considered to be part of the nucleotide sequence encoding the HCV nonstructural protein.

The promoter and polyadenylation signal used should be functional within the individual's cells. In order to maximize protein production, a regulatory sequence suitable for gene expression within the cell to which the construct is to be administered should be selected. In addition, codons that can be most efficiently transcribed within the cell should be selected. Those skilled in the art will be able to prepare DNA constructs that function in mammals, preferably human cells.

Promoters useful in the practice of the invention, particularly in the production of human gene vaccines, include but are not limited to simian virus 40 (SV40), mouse mammary tumor virus (MMTV) promoter, human immunodeficiency virus (HIV) Such as the HIV termination repeat (LTR) promoter, Moloney virus, ALV, cytomegalovirus (CMV) such as the CMV early promoter, Epstein Barr virus (EBV), Rous sarcoma virus (RSV) Examples of such promoters include human myosin, human hemoglobin, human muscle creatine, and human metallothionein.

Examples of polyadenylation signals useful in the practice of the present invention, particularly in the production of human gene vaccines, include, but are not limited to, SV40 polyadenylation signals and LTR polyadenylation signals. In particular, the SV40 polyadenylation signal used an SV40 polyadenylation signal present in the pCEP4 plasmid (Invitrogen, San Diego, CA).

In addition to the regulatory elements required for gene expression, other factors may be involved in the gene construct. These additional parameters include enhancers. Enhancers may be selected from the group including, but not limited to, human actin, human myosin, human hemoglobin, human muscle creatine and virus enhancers derived from CMV, RSV and EBV.

It is possible to provide the cloning start point of the mammal to the gene construct in order to maintain the gene construct outside the chromosome and produce multiple copies of the construct within the cell. Plasmids pCEP4 and pREP4 purchased from Invitrogen contain the nucleotide antigene EBNA-1 coding region which does not enter Epstein Barr virus cloning start point and chromosome but replicates episomes of high copy number.

But are not limited to, intramuscular, intraperitoneal, intradermal, subcutaneous, intravenous, intraarterial, intravaginal and oral and transdermal, or inhalation or suppository administration. Preferred routes of administration are intramuscular, intraperitoneal, intradermal and subcutaneous injection. Delivery of the gene construct encoding the HCV nonstructural protein provides mucosal immunity to the individual to which the construct is to be immunized with a dosing regimen presented to the mucosal immune related tissue. Thus, in some instances, gene constructs are delivered by intratracheal instillation of the individual.

The gene constructs may be administered in a manner that includes, but is not limited to, conventional injections, needless injection devices, or " microinjection shock gene injectors ". Alternatively, gene vaccines can be introduced into cells separated from the individual in various ways. These methods include, for example, ex vivo transfection, electroporation, microinjection and microinjection shock methods. After the gene construct is introduced into the cell, it is transplanted into the individual. Even though the vaccine-administered cells originally originated from other individuals, non-immunogenic cells into which the gene construct was introduced can be transplanted into the subject.

In some embodiments of the invention, gene constructs are administered to a subject using a needleless injection device. In some embodiments of the present invention, gene constructs are administered concurrently, intradermally, subcutaneously, and intramuscularly, using a needle-free injection device. The needle-free injection device is well known and widely available. One skilled in the art can use a needle-free injection device to deliver genetic material to a cell of a subject according to the instructions herein. The needleless injection device is suitable for delivering the genetic material to all tissues. It is particularly useful for delivering genetic material to skin and muscle cells. In some embodiments, a needleless injection device is useful for injecting a liquid comprising DNA molecules onto the skin surface of an individual. Liquids are injected at a sufficient rate to pass through the skin surface when in contact with the skin and penetrate into the skin and subcutaneous muscle tissue. Thus, the genetic material is co-administered intradermally, subcutaneously and intramuscularly. In some embodiments, the needle-free injection device can be used to deliver genetic material to the tissue of the organ in order to introduce nucleic acid molecules into cells of other organs.

The gene vaccine of the present invention comprises from about 1 nanogram to about 1000 micrograms of nucleic acid, preferably DNA. In some preferred embodiments, the vaccine comprises from about 10 nanograms to about 800 micrograms of nucleic acid. In some preferred embodiments, the vaccine comprises about 0.1 to about 500 micrograms of nucleic acid. In some preferred embodiments, the vaccine comprises about 1 to about 350 micrograms of nucleic acid. In some preferred embodiments, the vaccine comprises about 25 to about 250 micrograms of nucleic acid. In some preferred embodiments, the vaccine comprises about 100 micrograms of nucleic acid. A person of ordinary skill in the art can readily prepare a vaccine containing the desired amount of nucleic acid.

The gene vaccine of the present invention is formulated according to the dosage form to be used. Those skilled in the art can readily formulate pharmaceutical compositions comprising gene constructs. The pharmaceutical composition of the present invention comprises a single gene construct encoding NS3, NS4 or NS5 or a combination thereof. Alternatively, the pharmaceutical composition of the present invention comprises a plurality of gene constructs encoding NS3, NS4 or NS5 or a combination thereof. In addition, the pharmaceutical compositions of the present invention comprise single or multiple gene constructs encoding NS3, NS4 or NS5 fragments or combinations thereof. In addition, the pharmaceutical composition of the present invention comprises a single gene construct encoding a fusion protein of whole or a fragment of a NS3, NS4 or NS5 protein. In some cases, isotonic agents are used. In general, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol and lactose. Sometimes isotonic solutions such as phosphate buffered saline are preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstrictor is added to the formulation. The pharmaceutical preparation of the present invention is provided in a sterilized state and a non-pyrogenic state.

The gene construct of the present invention may be formulated or administered with a substance that increases the acceptance and / or expression of the gene construct by the cell, when used, rather than when the same gene vaccine is used . The above materials administered with gene constructs and methods of administration thereof are disclosed in U.S. Patent Nos. 5,830,876, 5,593,972, 5,739,118, and PCT Patent Application No. PCT / US94 / 00899 filed on Jan. 16, 1994. Such agents include but are not limited to CaPO ₄ , DEAE dextran, anionic lipids, extracellular matrix-active enzymes, saponins, lectins, estrogen compounds and steroid hormones, hydroxylated lower alkyl, dimethylsulfoxide (DMSO), urea and benzoic ester anilide, Amidines, urethanes and their hydrochlorides, such as the hydrochloride of a local anesthetic. The gene constructs are also encapsulated and administered together in a lipid / polyvalent cation complex. A preferred promoter is a bulk biocaine. The compositions may conveniently be presented in unit dosage form and may be prepared by methods known in the art, for example, as described in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, Pa., 1980).

In the examples presented below, DNA-based vaccination with plasmids encoding three different nonstructural proteins of HCV results in a strong antigen-specific immune response in both immune systems. After three immunizations, a detectable antibody response occurred in all animals. In this regard, these nonstructural proteins are far superior to previous studies using HCV core structural proteins [Tokushige, et al., Hepatology, 1996, 24, 14-20; And Geissler, et al., J. Immunol., 1997, 158, 1231-1237]. In a preferred embodiment, the humoral immune response to nonstructural proteins can be elevated by the addition of cytokine expression plasmids such as IL-2 and GM-CSF, which activate antigen presenting cells [Geissler, et al., J. Immunol., 1997, 158, 1231-1237; And Xiang, Immunity, 1995, 2, 129-135). Three plasmids encoding NS3, NS4 and NS5 all proven to induce CD4 + T-cell inflammatory responses of the dominant T _H 1 phenotype. In addition, strong specific CD8 + CTL responses have been specifically induced in NS3 and NS5 cases, which previously produced dissolution values that were found to induce defense against various pathogens in animal model systems [Tascon, et al., Na. Med., 1996, 2, 888-892; And Huygen, et al., Nat. Med., 1996, 2, 893-898]. We also investigated whether the CTL response induced by the DNA-based mutation defended tumorigenesis in animals using winter-specific SP2 / 0 tumor cells stably transfected with the cDNA encoding the NS5 protein. Tumor formation was prevented in about 60% of mice, indicating that this immunization treatment induced a high level of CTL activity in vivo. In addition, the tumor weight of the tumor-bearing animal was significantly reduced compared to immunized with the simulated DNA or recombinant NS5 protein. This model also demonstrates that inhibition of tumor growth can measure high levels of cellular immune response to Flavivirus nonstructural proteins in animal models where measured.

The results disclosed herein demonstrate that DNA-based immunization using gene constructs encoding HCV nonstructural proteins as described herein is useful for the treatment of HCV-bearing individuals and for HCV-preventive vaccines.

Further, in order to demonstrate the present invention, the present invention will be illustrated by the following examples. These embodiments are not intended to be construed as limiting the scope of the disclosure.

Example 1: Design and production of HCV expression vector

The initiation and termination codons were introduced into the expression plasmid (pApO31) induced by the CMV-promoter and the RSV enhancer to clone a gene encoding each non-structural protein. In addition, an SP2 / 0 cell line (FIG. 1A) was prepared that was stably transfected using an expression vector (pcDNA3) containing a selection marker.

As a viral gene source, a plasmid named pBRTM / HCV1 containing the full-length ORF of HCV was used to clone the expression vector of the present invention [Grakoui, et al., J. Virol., 1993, 67, 1385-1395 ]. Alternatively, the nucleotide sequence encoding HCV can be obtained from Genbank Accession Nos. X61596 and D16435. The inserts pApO31-NS3, pApO31-NS4 and pApO31-NS5 were PCR cloned after the initiation and termination codons and restriction sites using the following primers were inserted: NS3: 5'-GGTCTAGATTGATGGCGC CCATCACGGC-3 '(XbaI) (SEQ ID NO: 3), 5'-CACACGCGTTCACGTGACGACCTCCAGGT-3' (Mlu I) (SEQ ID NO: 5), 5'-CCAGGATCCTC AGCATGGAGTGGTACA-3- (BamHI) (SEQ ID NO: 6) and NS5 in the case of NS5: 5'-TCAGTCTAGAATGTCCGGCTCCG GCTCCTGGCTAAGGGA- ) (SEQ ID NO: 8). After PCR amplification using a high-confidence PCR system (Boehringer Mannheim, Indianapolis, IN), the cDNA fragment was inserted into a plasmid expression vector pApO3 (Apollon, Malvern, PA) containing the RSV enhancer factor and induced by the CMV promoter . The constructs were cultured in DH5α and the plasmid DNA was purified using Qiagen Giga Kit (Santa Clara, Calif.) Using 2 × cesium chloride centrifugation or an endorphin buffer system. Non-structural gene inserts were identified by sequencing using standard methods.

In order to establish stable NS3, NS4 and NS5 expressing cell lines as target cells of CTL-analysis, nonstructural protein coding gene segments were cloned into pcDNA3 and pcDNA3.1 / Zeo (-) expression vectors (Invitrogen, San Diego ). First, XbaI and MluI fragments of NS3 and NS5 were subcloned into the NheI / MluI site of Litmus-38 vector (New England Biolabs, Mass.) And digested with EcoRI and SalI to obtain EcoRI of pcDNA3 and pcDNA3.1 / Zeo / XhoI &lt; / RTI &gt; multiple cloning site. The XbaI and BamHI fragments containing NS4 were re-ligated into Litmus-20 (New England Biolabs), digested with KpnI and EcoRI, and subsequently ligated into the pcDNA3 vector. The plasmids were named pcDNA3-NS3, pcDNA3-NS4 and pcDNA3.1 / Zeo (1) -NS5.

Those skilled in the art having a DNA sequence coding for an HCV nonstructural protein can devise a primer for preparing the gene construct of the present invention. Also, nucleotide base substitution can be made so as not to affect the binding of the primer. Also, as is known to those skilled in the art, primers can be prepared using endonuclease restriction sites for cloning and ligation. Thus, one skilled in the art can design all primers and perform PCR amplification to produce all the gene constructs of the present invention. The PCR product can be ligated to an expression vector.

Plasmids comprising the nucleotide coding sequence of the HCV nonstructural protein described above each comprise a nucleotide coding region of the HCV nonstructural protein located under the transcriptional control of the CMV promoter and the RSV enhancer factor, respectively.

Example 2: In vitro expression

The nucleotide sequences of the plasmid constructs were analyzed, and protein expression was confirmed in vitro in HuH-7 cells after transient transfection and in SP2 / 0 target cells after stable transfection. A protein band of about 70 kD for NS3, about 30 kD for NS4, and 125 kD for NS5 was expressed in the cells but not in the culture medium (Fig. 1B).

HuH-7 human liver cancer cell lines were transiently transfected with various structures using the calcium phosphate method to measure the expression level of HCV nonstructural proteins. Briefly, the cell lysate was prepared in modified RIPA buffer (0.15 M NaCl, 1% NP-40, 50 mM Tris, 0.5% DOC and 1% SDS) after metabolic labeling with ³⁵ S-methionine and cysteine for 4 hours . Cell lysates were pretreated with horse serum and allowed to bind Sepharose A by preincubation overnight with polyclonal antiserum WU 110 (NS3), W 148/151 (NS4) and WU 115 (NS5) [Grakoui, et al. , J. Virol., 1993, 67, 1385-1395]. Proteins were separated by SDS-PAGE, and the gel was dried and irradiated. NS5 protein expression was also confirmed by Western blot and immunofluorescence analysis using a mouse mAb (Biogenesis, Sandown, NH). To obtain a stably transfected cell line expressing NS3, NS4 and NS5, homologous BALB / c mouse myeloma derived cell line SP2 / 0 was isolated by electroporation with pcDNA3 plasmid containing the desired viral gene insert Transfected Cells growing under G418 selection conditions were cloned by limiting dilution (0.3 cells / well) and screened by the method described above.

The pcD3 and pcD3.1 plasmids, respectively containing neomycin or zeomycin resistance genes, were used for cloning of non-structural HCV genes and production of stable homologous target cell lines. Temporarily the HuH-7 cells by transfection of these structures and beta-after-galactosidase assay was adjusted to the transfection efficiency, cells were methionine and cysteine-free medium in 30 minutes malnutrition ³⁵ S- methionine and Cysteine for 4 hours. The cell lysate was immunoprecipitated with polyclonal rabbit serum specific for nonstructural proteins and separated into Sepharose A beads, analyzed by SDS-PAGE, and radiographically taken. Lanes 1, 3, and 5 are cells transfected with mock DNA and negative control (Mock). Lanes 2, 4, and 6 show specific bands of about 70 kD for NS3, about 30 kD for NS4, and 125 kD for NS5. (Lanes 7-10): SP2 / 0 cells were transfected with a pcD3-based construct containing the genes for NS3, NS4 and NS5. After screening with antibiotics, the cells were cloned by limiting dilution (0.3 cells / well) and cultured and then analyzed by radioactivity labeling and immunoprecipitation for NS3 or Western blot for NS5 as described above. Lanes 7 and 9 represent cell lysates of cells stably expressing the HCV-core protein as negative control (SP2-19), and lanes 8 and 10 represent specific expression of NS3 and NS5. These cells were used as target cells for in vitro stimulation and CTL assays.

Example 3: Immunization method

Female BALB / c (h-2d) mice were housed under standard non-pathogenic conditions at the animal facility of Massachusetts General Hospital. Mice were purchased from Charles River Laboratories (Wilmington, MA) and 20-week old mice were used for in vivo studies. A total of 100 [mu] g of plasmid DNA in 100 [mu] l of 0.9% NaCl was injected into the femoral muscle of the mice twice and three times at 5 different sites. Booster injections were injected on the opposite leg every 14 days. Five micrograms of recombinant NS3, NS4 and NS5 nonstructural proteins (Mikrogen, Munich) in CFA as a positive control in all immunological experiments were intraperitoneally injected at day 0 and boosted with the same amount of protein in 0.05% SDS after 4 and 8 weeks Respectively. Plasmid vectors and recombinant hepatitis B surface antigens (HbsAg) (Energix, Smith Kline Beecham, Philadelphia), which were not inserted as negative control, were used in this experiment. All mice were sacrificed 10 days after the last immunization.

Example 4: Measuring humoral immune response

The levels of anti-NS3, NS4 and NS5 antibodies were measured in the serum of each animal immunized using established ELISA methods. Briefly, a microtiter plate (Falcon, Micro-test IIIM Flexible Assay Plate) was coated (0.5 / / well) overnight at 4 째 C with the recombinant protein described above. After blocking with fetal bovine plasma (FBS) at 20 DEG C for 2 hours, a 1: 50 dilution of mouse serum was added to the plate and further incubated at 20 DEG C for 1 hour. After washing four times with phosphate buffered saline containing 0.05% Tween-20, horseradish peroxidase-labeled anti-mouse antibody (Amersham, Arlington Heights, IL) was diluted 1: 2000. After incubation for 1 hour, the plates were washed and chromogenic substrate was added and read with an automated reader.

After three immunizations, binding specific enzyme immunoreactivity (ELISA) was used to confirm the specific antibody response to the three nonstructural proteins in all immunized animals. (Fig. 2a). As a positive control, recombinant NS3, NS4 and NS5 nonstructural proteins were inoculated into the peritoneal cavity of mice three times by mixing with the complete adjuvant solution and, as expected, a strong humoral immune response was demonstrated (data not shown).

Figure 2a shows the humoral immune response to NS3, NS4 and NS5 produced by DNA-based immunization. Serum antibody levels were measured by ELISA (n = 5 in each group). Serum from mice coated with BSA and immunized with mock DNA was used as a control. Positive control mice were immunized with intraperitoneal administration of recombinant protein (data not shown). Figure 2b shows T-cell proliferation measured 3 days after in vitro stimulation with specific or non-specific recombinant protein. After incubation with H ³ -thymine for 18 hours, cells were harvested. The cpm was determined by subtracting the basal activity (for example, incubation without antigen). Incubation with 1 ug of recombinant NS3 protein was toxic and no proliferation was observed. Mice immunized with recombinant protein with CFA showed a 5-10 fold higher response (data not shown).

Example 5: Lymphoproliferation and cytokine secretion assay

Mice were anesthetized with isoflurane (Aerrane, Anaquest, NJ) and spleen cells were recovered. The red blood cells were removed by incubation in 0.83% NH ₄ Cl / 0.17 M Tris (pH 7.4) at 25 ° C for 5 minutes. Washed twice with 10% FBS, and spleen cells and 2-mercaptoethanol complete DMEM (Mediatech, Washington, DC) 5 × 10 5 years by one 96-well plate for each sample at a concentration of cells / well in 200 ㎕ containing Lt; / RTI &gt; Cells were stimulated with recombinant nonstructural proteins (NS3, NS4 and NS5) (Mikrogen, Munich) at different concentrations (0, 0.01 and 1 ug / ml). As a negative control, effector cells were stimulated with the same concentration of recombinant HCV-core or HbsAg protein (Energix). After stimulation for 3 days, ³ H-thymine (1 μCi / well) was added. The cells were further incubated for 18 hours and then recovered to quantify ³ H-thymine bound to the DNA. The binding of radioactivity by basal activity (? Cpm) was modified. To measure cytokine secretion, effector cells were cultured as described above and cultured in culture supernatants using a commercial kit (Endogen, Boston, Mass.) According to the manufacturer's instructions for IL-2, IL-4 and interferon- Respectively.

To investigate the cell-mediated immune response to nonstructural proteins, splenocytes were harvested and re-stimulated with recombinants or antigens expressed by stably transfected cell lines in vitro. Significant lymphocyte proliferation, as measured by [ ³ H] thymine binding, was induced by all nonstructural proteins at different antigen concentrations (Fig. 2b). As a method of generating maximum stimulation, the intraperitoneal immune treatment of the recombinant protein showed a 5- to 10-fold higher lymphocyte proliferation rate for the three proteins (data not shown). The results of cytokine measurement after DNA-based immunization demonstrate the classical T1 response to high levels of IFN-y (Fig. 2c) and IL-2 (Fig. 2d) secreted into cell culture fluids. On the other hand, IL-4 production was not confirmed after gene immunization using a gene encoding HCV nonstructural protein (Fig. 2E).

Figures 2c, 2d and 2e show cytokines secreted into supernatants measured in vitro and measured after 48 hours. All DNA constructs encoding NS3, NS4 and NS5 induced T _H 1 -type cytokine secretion forms. For comparison, mice were immunized intraperitoneally (n = 4) three times with recombinant protein. Mice were immunized with recombinant HbsAg as a negative control.

Example 6: Cytotoxic T-lymphocyte activity

Splenocytes from mice immunized in complete DMEM containing 10% FCS and 2-mercaptoethanol (5 x ^10-5 M) were suspended and cytotoxic activity was assayed after 5 days of in vitro stimulation. Recombinant murine IL-2 was added once at a concentration of 5 U / ml and irradiated (10,000 rad) of 2x10 ⁶ SP2 / 0 cells (SP2 / NS3-3) stably expressing full-length NS3 or NS5 protein a reaction cell (4 × 10 ⁷⁾ with, SP2 / NS5-21) was cultured. After 5 days, the cytotoxic effector lymphocyte group was recovered and subjected to a 4 hr ⁵¹ Cr-release assay on a 96 well plate using 4 hr ⁵¹ Cr-labeled Sp2 / NS3-3 or SP2 / NS5-21. The parent SP2 / 0 or SP2-19 expressing the HCV core protein was used as a control for the antigen specificity of the lytic and basal activities. CTL activity assays were performed with lymphocyte effector and target (E: T) ratios of 100: 1, 30: 1, 10: 1 and 3: Hybridoma supernatant GK 1.5 (anti-CD4, rat) containing anti-CD4 + or CD + 8 mAb; 3.155 (anti-CD8, rat) and effector cells were incubated for 30 min at 4 ° C, washed and incubated with complement (1: 5 dilution of low toxicity rabbit complement (Cedarlane Laboratories, Ontario, Canada) at 37 ° C) Cell depletion experiments.

The removal of the virus from the infected cell because the CTL response is essential, stable transfection is the dissolution of splenocytes ability of mice immunized for myeloma target cells of the SP2 / 0 mouse Winter expressing NS3 and NS5 protein, ⁵¹ Cr - release analysis. Mice immunized with NS3 and NS5 showed a strong specific cytotoxic T-cell response 5 days after in vitro stimulation, while a low activity was observed against SP2 / 0 or SP2-19 used as a control for target cell specificity (Figs. 3A and 3B). Splenocytes were incubated with monoclonal antibodies (mAbs) of CD8 + or CD4 + responses in the presence of complement to demonstrate the phenotype of cells showing specific lysis. Cytotoxic activity was mediated by CD8 + cells (Figure 3c). The present inventors could not establish the SP2 / 0 cell line stably expressing the NS4 protein, and thus could not measure the CTL activity against the HCV nonstructural protein.

Figure 3 shows cytotoxic T-cell (CTL) responses to NS3 (A) and NS5 (B) in different ratios of effector versus target cells. Irradiated mouse myeloma cells (n = 5), stably expressing NS3 and NS5, were incubated in vitro with spleen cells for 5 days. Then, the CTL activity was measured by a 4 hour Cr ⁵¹ release assay on the stably transfected target cell line. The baseline activity of SP2 / 0 or SP2-19 (HCV core expression) was subtracted to determine the cost value. Figure 3c shows the cells incubated with anti-CD8 + or anti-CD4 + mAb on ice for 30 minutes and incubated with complement for 30 minutes at 37 ° C in a T-cell depletion experiment. Control cells were incubated without anti-CD8 + or anti-CD4 + mAb. The basal activity was measured for SP2-19, an irrelevant negative control cell line stably transfected with the HCV core expression construct.

Example 7: Measurement of T-lymphocyte activity of intracellular cytotoxicity

Until now, no one was able to establish a stable cell line that expresses nonstructural proteins used for CTL activity, making CTL experiments very difficult. Mice were immunized three times with simulated DNA or pApNS5 vector into the muscle. Some animals were immunized intraperitoneally with recombinant NS5 or a combination of the two. NS5-4 (aa 2622-2868) and NS5-12 (aa 2007-2268) containing the HCV-NS5a and HCV-NS5b sites (about 50% of the total length of NS5) as recombinant proteins (in 5 ug intraperitoneal). A mixture of the E. coli expression protein (Mikrogen, Munich, Germany) was used. One week after the last immunization with various plasmid constructs or recombinant proteins, 2 x 10 ⁶ SP2 / 0-derived cells stably expressing NS5 were washed and suspended in 200 μl PBS and subcutaneously injected into the right flank. SP2 / 0 cells expressed HCV NS5 (SP / NS5-21) or HCV core protein SP2 / 19. In this animal model, tumor formation was measured 15 days after inoculation and the number of animals in which the tumor was formed and the tumor weight were measured.

Only 40% of mice treated with simulated DNA and treated with NS5-expressing mouse myeloma cell lines (SP2 / Ns5-21) formed tumors after 15 days. In addition, mice immunized with the mock DNA or recombinant NS5 protein, or those immunized with the same winterized SP2 / 0 cell line expressing another HCV structural protein (HCV core) as a control, Tumor size was small (Figures 4a and 4b). Indeed, 90-100% of the mice immunized with the simulated DNA or treated with SP2-19 cells showed tumor formation, demonstrating the specificity of CTL activity in this small animal tumor model. It is emphasized that immunization with recombinant NS5 protein in CFA does not prevent tumorigenesis in animals. To measure the concurrent effects of vaccine administration using DNA-based immunization and recombinant proteins, one group of animals was immunized with both. Tumorigenesis was partially prevented, but this method was not as effective as the three immunized animals with DNA encoding the NS5 protein (Fig. 4A).

Figure 4a shows the results obtained in a tumor model for measuring CTL activity. Mice were immunized intraperitoneally with pApNS5 or simulated DNA (100 [mu] g) intraperitoneally with intramuscular or recombinant NS5 protein (5 [mu] g). The last group received DNA-immunization and recombinant proteins at the same time. Tumors were treated with SP2NS5-21 or SP2-10 cells and after 15 days the number of mice in which the tumors were developed was counted and tumor weights were determined. FIG. 4b shows an animal immunized with the mock DNA from the left and treated with SP2 / NS5-21 cells, an animal immunized with pApNS5, treated with SP2-19 cells (stable expression of HCV core), and three immunized with recombinant NS5 protein And treated with SP2 / NS5-21 cells. The first, third and fourth animals, with the exception of the second immunized with pApNS5 and treated with a stable myeloma cell line expressing NS5, formed large tumors in the right flank.

Claims (34)

A recombinant nucleic acid molecule comprising a nucleotide sequence encoding a hepatitis C virus non-structural protein. 2. The recombinant nucleic acid molecule of claim 1, wherein the nonstructural protein is selected from the group consisting of NS3, NS4 and NS5. The recombinant nucleic acid molecule according to claim 1, wherein the nucleotide sequence encodes a fusion protein encoding NS3, NS4 or NS5 or a combination thereof. The recombinant nucleic acid molecule according to claim 1, wherein the nucleotide sequence encodes at least 50 amino acid fragments of a non-structural protein selected from the group consisting of NS3, NS4 and NS5. 3. The recombinant nucleic acid molecule of claim 2, wherein the nucleotide sequence is operably linked to a regulatory factor that functions in a human cell. 6. The recombinant nucleic acid molecule of claim 5, wherein said nucleotide sequence is operably linked to a promoter, enhancer, polyadenylation sequence and optionally a 5'UTR of hepatitis C virus. The recombinant nucleic acid molecule according to claim 6, wherein the promoter is a cytomegalovirus promoter and the enhancer is a raus sarcoma virus enhancer. A recombinant host cell comprising the nucleic acid molecule of claim 1. (a) the recombinant nucleic acid molecule of claim 1, wherein the nucleotide sequence is operably linked to a regulator functioning in a human cell; and (b) a pharmaceutically acceptable carrier or diluent &Lt; / RTI &gt; 10. The pharmaceutical composition according to claim 9, wherein the nucleotide sequence encodes a non-structural protein selected from the group consisting of NS3, NS4 and NS5. 10. The pharmaceutical composition according to claim 9, wherein the nucleotide sequence encodes a fusion protein encoding NS3, NS4 or NS5 or a combination thereof. 10. The pharmaceutical composition according to claim 9, wherein the nucleotide sequence encodes at least 50 amino acid fragments of a non-structural protein selected from the group consisting of NS3, NS4 and NS5. 11. A pharmaceutical composition according to claim 10, wherein said modulator functioning in a human cell comprises a promoter, an enhancer, a polyadenylation sequence and optionally a 5'UTR of hepatitis C virus. 14. The pharmaceutical composition according to claim 13, wherein the promoter is a cytomegalovirus promoter and the enhancer is a raus sarcoma virus enhancer. 10. The pharmaceutical composition of claim 9, further comprising an accelerator. 16. The pharmaceutical composition according to claim 15, wherein the promoter is bupivicaine. . 18. A method of treating an immune response against a hepatitis C virus in a human, comprising administering to the person not infected with the hepatitis C virus one or more recombinant nucleic acid molecules of claim 1 in an amount effective to induce an immune response to the hepatitis C virus Lt; / RTI &gt; 19. The method of claim 18, wherein the nonstructural protein is selected from the group consisting of NS3, NS4, and NS5. 19. The method of claim 18, wherein the nucleotide sequence encodes a fusion protein that encodes NS3, NS4, or NS5 or a combination thereof. 19. The method of claim 18, wherein the nucleotide sequence encodes at least 50 amino acid fragments of a non-structural protein selected from the group consisting of NS3, NS4 and NS5. 20. The method of claim 19, wherein the nucleotide sequence is operably linked to a regulatory factor that functions in a human cell. 23. The method of claim 22, wherein the nucleotide sequence is operably linked to a promoter, enhancer, polyadenylation sequence and optionally a 5'UTR of hepatitis C virus. 24. The method of claim 23, wherein the promoter is a cytomegalovirus promoter and the enhancer is a raus sarcoma virus enhancer. 19. The method of claim 18, wherein the immune response comprises a cellular response. 19. The method of claim 18, wherein the immune response comprises a humoral response. 19. The method of claim 18, wherein the recombinant nucleic acid molecule is present in a pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent. 28. The method of claim 27, wherein the pharmaceutical composition further comprises an accelerator. 29. The method of claim 28, wherein the promoter is a bulk biocide. 10. A method of immunizing a human, comprising administering to a person susceptible to hepatitis C virus infection an effective amount of the pharmaceutical composition of claim 9 to cause an immune response against hepatitis C virus. 31. The method of claim 30, wherein the human is administered to the site of administration of the pharmaceutical composition. A method of immunizing a human, comprising administering the recombinant nucleic acid molecule of claim 1 in an amount effective to cause an immune response in a human susceptible to hepatitis C virus. 11. A method of treating a person as described above, comprising administering to a person infected with hepatitis C virus a pharmaceutical composition of claim 9 in an amount effective to cause a therapeutic immune response to hepatitis C virus. 34. The method according to claim 33, wherein the human is administered to the administration site of the pharmaceutical composition.