KR19990022536A - Oligonucleotides having a phosphorothioate linker of high chiral purity - Google Patents
Oligonucleotides having a phosphorothioate linker of high chiral purity Download PDFInfo
- Publication number
- KR19990022536A KR19990022536A KR1019970709017A KR19970709017A KR19990022536A KR 19990022536 A KR19990022536 A KR 19990022536A KR 1019970709017 A KR1019970709017 A KR 1019970709017A KR 19970709017 A KR19970709017 A KR 19970709017A KR 19990022536 A KR19990022536 A KR 19990022536A
- Authority
- KR
- South Korea
- Prior art keywords
- oligonucleotides
- phosphorothioate
- oligonucleotide
- seq
- sequence
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Public Health (AREA)
- Plant Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 서열-특이적 포스포로티오에이트 올리고뉴클레오티드는 실질적으로 모두 Sp 이거나 실질적으로 모두 Rp인 포스포로티오에이트 당간 결합기 중의 하나에 의하여 연결된 뉴클레오시드 단위로 이루어진다. 실질적으로 순수한 키랄성 당간 결합기를 가지는 그러한 서열-특이적 포스포로티오에이트 올리고뉴클레오티드는 효소적 또는 화학적 합성에 의하여 제조될 수 있다.The present invention relates to a sequence-specific phosphorothioate oligonucleotide consisting of nucleoside units linked by one of the phosphorothioate bi-linking groups substantially all of Sp or substantially all Rp. Such sequence-specific phosphorothioate oligonucleotides having substantially pure chiral intergranular linking groups can be prepared by enzymatic or chemical synthesis.
Description
[관련된 출원에 관한 참조사항][References Related to Related Applications]
본 출원은 1991. 10.16자 출원된(현재 포기됨) 미국 특허출원 제07/777,007호의 계속출원인 1994. 8. 29자 출원된 미국특허출원 제08/297,703호의 일부 계속 출원이다. 본 출원은 또한 미국 특허출원 제07/777,007호의 일부 계속 출원인 1991. 10. 15자 출원된 미국 특허출원제07/777,670호호의 분할 출원인 1993. 5. 5자 미국 특허출원 제08/058,023호의 일부 계속 출원이다. 상기 언급된 출원은 각각 본 출원과 함께 양도되었으며 각각의 개시된 전체 내용은 본 명세서에 참고로 언급되어 있다.This application is a continuation-in-part of U.S. Patent Application Serial No. 08 / 297,703, filed on August 8, 1994, the continuation-in-part of U.S. Patent Application No. 07 / 777,007, filed October 10, 1991 (now abandoned). This application is also a continuation-in-part of U.S. Patent Application No. 07 / 777,007, filed Sep. 5, 1993, which is a continuation-in-part of U.S. Patent Application No. 07 / 777,670, Application. Each of the above-cited applications is assigned to the respective assignee of the present application, each of which is incorporated herein by reference in its entirety.
[발명의 분야][0001]
본 발명은 당간 결합기에 의하여 결합된 뉴클레오시드로 이루어진 서열-특이적 포스포로티오에이트 올리고뉴클레오티드 및 그 제조방법과 용도에 관한 것이다. 보다 구체적으로 본 발명의 올리고뉴클레오티드의 뉴클레오시드를 연결하는 당간 결합기는 실질적으로 순수하게 모두 Sp 또는 모두 Rp인 키랄 포스포로티오에이트 결합기인 포스포로티오에이트 결합기이다. 그러한 올리고뉴클레오티드는 화학적 또는 효소적 합성에 의하여 제조된다. 그것들은 특히 진단, 치료 및 연구시약으로서 적합하다.The present invention relates to a sequence-specific phosphorothioate oligonucleotide consisting of a nucleoside linked by a sugar bridge, and to a process for its preparation and use. More specifically, the intergranular linking group connecting the nucleosides of the oligonucleotide of the present invention is a phosphorothioate linking group which is substantially purely a chiral phosphorothioate linking group having both Sp or both Rp. Such oligonucleotides are prepared by chemical or enzymatic synthesis. They are particularly suitable as diagnostic, therapeutic and research reagents.
[발명의 배경]BACKGROUND OF THE INVENTION [
올리고뉴클레오티드는 단일-가닥 RNA 또는 단일-가닥 DNA에 혼성화하는 것으로 알려져 있다. 혼성화는 표적 RNA 또는 DNA의 염기와 올리고뉴클레오티드의 염기의 서열-특이적 염기쌍 수소 결합이다. 그러한 염기쌍은 서로에 대하여 상보적이라 한다.Oligonucleotides are known to hybridize to single-stranded RNA or single-stranded DNA. Hybridization is a sequence-specific base pair hydrogen bond of the base of the target RNA or DNA and the base of the oligonucleotide. Such base pairs are said to be complementary to each other.
상보적 헥산에 대한 올리고뉴클레오티드의 혼성화 정도를 결정함에 있어서 상보적 핵산에 결합하는 올리고뉴클레오티드의 상대적 성능은 특정 혼성화 복합체의 용융 온도를 결정함으로써 비교되어질 수 있다. 용융 온도(Tm), 이중 나선의 특징적 물리적 성질은 50%의 나선(혼성화된) 대 코일(혼성화되지 않은) 형태가 나타나는 온도를 나타낸다. Tm은 혼성화 복합체의 형성 및 붕괴(용융)를 결정하는 UV 스펙트럼을 사용함으로써 측정된다. 혼성화시 발생되는 염기 중첩은 UV 흡광도의 감소(hypochromicity)와 동시에 일어난다. 결국 UV 흡광도의 감소는 더 높은 Tm을 나타낸다. Tm이 더 높을수록 가닥사이의 결합강도는 더 커진다.In determining the degree of hybridization of an oligonucleotide to complementary hexane, the relative performance of the oligonucleotide binding to the complementary nucleic acid can be compared by determining the melting temperature of the particular hybridization complex. The melting temperature (T m ), the characteristic physical properties of the double helix, represents the temperature at which a spiral (hybridized) to coil (unhybridized) form of 50% occurs. The T m is determined by using the UV spectrum to determine the formation and collapse (melting) of the hybridization complex. The base overlap that occurs during hybridization occurs simultaneously with the hypochromicity of the UV absorbance. Eventually, the decrease in UV absorbance indicates a higher T m . The higher the T m , the greater the bond strength between the strands.
올리고뉴클레오티드는 세포내 효소 RNase H를 사용함으로써 표적 RNA의 효소적 분해를 효과적이게 하는 데 사용될 수 있다. 그러한 RNase H 분해 메카니즘은 2'-디옥시리보푸란노실 올리고뉴클레오티드가 표적 RNA에 혼성화하는 것을 필요로 한다. 그 결과 형성된 DNA-RNA 이중구조는 RNase H 효소를 활성화시키고 활성화된 효소는 RNA 가닥을 분해시킨다. RNA 가닥의 분해는 표적 RNA의 정상적인 기능을 파괴시킨다. 포스포로티오에이트 올리고뉴클레오티드는 이런 형태의 메카니즘에 의하여 작동한다. 그러나 RNase H의 세포 활성화에 유용한 DNA 올리고뉴클레오티드에 대하여, 그 올리고뉴클레오티드는 RNase H 활성화에 충분한 시간동안 세포에서 살아남기 위하여 뉴클레아제에 상당히 안정적임에 틀림없다. 연구시약으로서 올리고뉴클레오티드의 용도와 같은 비-세포적 용도에 대해서 그러한 뉴클레아제 안정성은 꼭 필요한 것은 아니다. Walder et al.의 몇몇 간행물들은 RNase H 및 올리고뉴클레오티드의 상호 작용에 대하여 기재하고 있다. 그것들 중 특히 관심을 모으는 것은 (1) Dagle et al., Nucleic Acids Research 1990, 18, 4751; (2) Dagle et al., Antisense Research And Development 1991, 1, 11; (3) Eder et al., J. Biol, Chem. 1991, 266, 6472; 및 (4) Dagle et al., Nucleic Acids Research 1991, 19, 1805가 있다. 이들 간행물에 따르면 수직되지 아니한 포스포디에스테르 뉴클레오드시간 결합기 및 수식된 포스포로티오에이트 뉴클레오시드간 결합기를 모두 가지는 DNA 올리고뉴클레오티드는 세포내 RNase H에 대한 기질이 된다. 그것들은 기질이기 때문에 RNase H에 의한 표적 RNA의 분해를 활성화시킨다. 그러나 저자들은 포스포디에스테르 결합기와 포스포로티오에이트 결합기 모두가 Xenopus 배(embryos)에서 엑소뉴클레아제 분열에 민감하다는 사실을 더 주지시키고 있다. 그러한 뉴클레아제 분열은 RNase H 활성에 사용될 수 있는 올리고뉴클레오티드를 빠르게 고갈시키기 때문에 유해하다.Oligonucleotides can be used to make the enzymatic degradation of target RNA effective by using the intracellular enzyme RNase H. Such an RNase H degradation mechanism requires that 2 ' -dioxyribofuranosyl oligonucleotides hybridize to the target RNA. The resulting DNA-RNA duplex activates the RNase H enzyme and the activated enzyme degrades the RNA strand. Decomposition of the RNA strand destroys the normal function of the target RNA. Phosphorothioate oligonucleotides work by this type of mechanism. However, for DNA oligonucleotides useful for cellular activation of RNase H, their oligonucleotides must be fairly stable to nuclease to survive in the cells for a sufficient time to activate RNase H. Such nuclease stability is not necessary for non-cellular applications such as the use of oligonucleotides as research reagents. Several publications from Walder et al. Describe the interaction of RNase H and oligonucleotides. Of particular interest are (1) Dagle et al., Nucleic Acids Research 1990, 18, 4751; (2) Dagle et al., Antisense Research And Development 1991, 1, 11; (3) Eder et al., J. Biol. Chem. 1991, 266, 6472; And (4) Dagle et al., Nucleic Acids Research 1991, 19, 1805. According to these publications, DNA oligonucleotides having both a non-orthogonal phosphodiester nucleotide time coupler and a modified phosphorothioate nucleoside linker become substrates for intracellular RNase H. Because they are substrates, they activate the degradation of target RNA by RNase H. However, we are more aware that both the phosphodiester linker and the phosphorothioate linker are sensitive to exonucleolytic cleavage in the Xenopus embryos. Such nuclease cleavage is detrimental because it quickly depletes oligonucleotides that can be used for RNase H activity.
상기 참고자료 (1), (2) 및 (4)에 기재된 바와 같이, 뉴클레아제 분열에 대항하는 올리고뉴클레오티드를 안정화시키는 반면에 RNase H 활성화를 제공하기 위하여 포스포르아미데이트, 알킬 포스포네이트 또는 포스포트리에스테르 부분 사이에 위치한 짧은 부분의 포스포디에스테르 연결된 뉴클레오티드를 포함하는 2'-디옥시 올리고뉴클레오티드가 제조되었다. 포스포르아미데이트-함유 올리고뉴클레오티드가 엑소뉴클레아제에 대하여 안정된 반면에 각각의 포스포르아미데이트 결합기는 포스포르아미데이트 함유 올리고뉴클레오티드의 측정된 Tm수치에서 1.6℃의 손실이 있었다고 상기 참고자료(4)에 기재되어 있다. 그러한 Tm수치의 감소는 올리고뉴클레오티드 및 그것의 표적 핵산 가닥사이에 혼성화의 감소를 나타낸다.As described in the above reference materials (1), (2) and (4), phosphoramidate, alkylphosphonate or phosphonamidate is used to stabilize oligonucleotides against nuclease cleavage, while providing RNase H activation. A 2 ' -deoxyoligonucleotide containing a phosphodiester linked short nucleotide located between the phosphotriester moieties was prepared. While the phosphoramidate-containing oligonucleotide was stable to the exonuclease, each phosphoramidate linker had a loss of 1.6 ° C at the measured T m value of the phosphoramidate-containing oligonucleotide, 4). Such a decrease in T m value indicates a decrease in hybridization between the oligonucleotide and its target nucleic acid strand.
진단, 연구시약 및 치료제로서의 올리고뉴클레오티드의 적용은 올리고뉴클레오티드가 세포막을 통하여 수송되거나 세포에 의하여 포착되어 표적 RNA 또는 DNA에 적당히 혼성화된 후 핵산 기능을 종료시키거나 파괴시키는 것이 필요하다. 이러한 결정적 기능은 부분적으로 뉴클레아제 분열에 대한 올리고뉴클레오티드의 초기 안정성에 부분적으로 의존한다. 더욱이 이들 기능들은 표적 RNA 또는 DNA 분자에 대한 올리고뉴클레오티드의 특이성에 의존한다.The application of oligonucleotides as diagnostics, research reagents and therapeutic agents requires that oligonucleotides be transported through cell membranes or captured by cells to hybridize appropriately to target RNA or DNA followed by termination or destruction of nucleic acid function. This critical function is partly dependent in part on the initial stability of the oligonucleotides to nuclease cleavage. Moreover, these functions depend on the specificity of the oligonucleotide for the target RNA or DNA molecule.
이들 목적에 대한 올리고뉴클레오티드의 심각한 결핍성은 세포내에 그리고 세포외에 위치할 수 있는 다양하게 산재하여 있는 뉴클레아제에 의한 효소적 분해에 대한 민감성이다. 수식되지 아니한 야생형(wild type) 올리고뉴클레오티드는 뉴클레아제에 의해 쉽게 분해되기 때문에 치료제로서 유용하지 못하다. 그러므로 그것들에 뉴클레아제 내성을 부여하기 위한 올리고뉴클레오티드의 수식은 올리고뉴클레오티드 치료 및 진단의 개발 지향적인 연구중에서 1차적인 관심사가 되어 왔다.The severe deficiency of oligonucleotides for these purposes is susceptibility to enzymatic degradation by nuclease, which is widely distributed, which can be located both intracellularly and extracellularly. Unmodified wild-type oligonucleotides are not useful as therapeutic agents because they are easily degraded by nuclease. Therefore, the modification of oligonucleotides to impart nuclease resistance to them has been of primary concern in the development of oligonucleotide therapy and diagnosis.
뉴클레아제 내성을 향상시키기 위한 올리고뉴클레오티드의 수식은 일반적으로 당-인산 골격 특히 인산 원자에서 일어난다. 포스포로티오에이트는 뉴클레아제에 대한 내성을 나타낸다고 알려져 있다. 또한 포스포로티오에이트 올리고뉴클레오티드는 일반적으로 천연의 포스포디에스테르 올리고뉴클레오티드보다 화학적으로 더 안정하다. 포스포로티오에이트 올리고뉴클레오티드는 또한 수용성 매질(media)에서 용해성을 나타낸다. 더욱이 포스포로티오에이트 올리고뉴클레오티드-RNA 헤테로듀플렉스는 내인성 RNase H에 대한 기질로서 제공될 수 있다. 또한 포스포로티오에이트 올리고뉴클레오티드는 높은 열역학적 안정성을 나타낸다. 그러나 높은 충실도로 표적 RNA 또는 DNA에 결합하는 올리고뉴클레오티드의 성능이 표적 RNA 또는 DNA에 결합하는 올리고뉴클레오티드의 성능이 표적 RNA 또는 DNA에 대한 혼성화에 중요하기는 하지만 올리고뉴클레오티드의 인 원자에서의 수식은 다양한 정도의 뉴클레아제 내성을 나타내는 반면에 일반적으로 더 열등한 혼성화 특성을 나타내게 된다. [Cohen, J.S., Ed., oligonucleotides: Antisense Inhibitors of Gene Expression CRC Press, Inc., Boca Raton, FL, 1989].Modifications of oligonucleotides to enhance nuclease resistance generally occur at the sugar-phosphate backbone, especially at the phosphate atom. Phosphorothioate is known to exhibit resistance to nuclease. Phosphorothioate oligonucleotides are also generally chemically more stable than natural phosphodiester oligonucleotides. Phosphorothioate oligonucleotides also exhibit solubility in aqueous media. Furthermore, phosphorothioate oligonucleotide-RNA heteroduplexes can be provided as substrates for endogenous RNase H. Phosphorothioate oligonucleotides also exhibit high thermodynamic stability. However, although the performance of oligonucleotides binding to target RNA or DNA with high fidelity is important for hybridization to target RNA or DNA, the ability of oligonucleotides to bind to target RNA or DNA is important, , While exhibiting generally less inferior hybridization characteristics. [Cohen, J. S., Ed., Oligonucleotides: Antisense Inhibitors of Gene Expression CRC Press, Inc., Boca Raton, FL, 1989].
이 열등한 혼성화의 한가지 이유는 인 원자의 친키랄(prochiral) 성질이 될 수 있다. 수식된 인 올리고뉴클레오티드의 내부 인 원자에서 수식이 일어나면 Rp 및 Sp 광학이성질체가 되게 된다.One reason for this inferior hybridization may be the prochiral nature of the phosphorus atom. When an atom is internally modified in the modified phosphorylated nucleotide, it becomes an Rp and Sp optical isomer.
결과적으로 분자가 비대칭적인 치환체를 가지는 상기에서와 같이 얻어진 수식된 인 올리고뉴클레오티드는 2n의 이성체를 가지는 라세미 혼합물이 될 수 있고 n은 올리고뉴클레오티드의 포스포로티오에이트 당간 결합기 수와 동일하다. 이와 같이 14 비대칭 중심(center)을 가지는 15-mer 포스포로티오에이트 올리고뉴클레오티드는 214즉 16,384의 디아스테레오머(diasteromer)를 가진다. 이런 관점에서 라세미 혼합물내의 단지 작은 백분율의 올리고뉴클레오티드가 충분한 친화성으로 표적 mRNA 또는 DNA에 특이적으로 혼성화되는 것 같다.As a result, the modified phosphorylated oligonucleotide obtained as above with the molecule having an asymmetric substituent can be a racemic mixture having an isomer of 2 n and n is equal to the number of phosphorothioate inter-bond groups of the oligonucleotide. Thus, a 15-mer phosphorothioate oligonucleotide having a 14 asymmetric center has a diasteromer of 2 14 or 16,384. In this respect only a small percentage of oligonucleotides in the racemic mixture appear to hybridize specifically to the target mRNA or DNA with sufficient affinity.
그 동안은 순수한 키랄 당간 결합기를 가지는 화학적으로 합성된 포스포로티오에이트 올리고뉴클레오티드는 단지 하나 또는 두 개의 디아스테레오머 당간 결합기를 가지는 분자에 한정되어 있다. 최근에는 서열-특이적 포스포로티오에이트 올리고뉴클레오티드의 화학적으로 합성된 라세미 혼합물의 유도된 키랄성의 영향은 순수한 키랄 당간 결합기를 가지는 올리고뉴클레오티드의 합성이 자동적 합성에 의해서 이루어지지 못하였기 때문에 평가되지 못하였었다. 이것은 자동적으로 합성되는 동안 황의 비-입체특이적 통합 때문이었다. 예를 들어 Stec et al., J. Chromatography, 326:263 (1985)는 라세미 당간 결합기를 가지는 일정 올리고뉴클레오티드 포스포로티오에이트를 합성하였으나 하나 또는 대부분 두 개의 디아스테레오머성 인 당간 결합기를 가지는 일정의 작은 올리고머의 디아스테레오머만을 분석할 수 있었다.In the meantime, chemically synthesized phosphorothioate oligonucleotides having a pure chiral interchain linker are limited to molecules having only one or two diastereomeric linkages. In recent years, the effect of the induced chirality of a chemically synthesized racemic mixture of sequence-specific phosphorothioate oligonucleotides has not been assessed because the synthesis of oligonucleotides with pure chiral inter-bond linkages has not been achieved by automatic synthesis . This was due to the non-stereospecific incorporation of sulfur during the automatic synthesis. For example, Stec et al., J. Chromatography, 326: 263 (1985) synthesized a constant oligonucleotide phosphorothioate with a linker group of racemic sugar, but did not produce a constant oligonucleotide phosphorothioate with one diastereomeric di- Only diastereomers of small oligomers could be analyzed.
그러나 Stec et al., [Nucleic Acids Res, 19:5883(1991)]은 올리고뉴클레오티드의 자동화된 입체조절 합성을 발표하였다. 상기 언급된 참고자료에 기재된 절차는 5가 포스포로티올 중심에서 염기-촉매된 친핵성 치환을 이용한다.However, Stec et al., [Nucleic Acids Res, 19: 5883 (1991)] disclosed an automated stereoselective synthesis of oligonucleotides. The procedures described in the above-referenced reference materials use base-catalyzed nucleophilic substitution at the pentagonal phosphorothiol centers.
효소적 방법을 이용한 모두 Rp 당간 결합기를 가지는 포스포로티오에이트의 합성법은 몇몇 과학자에 의하여 개발되었다 [Burgers and Eckstein, J. Biological Chemistry, 254:6889 (1979); Gupta et al., J. Biol. Chem. 256:7689(1982): Brody and Frey, Biochemistry, 20:1245 (1981); 및 Eckstein and Jovin, Biochemistry, 2:4546 (1983)]. Brody et al. [Biochemistry, 21:2570(1982)] 및 Romaniuk and Eckstein, [J. Biol. Chem, 257:7684(1982)]는 폴리 TpA 및 폴리 ApT 포스포로티오에이트를 효소적으로 합성한 반면 Burgers and Eckstein [Proc. Natl. Acad. Sci. U.S.A., 75:4798 (1978)]은 천연 포스포디에스테르 결합에 의하여 세 개의 디아스테레오머성 RpGpC 포스포로티오에이트 다이머를 헥사머에 연결하였다.The synthesis of phosphorothioates with an all-Rp inter-bond group using an enzymatic method has been developed by several scientists [Burgers and Eckstein, J. Biological Chemistry, 254: 6889 (1979); Gupta et al., J. Biol. Chem. 256: 7689 (1982): Brody and Frey, Biochemistry, 20: 1245 (1981); And Eckstein and Jovin, Biochemistry, 2: 4546 (1983)]. Brody et al. [Biochemistry, 21: 2570 (1982)] and Romaniuk and Eckstein, [J. Biol. Chem., 257: 7684 (1982)) enzymatically synthesized poly TpA and polyAt Phosphorothioate, while Burgers and Eckstein [Proc. Natl. Acad. Sci. U.S.A., 75: 4798 (1978)) linked three diastereomeric RpGpC phosphorothioate dimers to hexamers by natural phosphodiester linkages.
상보적 핵산에 결합하는 올리고뉴클레오티드의 상대적 능력은 특정 혼성 복합체의 용융 온도를 결정함으로써 비교될 수 있다. 용융 온도(Tm)은 이중 나선의 특징적 물리적 성질로서 50%의 나선 대 코일(혼성화되지 않은) 형태가 나타나는 온도(℃)를 의미한다. Tm은 혼성화의 형성 및 붕괴(용융)을 결정하기 위해 UV 스펙트럼을 이용함으로써 측정된다. 혼성화시에 발생되는 염기 중첩은 UV 흡광도의 감소(hypochromicity)와 동시에 나타난다. 따라서 UV 흡광도의 감소는 더 높은 Tm을 나타낸다. Tm이 높을수록 가닥의 결합강도가 더 커진다. 비-왓슨-크릭 염기쌍은 Tm에 강력한 불안정화 효과를 가져온다.The relative abilities of oligonucleotides that bind to complementary nucleic acids can be compared by determining the melting temperature of a particular hybrid complex. The melting temperature (T m ) is the characteristic physical property of the double helix, which means the temperature at which 50% of the helical to coil (unhybridized) form appears (° C). The T m is measured by using UV spectra to determine the formation and collapse (melting) of the hybridization. The base overlap that occurs during hybridization appears at the same time as the decrease in UV absorbance (hypochromicity). Thus, a decrease in UV absorbance indicates a higher T m . The higher the T m , the greater the bond strength of the strand. The non-Watson-Crick base pair has a strong destabilizing effect on the T m .
기초적 보고서 [Stec, J. W., Oligonucleoticle as Antisense Inhibitors of Gene Expression: Therapeutic Implications, Meeting abstracts, June 18-21, 1989]에서는 당간 결합기에서 하나의 결합기를 제외하고 모두 수식된 포스페이트 결합기인 (all except one 이라함) Rp 입체배열(stereoconfiguration) 또는 all except one Sp 입체배열을 가지는 티미딘 호모폴리머 옥타머가 천연의 포스포디에스테르 결합에 의해 연결된 두 개의 티미딘 메틸포스포네이트 테트라머성 디아스테레오머로부터 형성되었다. 하나를 제외하고 모두 Rp 당간 결합기를 가지는 Rp all except one 메틸포스포네이트 비-서열-특이적 티미딘 호모옥타머, 즉 (dT)8이 all except one Sp 배열 메틸포스포네이트 결합기를 가지는 유사한 티미딘 호모폴리머에 의해서 형성된 하이브리드(hybrid) 및 하나를 제외하고 모두 Sp 당간 결합기를 가지는 d(A)15(0℃) 즉 d(T)15의 하이브리드 보다 15-mer 디옥시아데노신 호모폴리머 즉 (dA)15)와 열역학적으로 더 안정된 하이브리드를 형성시킨다는 사실은 주목할 만하다. 천연의 포스포디에스테르 결합기를 가지는 d(T)8, 즉 옥타티미딘산 및 d(A)15사이의 하이브리드는 14℃의 Tm을 가진다고 보고되었다.In the basic report [Stec, JW, Oligonucleoticle as Antisense Inhibitors of Gene Expression: Therapeutic Implications, Meeting abstracts, June 18-21, 1989], all except one ) Rp stereoconfiguration or all except one Sp 3 stereoisomer was formed from two thymidine methylphosphonate tetramer diastereomers connected by a natural phosphodiester linkage. Rp all except one methylphosphonate non-sequence-specific thymidine homooctamer, ie (dT) 8 , with all Rp interphase linkers except one, with all except one Sp-like methylphosphonate linker (DA) 15 (0 ° C), that is, d (T) 15 , which has a linker between all the Sp sugar chains except for one, and a 15-mer deoxyadenosine homopolymer (dA ) 15 ) to form thermodynamically more stable hybrids. It has been reported that hybrids between d (T) 8 , that is, octatrimidic acid and d (A) 15 with a natural phosphodiester linkage group, have a T m of 14 ° C.
더 최근에는, Ueda et al. [Nucleic Acids Research, 19:547 (1991)]은 해독계에서 사용하기 위하여 Rp 디아스테레오머성 포스포로티오에이트를 간헐적으로 통합시킨 mRN 효소적으로 합성하였다.More recently, Ueda et al. [Nucleic Acids Research, 19: 547 (1991)] synthesized mRN enzymatically with intermittently integrated Rp diastereomeric phosphorothioate for use in detoxification systems.
Ueda et al.은 T7 RNA 폴리머라제에 대한 17개의 프로모터 및 한 개의 종결자리를 가지는 T7 콜리판(coliphane) DNA를 이용하였다. T7 RNA 폴리머라제에 의한 시험관내(in vitro) 합성은 수백에서 수만의 뉴클레오티드를 가지는 mRNA를 생성시켰다.Ueda et < RTI ID = 0.0 > al. ≪ / RTI > used 17 promoters for T7 RNA polymerase and T7 colony DNA with one terminus. In vitro synthesis by T7 RNA polymerase produced mRNA with hundreds to tens of thousands of nucleotides.
주쇄의 키랄 특성(chirality)은 또한 RNase H 활성에 대한 포스포로티오에이트 올리고뉴클레오티드-RNA 헤테로듀플렉스의 민감성에 영향을 미칠 수 있다. RNase H에 대하여 주형으로서 제공될 수 있는 성능은 RNase H가 RNA-DAN 올리고뉴클레오티드 헤테로듀플렉스에서의 RNA 성분의 분해를 야기시키는 것으로 제안되고 있기 때문에 중요한 치료적 용도를 가진다. 올리고뉴클레오티드가 Rp 및 Sp 당간 결합기의 라세미 혼합물을 포함하고 있어서, 모든 포스포로티오에이트 올리고뉴클레오티드는 RNase H에 대하여 기질로서 동등하게 기능할 수 있는가는 알려져 있지 않다. 다양한 촉매 반응을 위하여 핵산의 포스포디에스테르 주쇄의 가수분해는 입체 특이적 메카니즘(in-line mechanism) 및 배열(configuration)의 역전(inversion)에 의하여 진행된다. 그러므로 최대의 혼성화 효율 및 해독 종결에 대한 올바른 키랄 특성을 포함하는 단지 적은 백분율의 올리고뉴클레오티드가 라세미 혼합물에 있을 수 있다. 이와 같이 헤테로듀플렉스내에서 RNase H에 대한 기질로서 제공될 수 있는 포스포로티오에이트 올리고뉴클레오티드의 백분율을 증가시키게 되면 안티센스 치료제를 위한 더 효과적인 화합물로 될 수 있을 것이다.The chirality of the backbone can also affect the sensitivity of the phosphorothioate oligonucleotide-RNA heteroduplex to RNase H activity. The performance that can be provided as a template for RNase H has important therapeutic uses because RNase H is proposed to cause degradation of RNA components in RNA-DAN oligonucleotide heteroduplexes. It is not known that all phosphorothioate oligonucleotides can function equally as a substrate for RNase H, since the oligonucleotides comprise a racemic mixture of Rp and Sp sugar linkages. For various catalytic reactions, hydrolysis of the phosphodiester backbone of the nucleic acid proceeds by in-line mechanism and inversion of configuration. Thus, only a small percentage of the oligonucleotides may be present in the racemic mixture, including the maximum hybridization efficiency and the correct chiral properties for the transcription termination. Increasing the percentage of phosphorothioate oligonucleotides that can be provided as a substrate for RNase H in heteroduplexes as such would be a more effective compound for antisense therapeutics.
혼성화 충실도를 향상시키기 위하여 실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드가 매우 바람직하다. 나아가서 실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드는 더 효율적인 치료적 화합물이 될 수 있다. 그러나 지금까지는 그러한 분자를 합성하는 데 성공하지 못하였다. 그러므로 실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드를 합성하는 간단한 방법이 더욱 요구된다.To improve hybridization fidelity, phosphorothioate oligonucleotides having a substantially pure chiral interchain linker are highly preferred. Furthermore, phosphorothioate oligonucleotides having a substantially pure chiral intergranular linking group can be a more efficient therapeutic compound. But so far, it has not succeeded in synthesizing such molecules. Therefore, there is a further need for a simple method for synthesizing phosphorothioate oligonucleotides having a substantially pure chiral intergranular bond group.
올리고뉴클레오티드의 뉴클레아제 내성 및 혼성화 충실도는 올리고뉴클레오티드 치료학의 개발에서 매우 중요하다는 것은 잘 인식되어 있다. 뉴클레아제 내성을 가지는 올리고뉴클레오티드는 또한 치료제 및 진단제로서 바람직하다.Nuclease resistance and hybridization fidelity of oligonucleotides are well recognized in the development of oligonucleotide therapeutics. Oligonucleotides having nuclease resistance are also preferred as therapeutic and diagnostic agents.
[발명의 요약][Summary of the Invention]
본 발명에 따르면, 실질적으로 모든 Sp 포스포로티오에이트 당간 결합기 또는 실질적으로 모든 Rp 포스포로티오에이트 당간 결합기중 하나에 의하여 모든 뉴클레오시드가 연결된 포스포로티오에이트 올리고뉴클레오티드가 제공된다. 바람직하게는 본 발명의 포스포로티오에이트 올리고뉴클레오티드는 표적 RNA 또는 DNA의 적어도 일부분 이상의 서열에 상보적이다.According to the present invention there is provided a phosphorothioate oligonucleotide in which all nucleosides are linked by virtue of virtually any Sp phosphorothioate bi-linkage group or substantially all of the Rp phosphorothioate bi-linkage groups. Preferably, the phosphorothioate oligonucleotides of the present invention are complementary to at least a portion of the sequence of the target RNA or DNA.
더욱이 본 발명에서는 실질적으로 순수한 키랄성 당간 결합기를 가지는 서열-특이적 포스포로티오에이트 올리고뉴클레오티드를 합성하는 화학적 및 효소적 방법을 제공하는데 상기 포스포로티오에이트 올리고뉴클레오티드는 실질적으로 모두 Rp 또는 실질적으로 모두 Sp 중 하나의 당간 결합기에 의하여 연결된 적어도 10개 이상의 뉴클레오시드 단위로 구성된다. 바람직하게는 포스포로티오에이트 올리고뉴클레오티드는 실질적으로 순수한 키랄성 당간 결합기에 의하여 연결된 약 10 내지 약 50개의 뉴클레오시드 단위로 구성되어 있다. 더욱 바람직하게는 상기 포스포로티오에이트 올리고뉴클레오티드는 실질적으로 순수한 키랄성 당간 결합기에 의하여 연결된 약 15 내지 약 30 뉴클레오티시드 단위로 구성된다. 가장 바람직하게는 상기 포스포로티오에이트 올리고뉴클레오티드는 실질적으로 순수한 키랄성 당간 결합기에 의하여 연결된 약 17 내지 21 뉴클레오시드 단위로 구성된다. 상기 방법은 프라이머, 주형 및 과량의 4개의 순수한 키랄성 뉴클레오시드 5'-O-(1-티오트리포스페이트를 결합시키는 것으로 이루어진다. 나아가서 상기 방법은 폴리머라제를 첨가하고 상보적 올리고뉴클레오티드에서 프라이머를 제거함으로써 상보적 올리고뉴클레오티드를 합성하는 것을 더 포함한다. 또한 상기 방법은 상기 주형으로부터 상기 상보적 올리고뉴클레오티드를 분리시키는 것으로 구성된다. 실질적으로 순수한 키랄성 당간 결합기를 가지는 서열-특이적 포스포로티오에이트 올리고뉴클레오티드를 합성하는 본 발명의 방법 중 다른 구체예에서 염기서열 프라이머, 주형 및 뉴클레오시드 5'-O-(1-티오트리포스페이트)의 라세미 혼합물이 통합된다. 실질적으로 순수한 키랄성 당간 결합기를 가지고 주형에 상보적인 포스포로티오에이트 올리고뉴클레오티드는 폴리머라제와 선택된 금속 이온을 첨가함으로써 합성된다. 이와 같이 합성된 올리고뉴클레오티드는 주형과 프라이머로부터 분리된다.Furthermore, the present invention provides a chemical and enzymatic method of synthesizing a sequence-specific phosphorothioate oligonucleotide having a substantially pure chiral interchain linker, wherein the phosphorothioate oligonucleotide is substantially all Rp or substantially all of Sp At least 10 nucleoside units linked by one sugar bridge group. Preferably, the phosphorothioate oligonucleotide is comprised of from about 10 to about 50 nucleoside units linked by a substantially pure chiral interchain linker. More preferably, the phosphorothioate oligonucleotide is comprised of from about 15 to about 30 nucleotide units linked by a substantially pure chiral interchain linker. Most preferably, the phosphorothioate oligonucleotide is comprised of about 17 to 21 nucleoside units linked by a substantially pure chiral interchain linker. The method comprises combining primers, templates and an excess of four pure chiral nucleoside 5'-O- (1-thiotriphosphates. Further, the method further comprises adding the polymerase and removing the primer from the complementary oligonucleotide The method further comprises separating the complementary oligonucleotides from the template. The sequence-specific phosphorothioate oligonucleotides having substantially pure chiral inter-glycate linking groups (1-thiotriphosphate), is synthesized in another embodiment of the method of the present invention to synthesize a substantially pure chiral inter- Lt; RTI ID = 0.0 > phosphorothioate < Oligonucleotides are synthesized by adding a metal ion selected and the polymerase. Thus, the oligonucleotide synthesized oligonucleotides are separated from the template and primers.
실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드는 표적 RNA 및 DNA와 형성된 헤테로듀플렉스의 열역학적 안정성을 증가시키고 RNase H 활성을 이끌어내는 데 유용하다. 나아가서 본 발명의 올리고뉴클레오티드 RNA의 활성을 조절하는 데 유용하다.Phosphorothioate oligonucleotides having a substantially pure chiral interchain bond group are useful for increasing the thermodynamic stability of the formed heteroduplex with the target RNA and DNA and eliciting RNase H activity. And is further useful for modulating the activity of the oligonucleotide RNA of the present invention.
올리고뉴클레오티드의 포스포디에스테르 결합기에서의 인 원자는 친-키랄성(pro-chiral)이 된다고 기재될 수 있다. 포스포디에스테르 결합기의 비-결합 산소 원자가 일단 교체되거나 수식되면 키랄성 당-포스페이트 결합기가 생성된다. 그 결과 생성되는 당간 결합기는 Sp 당간 결합기 또는 Rp 당간 결합기중의 하나가 될 수 있다. 포스포로티오에이트 결합기를 얻기 위해 천연의 포스포디에스테르 결합기의 비-결합 산소 원자를 황 원자로 치환시키게 되면 키랄성 중심이 형성되고 Sp와 Rp 디아스테레오머가 되도록 한다. 당간 주쇄에서 실질적으로 모든 원자가 Sp 또는 Rp 중 하나인 분자는 본 명세서에서 순수하게 키랄성인 것으로 언급된다.The phosphorus atom in the phosphodiester linkage group of the oligonucleotide can be described as being pro-chiral. Once the non-bonding oxygen atom of the phosphodiester linking group is replaced or modified, a chiral sugar-phosphate linking group is formed. The resultant intergranular linker can be either a linker between Sp or a linker between Rp. Substituting a sulfur atom for the non-bonded oxygen atom of the natural phosphodiester linkage group to obtain a phosphorothioate linking group results in a chiral center being formed and a Sp and Rp diastereomer. Molecules where in the backbone chain substantially all of the atoms are either Sp or Rp are referred to herein as being purely chiral.
리보뉴클레오시드-(NTPαS) 및 2'-디옥시리보뉴클레오시드-5'-O-(1-티오트리포스페이트) (dNTPαS)는 Ludwig and Eckstein [J. Org. Chem, 631 (1989)]의 방법을 이용하여 Sp 및 Rp 세라미 혼합물로서 합성되었다. 이 예시적인 합성법에서 보호되지 않은 뉴클레오시드는 5'-히드록실기를 포스피틸레이트시키는(phosphitylate) 2-클로로-4H-1,3,2-벤조디옥사포스포린-4-온과 반응될 수 있다. 피로포스페이트와 연이어 반응시키게 되면 황에 반응성이 있는 시클릭 트리포스페이트 유도체를 생성시키며 Rp 및 Sp 뉴클레오시드 5'-O-(1-티오트리포스페이트), 즉 α-티오트리포스페이트의 혼합물을 생성시키게 된다. 이 생성물은 DEAE-세파덱스 크로마토그래피에 의하여 정제 가능하고 NMR 스펙트로스코피에 의하여(특징적인 Rp 또는 SP 화학적 전이(shift)에 의하여) 구별할 수 있다.Ribonucleoside- (NTP? S) and 2'-deoxyribonucleoside-5'-O- (1-thiotriphosphate) (dNTP? S) were prepared according to the method of Ludwig and Eckstein [J. Org. Chem., 631 (1989)]. In this exemplary synthesis, the unprotected nucleoside can be reacted with 2-chloro-4H-1,3,2-benzodioxaphosphorin-4-one, which phosphitylates the 5'- have. Subsequent reaction with pyrophosphate produces a cyclic triphosphate derivative reactive with sulfur and produces a mixture of Rp and Sp nucleoside 5'-O- (1-thiotriphosphate), i.e., alpha -thiotriphosphate do. This product can be purified by DEAE-Sephadex chromatography and can be distinguished by NMR spectroscopy (by characteristic Rp or SP chemical shift).
하기 예에서 보는 바와 같이 순수한 Rp 및 Sp 뉴클레오시드-5'-O-(1-티오트리포스페이트) 디아스테레오머는 역상 HPLC 크로마토그래피와 같은 방법을 이용하여 예비 단계로 쉽게 분리될 수 있다. 그러한 HPLC-분리된 뉴클레오티드 디아스테레오머는 그러한 Rp 및 Sp 뉴클레오시드 5'-O-(1-티오트리포스페이트) 디아스테레오머의 상업적 표본과 분석적 HPLC 비교함으로써 더 특정화 될 수 있다.The pure Rp and Sp nucleoside-5'-O- (1-thiotriphosphate) diastereomers can be readily separated into preparative steps using methods such as reverse phase HPLC chromatography, as shown in the examples below. Such HPLC-isolated nucleotide diastereomers can be further characterized by analytical HPLC comparison with commercial samples of such Rp and Sp nucleoside 5'-O- (1-thiotriphosphate) diastereomers.
서열-특이적 천연 올리고뉴클레오티드, 예를 들어 천연 포스포디에스테르 올리고뉴클레오티드의 효소적 합성은 주형과 프라이머의 존재하에서 적당한 뉴클레아제의 사용에 의하여 영향을 받을 수 있다. 유사한 방법으로 혼합된 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드의 라세미 혼합물이 합성되어 질 수 있다. 본 발명에 따르면 그러한 효소적인 합성은 또한 서열-특이적 주형과 프라이머의 존재하에서 적당한 뉴클레아제에 대한 기질로서 에난시오머적으로(enantiomerically) 순수한 모든-Sp 또는 모든-Rp 뉴클레오시드 5'-O-(1-티오트리포스페이트)를 이용함으로써 실질적으로 순수한 키랄성 당간 결합기를 가지는 서열 특이적 포스포로티오에이트 올리고뉴클레오티드의 합성을 포함하도록 확장되어질 수 있다. 예를 들어 화학적으로 사용가능한 DNA 폴리머라제 시쿼나제(sequenaseTM) (U.S. Biochemical, Inc., Cleveland, OH)는 포스포디에스테르 올리고뉴클레오티드 주형 및 라세미 포스포로티오에이트 올리고뉴클레오티드 프라이머를 사용하여 포스포로티오에이트 올리고뉴클레오티드를 합성하는 데 이용될 수 있다. 이 폴리머라제를 이용하게 되면 포스포디에스테르 및 포스포로티오에이트 프라이머 모두가 신장되어질 수 있다.The enzymatic synthesis of sequence-specific natural oligonucleotides, such as natural phosphodiester oligonucleotides, can be effected by the use of suitable nucleases in the presence of template and primers. In a similar manner, a racemic mixture of phosphorothioate oligonucleotides having mixed chirally intergranular linking groups can be synthesized. According to the present invention, such enzymatic synthesis also enantiomerically enantiomerically pure all -Sp or all-Rp nucleoside 5'-O as a substrate for the appropriate nucleases in the presence of the sequence-specific template and primer Specific phosphorothioate oligonucleotides having a substantially pure chiral interchain interindividing group by using - (1-thiotriphosphate). For example, chemically possible DNA polymerase sikwo xylanase used (sequenase TM) (US Biochemical, Inc., Cleveland, OH) is oligonucleotide phosphodiester oligonucleotide template and a racemic phosphorothioate oligonucleotide phosphorothioate with an oligonucleotide primer thio Lt; / RTI > oligonucleotides. The use of this polymerase allows both phosphodiester and phosphorothioate primers to be elongated.
효소적으로 합성된 포스포로티오에이트 올리고뉴클레오티드의 수율은 주형과 프라이머를 반복적으로 첨가시키거나, 폴리머라제를 반복적으로 첨가시키거나, 뉴클레오시드 트리포스페이트를 반복적으로 첨가시키거나, 이런 방법들을 모두 또는 몇몇 조합하여 최적화될 수 있다. 예를 들어 주형과 프라이머의 반복적 첨가는 효소적 증폭(cascade)을 통하여 수율을 최대화할 수 있게 된다. 더 나아가서 시스템 버퍼(buffer)에서 주형과 프라이머의 예비적-혼성화 그리고 냉각 후 뉴클레아제 트리포스페이트 및 폴리머라제의 첨가에 의하여 최적화가 이루어질 수 있다.The yield of enzymatically synthesized phosphorothioate oligonucleotides can be determined by repeated addition of template and primer, by repeated addition of polymerase, by repeated addition of nucleoside triphosphate, Some combinations can be optimized. For example, iterative addition of templates and primers can maximize yield through enzymatic amplification (cascade). Furthermore, optimization can be achieved by the addition of nuclease triphosphates and polymerases after preliminary-hybridization of the template and primer in the system buffer and cooling.
적당한 폴리머라제는 DNA 또는 RNA 포스포로티오에이트 올리고뉴클레오티드 중 하나를 생성시키도록 선택될 수 있다. 그러한 폴리머라제는 T7 DNA 폴리머라제, 상기 언급된 sequenaseTM과 같은 수식된 T7 DNA 폴리머라제, E. coli DNA 폴리머라제, DNA 폴리 클레노우 단편 폴리머라제, M. luteus 폴리머라제, T4 박테리오파아지 폴리머라제, 수식된 T4 DNA 폴리머라제, T7 RNA 폴리머라제 및 E. coli RNA 폴리머라제를 포함하나 여기에 한정되는 것은 아니다.Suitable polymerases may be selected to produce either DNA or RNA phosphorothioate oligonucleotides. Such polymerases include, but are not limited to, T7 DNA polymerase, modified T7 DNA polymerase such as the sequenase TM mentioned above, E. coli DNA polymerase, DNA Polycleno short polymerase, M. luteus polymerase, T4 bacteriophage polymerase, But are not limited to, modified T4 DNA polymerase, T7 RNA polymerase, and E. coli RNA polymerase.
효소적 합성은 인 원자의 키랄성 중심에 대하여 배열의 역전으로 진행된다. 이와 같이 모든 Sp α-티오트리포스페이트를 사용하게 되면 실질적으로 모두 Rp 포스포로티오에이트 올리고뉴클레오티드를 생성시키게 되고 모든 Rp α-티오트리포스페이트를 사용하게 되면 실질적으로 모두 Sp 포스포로티오에이트 올리고뉴클레오티드를 생성시키게 된다. 본 발명의 다른 구체예에서 포스포로티에이트 키랄성 α-티오트리포스페이트 중 하나 또는 다른 것이 우세하게 들어갈 수 있도록 반응 용액에 메탈 이온을 사용하여 뉴클레오시드-5'-O-(1-티오트리포스페이트)의 라세미 혼합물로부터 합성될 수 있다. 상기 언급된 바와 같이 포스포로티오에이트 올리고뉴클레오티드의 폴리머라제 합성은 프라이머 뉴클레오시드-α-티오트리포스페이트의 키랄성 중심에 대하여 배열의 역전과 함께 수행된다. 특정 이론에 구속되는 것은 아니지만 모든 Rp 배열의 최적화는 예를 들어 E. coli 폴리머라제를 사용하여 반응 버퍼에서 고농도의 마그네슘 이온을 첨가시킴으로써 이루어질 수 있다고 여겨지고 있다. 유사한 방법으로 이론에 속박되고자 하는 것은 아니나 모든 Sp 배열이 반응 버퍼에서 고농도의 망간 이온을 사용함으로써 얻어질 수 있다.Enzymatic synthesis proceeds by reversing the arrangement with respect to the chiral center of the phosphorus atom. The use of all Sp [alpha] -thiotriphosphates thus produces substantially all Rp phosphorothioate oligonucleotides, and when all Rp [alpha] -thiotriphosphates are used, substantially all Sp phosphorothioate oligonucleotides are produced . In another embodiment of the present invention, metal ions are used in the reaction solution such that one or the other of the phosphorothioate chiral < RTI ID = 0.0 > a-thiotriphosphate < / RTI > ) ≪ / RTI > As mentioned above, the polymerase synthesis of phosphorothioate oligonucleotides is carried out with the reversal of the sequence with respect to the chiral center of the primer nucleoside-a-thiotriphosphate. Without being bound by any particular theory, it is believed that optimization of all Rp sequences can be achieved, for example, by the addition of high concentrations of magnesium ions in the reaction buffer using E. coli polymerase. While not intending to be bound by theory in a similar way, all Sp arrangements can be obtained by using high concentrations of manganese ions in the reaction buffer.
본 발명에 따르면 실질적으로 모두(substantially all)는 적어도 75% 이상의 당간 결합기가 순수한 키랄성인 모든 올리고뉴클레오티드를 포함하는 것을 의미한다. 더 바람직하게는 약 85% 내지 약 100% 순수한 키랄성인 당간 결합을 가지는 올리고뉴클레오티드가 실질적으로 순수한 키랄성이 된다. 가장 바람직하게는 약 95% 내지 약 100% 순수한 키랄성인 당간 결합기를 가지는 올리고뉴클레오티드가 실질적으로 순수한 키랄성이 된다.According to the present invention, substantially all means that at least 75% of the inter-terminal linker comprises all oligonucleotides which are pure chiral. More preferably from about 85% to about 100% pure chiral oligonucleotides with intergranular bonds are substantially pure chiral. Most preferably from about 95% to about 100% pure chiral, oligonucleotide having intergranular linkage is substantially pure chirality.
본 발명의 명세서에서 포스포로티오에이트 올리고뉴클레오티드라는 용어는 천연 생성된 염기, 당 및 포스포로티오에이트 결합기로부터 형성된다. 포스포로티오에이트 올리고뉴클레오티드를 포함한다. 천연 생성된 염기는 아데닌, 구아닌, 시토신, 티민 및 우라실을 포함한다. 천연 당은 β-d-리보푸란노실 및 β-D-2'-디옥시-에리쓰로-펜토푸란노실을 포함한다. 뉴클레오시드-5'-O-(1-티오트리포스페이트) 유사체가 적당한 폴리머라제에 대한 기질이 되는 정도로 포스포로티오에이트 올리고뉴클레오티드는 또한 올리고뉴클레오티드의 포스포로티오에이트 뉴클레오티드내에 통합된 수식된 염기 또는 수식된 당을 포함한다. 본 발명의 올리고뉴클레오티드의 수식된 염기는 아데닌, 구아닌, 시토신; 우라실, 티민, 크산틴, 히포크산틴, 2-아미노아데닌, 6-메틸, 2-프로필 및 다른 알킬 아데닌, 5-할로 우라실, 5-할로 시토신, 6-아자 우라실, 6-아자 시토신 및 6-아자 티민, 유사(pseudo) 우라실, 4-티오우라실, 8-할로 아데닌, 8-아미노아데닌, 8-티올 아데닌, 8-티오알킬 아데닌, 8-히드록실 아데닌 및 다른 8-치환된 아데닌, 8-할로 구아닌, 8-아미노 구아닌, 8-티올 구아닌, 8-티올알킬 구아닌, 8-히드록실 구아닌 및 다른 8-치환된 구아닌, 다른 아자 및 디아자 우라실, 다른 아자 및 디아자 티미딘, 다른 아자 및 디아자 시토신, 다른 아자 또는 디아자 아데닌, 다른 아자 및 디아자 구아닌, 5-트리플루오로메틸 우라실 및 5-트리플루오로 시토신을 포함한다. 당 부(moiety)는 디옥시리보오스 또는 리보오스일 수 있다. 본 발명의 올리고뉴클레오티드는 또한 수식된 핵염기 또는 본 발명의 사상과 일치하는 다른 수식을 가지는 수식된 핵염기 및 치료, 진단 또는 연구 시약으로서 사용될 수 있도록 뉴클레아제 내성을 증가시키는 특별한 수식 상태의 핵염기로 이루어질 수 있다. 본 발명의 올리고뉴클레오티드는 진단, 치료 및 연구시약으로서 이용될 수 있다. 그것들은 효과적인 양의 본 발명의 올리고뉴클레오티드를 적당한 약제학적으로 수용가능한 희석제 또는 담체에 첨가시킴으로써 제약적 조성물로 이용될 수 있다. 나아가서 그것들은 바람직하지 못한 단백질의 생성에 의하여 특징되어지는 질병을 가지는 유기체를 치료하기 위하여 사용될 수 있다. 유기체는 바람직하지 못한 단백질을 코드하는 표적 핵산의 가닥과 특이적으로 혼성화될 수 있는 서열을 가지는 본 발명의 올리고뉴클레오티드와 접촉될 수 있다.In the context of the present invention, the term phosphorothioate oligonucleotide is formed from naturally occurring bases, sugars and phosphorothioate linking groups. And phosphorothioate oligonucleotides. Naturally occurring bases include adenine, guanine, cytosine, thymine and uracil. Natural sugars include? -D-ribofuranosyl and? -D-2'-deoxy-erythro-pentofuranosyl. Phosphorothioate oligonucleotides may also be modified bases, such as modified bases incorporated into the phosphorothioate nucleotides of the oligonucleotides, to the extent that the nucleoside-5'-O- (1-thiotriphosphate) analog is a substrate for the appropriate polymerase Includes modified sugars. Modified bases of the oligonucleotides of the present invention include adenine, guanine, cytosine; 5-halothiocin, 6-azauracil, 6-azacytosine and 6-aminocycloheptane, which are known to those skilled in the art, 8-thioadenine, 8-thioalkyladenine, 8-hydroxyladenine and other 8-substituted adenines, 8-thioadenine, 8- Thioguanine, 8-thiolalkyl guanine, 8-hydroxyl guanine and other 8-substituted guanine, other aza and diazauracil, other aza and diazatrimidine, other aza and other 8-aminoguanine, Diazacytosine, other aza or diazadenine, other aza and diazaguanine, 5-trifluoromethyluracil and 5-trifluorocytosine. The moiety may be deoxyribose or ribose. The oligonucleotides of the present invention may also be modified nucleobases or modified nucleobases having other modifications in accordance with the teachings of the present invention and nucleotides of a particular modified form that increase nuclease resistance so that they can be used as therapeutic, Base. The oligonucleotides of the present invention can be used as diagnostic, therapeutic and research reagents. They can be used as a pharmaceutical composition by adding an effective amount of an oligonucleotide of the present invention to an appropriate pharmaceutically acceptable diluent or carrier. Furthermore, they can be used to treat organisms having diseases characterized by the production of undesirable proteins. The organism may be contacted with an oligonucleotide of the invention having a sequence that can specifically hybridize with a strand of a target nucleic acid encoding an undesired protein.
치료적 조성물 및 그 이후의 투여 형태는 이 분야의 통상의 지식의 범위내에 있다. 일반적으로 치료를 위해 그러한 치료의 필요성이 있는 환자에게 대개 약제학적으로 수용가능한 담체내에 존재하는 본 발명에 따른 올리고뉴클레오티드를 환자의 나이 및 치료되는 질병 상태의 심각도에 따라 체중 kg당 0.01㎍ 내지 100g의 양으로 투여한다. 나아가서 치료법은 특정 질병의 속성, 심각성 및 환자의 전체적 상태에 따라 변할 수 있는 기간동안 지속될 수 있고 하루에 한번식에서 몇 년에 한번씩까지 연장될 수 있다. 치료한 다음 환자 상태 변화 및 질병상태의 징후 완화를 조사하였다. 올리고뉴클레오티드의 투여량은 환자가 현재 투여량 수준에 대하여 반응하지 않는 경우에 증가될 수 있고 또한 질병상태의 완화가 관찰되거나 질병 상태가 제거된다면 투여량은 감소될 것이다.Therapeutic compositions and subsequent dosage forms are within the ordinary skill in the art. In general, for those patients in need of such treatment for treatment, the oligonucleotides according to the invention, which are usually present in a pharmaceutically acceptable carrier, are administered in an amount of from 0.01 [mu] g to 100 g per kg of body weight, depending on the age of the patient and the severity of the disease condition being treated Dose. Furthermore, therapies can last for a period that can vary depending on the nature, severity, and overall condition of the particular disease, and can be extended from once a day to once every few years. After treatment, changes in patient status and symptom relief of disease status were investigated. The dose of the oligonucleotide can be increased if the patient does not respond to the current dose level and the dose will be reduced if mitigation of the disease state is observed or the disease state is removed.
몇몇 경우에 다른 전형적인 치료적 방법과 동시에 본 발명의 올리고뉴클레오티드로 환자를 치료하는 데 더욱 효과적일 수 있다.In some cases, be more effective in treating patients with the oligonucleotides of the present invention at the same time as other typical therapeutic methods.
투약은 치료되어야 할 질병 상태의 심각성 및 감응성에 의존하며, 치료과정은 몇일 내지 몇달까지 지속되거나 치료 효과가 나타나거나 질병 상태의 감소가 이루어질 때까지 지속되어진다. 최적 투여계획도 환자의 몸에 약물 축적량을 측정하여 계산되어 질 수 있다. 이 분야의 통상의 지식을 가진 자라면 최적 투여량, 투여법 및 반복 등급(rate)을 쉽게 결정할 수 있다. 최적 투여량은 개개의 올리고뉴클레오티드의 상대적 성능에 따라 달라질 수 있으며, 일반적으로 시험관내 및 생체내 동물 모델에서 효과적인 것으로 밝혀진 EC50에 기초하여 계산될 수 있다. 일반적으로 투여량은 체중 kg당 0.01㎍ 내지 100g이며 한번 또는 날마다, 주마다, 달마다 또는 년마다 또는 몇년에 한번씩 투여될 수 있다. 성공적인 치료에 이어서 질병 상태의 재발을 방지하기 위해서 환자가 지속적인 치료를 받도록 하는 것이 바람직하고, 올리고뉴클레오티드는 한번 또는 날마다 내지는 몇년마다 한번씩 체중 kg당 0.01㎍ 내지 100g 범위의 지속적 투여량으로 투여하였다.The dosage depends on the severity and susceptibility of the disease condition to be treated, and the treatment process lasts from days to months, until a therapeutic effect is achieved or the disease state is reduced. Optimal dosing schedules can also be calculated by measuring drug accumulation on the patient's body. Those skilled in the art will readily be able to determine the optimal dosage, dosage regimen and rate of repetition. Optimal dosages may vary depending on the relative performance of the individual oligonucleotides and may be calculated based on the EC 50 generally found to be effective in vitro and in vivo animal models. Generally, the dosage is 0.01 to 100 g per kg of body weight and may be administered once or every day, every week, monthly or yearly, or once every several years. Following successful treatment, it is desirable to have the patient under continuous therapy to prevent recurrence of the disease state, and oligonucleotides are administered at a sustained dose ranging from 0.01 μg to 100 g per kg body weight once, every day or every few years.
본 발명의 약제학적 조성물은 국소적 또는 조직적 치료가 바람직한가 그리고 치료되는 면적에 따라 여러 방법으로 투여될 수 있다. 투여법은 국부적(눈, 질(膣), 직장, 코, 피부), 경구 또는 비경구 투여가 될 수 있다. 비경구 투여는 혈관내 적하, 피하, 복막(腹膜)내 또는 근육내 주사 또는 포막(intrathecal) 또는 심장내 투여를 포함한다.The pharmaceutical compositions of the present invention may be administered in a variety of ways depending on whether the local or systemic treatment is desired and the area to be treated. The method of administration may be local (eye, vaginal, rectal, nasal, skin), oral or parenteral administration. Parenteral administration includes intravascular drip, subcutaneous, intraperitoneal (intraperitoneal) or intramuscular injection or intrathecal or intracardiac administration.
국소적 투여 형태는 피부투하 패치(patch), 연고, 로션, 크림, 겔, 드롭, 좌약, 스프레이, 액체 및 분말을 포함할 수 있다. 종래의 약제학적 담체, 수성(aqueous), 분말 또는 오일성 염기, 식크너(thickner) 등등이 필요하고 또 바람직한 형태이다. 피복된 콘돔, 글러브(gloves) 등등도 또한 유용하다.Topical dosage forms may include skin release patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickner and the like are necessary and preferred forms. Coated condoms, gloves, etc. are also useful.
경구 투여하기 위한 조성물은 분말 또는 과립, 현탁액 또는 수용액 또는 비-수성 매질, 캡슐, 주머니(sachet) 또는 정제(tablet)를 포함한다. 식크너, 풍미제, 희석제, 유화제, 분산 조제 또는 고착제도 바람직할 수 있다.Compositions for oral administration include powders or granules, suspensions or aqueous or non-aqueous media, capsules, sachets or tablets. A flavoring agent, a diluent, an emulsifying agent, a dispersing aid or a fixing agent may be preferable.
포막내 또는 심장내 투여하기 위한 조성물은 버퍼, 희석제 및 다른 적당한 첨가제를 포함할 수도 있다. 무균의 수용액을 포함할 수 있다.Compositions for intratracheal or intracardiac administration may also include buffers, diluents and other suitable additives. A sterile aqueous solution may be included.
비경구 투여 형태는 버퍼, 희석제 또는 다른 적당한 첨가제를 포함할 수도 있다. 무균의 수용액을 포함할 수 있다.Parenteral dosage forms may also include buffers, diluents or other suitable additives. A sterile aqueous solution may be included.
본 발명의 포스포로티오에이트 올리고뉴클레오티드는 혼성화, 뉴클레아제 내성 및 RNase H 활성에 대한 효과에 대하여 천연의 포스포디에스테르 올리고뉴클레오티드 및 라세미 포스포로티오에이트 뉴클레오티드와 대조적일 수 있다. 유사하게 실질적으로 순수한 키랄성인 당간 결합기를 가지는 순수한 포스포로티오에이트 올리고뉴클레오티드는 생체내 시험 시스템에서 치료의 효율성을 증가시키는 성능에 대하여 시험 시스템에서 치료의 효율성을 증가시키는 성능에 대하여 평가될 수 있다. 치료의 효율성의 그러한 증가는 약동력학 또는 대사, 독물학(toxicology), 배치(예를 들어 흡착 및 분포), 및 종(species) 비교와 같은 속성을 포함하는 것이다.The phosphorothioate oligonucleotides of the present invention may be in contrast to natural phosphodiester oligonucleotides and racemic phosphorothioate nucleotides for their effect on hybridization, nuclease resistance and RNase H activity. Pure phosphorothioate oligonucleotides, similarly having substantially pure chirality, intergranular linkages can be evaluated for their ability to increase the efficiency of treatment in a test system for their ability to increase the efficiency of treatment in an in vivo test system. Such an increase in the efficiency of treatment may include properties such as pharmacodynamics or metabolism, toxicology, placement (e.g., adsorption and distribution), and species comparison.
모두 Rp 또는 모두 Sp 당간 결합기를 가지는 호모폴리머는 안정성 및 다른 특성에 대한 기초적 연구에 유용하게 사용되고 있다. 그러나 이들 올리고뉴클레오티드는 표적 분자에 대해 특이적이지 못하기 때문에 치료학적으로 사용되지 못한다. 특이적 서열을 가지는 포스포로티오에이트 올리고뉴클레오티드는 표적 핵산에 특이적으로 혼성화하기 위해 필요하다.Homopolymers having both Rp or all Sp 2 -binding bonds have been usefully used in basic studies on stability and other properties. However, these oligonucleotides are not therapeutically used because they are not specific for the target molecule. Phosphorothioate oligonucleotides having specific sequences are necessary to specifically hybridize to a target nucleic acid.
실질적으로 순수하게 키랄성인 당간 결합기를 가지는 서열-특이적 포스포로티오에이트 올리고뉴클레오티드는 표적 RNA 및 DNA와의 헤테로듀플렉스의 열역학적 안정성을 증가시키고 RNase H의 활성을 유도하는 데 유용하다.Sequence-specific phosphorothioate oligonucleotides having substantially purely chiral intergranular linkages are useful for increasing the thermodynamic stability of the heteroduplex with target RNA and DNA and inducing the activity of RNase H.
방사성 표지화는 실질적으로 순수하게 키랄성인 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드를 동정(identification)하는 데 도움이 될 수 있다. 자동화된 합성기에서 합성된 라세미 포스포로티오에이트 올리고뉴클레오티드에 대하여 [35S](방사성표시된 원소 황)가 합성기로부터 얻어진 수소-포스페이트 올리고머의 산화에 사용되어질 수 있다. 효소적으로 합성된 포스포로티오에이트 올리고뉴클레오티드의 라벨화는 폴리머라제 반응성 [α-32P]ATP 및 리가아제 또는 [α-35S]ATPs를 이용하여 수행될 수도 있다. 또한 방사성 표시된 뉴클레오시드 트리포스페이트는 프로브 및 서열분석에서도 사용될 수 있다. 자동방사선이 표준 방법으로 만들어질 수 있다.Radioactive labeling can help identify phosphorothioate oligonucleotides having a substantially purely chiral interchain linker. For racemic phosphorothioate oligonucleotides synthesized in an automated synthesizer, [ 35 S] (radioactively labeled elemental sulfur) can be used for the oxidation of hydrogen-phosphate oligomers obtained from the synthesizer. Labeling of enzymatically synthesized phosphorothioate oligonucleotides may be performed using polymerase reactive [[alpha] - 32 P] ATP and ligase or [[alpha] - 35 S] ATPs. Radioactive labeled nucleoside triphosphates can also be used in probes and sequencing. Automatic radiation can be made by standard methods.
본 발명의 주형은 질병-강화성 단백질의 합성을 유도하는 핵산 서열의 가장 바람직한 영역이다. 상기 주형 올리고뉴클레오티드의 영역에 염기쌍을 형성하는 짧은 올리고뉴클레오티드는 폴리머라제에 의한 올리고뉴클레오티드 합성에 대한 시발점을 형성하는 프라이머로서 작용한다.The template of the present invention is the most preferred region of the nucleic acid sequence that leads to the synthesis of disease-enhancing proteins. Short oligonucleotides that form base pairs in the region of the template oligonucleotide serve as primers to form a starting point for oligonucleotide synthesis by the polymerase.
실질적으로 순수한 키랄성인 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드는 뉴클레아제 분해, 예를 들어 제한 엔도뉴클레아제 분해에 민감한 자리를 가지도록 선택될 수 있는 프라이머를 사용하여 합성될 수 있다. 상기 분해 자리는 상기 프라이머의 3' 말단에 위치할 수 있다. 적당한 제한 엔도뉴클레아제에 의한 분해는 상기 프라이머로부터 첫번째 5' 말단 뉴클레오시드가 제거된 올리고뉴클레오티드가 된다. 본 발명의 상기 포스포로티오에이트 올리고뉴클레오티드가 된다. 본 발명의 상기 포스포로티오에이트 올리고뉴클레오티드의 부가적 뉴클레오시드는 효소적 수단에 의하여 첨가된 뉴클레오시드 키랄 티오트리포스페이트이다.Phosphorothioate oligonucleotides having substantially pure chirality intergranular linkages can be synthesized using primers that can be selected to have sites that are sensitive to nuclease degradation, for example, restriction endonuclease digestion. The cleavage site may be located at the 3 ' end of the primer. Degradation by a suitable restriction endonuclease results in an oligonucleotide from which the first 5 ' terminal nucleoside has been removed from the primer. To become the phosphorothioate oligonucleotide of the present invention. An additional nucleoside of the phosphorothioate oligonucleotide of the present invention is a nucleoside chiral thiotriphosphate added by enzymatic means.
선택된 프라이머와 함께 적당한 제한 뉴클레아제를 선택함으로써 바람직한 포스포로티오에이트 올리고뉴클레오티드의 다양한 5'-말단 뉴클레오시드는 포스포로티오에이트 뉴클레오티드의 5' 말단에 적당하게 위치한다. 이와 같이 프라이머로부터 하나의 뉴클레오시드가 본 발명의 신규 합성된 서열 특이적 포스포로티오에이트 올리고뉴클레오티드의 첫번째 5' 뉴클레오시드가 되도록 스태거된(staggered) 절단이 되는 한 어떠한 엔도뉴클레아제 인식 자리라도 디자인될 수 있다.The various 5'-terminal nucleosides of the preferred phosphorothioate oligonucleotides are suitably located at the 5 ' end of the phosphorothioate nucleotides by selecting the appropriate restriction nuclease with the selected primer. Thus, as long as one nucleoside from the primer is a staggered cleavage to be the first 5 ' nucleoside of the newly synthesized sequence-specific phosphorothioate oligonucleotide of the present invention, any endonuclease recognition Even a seat can be designed.
바람직한 서열의 적당한 주형에 상기 프라이머를 효소적으로 연장시키는 것이 완성될 때에 본 발명의 포스포로티오에이트 올리고뉴클레오티드는 적당한 뉴클레아제를 사용하여 상기 프라이머에서 이탈될 수 있다. 예를 들어 바람직한 포스포로티오에이트 올리고뉴클레오티드의 5' 말단에서 구아노신 뉴클레오시드를 통합시키기 위하여 그것의 3' 말단에 CTGCAG 서열을 가지는 프라이머가 사용될 수 있다. Pst 1 제한 뉴클레아제를 그 다음 사용하게 되면 A-G 연결을 분해시킬 수 있다. A-G 연결의 구아노신 뉴클레오시드 성분은 바람직한 포스포로티오에이트 올리고뉴클레오티드의 5' 말단 뉴클레오시드로서 통합되어 질 수 있다. 다른 제한 엔도뉴클레아제로는 BamH1, Smal 및 HinD III 제한 엔도뉴클레아제가 사용될 수 있고 여기에 한정되는 것은 아니다.When the enzymatic extension of the primer into a suitable template of the desired sequence is complete, the phosphorothioate oligonucleotides of the present invention can be released from the primer using appropriate nucleases. For example, a primer having a CTGCAG sequence at its 3 'end may be used to incorporate a guanosine nucleoside at the 5' end of the desired phosphorothioate oligonucleotide. The next use of the Pst 1 restriction nuclease can disassemble the A-G linkage. The guanosine nucleoside component of the A-G linkage can be integrated as the 5 'terminal nucleoside of the preferred phosphorothioate oligonucleotide. Other limiting endonucleases include, but are not limited to, BamH1, Smal, and HinD III restricted endonuclease.
상기 주형과 결합된 상태로 있는 올리고뉴클레오티드는 상기 주형으로부터 분리될 수 있고 그런 다음 겔 전기영동 및/또는 크로마토그래피에 의하여 정제된다. 예를 들어 적당한 정제는 SepPac(Millipore, Miford, MA) 크로마토그래피와 연계된 표준 폴리아크릴아미드/우레아 겔 전기영동을 이용하여 수행될 수 있다. 사용될 수 있는 다른 유용한 크로마토그래피 기술은 HPLC 크로마토그래피이다.The oligonucleotide that is in association with the template can be separated from the template and then purified by gel electrophoresis and / or chromatography. For example, suitable purification can be performed using standard polyacrylamide / urea gel electrophoresis in conjunction with SepPac (Millipore, Miford, MA) chromatography. Another useful chromatographic technique that may be used is HPLC chromatography.
본 발명의 키랄 포스포로티오에이트 올리고뉴클레오티드는 Stec et al. [Nucleic Acids Res., 19: 5883 (1991) 및 Stec 및 Lesnikowski [Methods in Molecular Biology, S. Agrawal, Ed., Volume 20, P.285, 1993]에 기재된 바와 같은 1,3,2-옥사티아포스폴란 중간체에 의하여 화학적으로 합성되어 질 수 있다.The chiral phosphorothioate oligonucleotides of the present invention can be synthesized by the methods described in Stec et al. Oxathia as described in Nucleic Acids Res., 19: 5883 (1991) and Stec and Lesnikowski [Methods in Molecular Biology, S. Agrawal, Ed., Volume 20, Can be chemically synthesized by phospholene intermediates.
본 발명의 방법에 따라 합성된 실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드는 다양한 방법에 의하여 분석되여질 수 있다. 예를 들어 실질적으로 순수하게 키랄성인 모두 Sp 또는 모두 Rp인 당간 결합기를 가지는 결과적으로 생성된 서열-특이적 포스포로티오에이트 올리고뉴클레오티드는 [31P]NMR 화학적 전이(shift)를 이용하여 결정될 수 있다. 그러한 화학적 이동은 포스포로티오에이트 디뉴클레오티드의 Rp 에피머를 동정하는 데 사용될 수 있다(Luclwig and Eckstein, J. Org. Chem., 631-635(1989).Phosphorothioate oligonucleotides having a substantially pure chiral inter-glyon junction group synthesized according to the method of the present invention can be analyzed by various methods. For example, the resulting sequence-specific phosphorothioate oligonucleotides having interspecific binding sites that are all purely chiral Sp or all Rp can be determined using the [ 31 P] NMR chemical shift . Such chemical shifts can be used to identify Rp epimers of phosphorothioate dinucleotides (Luclwig and Eckstein, J. Org. Chem., 631-635 (1989).
본 발명의 포스포로티오에이트 올리고뉴클레오티드의 서열의 충실도는 Sl 뉴클레아제에 대한 헤테로듀플렉스의 민감성을 이용하여 결정할 수 있다.The fidelity of the sequence of the phosphorothioate oligonucleotides of the present invention can be determined using the sensitivity of the heteroduplex to Sl nuclease.
포스포로티오에이트 올리고뉴클레오티드의 서열은 [알파-32P] 코르디세핀(cordycepin) 트리포스페이트, 즉 3'-디옥시아데노신-5'-트리포스페이트로 포스포로티오에이트 올리고뉴클레오티드의 3'-히드록실기를 라벨화함으로써 더 구체화되어 질 수 있다. 그 결과 올리고뉴클레오티드는 효소적 분해에 민감하게 된다.The sequence of the phosphorothioate oligonucleotide is [alpha- 32 P] cordycepin triphosphate, i.e. 3'-deoxy adenosine-5'-triphosphate, the 3'-hydroxycarboxylate of phosphorothioate oligonucleotides This can be further specified by labeling the actual work. As a result, oligonucleotides become sensitive to enzymatic degradation.
상보적 가닥에 결합하는 실질적으로 순수한 키랄성인 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드의 상대적 성능은 실질적으로 순수하게 키랄성인 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드 및 그것의 상보적 가닥의 혼성화 복합체의 용융 온도를 결정함으로써 비교된다. 용융온도(Tm), 이중가닥의 특징적 물리적 성질은 50% 나선 대 코일(혼성화되지 않음) 형태가 나타나는 섭씨 온도를 의미한다. Tm은 혼성화의 형성 및 붕괴(용융)을 결정하기 위해 UV 스펙트럼을 이용하여 측정된다. 혼성화 동안에 일어나는 염기 중첩은 UV 흡광도 감소(hypochromicity)와 동시에 나타난다. 따라서 UV 흡광도의 감소는 더 높은 Tm을 나타낸다. Tm이 더 높을수록 가닥의 결합 강도는 더 커진다. 비 왓슨-크릭 염기쌍은 Tm에 강하게 불안정화 영향을 미친다. 따라서 가능한 한 염기쌍이 최적 충실도에 가깝게 되는 것은 그것의 표적 RNA에 올리고뉴클레오티드의 최적 결합을 가지는 것이 바람직하다.The relative performance of phosphorothioate oligonucleotides having a substantially pure chiral linkage to a complementary strand, the phosphorothioate oligonucleotide is substantially the same as that of a phosphorothioate oligonucleotide having a substantially purely chiral interchain linker and its complementary strand hybridization complex ≪ / RTI > The melting temperature (T m ), the characteristic physical properties of the double strand, means the temperature in degrees Celsius, at which 50% helical to coil (unhybridized) form is present. The T m is measured using UV spectra to determine the formation and collapse (melting) of the hybridization. Base overlap occurring during hybridization occurs simultaneously with hypochromicity. Thus, a decrease in UV absorbance indicates a higher T m . The higher the T m , the greater the bond strength of the strands. The Biwatson-Creek base pair strongly destabilizes the T m . Therefore, it is preferable that the base pair as close to optimal fidelity as possible has an optimal binding of an oligonucleotide to its target RNA.
본 발명의 포스포로티오에이트 올리고뉴클레오티드는 또한 다양한 엑소뉴클레아제 및 엔도뉴클레아제의 분열 성능에 대한 내성에 대하여 평가될 수 있다. 포스포로티오에이트 올리고뉴클레오티드는 뉴클레아제로 처리될 수 있고 그런 다음 폴리아크릴아미드 겔 전기영동(PAGE)과 같은 방법으로 분석되고 Stains AllTM(Sigma Shem. Co., St. Louis, MO)와 같은 적당한 색소로 착색시킨다. 분해 생성물은 레이저 밀도계를 사용하여 정량할 수 있다.The phosphorothioate oligonucleotides of the present invention can also be evaluated for resistance to cleavage performance of various exonuclease and endonuclease. Phosphorothioate oligonucleotides can be treated with nuclease and then analyzed in the same manner as polyacrylamide gel electrophoresis (PAGE) and analyzed using a suitable method such as Stains All ™ (Sigma Shem. Co., St. Louis, Mo.) Colored with pigment. Decomposition products can be quantified using a laser density meter.
소 태아 및 인간 혈청이 실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드에 대한 세포핵성 활성을 평가하는 데 사용될 수 있다. 예를 들어 실질적으로 모두 Rp 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드도 이 방법으로 평가되어 질 수 있다. 3' 또는 5 말단 캡된(캡(cap)당 하나 또는 몇 개이ㅡ 포스포로티오에이트 결합기를 가지는) 분자의 조합에 관한 시험은 가장 큰 뉴클레아제 안정성을 생성시키는 조합을 만들어내는 데 사용될 수 있다. 캡핑은 정제된 Rp 모노머를 사용하여 서열의 캡 부분을 화학적으로 합성하고 DNA 합성기상의 올리고뉴클레오티드에 상기 캡을 통합시킴으로써 유효하게 이루어질 수 있다. 캡핑에 관한 분석법에 의하여 세포핵성 안정성에 대한 키랄성의 중요성 및 최대의 안정성을 얻기 위해 필요한 결합기의 수를 결정할 수 있다.Fetal and human serum can be used to assess the nucleoprotein activity of phosphorothioate oligonucleotides having a substantially pure chiral interchain linker. Phosphorothioate oligonucleotides having, for example, substantially all Rp-bp bonds can also be evaluated in this manner. Testing for combinations of 3 'or 5-terminal capped (with one or several phosphorothioate linkage groups per cap) molecule can be used to generate combinations that produce the greatest nuclease stability. Capping can be accomplished by chemically synthesizing the cap portion of the sequence using a purified Rp monomer and incorporating the cap into an oligonucleotide on the DNA synthesizer. The analysis of capping can determine the importance of chirality for the cell nucleus stability and the number of combinators required to achieve maximum stability.
RNase H의 촉매 활성에 대한 포스포로티오에이트 올리고뉴클레오티드-RNA 헤테로듀플렉스의 민감성도 또한 평가될 수 있다. 포스포로티오에이트 올리고뉴클레오티드는 혼성화하기 위한 다양한 온도에서 방사성 표지된 표적 mRNA(예를 들어 T7 RNA 폴리머라제에 의해 합성된 것)와 배양될 수 있다. 그런 다음 헤테로듀플렉스는 Minshull 및 Hunt [Nuc. Acid Res., 6433 (1986)]의 절차에 따라 E. coli의 RNase H와 함께 37℃에서 배양될 수 있다. 그 다음 생성물에 대하여 노던 블럿 분석에 의하여 RNase H 활성을 평가할 수 있고 이것은 생성물을 1.2% 아가로스/포름알데히드 겔에서 전기영동하고 니트로셀룰로오스에 옮기는 방법이다. 그런 후 여과분을 표적 mRNA에 상보적인 랜덤 프라이머 [32P)-표시된 cDNA를 사용하여 탐침하고 자동방사선에 의하여 정량하였다. RNA와 복합체를 형성할 때 RNase H에 대한 기질로서 작용하는 능력에 대한 키랄성의 영향을 결정하는 것으로서 서로 다른 포스포로티오에이트 유사체를 비교할 수 있다.The sensitivity of the phosphorothioate oligonucleotide-RNA heteroduplex to the catalytic activity of RNase H can also be assessed. Phosphorothioate oligonucleotides can be cultured with radiolabeled target mRNA (e.g., synthesized by T7 RNA polymerase) at various temperatures to hybridize. The heteroduplex is then described by Minshull and Hunt [Nuc. Acid Res., 6433 (1986)] at 37 [deg.] C with E. coli RNase H. The product can then be assayed for RNase H activity by Northern blot analysis, which is a method of electrophoresis of the product on 1.2% agarose / formaldehyde gel and transfer to nitrocellulose. The filtrate was then probed using a random primer [ 32 P] - labeled cDNA complementary to the target mRNA and quantitated by automated radiation. Different phosphorothioate analogs can be compared by determining the effect of chirality on the ability to act as a substrate for RNase H when complexed with RNA.
E. coli RNase H 및 포유류 RNase H의 촉매 활성에 대한 헤테로듀플렉스의 민감성에 대한 비교가 행하여질 수도 있다. 헤테로듀플렉스는 해독 조건하에서 토끼의 적혈구 용해물(lysate)에서 배양할 수 있고 외인성 RNase H에 의하여 mRNA를 촉매적으로 분열시키기 위한 노던 블롯 분석을 통하여 평가될 수 있다. 이것은 포유류 RNase H 활성에 대한 키랄성의 영향을 결정하도록 하여준다.A comparison may be made to the sensitivity of the heteroduplex to the catalytic activity of E. coli RNase H and mammalian RNase H. Heteroduplexes can be cultured in red blood cell lysates of rabbits under detoxification conditions and can be assessed through Northern blot analysis to catalytically cleave mRNA by extrinsic RNase H. This allows the determination of the effect of chirality on mammalian RNase H activity.
실질적으로 순수하게 키랄성인 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드는 또한 세포 배양 모델 시스템에서의 유전자 발현의 억제에 대하여 평가될 수도 있다. 실질적으로 순수하게 키랄성인 당간 결합기를 가지는 포스포로티오에이트가 더 강하거나 더 특이적인 유전자 발현의 억제자인가를 결정하기 위하여 리포터 유전자에 표적시키기 위하여 디자인된 실질적으로 순수한 키랄성 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드가 합성될 수 있고 유전자 발현의 세포 배양 모델에서 시험될 수 있다.Phosphorothioate oligonucleotides having substantially purely chiral intergranular linkages may also be evaluated for inhibition of gene expression in a cell culture model system. A phosphorothioate having a substantially pure chirality interchain bond group designed to be targeted to a reporter gene to determine whether phosphorothioate having a substantially pure chirality is a stronger or more specific inhibitor of gene expression, Eight oligonucleotides can be synthesized and tested in cell culture models of gene expression.
유전자 발현에 대한 안티센스 효과를 측정하기 위한 벡터 pSV2CAT의 용도는 종전에 알려져 있다. [Henthorn et al., Proc. Natl. Acad. Sci. U.S.A., 85: 6342 (1988)]. 이 벡터는 sv40 프로모터의 조절하에서 박테리아 클로람페니콜아세틸 트랜스퍼라제 유전자를 포함한다. CAT mRNA의 해독 개시에 상보적인 서열의 모두 Rp인 당간 결합기를 가지는 15-mer 포스포로티오에이트 올리고뉴클레오티드를 이용하여 pSV2CAT는 HeLa 세포에 형질전환 될 수 있고 세포를 48시간 동안 모두 Rp 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드로 처리한 후에 CAT 활성을 세포에서 분석할 수 있다. 실질적으로 순수하게 키랄인 당간 결합기를 가지는 포스포로티오에이트이 유전자 발현 억제 활성은 디아스테레오머성 당간 결합기를 가지는 화학적으로 합성된 랜덤 포스포로티오에이트 및 동일 서열을 가지는 천연의 포스포디에스테르 올리고뉴클레오티드와 직접 비교될 수 있다.The use of the vector pSV2CAT for measuring the antisense effect on gene expression is known heretofore. [Henthorn et al., Proc. Natl. Acad. Sci. U.S.A., 85: 6342 (1988)]. This vector contains the bacterial chloramphenicol acetyltransferase gene under the control of the sv40 promoter. PSV2CAT can be transformed into HeLa cells using a 15-mer phosphorothioate oligonucleotide with interspecific linkers, Rp, all of which are complementary to the initiation of CAT mRNA translation, CAT activity can be assayed in cells after treatment with phosphorothioate oligonucleotides. Phosphorothioate having a substantially purely chiral intergranular linkage has a gene expression inhibiting activity that is directly comparable to a chemically synthesized random phosphorothioate having a diastereomeric interchain bonding group and a natural phosphodiester oligonucleotide having the same sequence .
벡터 pSV2APAP [Marcus-Sekura et al., Nucleic Acids Research, 15:5749 (1987)]는 포유류 태반의 알칼리 포스파타제 유전자(PAP)를 포함한다. 이것은 유전자 발현에 대한 안티센스 효과를 측정하기 위한 리포터로서 사용될 수 있다. PAP는 인트론과 다른 RNA 가공(processing) 신호를 포함하는 박테리아 유전자라기 보다 포유류 유전자라는 점에서 리포터 유전자로서 CAT 보다 이점이 있다. 현재 PAP 발현은 자연적인 포유류 유전자 발현에서 현상에 더 가깝게 모방하고 있다고 여겨진다. CAT mRNA에 대하여 상기 기재된 바와 같이 실질적으로 순수하게 키랄인 당간 결합기를 가지는 15-mer 포스포로티오에이트 올리고뉴클레오티드는 화학적으로 합성된 라세미 포스포로티오에이트 및 유사한 서열을 가지는 천연의 포스포디에스테르 올리고뉴클레오티드와 병행하여 실험될 수 있다. PAP 및 CAT 리포터 구조물은 유전자 발현에 비-특이적 효과에 대하여 시험하는 상호적 실험에서 대조부로서 사용한다.The vector pSV2APAP [Marcus-Sekura et al., Nucleic Acids Research, 15: 5749 (1987)] contains the alkaline phosphatase gene (PAP) of the mammalian placenta. It can be used as a reporter to measure the antisense effect on gene expression. PAP has advantages over CAT as a reporter gene in that it is a mammalian gene rather than a bacterial gene that contains introns and other RNA processing signals. It is now believed that PAP expression mimics the phenomenon more closely in natural mammalian gene expression. A 15-mer phosphorothioate oligonucleotide having a substantially purely chiral interchain linker as described above for CAT mRNA is a chemically synthesized racemic phosphorothioate and a natural phosphodiester oligonucleotide having a similar sequence . ≪ / RTI > PAP and CAT reporter constructs are used as controls in reciprocal experiments to test for non-specific effects on gene expression.
또한 실질적으로 순수한 키랄성인 당간 결합기를 가지는 포스포로티오에이트 올리고뉴클레오티드는 생체내에서 RNA 해독의 억제자로서 작용하는 능력에 대하여 평가될 수 있다. 다양한 치료적 분야는 본 발명의 올리고뉴클레오티드에 의한 그러한 조작에 대한 목표가 될 수 있다. 하나의 치료적 분야는 C형 간염 바이러스(HCV)에 의해 야기되는 간염이다. 다음의 포스포로티오에이트 올리고뉴클레오티드는 HCV 간염치료에 적용된다: Oligo # 259, CCTTTCGCGACCCAACACTA (SEQ ID NO: 1), Oliogo # 260, GCCTTTCGCGACCCAACACT (SQ ID NO: 2), Oligo # 270, GTACCACAAGGCCTTTCGCG (SEQ ID NO: 3), Oligo #330, GTGCTCATGGTG CACGGTCT (SEQ ID NO: 4) 및 Oligo # 340, TTTAGGATTCGTGC TCATGG (SEQ ID NO: 5), 또 다른 치료분야인 염증성 질병은 세포간 세포 부착 분자 (ICAM-1)에 의하여 매개된다. 염증성 질병의 치료에 적용되는 올리고뉴클레오티드는 ISIS-2302, GCCCAAGCTGGCATCCGTCA (SEQ ID NO: 6)를 포함한다. 또 다른 치료적 분야는 시토메갈로바이러스(CMV)에 의해서 야기되는 간염을 포함한다. ISIS-2922는 CMV 망막염 치료에 적용되는 포스포로티오에이트 올리고뉴클레오티드이며 GCGTTTGCTCT TCTTCTTGCG (SEQ ID NO: 7)의 서열을 가진다. 또 다른 치료적 분야는 단백질 키나아제 C-α(PKC-α)에 의해 매개되는 암을 포함한다. ISIS-3521은 그러한 암의 치료에 적용될 수 있는 포스포로티오에이트 올리고뉴클레오티드이며 GTTCTCGCTGGTGAGTTTCA (SEQ ID NO: 8)의 서열을 가진다. 또한 이 치료적 분야는 C-raf 키나아제-매개된 암을 포함한다. ISIS-5132는그러한 암의 치료에 적용될 수 있는 포스포로티오에이트 올리고뉴클레오티드이며 TCCCGCCTGTGACATGCATT (SEQ ID NO: 9)의 서열을 가진다. 더욱이 이 치료적 분야는 Ha-ras 또는 Ki-ras에 의하여 매개되는 암을 포함한다. 하기의 포스포로티오에이트 올리고뉴클레오티드는 그러한 암의 치료에 적용될 수 있다: ISIS-2503, TCCGTCATCGCTCCTCAGGG (SEQ ID NO: 10), ISIS-2570, CCACACCAGACGGCGCCC (SEQ ID NO: 11) 및 ISIS-6957, CAGTGCCTGCGCCGCGCTCG (SEQ ID NO: 12). 또 다른 치료적 분야는 AIDS를 포함하며 HIV에 의해 매개되는 다른 관련 질병도 포함한다. ISIS-5320은 AIDS의 치료에 적용될 수 있는 포스포로티오에이트 올리고뉴클레오티드이며 TTGGGGTT (SEQ ID NO: 17)의 서열을 가진다. 상기 서열에서 올리고뉴클레오티드의 각각의 뉴클레오티드 단위는 5'에서 3' 방향으로 왼쪽에서 오른쪽으로 나열되어 있다.Phosphorothioate oligonucleotides having a substantially pure chirality glycosylated linker can also be evaluated for their ability to function as inhibitors of RNA degradation in vivo. A variety of therapeutic areas may be targets for such manipulation by the oligonucleotides of the present invention. One therapeutic area is hepatitis caused by hepatitis C virus (HCV). The following phosphorothioate oligonucleotides are applied in the treatment of HCV hepatitis: Oligo # 259, CCTTTCGCGACCCAACACTA (SEQ ID NO: 1), Oliogo # 260, GCCTTTCGCGACCCAACACT (SQ ID NO: 2), Oligo # 270, GTACCACAAGGCCTTTCGCG Another therapeutic area, inflammatory disease, is the intercellular cell adhesion molecule (ICAM-1 (SEQ ID NO: 3)), Oligo # 330, GTGCTCATGGTG CACGGTCT (SEQ ID NO: 4) and Oligo # 340, TTTAGGATTCGTGC TCATGG Lt; / RTI > Oligonucleotides that are applied in the treatment of inflammatory diseases include ISIS-2302, GCCCAAGCTGGCATCCGTCA (SEQ ID NO: 6). Another therapeutic area includes hepatitis caused by cytomegalovirus (CMV). ISIS-2922 is a phosphorothioate oligonucleotide applied to the treatment of CMV retinitis and has the sequence GCGTTTGCTCT TCTTCTTGCG (SEQ ID NO: 7). Another therapeutic area includes cancers mediated by protein kinase C-alpha (PKC-alpha). ISIS-3521 is a phosphorothioate oligonucleotide that can be applied to the treatment of such cancers and has the sequence GTTCTCGCTGGTGAGTTTCA (SEQ ID NO: 8). This therapeutic area also includes C-raf kinase-mediated cancers. ISIS-5132 is a phosphorothioate oligonucleotide applicable to the treatment of such cancers and has the sequence of TCCCGCCTGTGACATGCATT (SEQ ID NO: 9). Moreover, this therapeutic area includes cancers mediated by Ha-ras or Ki-ras. The following phosphorothioate oligonucleotides can be applied to the treatment of such cancers: ISIS-2503, TCCGTCATCGCTCCTCAGGG (SEQ ID NO: 10), ISIS-2570, CCACACCAGACGGCGCCC (SEQ ID NO: 11) and ISIS-6957, CAGTGCCTGCGCCGCGCTCG SEQ ID NO: 12). Another therapeutic area includes AIDS and other related diseases mediated by HIV. ISIS-5320 is a phosphorothioate oligonucleotide applicable to the treatment of AIDS and has the sequence of TTGGGGTT (SEQ ID NO: 17). Each nucleotide unit of the oligonucleotide in the above sequence is listed from left to right in the 5 'to 3' direction.
본 발명의 명세서에서 혼성화(hybridization)는 상보적 뉴클레오티드 단위 사이에 왓슨-크릭, 훅스틴 또는 역(reversed) 훅스틴 수소 결합일 수 있다. 수소 결합을 의미한다. 예를 들어 아데닌과 티민은 수소 결합의 형성에 의하여 결합하는 상보적 핵염기이다. 본 명세서에 사용된 바와 같이 상보적이란 것은 두 개의 뉴클레오티드 단위간에 서열 상보성에 관한 것을 의미한다. 예를 들어 올리고뉴클레오티드의 일정 위치에서 뉴클레오티드 단위가 DNA 또는 RNA 분자의 동일 위치에서의 뉴클레오티드 단위와 수소 결합할 수 있다면 올리고뉴클레오티드 및 DNA 또는 RNA는 그 위치에서 서로 상보적인 것으로 여겨진다. 올리고뉴클레오티드 및 DNA 또는 RNA는 각 분자내의 충분한 수의 대응하는 위치가 서로 수소결합할 수 있는 뉴클레오티드 단위에 의하여 차지될 때 서로 상보적이게 된다. 이와 같이 특이적으로 혼성화하는 및 상보적인은 올리고뉴클레오티드 및 표적 RNA 또는 DNA 사이에 생기는 안정되고 특이적인 결합이 되도록 충분한 정도의 상보성을 나타내는 데 사용되는 용어이다. 특이적으로 혼성화하기 위하여 올리고뉴클레오티드가 그것의 표적 DNA 서열에 100% 상동성을 가질 필요는 없는 것으로 여겨진다. 올리고뉴클레오티드의 표적 RNA 또는 DNA 분자에 대한 결합기 표적 RNA 또는 DNA의 정상적 기능을 방해할 때 올리고뉴클레오티드가 충분히 혼성화 가능한 것이고, 특이적 결합에 바람직한 조건, 즉 생체내 또는 치료학적 처리의 경우 생리적 조건에서 또는 시험관내 분석의 경우 분석이 행하여지는 조건하에서 비-표적 서열에 대한 올리고뉴클레오티드의 비-특이적 결합을 피하기 위한 충분한 정도의 상보성이 있게 된다.In the present specification, hybridization may be a Watson-Crick, Hooksteen or a reversed Hooksteen hydrogen bond between complementary nucleotide units. Hydrogen bond ". For example, adenine and thymine are complementary nuclear bases that bind by the formation of hydrogen bonds. As used herein, complementarity refers to sequence complementarity between two nucleotide units. For example, if a nucleotide unit at a certain position of an oligonucleotide can be hydrogen bonded to a nucleotide unit at the same position of the DNA or RNA molecule, the oligonucleotide and DNA or RNA are considered to be complementary to each other at that position. Oligonucleotides and DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotide units capable of hydrogen bonding to each other. Such specifically hybridizing and complementary silver is a term used to indicate a sufficient degree of complementarity to be a stable and specific binding between the oligonucleotide and the target RNA or DNA. It is not expected that oligonucleotides need to have 100% homology to its target DNA sequence to specifically hybridize. The oligonucleotide is sufficiently hybridizable when it interferes with the normal function of the binding-target RNA or DNA to the target RNA or DNA molecule of the oligonucleotide, and the conditions favorable for the specific binding, that is, under physiological conditions in the case of in vivo or therapeutic treatment, or In the case of in vitro assays, there is a sufficient degree of complementarity to avoid non-specific binding of oligonucleotides to non-target sequences under conditions under which the assay is performed.
특히 본 발명의 올리고뉴클레오티드는 진단제로서 치료용으로 사용될 수도 있고 본 발명의 양수인에게 양도된 하기 미합중국 특허출원에서 특정화된 바와 같이 연구하기 위해 사용될 수도 있다. 이 출원들의 발명의 명칭은 다음과 같다. RNA 활성을 조절하기 위한 조성물 및 방법, 제463,358호, 1/11/90 출원; 파필로마 바이러스의 안티센스 올리고뉴클레오티드 억제자, 제445,196호 12/4/89 출원; 헤르페스 바이러스의 효과를 조절하기 위한 올리고뉴클레오티드 치료, 제485,297호, 2/26/90 출원; RNA 의태를 통하여 유전자 발현을 조절하기 위한 시약 및 방법, 제497,090호, 3/21/90 출원; 지질 대사의 올리고뉴클레오티드 조절, 제516,969호, 4/30/90 출원; 시토메갈로바이러스 감염의 효과를 조절하기 위한 올리고뉴클레오티드, 제568,366호, 8/16/90 출원; 인간 면역결핍 바이러스의 안티센스 억제자, 제521,907호, 5/11/90 출원; 유전자 발현을 조절하기 위한 뉴클레아제 내성 피리딘 수식식 올리고뉴클레오티드, 제558,806호, 7/27/90 출원; 신규의 폴리아민 컨쥬게이트된 올리고뉴클레오티드, 제558,663호 7/27/90 출원; RNA 이차 구조로 저해하는 유전자 발현의 조절, 제518,929호, 5/4/90 출원; 세포부착의 올리고뉴클레오티드 조절, 제567,289호, 8/14/90 출원; 인플루엔자 바이러스의 저해, 제567,287호, 8/14/90 출원; 칸디다균의 저해, 제568,672호, 8/16/90 출원; 및 파필로마 바이러스의 안티센스 올리고뉴클레오티드 억제자, PCT/US 90/07067, 12/3/90 출원. 이들 출원들은 올리고뉴클레오티드 상호작용을 통하여 RNA 및 DNA의 활성의 향상된 조절이 이루어질 수 있는 다수의 방법을 개시하고 있다. 여기에서 개시된 특이적 서열이 본 발명과 관련하여 사용될 수 있다는 점에서 상기 미국 특허출원들의 개시 내용들은 본 명세서에 참고로 통합되어 있다.In particular, the oligonucleotides of the present invention may be used therapeutically as diagnostic agents and may be used for study as specified in the U.S. patent applications assigned to the assignee of the present invention. The names of the inventions of these applications are as follows. Compositions and methods for modulating RNA activity, 463,358, filed 1/11/90; Antisense oligonucleotide inhibitor of papilloma virus, No. 445,196, filed 12/4/89; Treatment of oligonucleotides to modulate the effects of herpesviruses, 485,297, 2/26/90 application; Reagents and methods for regulating gene expression through RNA conformation, filed 497,090, filed 3/21/90; Oligonucleotide Regulation of Lipid Metabolism, No. 516,969, filed 4/30/90; Oligonucleotides for controlling the effects of cytomegalovirus infection, 568,366, 8/16/90 application; Antisense Inhibitors of Human Immunodeficiency Virus, U.S. Patent No. 521,907, filed 5/11/90; Nuclease resistant pyridine modified oligonucleotides for controlling gene expression, U. S. Patent No. 558,806, 7/27/90; New polyamine conjugated oligonucleotides, U. S. Patent No. 558,663, 7/27/90; Regulation of gene expression that inhibits RNA secondary structure, filed < RTI ID = 0.0 > 518,929, < / RTI > Oligonucleotide regulation of cell adhesion, filed on August 5, 1987; Inhibition of influenza virus, 567,287, filed 8/14/90; Inhibition of Candida, 568,672, filed 8/16/90; And antisense oligonucleotide inhibitors of papilloma virus, PCT / US 90/07067, filed 12/3/90. These applications disclose a number of methods by which improved regulation of the activity of RNA and DNA can be achieved through oligonucleotide interaction. The disclosures of these U.S. Patent Applications are incorporated herein by reference in that the specific sequences disclosed herein may be used in connection with the present invention.
하기의 실시예는 예시적이며 본 발명의 범위를 제한하고자 하는 것이 아니다.The following examples are illustrative and are not intended to limit the scope of the invention.
실시예 1Example 1
모든 Sp 또는 모든 Rp 5'-O-(1-티오트리포스페이트)뉴클레오티드의 분리Isolation of all Sp or all Rp 5'-O- (1-thiotriphosphate) nucleotides
5'-O-(1-티오트리포스페이트)데옥시뉴클레오시드 및 리보뉴클레오시드는 OSD Hypersil(Shandon Southern, Runcon, UK)로 충진되고 A 용매(5mM 테트라부틸암모늄 이온을 포함하는 3mM 포타슘 포스페이트, pH 7.0) 및 B 용매(메탄올에 있는 5mM 테트라부틸암모늄 하이드록사이드)의 아이소크래틱 혼합물로 용리되는 칼럼을 사용하는 C-18 역상 고성능 액체 크로마토그래피(high performance liquid chromatography(HPLC))를 이용하여 분리된다. 또는 0% 내지 5% 아세토니트릴의 선형 기울기(linear gradient)를 포함하는 pH 7.5, 100mM 트리에틸암모늄 비카보네이트를 이용하여 20분간에 걸친 효과적인 분리가 수행된다.The 5'-O- (1-thiotriphosphate) deoxynucleoside and ribonucleoside were loaded with OSD Hypersil (Shandon Southern, Runcon, UK) and incubated with A solvent (3 mM potassium phosphate containing 5 mM tetrabutylammonium ion, 18 high performance liquid chromatography (HPLC) using a column eluted with an isocratic mixture of a solvent (pH 7.0) and a solvent B (5 mM tetrabutylammonium hydroxide in methanol) Separated. Or 100 mM triethylammonium bicarbonate containing a linear gradient of 0% to 5% acetonitrile over a period of 20 minutes.
이러한 HPLC 분리된 에난티오머(enantiomers)의 순도를 확립하기 위해서 상기 HPLC 분리된 Sp 및 Rp 에난티오머는 상업적으로 사용할 수 있는 E.I. Dupont, Wilmington, DE.로부터 얻을 수 있는 데옥시뉴클레오티드 5'-O-(1-티오트리포스페이트)에 비교된다.In order to establish the purity of these HPLC separated enantiomers, the HPLC separated Sp and Rp enantiomers were prepared from commercially available E.I. Compared to the deoxynucleotide 5'-O- (1-thiotriphosphate) available from Dupont, Wilmington, DE.
실시예 2Example 2
라세미 포스포로티오에이트 올리고뉴클레오티드의 실질적으로 모두 Rp 당간 결합기를 갖는 포스포로티오에이트 연장체(extension)의 합성Synthesis of phosphorothioate extension with substantially all Rp interspecific linkers of racemic phosphorothioate oligonucleotides
라세미 포스포로티오에이트 올리고뉴클레오티드 연장체의 모든 rp 포스포로티오에이트의 효소적 합성은 변형된 T7 DNA 폴리머라제 I, SequenaseTM(U.S. Biochemicals Corp., Cleveland, OH)를 사용함에 영향을 받는다. 상기 T7 DNA 폴리머라제는 18-mer 포스포로티오에이트 올리고뉴클레오티드 프라이머를 혼성하여 21-mer 천연 포스포디에스테르 올리고뉴클레오티드로 연장시키는 데 사용된다. 1×SequenaseTM반응 버퍼(U.S. Biochemicals Corp., Cleveland, OH)내의 30 picomoles(pmol)의 프라이머 및 주형(최종 vol 10㎕)은 5분동안 95℃로 가열되고 서서히 상온으로 냉각된다. 180pmol의 데옥시 5'-[α-35S] 시티딘 트리포스페이트 및 SequenaseTM효소(U.S. Biochemicals Corp., Cleveland, OH)가 첨가되고 27℃에서 약 20분간 배양된다. 그 생성물은 20% 폴리아크릴아미드/7M 우레아 변성 겔을 이용하는 폴리아크릴아미드 겔 전기영동(PAGE)을 통해 분석된다. 상기 생성물의 자동방사선 사진은 프라이머/주형이 부재하는 대조부 반응과 비교된다. 그 최종 생성물은 예를 들어 효소적 분해에 의하여 더 특징화 된다. 하나의 이러한 분해는 뱀 독성 포스파타제(snake venom phosphatase) 분해이다. E. coli DNA 폴리머라제 I을 사용하여 합성된 디뉴클레오시드 모노포스포로티오에이트의 뱀 독성 포스파타제 분해는 상기 뉴클레오시드가 Rp 배열로 된다는 것을 보여준다.Racemic phosphorothioate oligonucleotide rp all phosphorothioate enzymatic synthesis of thio-Eight nucleotide yeonjangche is influenced by the use of the modified T7 DNA polymerase I, Sequenase TM (US Biochemicals Corp. , Cleveland, OH). The T7 DNA polymerase is used to hybridize 18-mer phosphorothioate oligonucleotide primers to extend to 21-mer native phosphodiester oligonucleotides. Primers and templates (final volume 10 μl) of 30 picomoles (pmol) in 1 × Sequenase ™ reaction buffer (US Biochemicals Corp., Cleveland, OH) were heated to 95 ° C. for 5 minutes and slowly cooled to room temperature. 180 pmol of deoxy 5 '- [? - 35 S] cytidine triphosphate and Sequenase ™ enzyme (US Biochemicals Corp., Cleveland, OH) are added and incubated at 27 ° C for about 20 minutes. The product is analyzed by polyacrylamide gel electrophoresis (PAGE) using 20% polyacrylamide / 7M urea-modified gel. Autoradiography of the product is compared with the control reaction in the absence of the primer / template. The final product is further characterized, for example, by enzymatic degradation. One such degradation is snake venom phosphatase degradation. The snake toxicity phosphatase degradation of dinucleoside monophosphorothioate synthesized using E. coli DNA polymerase I shows that the nucleoside is in the Rp sequence.
실시예 3Example 3
실질적으로 순수한 Rp 당간 결합기를 갖는 포스포로티오에이트 CGACTATGCAAGTAC (SEQ ID NO: 13)의 합성Synthesis of phosphorothioate CGACTATGCAAGTAC (SEQ ID NO: 13) with substantially pure Rp interphase linker
서열 특이적인 모든 Rp 포스포로티오에이트 올리고뉴클레오티드의 대규모의 효소적 합성은 55-mer 천연 포스포디에스테르 주형 및 41-mer 천연 포스포디에스테르 프라이머를 사용하는 것에 영향을 받는다. 상기 주형의 서열은 GTACTTGCATAGTCGATCGGAAAATAGGGTTCTCATCTCCCGGGATTTGGTTGAG (SEQ ID NO: 14)이고: 상기 프라이머의 서열은 CTCAACCAAATCCCGGGAGATGAGAACCCTATTTTCCGATC (SEQ ID NO: 15)이다.Large-scale enzymatic synthesis of all sequence-specific Rp phosphorothioate oligonucleotides is influenced by the use of 55-mer native phosphodiester template and 41-mer native phosphodiester primers. The sequence of the template is GTACTTGCATAGTCGATCGGAAAATAGGGTTCTCATCTCCCGGGATTTGGTTGAG (SEQ ID NO: 14): The sequence of the primer is CTCAACCAAATCCCGGGAGATGAGAACCCTATTTTCCGATC (SEQ ID NO: 15).
상기 주형은 요구되는 특수한 CGACTATGCAAGTAC (SEQ ID NO: 13)에 상보적인 서열을 갖도록 선택되었다. SequenaseTM버퍼(U.S. Biochemicals Corp., Cleveland, OH)는 5×에서 1×로 희석되어 사용된다. 상기 주형 및 프라이머는, 둘다 20nM의 농도에서 상기 버퍼 40㎕를 첨가한다. 상기 주형 및 프라이머는 95℃에서 5분간 혼성되고 상온으로 냉각된다. 1:8로 희석된 SequenceTM효소 20㎕ 및 Sp GTPαS, CTPαS, ATPαS 및 TTPαS를 각각 320μM을 첨가한다. 상기 반응용액은 물로 140㎕로 조정한다. 37℃에서 18시간 동안 배양한다. 상기 반응용액은 표준방법에 따라 페놀과 같은 부피로 2× 추출되고 -20℃에서 100% 에탄올 2.5 부피로 처리하는 표준방법으로 침전시키고, 펠트화하여(peltize), 70% 에탄올 50㎕로 세척하고, 다시 펠트화한 후 건조시킨다. 상기 침전물은 20㎕ 물에서 30분 동안 현탁시킨 후 40㎕ 물에 1mM CaCl2, 25mM 트리스 HCl pH 8.0으로 조절된다. 상기 용액은 5분동안 95℃로 유지되고 얼음으로 급격히 냉각된다.The template was selected to have a sequence complementary to the specific CGACTATGCAAGTAC required (SEQ ID NO: 13). Sequenase TM buffer (US Biochemicals Corp., Cleveland, OH ) is used diluted in a 5 × 1 ×. The template and the primer add 40 [mu] l of the buffer at a concentration of 20 nM both. The template and the primer are mixed at 95 DEG C for 5 minutes and cooled to room temperature. 20 μl of Sequence ™ enzyme diluted 1: 8 and 320 μM of Sp GTPαS, CTPαS, ATPαS and TTPαS, respectively. The reaction solution is adjusted to 140 μl in water. Incubate at 37 ° C for 18 hours. The reaction solution was precipitated, peltized, and washed with 50 [mu] l of 70% ethanol in a standard manner, 2x extracted with the same volume as phenol and treated with 2.5 volumes of 100% ethanol at -20 [ , Again felted and dried. The precipitate is suspended in 20 쨉 l of water for 30 minutes and then adjusted to 40 쨉 l of water with 1 mM CaCl 2 , 25 mM Tris HCl, pH 8.0. The solution is maintained at 95 [deg.] C for 5 minutes and rapidly cooled with ice.
상기 주형 및 프라이머는 4.6μM DNase의 첨가하고 37℃에서 10분간 배양함에 의해서 합성된 뉴클레오티드로부터 제거된다. 상기 반응 혼합물은 2번 페놀 추출시키고 상기와 같이 에탄올로 침전시켰다. 상기 침전물을 물에서 재현탁시키고 SepPakTM크로마토그래피(Millipore, Milford, MA)와 결합하는 20% 폴리아크릴아미드/7M 우레아 겔을 사용하여 정제시킨다.The template and the primer are removed from the synthesized nucleotide by adding 4.6 [mu] M DNase and incubating at 37 [deg.] C for 10 minutes. The reaction mixture was phenol extracted twice and precipitated with ethanol as above. The precipitate is resuspended in water and purified using 20% polyacrylamide / 7M urea gel coupled with SepPak ( TM) chromatography (Millipore, Milford, Mass.).
다른 합성에 있어서, Pst 1 제한 뉴클레아제(Life Technologies, Inc., Gaithersburg, MD)는 제한부분의 프라이머-결합된 포스포로티오에이트 올리고뉴클레오티드를 분해시키는 데 사용된다. 요구되는 CGACTATGCAAGTAC )SEQ ID NO: 13) 포스포로티오에이트 올리고뉴클레오티드는 폴리아크릴아미드/SepPakTM크로마토그래피(Millipore Milford, MA)와 연계된 7M 우레아 전기영동법을 사용하여 정제된다. 수득률은 상기 반응동안 주형-프라이머의 반복적 첨가에 의해 영향을 받는 효소적 증폭법(cascade)을 이용하여 최적화된다. 상기 증폭적으로 증가된 합성은 상기 20㎖ 반응으로부터의 모두 Rp 배열인 포스포로티오에이트 올리고뉴클레오티드의 단위 75 A260을 생성한다.In other syntheses, Pst 1 restriction nuclease (Life Technologies, Inc., Gaithersburg, Md.) Is used to degrade the restriction site primer-linked phosphorothioate oligonucleotides. CGACTATGCAAGTAC required SEQ ID NO: 13) Phosphorothioate oligonucleotides are purified using 7M urea electrophoresis in conjunction with polyacrylamide / SepPak ™ chromatography (Millipore Milford, Mass.). The yield is optimized using an enzymatic amplification cascade that is effected by repeated addition of template-primers during the reaction. The amplified increased synthesis yields unit 75 A 260 of the phosphorothioate oligonucleotide, which is the entire Rp sequence from the 20 ml reaction.
실시예 4Example 4
자동화된 DNA 합성을 이용하는 당간 결합기의 라세미 혼합물을 갖는 포스포로티오에이트 올리고뉴클레오티드의 합성Synthesis of phosphorothioate oligonucleotides having a racemic mixture of intergranular linkages utilizing automated DNA synthesis
올리고뉴클레오티드는 표준방법 [Agrawal et al., Proc. Natl. Acad. Sco. U.S.A, 85:7079(1988)]인 하이드로겐 포스포네이트 화학법을 이용하는 자동화된 DNA 합성기(Applied Biosystems model 380B)에서 합성된다. 상기 최종적인 결합단계 후에, 상기 포스포로티오에이트 결합기는 카본 디설파이드/트리에틸아민/피리딘의 황으로 결합 올리고머를 산화시킴으로서 생성된다. 황산화 후에, 지지체로부터 올리고뉴클레오티드를 이탈시키고 염기 차단 그룹을 제거하기 위해서는 암모늄 하이드록시드를 사용하는 표준 탈보호 방법이 사용된다. 상기 포스포로티오에이트 올리고뉴클레오티드는 올리고뉴클레오티드 정제 칼럼(OPC; ABI, Foster City, CA) 크로마토그래피 및 Beckman System Gold HPLC를 사용하여 HPLC에 의하여 정제된다. 상기 HPLC-정제된 올리고뉴클레오티드는 에탄올로 침전시키고 20% 아크릴아미드/7M 우레아에서의 겔 전기영동법 또는 분석적인 HPLC에 의하여 최종적 순도가 평가된다. 상기 뉴클레오티드 서열의 신빙성은 피리딘/물 내의 요오드에 의한 산화 및 표준 시퀀싱 방법에 의해서 평가된다. 이들 뉴클레오티드는 각각의 포스포러스 결합기에서 Rp 및 Sp 이성질체의 모든 가능한 조합의 혼합물을 포함한다.Oligonucleotides can be prepared by standard methods [Agrawal et al., Proc. Natl. Acad. Sco. U.S.A., 85: 7079 (1988)], using an automated DNA synthesizer (Applied Biosystems model 380B) using hydrogenphosphonate chemistry. After the final coupling step, the phosphorothioate linker is formed by oxidizing the bonded oligomer with sulfur of carbon disulfide / triethylamine / pyridine. After sulfation, a standard deprotection method using ammonium hydroxide is used to remove the oligonucleotide from the support and remove the base blocking group. The phosphorothioate oligonucleotides are purified by HPLC using an oligonucleotide purification column (OPC; ABI, Foster City, CA) chromatography and Beckman System Gold HPLC. The HPLC-purified oligonucleotides are precipitated with ethanol and the final purity is assessed by gel electrophoresis in 20% acrylamide / 7M urea or analytical HPLC. The authenticity of the nucleotide sequence is assessed by standard oxidation and oxidation by iodine in pyridine / water. These nucleotides comprise a mixture of all possible combinations of the Rp and Sp isomers in each phosphorous linker.
실시예 5Example 5
열역학적 및 동력학적 혼성화 분석을 위해 T7 RNA 폴리머라제를 사용하는 상보적 DNA 또는 RNA 서열의 합성Synthesis of complementary DNA or RNA sequences using T7 RNA polymerase for thermodynamic and kinetic hybridization assays
천연 포스포디에스테르 결합기의 짧은 상보적 DNA 올리고뉴클레오티드의 합성은 ABI model 380B DNA 합성기에서 표준 자동화 합성을 이용하여 수행된다. 정확한 길이의 상기 뉴클레오티드는 HPLC에 의해서 정제되고 표준기술에 의해서 서열분석된다.Synthesis of short complementary DNA oligonucleotides of native phosphodiester linkage groups is performed using standard automated synthesis in an ABI model 380B DNA synthesizer. The nucleotides of the correct length are purified by HPLC and sequenced by standard techniques.
혼성분석을 위한 짧은, 상보적 RNA 뉴클레오티드의 합성을 위해 T7 RNA 폴리머라제가 사용된다. 고농도에서는 많은 양의 T7 RNA 폴리머라제가 짧은 RNA를 합성하는 데 요구되는 많은 개시 싸이클이 필요하다. 이러한 요구에 의하면, 상기 RNA 폴리머라제는 Brookhaven National Laboratory(U[ton, NY)로부터 구할 수 있는 BL21/pAR1219, T7 RNA 폴리머라제 발현 벡터를 포함하는 E. coli의 균주(strain)로부터 제거된다. 상기의 떨어진 부분은 2ℓ의 세포로부터 대략 300,000 내지 500,000 T7 RNA 폴리머라제 단위, 흡광도=1.2 A600생성된다. 이것은 짧은 (10-30 뉴클레오티드) RNA 종(species)의 합성을 위해서 충분히 농축된다. 합성에 있어서, 상보적 표적 서열 및 T7 프로모터 혼성화 서열을 포함하는 T7 프로모터 및 주형은 ABI 합성기(ABI, Foster City, CA)를 사용하여 합성된다. 주형 및 프로모터는 효소적 합성을 위해 올바른 종(species)이 존재함을 확실히 하기 위해서 HPLC로 정제된다. 합성된 생성물은 20% 폴리아크릴아미드/8M 우레아 겔에서 정제되고 표준과정에 의해서 서열분석된다.T7 RNA polymerase is used for the synthesis of short, complementary RNA nucleotides for hybrid analysis. At high concentrations, large amounts of T7 RNA polymerase require many initiation cycles required to synthesize short RNAs. According to this requirement, the RNA polymerase is removed from a strain of E. coli containing the BL21 / pAR1219, T7 RNA polymerase expression vector available from Brookhaven National Laboratory (U [ton, NY]). This distant part is generated from approximately 2,000 cells to approximately 300,000 to 500,000 T7 RNA polymerase units, absorbance = 1.2 A 600 . It is sufficiently concentrated for the synthesis of short (10-30 nucleotides) RNA species. In the synthesis, T7 promoters and templates containing complementary target sequences and the T7 promoter hybridization sequence are synthesized using an ABI synthesizer (ABI, Foster City, Calif.). Templates and promoters are purified by HPLC to ensure that the correct species is present for enzymatic synthesis. The synthesized product is purified on a 20% polyacrylamide / 8M urea gel and sequenced by standard procedures.
실시예 6Example 6
열적 변성Thermal degeneration
올리고뉴클레오티드(본 발명 또는 그밖의 포스포로티오에이트 올리고뉴클레오티드)는 10mM 이온 강도 버퍼(89.8mM NaCl, 10mM Na-phosphate, pH, 7.0, 0.2mM EDTA)내의 각각의 올리고뉴클레오티드를 위한 4μM 표준농도에서 상보적 DNA 또는 RNA 올리고뉴클레오티드와 배양된다. 시료들은 90℃로 가열되고 Guilford Response II 스펙트로포토미터(Corning)를 사용하여 초기 흡수된다. 그 후 시료들은 서서히 15℃로 냉각되고 상기 변화는 열변성 과정동안 260nm에서의 흡수가 모니터된다. 상기 온도가 1도 상승되면/흡수 판독 및 변성 측면은 용융곡선의 최초 유도체를 취하여 분석한다. 데이타 또한 상기 Tm및 델타 G를 구분하기 위한 2-단계 선형 역행 분석을 이용하여 분석된다. 이들 시험의 결과는 표 1에 나타내었다.The oligonucleotides (the present invention or other phosphorothioate oligonucleotides) were complemented at 4 μM standard concentrations for each oligonucleotide in 10 mM ionic strength buffer (89.8 mM NaCl, 10 mM Na-phosphate, pH, 7.0, 0.2 mM EDTA) Lt; RTI ID = 0.0 > oligonucleotides. ≪ / RTI > Samples are heated to 90 ° C and initially absorbed using a Guilford Response II spectrophotometer (Corning). The samples are then slowly cooled to 15 DEG C and the change is monitored for absorption at 260 nm during the thermal denaturation process. If the temperature is raised by one degree / absorptive readout and denaturation aspects are taken by taking the first derivative of the melting curve. The data are also analyzed using a two-step linear regression analysis to distinguish the T m and delta G from each other. The results of these tests are shown in Table 1.
[표 1][Table 1]
실시예 7Example 7
방사성표지된 올리고뉴클레오티드의 합성Synthesis of radiolabeled oligonucleotides
필터 결합 분석(filter binding assay)은 여러 가지 포스포로티오에이트 올리고뉴클레오티드의 결합 엄격성(stringency), 즉 그것들의 혼성화되고 DNA 또는 RNA와 헤테로듀플렉스를 형성하는 경향성을 정량하기 위해서 사용된다. 이들 분석은 방사성표지된 올리고뉴클레오티드를 필요로 한다.Filter binding assays are used to quantify the binding stringency of several phosphorothioate oligonucleotides, i.e. their tendency to hybridize and form a heteroduplex with DNA or RNA. These assays require radiolabeled oligonucleotides.
모든 Rp 당간 결합기들을 갖는 포스포로티오에이트 올리고뉴클레오티드들은 Sp 모노머들로부터 정제되어진 [35S]-모노머들로부터 효소적 방법에 의해 합성된다. 혼합된 키랄성 당간 결합기들을 포함하는 포스포로티오에이트 올리고뉴클레오티드의 자동화된 합성을 위하여, 올리고뉴클레오티드는 하이드로겐 포스포네이트를 포함하도록 합성된 후 피리딘/카본 디설파이드 혼합물에서 원소[35S]의 존재하에 황화된다. 그 결과 방사성표지된 포스포로티오에이트 올리고뉴클레오티드는 OPC 크로마토그래피 및 HPLC에 의해서 정제될 수 있다. 표적 mRNA는 니트로셀룰로오스 필터에 이용되고 80℃에서 2분간 구어진 후, 차단되고 방사성표지된 포스포로티오에이트 올리고뉴클레오티드와 혼성화된다. 결합의 엄격성은 온도의 증가후 또는 Tris NaCl 버퍼와 같은 용리용(eluting) 버퍼의 이온력이 증가한 후에 필터로부터 용리되는 방사성표지된 올리고뉴클레오티드를 정량함으로써 평가된다. 용리된 올리고뉴클레오티드는 포스페이트 버퍼를 동등하게 이용하는 음이온 교환 HPLC 프로토콜에서의 이동성에 대하여 분석된다. 그 결과는 조합한 당간 결합기의 라세미 혼합물을 갖는 표준 올리고뉴클레오티드의 이동성과 비교된다.Phosphorothioate oligonucleotides with all Rp interphase linkers are synthesized by enzymatic methods from [ 35 S] - monomers purified from Sp monomers. For the automated synthesis of phosphorothioate oligonucleotides containing mixed chiral intergranular bond groups, the oligonucleotides are synthesized to include a hydrogen phosphonate and then reacted in the presence of an element [ 35 S] in a pyridine / carbon disulfide mixture do. As a result, radiolabeled phosphorothioate oligonucleotides can be purified by OPC chromatography and HPLC. The target mRNA is used in a nitrocellulose filter and blasted at 80 ° C for 2 minutes before hybridization with blocked and radiolabeled phosphorothioate oligonucleotides. The stringency of binding is assessed by quantifying the radiolabeled oligonucleotide eluted from the filter after increasing temperature or after increasing the ionic force of an eluting buffer such as Tris NaCl buffer. The eluted oligonucleotides are analyzed for mobility in an anion exchange HPLC protocol that equally utilizes phosphate buffer. The results are compared to the mobility of standard oligonucleotides with a racemic mixture of conjugated sugar-linker groups.
실시예 8Example 8
뉴클레아제 분해Neclease decomposition
10% 소 태아 혈청(FCS)를 포함하는 배양액에서 포스포로티오에이트 올리고뉴클레오티드의 뉴클레아제 분열의 속도의 결정은 10% 열불활성 FCS를 포함하는 Dulbecco's Modified Essential Medium(DMEM)에서 수행된다. 상기 FCS의 열불활성은 배양액에 첨가되기 전에 55℃에서 1시간 동안 실행된다. 라세미 및 순수한 키랄성 당간 결합기를 갖는 올리고뉴클레오티드 뉴클레아제 절단에 대한 저항에 대하여 따로따로 평가된다. 각 66㎍/㎖의 올리고뉴클레오티드는 각각 배양액에 첨가되고 37℃에서 배양되며, 그 때의 시간 간격은 표 2에 나타낸 바와 같다. 15㎕의 앨리큇(Aliquots)을 제거하고 0.1M Tris-HCl(pH 8.3), 0.1M 붕산 및 2mM EDTA 중의 9M 우레아 15㎕에 첨가하였다. 앨리큇은 와동(vortex)시켜 혼합하고 -20℃에서 보관하였다. 폴리아크릴아미드 겔 전기영동(PAGE) 분석은 20% 폴리아크릴아미드/7M 우레아 슬랩 겔을 사용하였다. 하기의 전기 영동법에서 겔은 Stains All(Signa Chem. CO., St. Louis, MO)을 사용하여 착색되었다. 탈착색시킨 다음, 겔은 UltraScan XL 장치(Pharmacia LKB Biotechnology, Uppsala, Sweden)를 사용하는 레이저 밀도계로 분석되었다.Determination of the rate of nucleolytic cleavage of phosphorothioate oligonucleotides in culture medium containing 10% fetal bovine serum (FCS) is carried out in Dulbecco's Modified Essential Medium (DMEM) containing 10% heat-inactivated FCS. The thermal inactivation of the FCS is carried out at 55 DEG C for 1 hour before being added to the culture medium. The resistance to cleavage of oligonucleotide nuclease with racemic and pure chiral intergranular linkage is evaluated separately. Each 66 μg / ml oligonucleotide was added to the culture medium and incubated at 37 ° C, with the time intervals shown in Table 2. 15 μl of aliquots were removed and added to 15 μl of 9 M urea in 0.1 M Tris-HCl (pH 8.3), 0.1 M boric acid and 2 mM EDTA. Allium were vortexed and stored at -20 ° C. Polyacrylamide gel electrophoresis (PAGE) analysis used 20% polyacrylamide / 7M urea slab gel. In the following electrophoresis, the gel was stained using Stains All (Signa Chem. CO., St. Louis, Mo.). After desorption, the gel was analyzed with a laser density meter using an UltraScan XL instrument (Pharmacia LKB Biotechnology, Uppsala, Sweden).
집적이 이루어지면 배양 전의 총길이(n)로부터 n-1까지의 감소를 퍼센트로 나타낸다. Rp 순수한 키랄성 당간 결합기들을 갖는 올리고뉴클레오티드 서열 CGACTATGCAAGTAC(SEQ ID NO: 6)에 대한 결과는 표 2에 나타내었다.When integration is performed, the percentage decrease from the total length (n) to n-1 before incubation is indicated. The results for the oligonucleotide sequence CGACTATGCAAGTAC (SEQ ID NO: 6) with Rp pure chiral intergranular linkages are shown in Table 2.
[표 2][Table 2]
표 2에서 나타난 바와 같이 실질적으로 순수한 키랄성 당간 결합기들을 갖는 포스포로티오에이트 올리고뉴클레오티드의 뉴클레아제 분해에 대한 내성은 라세미 당간 결합기들을 갖는 포스포로티오에이트 올리고뉴클레오티드의 내성보다 우수했다는 것을 보여준다.As shown in Table 2, the resistance to phosphorylation of phosphorothioate oligonucleotides having substantially pure chiral intergranular linking groups was superior to that of phosphorothioate oligonucleotides with linkages between racemic sugars.
실시예 9Example 9
RNASE H 분석RNASE H analysis
라세미 및 실질적으로 순수한 키랄성 당간 결합기를 갖는 포스포로티오에이트 RNase H에 대한 민감성에 대해 분석된다. 올리고뉴클레오티드(RNA에 대해 2-배 초과된 몰 함량) 및 시험관 내에서 합성된 mRNA(T7 RNA 폴리머라제 프로모터를 사용하는)는 5㎕(3.1Kb) RNase H 혼성화 버퍼에서 60℃로 30분 동안 배양되었다. 시료들은 서서히 상온으로 냉각되었고 3.7mg/㎕ BSA, 20 단위 E. coli RNase H(Promega), 142mM DTT, 150mM KCl, 및 3mM MgCl2로 조절된다. 시료들은 37℃에서 30분간 배양된다. 그리고 나서 시료들은 페놀로 추출되고, 에탄올로 침전시키고, 그리고 하기 에티듐 브로마이드 착색한 1.2% 아가로스 겔에서 전기 영동법에 의해 분석하였다. RNA 시료들의 대략적인 길이를 결정하기 위해서 시료들과 함께 마커(marker)가 겔에서 동시에 이동한다.The sensitivity to phosphorothioate RNase H with racemic and substantially pure chiral inter-diacyl linkages is analyzed. Oligonucleotides (molar excess of 2-fold for RNA) and mRNA synthesized in vitro (using the T7 RNA polymerase promoter) were incubated in 5 [mu] l (3.1 Kb) RNase H hybridization buffer for 30 min at 60 [ . Samples were slowly cooled to room temperature and adjusted with 3.7 mg / l BSA, 20 units E. coli RNase H (Promega), 142 mM DTT, 150 mM KCl, and 3 mM MgCl 2 . Samples are incubated at 37 ° C for 30 minutes. Samples were then extracted with phenol, precipitated with ethanol, and analyzed by electrophoresis on a 1.2% agarose gel stained with thiuram bromide. In order to determine the approximate length of the RNA samples, the markers move simultaneously in the gel with the samples.
실시예 10Example 10
HCV가 원인이 되는 간염을 앓고 있는 환자는 Oligo #259(SEQ ID NO: 1), Oligo #260(SEQ ID NO: 2), Oligo #270(SEQ ID NO: 3), Oligo #330(SEQ ID NO: 4) 또는 Oligo #340(SEQ ID NO: 5)로 치료하며, 이들 각각은 실시예 3 또는 실시예 19의 과정에 따라 합성된다. 올리고뉴클레오티드의 1-1000㎍/kg 체중량은 제약학적으로 수용가능한 담체에 첨가되어 정맥을 통해서 또는 근육을 통해서 투입되었다. 치료는 질병이 제거될 때까지 필요에 따라 반복될 수도 있다.Patients suffering from hepatitis caused by HCV have been found to be at increased risk of developing hepatitis in patients with hepatitis due to the combination of Oligo # 259 (SEQ ID NO: 1), Oligo # 260 (SEQ ID NO: 2), Oligo # 270 NO: 4) or Oligo # 340 (SEQ ID NO: 5), each of which is synthesized according to the procedure of Example 3 or Example 19. 1-1000 μg / kg body weight of oligonucleotide was added to the pharmaceutically acceptable carrier and injected via the vein or through the muscle. Treatment may be repeated as needed until the disease is removed.
실시예 11Example 11
ICAM-1에 의해 조절되는 염증성 질병을 앓고 있는 환자들은 실시예 3 또는 실시예 19에 의해서 합성되는 올리고뉴클레오티드, 및 그 서열 GCCCAAGCTGGCATCCGTCA(SEQ ID NO: 6)를 갖는 올리고뉴클레오티드 ISIS-2302로 치료된다. 올리고뉴클레오티드의 1-1000㎍/kg 체중량은 약제학적으로 수용가능한 담체에 첨가되어 정맥 또는 근육을 통해서 투입되었다. 치료는 질병이 제거될 때까지 반복될 수도 있다.Patients suffering from inflammatory diseases that are modulated by ICAM-1 are treated with the oligonucleotide synthesized by Example 3 or Example 19, and the oligonucleotide ISIS-2302 with its sequence GCCCAAGCTGGCATCCGTCA (SEQ ID NO: 6). 1-1000 占 퐂 / kg body weight of oligonucleotide was added to the pharmaceutically acceptable carrier and injected via vein or muscle. Treatment may be repeated until the disease is removed.
실시예 12Example 12
사이토메갈로 바이러스에 의한 망막염을 앓고 있는 환자는 실시예 3 또는 실시예 9에 의해 합성되고 GCGTTTGCTCTTCTTCTTGCG(DEQ ID NO: 7) 서열을 갖는 올리고뉴클레오티드 ISIS-2922로 치료된다. 올리고뉴클레오티드의 1-1000㎍/kg 체중량은 약제학적으로 수용가능한 담체에 첨가되어 정맥 또는 근육을 통해서 투입되었다. 치료는 질병이 제거될 때까지 반복될 수도 있다.Patients suffering from retinitis caused by cytomegalovirus are treated with the oligonucleotide ISIS-2922 synthesized by Example 3 or Example 9 and having the sequence GCGTTTGCTCTTCTTCTTGCG (DEQ ID NO: 7). 1-1000 占 퐂 / kg body weight of oligonucleotide was added to the pharmaceutically acceptable carrier and injected via vein or muscle. Treatment may be repeated until the disease is removed.
실시예 13Example 13
PKC-α-조절되는 암을 앓고 있는 환자는 실시예 또는 실시예 9에 의해 합성된 올리고뉴클레오티드, 및 GTTCTCGCTGGTGAGTTTCA(SEQ ID NO: 8) 서열을 갖는 올리고뉴클레오티드, ISIS-2922로 치료된다. 올리고뉴클레오티드 1-1000㎍/kg 체중량은 약제학적으로 수용가능한 담체에 첨가되어 정맥 또는 근육을 통해서 투입되었다. 치료는 질병이 제거될 때까지 반복될 수도 있다.Patients suffering from PKC- [alpha] -controlled cancer are treated with an oligonucleotide synthesized according to Example or Example 9, and an oligonucleotide having the sequence GTTCTCGCTGGTGAGTTTCA (SEQ ID NO: 8), ISIS-2922. 1-1000 μg / kg body weight of oligonucleotide was added to the pharmaceutically acceptable carrier and injected via vein or muscle. Treatment may be repeated until the disease is removed.
실시예 14Example 14
C-raf 키나아제-조절되는 암을 앓고 있는 환자는 실시예 3 또는 실시예 19에 의해 합성된 올리고뉴클레오티드, 및 TCCCGCCTGTGACATGCATT(SEQ ID NO: 9) 서열을 갖는 올리고뉴클레오티드 ISIS-5132로 치료되었다. 올리고뉴클레오티드의 1-1000㎍/kg 체중량은 약제학적으로 수용가능한 담체에 첨가되어 정맥 또는 근육을 통해서 투입되었다. 치료는 질병이 제거될 때까지 반복될 수도 있다.Patients suffering from C-raf kinase-regulated cancer were treated with an oligonucleotide synthesized by Example 3 or Example 19 and an oligonucleotide ISIS-5132 with the sequence TCCCGCCTGTGACATGCATT (SEQ ID NO: 9). 1-1000 占 퐂 / kg body weight of oligonucleotide was added to the pharmaceutically acceptable carrier and injected via vein or muscle. Treatment may be repeated until the disease is removed.
실시예 15Example 15
C-raf 키나아제-조절되는 암을 앓고 있는 환자는 실시예 3 또는 실시예 19에 의해 각각 합성된 ISIS-2503(SEQ ID NO: 10), ISIS-2570(SEQ ID NO: 11) 또는 ISIS-6957(SEQ ID NO: 12)로 치료되었다. 올리고뉴클레오티드의 1-1000㎍/kg 체중량은 약제학적으로 수용가능한 담체에 첨가되어 정맥 또는 근육을 통해서 투입되었다. 치료는 질병이 제거될 때까지 반복될 수도 있다.Patients suffering from C-raf kinase-modulating cancer were selected from ISIS-2503 (SEQ ID NO: 10), ISIS-2570 (SEQ ID NO: 11) or ISIS-6957 (SEQ ID NO: 12). 1-1000 占 퐂 / kg body weight of oligonucleotide was added to the pharmaceutically acceptable carrier and injected via vein or muscle. Treatment may be repeated until the disease is removed.
실시예 16, 17 및 18의 화합물 1, 2 및 3은 Stec et al. [Nucleic Acids Res., 19:5883(1991)] 및 Stec and Lesnikowski [Methods in Molecular Biology, S. Agrawal, Ed., Volume 20, p. 285, 1993]에 의해 합성된다.Compounds 1, 2 and 3 of Examples 16, 17 and 18 were prepared according to Stec et al. [Nucleic Acids Res., 19: 5883 (1991)] and Stec and Lesnikowski [Methods in Molecular Biology, S. Agrawal, Ed., Volume 20, p. 285, 1993).
실시예 16Example 16
2-클로로-1,3,2-옥사티아포스폴렌의 합성(1)Synthesis of 2-chloro-1,3,2-oxathiaphospholene (1)
피리딘(1mol), 벤진(400㎖), 2-머캅토에탄올(0.5mol) 및 포스포러스 트리클로라이드(0.5mol)의 혼합물은 상온에서 30분 동안 교반된다. 피리디늄 클로라이드는 여과되어 제거되고, 용매는 감압하에 증기화되고 조(crude) 생성물은 감압하에 증류되어 정제된다. 70-72℃/20mmHg에서 끓는 분액들을 수집하여31P NMR에 의하여 특성화하였다.A mixture of pyridine (1 mol), benzene (400 mL), 2-mercaptoethanol (0.5 mol) and phosphorus trichloride (0.5 mol) was stirred at room temperature for 30 minutes. The pyridinium chloride is filtered off, the solvent is evaporated under reduced pressure and the crude product is distilled off under reduced pressure. Boiling separations at 70-72 ° C / 20 mmHg were collected and characterized by 31 P NMR.
실시예 17Example 17
N,N-디이소프로필아미노-1,3,2-옥사티아포스폴렌의 합성(2)Synthesis of N, N-diisopropylamino-1,3,2-oxathiaphospholene (2)
화합물 1(0.2mol)은 n-펜탄(300mol)에 용해되고 디이소프로필아민이 적하하여 첨가된다. 그 반응물은 상온에서 30분간 교반되고, 그 후 디이소프로필아민 하이드로클로라이드는 여과되고, 용매는 감압하에 증기화되고, 그 조 생성물은 진공 증류에 의해서 정제된다. 생성물 2는 70℃/0.1mmHg에서 끓는 분액으로서 얻어졌고31P NMR 및 질량 분석기에 의해서 특성화하였다.Compound 1 (0.2 mol) was dissolved in n-pentane (300 mol) and diisopropylamine was added dropwise. The reaction is stirred at room temperature for 30 minutes, after which the diisopropylamine hydrochloride is filtered off, the solvent is evaporated under reduced pressure and the crude product is purified by vacuum distillation. Product 2 was obtained as a boiling fraction at 70 ° C / 0.1 mmHg and characterized by 31 P NMR and mass spectrometry.
실시예 18Example 18
5'-O-디메톡시트리틸티미딘-3'-O[2-티오노-1,3,2-옥사티아포스폴렌]의 합성(3)Synthesis of 5'-O-dimethoxytrityl thymidine-3'-O [2-thio-1,3,2-oxathiaphospholene] (3)
5'-O-디메톡시트리틸티미딘(10mmol) 및 1H-테트라졸(11mmol)은 진공 건조되고 디클로로메탄(25㎖)에 용해시켰다. 화합물 2(11mmol)는 그 용액에 첨가되고 그 반응물은 상온에서 2시간 동안 교반되었다. 건조된 황원소(15mmol)가 첨가되고 그 반응물은 상온에서 16시간 동안 교반되었다. 미반응 황은 여과되고 그 여과물은 감압하에서 농축된다. 잔여물은 클로로포름(3㎖)에 용해되고 우선 클로로포름으로 용리시키고, 그 다음에 클로로포름:메탄올(97:3)로 용리시키는 실리카 겔(230-400 메쉬) 칼럼 크로마토그래피에 의해서 정제된다. 화합물 3의 개개의 디아스테레오머성 종류는 실리카 겔상의 칼럼 크로마트그래피에 의하여 얻어진다. 화합물 3은 에틸 아세테이트에 용해되고 실리카 겔 60H 칼럼상에 적용된다. 에틸 아세테이트는 용리 용매로 사용되고, 용리(elution)는 HPTLC(실리카 겔 60, 전개 용매로서 에틸아세테이트를 사용)에 의하여 관찰된다. 화합물 3의 분리된 디아스테레오머를 포함하는 분액들은 감압하에서 농축되고 그 잔여물은31P NMR 및 HPLC(Lichrospher Si 100, 5μM, 용리제로서 에틸 아세테이트를 사용, 3㎖/min의 유량속도)에 의해서 특성화된다. 빠르게 용리되는 분액은 Sp 디아스테레오머에 해당하고, 느리게 용리되는 분액은 Rp 디아스테레오머에 해당한다.5'-O-dimethoxytrityl thymidine (10 mmol) and 1H-tetrazole (11 mmol) were dried in vacuo and dissolved in dichloromethane (25 mL). Compound 2 (11 mmol) was added to the solution and the reaction was stirred at ambient temperature for 2 hours. A dried sulfur element (15 mmol) was added and the reaction was stirred at ambient temperature for 16 hours. Unreacted sulfur is filtered off and the filtrate is concentrated under reduced pressure. The residue was dissolved in chloroform (3 mL) and purified first by silica gel (230-400 mesh) column chromatography eluting with chloroform and then eluting with chloroform: methanol (97: 3). The individual diastereomeric classes of compound 3 are obtained by column chromatography on silica gel. Compound 3 is dissolved in ethyl acetate and applied on a silica gel 60H column. Ethyl acetate was used as elution solvent and elution was observed by HPTLC (silica gel 60, using ethyl acetate as developing solvent). The separations containing the separated diastereomers of compound 3 were concentrated under reduced pressure and the residue was purified by 31 P NMR and HPLC (Lichrospher Si 100, 5 uM, using ethyl acetate as eluent at a flow rate of 3 ml / min) . The rapidly eluting fraction corresponds to the Sp diastereomer and the slowly eluting fraction corresponds to the Rp diastereomer.
실시예 19Example 19
고체상 자동화 합성에서 5'-OH 뉴클레오시드 및 순수한 디아스테레오머성 3 사이에서의 반응의 입체특이성 조절Modulation of the stereospecificity of the reaction between the 5'-OH nucleoside and the pure diastereomeric 3 in solid phase automated synthesis
Stec et al.의 절차는 적합한 Biosystems(Foster City, CA) model 380B 자동화 DNA 합성기를 사용하여 진행하였다. 상기 5'-OH 뉴클레오시드 및 3과 같은 순수한 디아스테레오머성 뉴클레오시드 옥사티아포스폴란 사이의 반응은 촉매로 1,8-디아자바이시클로(5.4.0)운데크-7-엔(DBU)의 사용을 필요로 한다. 자동화된 DNA 합성기내의 지지체 매트릭스에 올리고뉴클레오티드를 부착시키기 위해 사용하는 상업적으로 구입가능한 결합제는 DBU에 대해 불안정하기 때문에, 결합제의 변형이 필요하다. 옥사티아포스폴란 방법을 통한 올리고뉴클레오티드의 합성에 적합한 결합제는 DBU에 대한 내성이 있는 숙시닉-사코시닐(succinic-sarcosinyl) 결합제이고, 상온에서 1시간 이하로 농축된 암모늄 하이드록사이드에 의해서 가수분해될 수 있다.The procedure of Stec et al. Was performed using a suitable Biosystems (Foster City, CA) model 380B automated DNA synthesizer. The reaction between the 5'-OH nucleoside and the pure diastereomeric nucleoside oxathiaphospholane, such as 3, was catalyzed by the reaction of 1,8-diazabicyclo (5.4.0) undec-7-ene (DBU ). ≪ / RTI > A commercially available binding agent used to attach oligonucleotides to a support matrix in an automated DNA synthesizer is unstable to DBU and therefore requires modification of the binding agent. Suitable binders for the synthesis of oligonucleotides via the oxathiaphospholane method are succinic-sarcosinyl binders resistant to DBU and are prepared by ammonium hydroxide concentrated at < Can be decomposed.
(A) 숙시닉-사코시닐 결합제를 통한 고체 매트릭스에 결합되는 5'-O-디메톡시트리틸뉴클레오시드의 합성:(A) Synthesis of 5'-O-dimethoxytrityl nucleoside bound to a solid matrix via a succinic-sarcosinyl binder:
(1) N-Fmoc-사코신(sarcosine)(Bachem Bioscience, Inc., Philadelphia, PA)(1.6mmol)이 긴 사슬 알킬 아민-CPG(LCA-CPG, Sigma, St. Louis, MO)(2g)에 첨가되고 진공하에서 건조되었다. 무수 DMF(5㎖), 피리딘(0.5㎖) 및 DCC(2.4mmol)이 첨가되고 그 반응물은 상온에서 12시간 동안 교반된다. 상기 용매는 여과되고 그 지지체는 메탄올:아세토니트릴:피리딘(1:1:1, 3×20㎖)으로 세척된다. 상기 N-Fmoc 보호 그룹은 피리딘내의 10% 피페리딘 용액 10㎖로 지지체를 다룸으로써 제거된다. N-사코시닐화된(sarcosinylated) LCA-CPG는 메탄올:아세토니트릴:피리딘(1:1:1, 3×20㎖)로 세척되고 진공하에서 건조된다.(1) N-Fmoc-sarcosine (Bachem Bioscience, Inc., Philadelphia, PA) (1.6 mmol) was dissolved in long chain alkylamine-CPG (LCA-CPG, Sigma, St. Louis, MO) Lt; / RTI > and dried under vacuum. Anhydrous DMF (5 mL), pyridine (0.5 mL) and DCC (2.4 mmol) were added and the reaction stirred at room temperature for 12 hours. The solvent is filtered off and the support is washed with methanol: acetonitrile: pyridine (1: 1: 1, 3 x 20 ml). The N-Fmoc protecting group is removed by treating the support with 10 ml of 10% piperidine solution in pyridine. The N-sarcosinylated LCA-CPG is washed with methanol: acetonitrile: pyridine (1: 1: 1, 3 x 20 ml) and dried under vacuum.
(2) 5'-O-디메톡시트리틸뉴클레오시드는 (1)에서 설명한 바와 같이 DMF(2㎖), 피리딘(0.2㎖) 및 DCC(50mg)의 존재하에서 얻어진 그 반응물은 상온에서 12시간동안 혼합된 후 메탄올:아세토니트릴:피리딘(1:1:1, 3×20㎖)로 세척되고, 진공에서 건조된다. 건조 후, 상기 지지체는 N-메틸이미다졸:THF(1㎖) 및 아세틱 무수물/루티딘(1㎖)에서 15분간 처리된다. 그후 상기 지지체는 메탄올:아세토니트릴:피리딘(1:1:1, 3×10㎖)로 세척된 후, 진공하에서 건조된다.(2) The 5'-O-dimethoxytrityl nucleoside was obtained in the presence of DMF (2 ml), pyridine (0.2 ml) and DCC (50 mg) as described in (1) And washed with methanol: acetonitrile: pyridine (1: 1: 1, 3 x 20 ml) and dried in vacuo. After drying, the support is treated with N-methylimidazole: THF (1 ml) and acetic anhydride / lutidine (1 ml) for 15 minutes. The support is then washed with methanol: acetonitrile: pyridine (1: 1: 1, 3 x 10 ml) and then dried under vacuum.
(B) 순수한 디아스테레오머성 활성화된 뉴클레오시드는 그후 300-배 과량인 물 함량의 DBU 존재하에서 사코시닐 LCA-CPG 지지체에 부착된 올리고뉴클레오티드에 첨가된다. 상기 활성화된 뉴클레오시드의 디아스테레오머는 커플링 반응에 사용되기 전에 칼럼 크로마토그래피 [실리카 겔 60H, 에틸 아세테이트는 용리 용매로 사용되고 용리는 HPTLC(실리카 겔 60, 전개 용매로서 에틸 아세테이트를 사용)에 의해 관찰된다]에 의해서 분리된다. 그 합성 프로토콜은 표 3에 나타내었다.(B) The pure diastereomerically active nucleoside is then added to the oligonucleotide attached to the saccharide LCA-CPG support in the presence of a water content of DBU of 300-fold excess. The diastereomer of the activated nucleoside was purified by column chromatography [silica gel 60H, ethyl acetate was used as elution solvent and elution was carried out by HPTLC (silica gel 60, using ethyl acetate as developing solvent) Are observed. The synthesis protocol is shown in Table 3.
[표 3][Table 3]
상기 포스포로티오에이트 올리고뉴클레오티드이 디아스테레오머성 순도는31P NMR에 의해서, HPLC (Lichrospher Siloo, SμM, 용리제로서 에틸 아세테이트, 유량속도 3㎖/min), 효소적 또는 전기영동적 방법에 의해서 결정될 수 있다.The diastereomeric purity of the phosphorothioate oligonucleotide can be determined by 31 P NMR, by HPLC (Lichrospher Siloo, SμM, ethyl acetate as eluent, flow rate 3 ml / min), enzymatic or electrophoretic methods .
실시예 20Example 20
인간 환자에 있어서 질병 상태의 치료Treatment of disease states in human patients
본 발명의 올리고뉴클레오티드는 다양한 질병상태의 치료를 위해서 사용된다. 특별한 질병으로 진단받은 환자의 치료는 적절한 방법으로 환자에게 약학적으로 수용되는 형식으로, 올리고뉴클레오티드의 효과적인 복용을 조절하는 것으로 이루어진다.The oligonucleotides of the present invention are used for the treatment of various disease states. Treatment of a patient diagnosed with a particular disease consists of modulating the effective dose of the oligonucleotide in a pharmaceutically acceptable manner to the patient in an appropriate manner.
효과적인 올리고뉴클레오티드의 양은 치료되는 질병의 상태, 질병상태의 심각성 및 치료를 받는 환자의 나이에 의존한다. 올리고뉴클레오티드의 유효량은 IC50에 기초하여 결정되고 이는 당분야의 기술자에게는 일반적인 절차이다. 상대적으로 올리고머의 유효얄은 약물동태학적 소프트웨어 프로그램 TopFit을 이용하여 결정된다. 예를 들어 올리고뉴클레오티드의 사용량은 질병상태에 따라 체중 kg당 0.01㎍(아이들)부터 100g(상인)까지 다양한다. 유사하게, 그 사용빈도는 질병의 상태에 의존하고 하루에 한번 또는 그 이상에서 매해 20년에 한번까지 다양한다.The amount of effective oligonucleotide will depend on the condition of the disease being treated, the severity of the disease condition, and the age of the subject being treated. An effective amount of oligonucleotide of the nucleotide is determined based on the IC 50, which is a common procedure for skilled in the art. Relatively effective oligomers are determined using the pharmacokinetic software TopFit. For example, the amount of oligonucleotides used varies from 0.01 micrograms per kg body weight (children) to 100 grams (merchant) per body weight depending on the disease condition. Similarly, the frequency of use depends on the condition of the disease and varies from once a day or more to once every 20 years.
올리고뉴클레오티드 투여경로는 치료되는 질병상태에 의존한다. 예를 들면, 염증성 질환에 대한 치료를 받는 환자에 대한 올리고뉴클레오티드의 투여는 경구 또는 직장을 통하여 이루어진다. AIDS에 감염된 환자의 치료에 있어서, 올리고뉴클레오티드 투여의 가장 효과적인 방법은 경구투여 또는 피하주사이다. 유방암과 같은 암은 피하주사를 통해서 치료되는 반면, 결장암은 올리고뉴클레오티드의 경구 또는 직장투여로 치료된다. 중추신경계의 질병 또는 장애는 환자의 척추나 뇌에 대한 올리고뉴클레오티드의 운반을 위하여 포막 또는 심실을 통하여 치료된다. 올리고뉴클레오티드의 투여에 이어서, 그 환자는 질병의 상태와 관련된 중상의 경감에 대해 관찰된다. 그 후 치료를 위한 질병상태의 심각성 및 순용매 따라 (증가 또는 감소) 그 사용량이 조정된다. 본 발명의 올리고뉴클레오티드를 바람직하게 투여하기 위해서 다른 일반적인 요법과 결합될 수 있다. 상기 뉴클레오티드는 AIDS에 걸린 환자의 치료를 위한 AZT, 궤양성 대장염과 같은 염증성 장애의 치료를 위한 설파살라진(sulfasalazine), 및 결장암의 치료를 위한 5-플루오로우라실 등을 포함하는 약물과 함께 투여될 수 있으나 여기에 한정되는 것은 아니다.The route of administration of the oligonucleotide depends on the disease state being treated. For example, the administration of an oligonucleotide to a patient undergoing treatment for an inflammatory disease is through the oral or rectal route. In treating patients infected with AIDS, the most effective method of administering oligonucleotides is oral or subcutaneous injection. Cancers such as breast cancer are treated by subcutaneous injection, whereas colon cancer is treated with oral or rectal administration of oligonucleotides. The disease or disorder of the central nervous system is treated through the capsule or ventricle for delivery of oligonucleotides to the spinal cord or brain of the patient. Following administration of the oligonucleotide, the patient is observed for alleviating the severity of the disease associated with the condition. Thereafter, the severity of the disease state for treatment and the net solvent usage (increase or decrease) are adjusted accordingly. The oligonucleotides of the present invention can be combined with other general therapies for the preferred administration. The nucleotides can be administered with drugs including AZT for the treatment of patients with AIDS, sulfasalazine for the treatment of inflammatory disorders such as ulcerative colitis, and 5-fluorouracil for the treatment of colon cancer, But are not limited thereto.
또한, 환자의 질병상태의 성공적인 치료를 위해서 투여 지속 요법이 바람직하다. 지속요법의 일부로써 올리고뉴클레오티드 투여의 빈도 및 사용량은 체중 kg당 0.01㎍에서 100g까지, 하루에 한번 또는 그 이상에서 매 몇 년에 한번까지 범위가 다양하다.Also, for successful treatment of a patient ' s disease condition, sustained-dose therapy is preferred. As part of sustained therapy, the frequency and amount of oligonucleotide administration ranges from 0.01 μg to 100 g per kg of body weight, from once a day or more to once every few years.
실시예 21Example 21
올리고뉴클레오티드의 심실내 투여Intraventricular administration of oligonucleotides
환자의 뇌에 대한 약물의 직접적인 운반을 위한 내심실의 약물 투여는 질병이 뇌에 감염된 환자의 치료에 바람직하다. 올리고뉴클레오티드 투여의 이러한 유형을 효과적이도록 하기 위해서, 실리콘 카테테르(catheter)가 환자뇌의 뇌실(ventricle)에 외과적으로 삽입되고, 복부에 외과적으로 이식된 피하주입 펌프(Medtronic Inc, Minneapolis, MN)에 연결된다 [Cancer Research, 44:1698(1984)]. 상기 펌프는 올리고뉴클레오티드를 투입하는데 사용되고 사용량 조절을 정확히 하며 내부적 프로그래밍 장치의 목적에 따른 사용량 계획의 범위를 정확하게 한다. 상기 펌프의 보유 능력은 18-20㎖이고 주입속도는 0.1㎖/h에서 1㎖/h의 범위이다. 매일에서 매달에 이르는 투여의 빈도에 의존하여 약물의 양이 체중 kg당 0.01㎍에서 100g까지 조절되고, 펌프의 보유고가 3-10주의 간격으로 다시 채워진다. 펌프의 재충진은 펌프의 자가 봉합 격벽(septum)의 단일 경피 구멍을 통해서 이루어진다.Drug administration of the myocardium for direct delivery of the drug to the patient's brain is desirable for the treatment of patients infected with the disease. To make this type of oligonucleotide administration effective, a silicone catheter was inserted surgically into the ventricle of the patient's brain and subcutaneously infused into the abdomen (Medtronic Inc, Minneapolis, MN) ) [Cancer Research, 44: 1698 (1984)]. The pump is used to inject oligonucleotides and allows precise dosing control and precise dosing schedules for the purpose of the internal programming device. The holding capacity of the pump is 18-20 ml and the injection rate is in the range of 0.1 ml / h to 1 ml / h. Depending on the frequency of administration from day to month, the amount of drug is regulated from 0.01 μg to 100 g per kg of body weight, and the reservoir of the pump is refilled at intervals of 3-10 weeks. The refilling of the pump takes place through a single perforated hole in the pump's self-sealing septum.
실시예 22Example 22
올리고뉴클레오티드의 포막내 투여Intratumoral administration of oligonucleotides
환자의 척추의 칼럼에 약물의 삽입을 위한 관부적 약물조절은 중추신경계의 질환을 앓고 있는 환자에게 바람직하다. 올리고뉴클레오티드 조절의 이러한 경로를 효과적으로 하기 위해 환자의 L3-4 요추의 내면에 실리콘 카테터가 외과적으로 주입되고, 이것은 상복부에 외과적으로 주입된 피하주입 펌프에 연결된다[The Annals of Pharmacotherapy, 27:912(1993) and Cancer, 41:1270(1993)] 상기 펌프는 올리고뉴클레오티드를 투입하는 데 사용되고 사용량 조절을 정확히 하며 내부적 프로그래밍 장치의 목적에 따른 사용량 계획의 범위를 정확하게 한다. 상기 펌프의 보유 능력은 18-20㎖이고 주입 속도는 0.1㎖/h에서 1㎖/h의 범위이다. 매일에서 매달에 이르는 투여의 빈도에 의존하여 약물의 양이 체중 kg당 0.01㎍에서 100g까지 조절되고, 펌프의 보유고가 3-10주의 간격으로 다시 채워진다. 펌프의 재충진은 펌프의 자가 봉합 격벽(septum)의 단일 경피 구멍을 통해 이루어진다.Tubular drug control for drug insertion in the patient's spinal column is desirable for patients suffering from central nervous system disorders. To effectively effect this pathway of oligonucleotide regulation, a silicone catheter is surgically implanted into the patient's L3-4 lumbar spine, which is connected to a surgically implanted subcutaneous infusion pump at the epigastrium [The Annals of Pharmacotherapy, 27: 912 (1993) and Cancer, 41: 1270 (1993)] The pump is used to inject oligonucleotides and precisely controls dosage and precisely schedules dosing schedules for purposes of internal programming devices. The holding capacity of the pump is 18-20 ml and the injection rate is in the range of 0.1 ml / h to 1 ml / h. Depending on the frequency of administration from day to month, the amount of drug is regulated from 0.01 μg to 100 g per kg of body weight, and the reservoir of the pump is refilled at intervals of 3-10 weeks. The refilling of the pump takes place through a single perforation in the septum of the pump's self-sealing septum.
실시예 23Example 23
AIDS를 앓고 있는 환자는 실시예 3 또는 실시예 19에 의해 합성된 올리고뉴클레오티드 ISIS-5320으로 치료되고, TTGGGGTT(SEQ ID NO: 17) 서열을 갖는다. 올리고뉴클레오티드의 체중량 1~1000㎍/kg은 약학적으로 수용가능한 담체내에 있게 되고 유리체내로(intravitreally) 조절된다. 감염이 제거될 때까지 필요에 따라 치료가 반복된다.The patient suffering from AIDS is treated with the oligonucleotide ISIS-5320 synthesized by Example 3 or Example 19, and has the sequence TTGGGGTT (SEQ ID NO: 17). The weight of the oligonucleotide of 1 to 1000 占 퐂 / kg is in a pharmaceutically acceptable carrier and is intravitreally regulated. Treatment is repeated as needed until the infection is removed.
서열목록Sequence List
(1) 일반적 정보 :(1) General information:
(i) 출원인 : 아이시스 파마슈티컬즈 인코포레이티드(i) Applicant: Isis Pharmacists Inc.
(ii) 발명의 명칭 : 높은 키랄 순수성의 포스포로티오에이트 결합자를 가지는 올리고뉴클레오티드(ii) Title of the invention: Oligonucleotides having a phosphorothioate linker with high chiral purity
(iii) 염기서열의 수 : 17(iii) Number of base sequences: 17
(iv) 주소 :(iv) Address:
(A) 수신인 : 우드콕 워시번 쿠르쯔 매키워즈 노리스(A) Recipient: Woodcock Washburn Burke McCarthy Norris
(B) 거리명 : 원 리버티 플레이스-46쓰 플로어(B) Street name: One Liberty Place-46 floor
(C) 도시명 : 필라델피아City: Philadelphia
(D) 주명 : PA(D) Title: PA
(E) 국명 : 미합중국(E) Country: United States of America
(F) 우편번호 :19103(F) Postal Code: 19103
(v) 컴퓨터 해독 형태 :(v) Computer decryption mode:
(A) 매체 형태 : 3.5인치 디스크, 720 Kb(A) Media type: 3.5 inch disc, 720 Kb
(B) 컴퓨터 : IBM PC 호환가능(B) Computer: IBM PC compatible
(C) 작동 시스템 : PC-DOS/MS-DOS(C) Operating system: PC-DOS / MS-DOS
(D) 소프트웨어 : 워드퍼펙트 6.1(D) Software: WordPerfect 6.1
(vi) 본 출원에 대한 데이타 :(vi) Data for this application:
(A) 출원번호 : PCT/US96/08757(A) Application number: PCT / US96 / 08757
(B) 출원일 : 1996. 6. 5.(B) Filing date: June 5, 1996
(C) 분류 : N/A(C) Classification: N / A
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/471,967(A) Application number: 08 / 471,967
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/467,597(A) Application No. 08 / 467,597
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 :08/468,447(A) Application number: 08 / 468,447
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/468,569(A) Application number: 08 / 468,569
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/466,692(A) Application number: 08 / 466,692
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/471,966(A) Application number: 08 / 471,966
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/469,851(A) Application number: 08 / 469,851
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(vii) 종전 출원에 대한 데이타 :(vii) Data on previous application:
(A) 출원번호 : 08/470,129(A) Application No. 08 / 470,129
(B) 출원일 : 1995. 6. 6.(B) Filing date: June 6, 1995
(viii) 대리인 정보 :(viii) Agent information:
(A) 성명 : 조셉 루시(A) Name: Joseph Lucy
(B) 등록번호 : 33,307(B) Registration number: 33,307
(C) 참조/서류번호 : ISIS-2298(C) Reference / Document Number: ISIS-2298
(ix) 통신 정보 :(ix) Communication information:
(A) 전화번호 : 215-568-3100(A) Phone: 215-568-3100
(B) 텔레팩스 : 215-568-3439(B) Telepax: 215-568-3439
(2) 서열 ID NO : 1에 관한 정보 :(2) Information on SEQ ID NO: 1:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20 염기쌍(A) Length: 20 base pairs
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열 기재 : SEQ ID NO: 1:(xi) SEQ ID NO: 1:
CCTTTCGCGA CCCAACACTA20CCTTTCGCGA CCCAACACTA20
(2) 서열 ID NO : 2에 관한 정보 :(2) Information on SEQ ID NO: 2:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 2:(xi) SEQ ID NO: 2:
GCCTTTCGCG ACCCAACACT20GCCTTTCGCG ACCCAACACT20
(2) 서열 ID NO : 3에 관한 정보 :(2) Information on SEQ ID NO: 3:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 3:(xi) SEQ ID NO: 3:
GTACCACAAG GCCTTTCGCG20GTACCACAAG GCCTTTCGCG20
(2) 서열 ID NO : 4에 관한 정보 :(2) Information on SEQ ID NO: 4:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 4:(xi) SEQ ID NO: 4:
GTGCTCATGG TGCACGGTCT20GTGCTCATGG TGCACGGTCT20
(2) 서열 ID NO : 5에 관한 정보 :(2) Information on SEQ ID NO: 5:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 5:(xi) SEQ ID NO: 5:
TTTAGGATTC GTGCTCATGG20TTTAGGATTC GTGCTCATGG20
(2) 서열 ID NO : 6에 관한 정보 :(2) Information on SEQ ID NO: 6:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 6:(xi) SEQ ID NO: 6:
GCCCAAGCTG GCATCCGTCA20GCCCAAGCTG GCATCCGTCA20
(2) 서열 ID NO : 7에 관한 정보 :(2) Information on SEQ ID NO: 7:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 21(A) Length: 21
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 7:(xi) SEQ ID NO: 7:
GCGTTTGCTC TTCTTCTTGC G21GCGTTTGCTC TTCTTCTTGC G21
(2) 서열 ID NO : 8에 관한 정보 :(2) Information on SEQ ID NO: 8:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 8:(xi) SEQ ID NO: 8:
GTTCTCGCTG GTGAGTTTCA20GTTCTCGCTG GTGAGTTTCA20
(2) 서열 ID NO : 9에 관한 정보 :(2) Information on SEQ ID NO: 9:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 9:(xi) SEQ ID NO: 9:
TCCCGCCTGT GACATGCATT20TCCCGCCTGT GACATGCATT20
(2) 서열 ID NO : 10에 관한 정보 :(2) Information on SEQ ID NO: 10:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 10:(xi) SEQ ID NO: 10:
TCCGTCATCG CTCCTCAGGG20TCCGTCATCG CTCCTCAGGG20
(2) 서열 ID NO : 11에 관한 정보 :(2) Information on SEQ ID NO: 11:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 17(A) Length: 17
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열 기재 : SEQ ID NO: 11:(xi) SEQ ID NO: 11:
CCACACCGAC GGCGCCC17CCACACCGAC GGCGCCC17
(2) 서열 ID NO : 12에 관한 정보 :(2) Information on SEQ ID NO: 12:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 20(A) Length: 20
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 12:(xi) SEQ ID NO: 12:
CAGTGCCTGC GCCGCGCTCG20CAGTGCCTGC GCCGCGCTCG20
(2) 서열 ID NO : 13에 관한 정보 :(2) Information on SEQ ID NO: 13:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 15(A) Length: 15
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 13:(xi) SEQ ID NO: 13:
CGACTATGCA AGTAC15CGACTATGCA AGTAC15
(2) 서열 ID NO : 14에 관한 정보 :(2) Information on SEQ ID NO: 14:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 56(A) Length: 56
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 14:(xi) SEQ ID NO: 14:
GTACTTGCAT AGTCGATCGG AAAATAGGGT TCTCATCTCC CGGGATTTGG50GTACTTGCAT AGTCGATCGG AAAATAGGGT TCTCATCTCC CGGGATTTGG50
TTTGAG56TTTGAG56
(2) 서열 ID NO : 15에 관한 정보 :(2) Information on SEQ ID NO: 15:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 41(A) Length: 41
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 15:(xi) SEQ ID NO: 15:
CTCAACCAAA TCCCGGGAGA TGAGAACCCT ATTTTCCGAT C41CTCAACCAAA TCCCGGGAGA TGAGAACCCT ATTTTCCGAT C41
(2) 서열 ID NO : 16에 관한 정보 :(2) Information on SEQ ID NO: 16:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 14(A) Length: 14
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 16:(xi) SEQ ID NO: 16:
GACTATGCAA GTAC14GACTATGCAA GTAC14
(2) 서열 ID NO : 17에 관한 정보 :(2) Information on SEQ ID NO: 17:
(i) 서열특성 :(i) Sequence properties:
(A) 길이 : 8(A) Length: 8
(B) 유형 : 핵산(B) Type: Nucleic acid
(C) 가닥형태 : 단일(C) Strand Form: Single
(D) 위상 : 선형(D) Phase: Linear
(ii) 분자형태 : DNA(게놈)(ii) Molecular form: DNA (genome)
(xi) 서열기재 : SEQ ID NO: 17:(xi) SEQ ID NO: 17:
TTGGGGTT8TTGGGGTT8
Claims (6)
Applications Claiming Priority (15)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/466,692 US5654284A (en) | 1991-10-15 | 1995-06-06 | Oligonucleotides for modulating RAF kinase having phosphorothioate linkages of high chiral purity |
US8/468447 | 1995-06-06 | ||
US8/470129 | 1995-06-06 | ||
US08/470,129 US5635488A (en) | 1991-10-15 | 1995-06-06 | Compounds having phosphorodithioate linkages of high chiral purity |
US08/471,967 US5599797A (en) | 1991-10-15 | 1995-06-06 | Oligonucleotides having phosphorothioate linkages of high chiral purity |
US08/467,597 US5607923A (en) | 1991-10-15 | 1995-06-06 | Oligonucleotides for modulating cytomegalovirus having phosphorothioate linkages of high chiral purity |
US8/469851 | 1995-06-06 | ||
US8/471966 | 1995-06-06 | ||
US8/467597 | 1995-06-06 | ||
US8/470,129 | 1995-06-06 | ||
US08/468,447 US5576302A (en) | 1991-10-15 | 1995-06-06 | Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity |
US08/471,966 US5661134A (en) | 1991-10-15 | 1995-06-06 | Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity |
US8/466692 | 1995-06-06 | ||
US8/471967 | 1995-06-06 | ||
US08/469,851 US5587361A (en) | 1991-10-15 | 1995-06-06 | Oligonucleotides having phosphorothioate linkages of high chiral purity |
Publications (2)
Publication Number | Publication Date |
---|---|
KR19990022536A true KR19990022536A (en) | 1999-03-25 |
KR100257972B1 KR100257972B1 (en) | 2000-08-01 |
Family
ID=27569793
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1019970709017A KR100257972B1 (en) | 1995-06-06 | 1996-06-05 | Oligonucleotides having phosphorothioate linkages of high chiral purity |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR100257972B1 (en) |
-
1996
- 1996-06-05 KR KR1019970709017A patent/KR100257972B1/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
KR100257972B1 (en) | 2000-08-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU698739B2 (en) | Oligonucleotides having phosphorothioate linkages of high chiral purity | |
US5607923A (en) | Oligonucleotides for modulating cytomegalovirus having phosphorothioate linkages of high chiral purity | |
US5576302A (en) | Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity | |
US5599797A (en) | Oligonucleotides having phosphorothioate linkages of high chiral purity | |
US5587361A (en) | Oligonucleotides having phosphorothioate linkages of high chiral purity | |
US5661134A (en) | Oligonucleotides for modulating Ha-ras or Ki-ras having phosphorothioate linkages of high chiral purity | |
US5635488A (en) | Compounds having phosphorodithioate linkages of high chiral purity | |
US5620963A (en) | Oligonucleotides for modulating protein kinase C having phosphorothioate linkages of high chiral purity | |
US5506212A (en) | Oligonucleotides with substantially chirally pure phosphorothioate linkages | |
CA2121144C (en) | Oligonucleotides having chiral phosphorus linkages | |
JP3529135B2 (en) | How to cut a specific RNA strand | |
AU661662B2 (en) | Sugar modified oligonucleotides that detect and modulate gene expression | |
US5532130A (en) | Methods and compositions for sequence-specific hybridization of RNA by 2'-5' oligonucleotides | |
Sanghvi et al. | Antisense oligodeoxynucleotides: synthesis, biophysical and biological evaluation of oligodeoxynucleotides containing modified pyrimidines | |
US5654284A (en) | Oligonucleotides for modulating RAF kinase having phosphorothioate linkages of high chiral purity | |
JP2005522997A (en) | Oligonucleotides containing alternating segments and uses thereof | |
AU2003202376A1 (en) | Oligonucleotides comprising alternating segments and uses thereof | |
JP2003012688A (en) | Oligonucleotide n3'->p5' phosphoramidate: synthesis and compound: hybridization and nuclease resistance characteristic | |
JPH03190895A (en) | Nucleotide modification compound | |
US6339066B1 (en) | Antisense oligonucleotides which have phosphorothioate linkages of high chiral purity and which modulate βI, βII, γ, δ, Ε, ζ and η isoforms of human protein kinase C | |
KR100257972B1 (en) | Oligonucleotides having phosphorothioate linkages of high chiral purity | |
WO1999000401A1 (en) | 3'-monophosphorylating oligonucleotides |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20090121 Year of fee payment: 10 |
|
LAPS | Lapse due to unpaid annual fee |