KR19990022531A - VIII-protein receptor HNTNAD2 - Google Patents

Abstract

The present invention relates to human G-protein PAF receptor polypeptides, DNA (RNA) encoding such polypeptides, and methods for producing such polypeptides by recombinant techniques. The present invention also describes methods of using such polypeptides to identify antagonists and agents against such polypeptides and therapeutically using agents and antagonists to treat diseases associated with low and overexpression of PAF receptor polypeptides. do. Also described are diagnostic methods for detecting PAF receptor nucleic acid sequences and detecting soluble forms of receptors in a sample derived from a host.

Description

VIII-protein receptor HNTNAD2

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and the preparation of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human 7-permeable membrane receptors presumably identified as platelet activating factor receptors, hereinafter referred to as G-protein PAF receptors. The invention also relates to inhibiting the action of such polypeptides.

In many medically important physiological processes, it has been found that intervening proteins participate in signal transduction pathways associated with second messengers such as G-proteins and / or CAMPs [Ref. Lefkowitz, Nature, 351: 353-354 (1991). As used herein, these proteins refer to proteins that intervene in pathways with G-proteins or PPG proteins. Representative examples of these proteins include GPC receptors such as adrenergic and dopamine receptors (Kobilka, B.K., et al., PNAS, 84: 46-50 (1987); Kobilka, B.K., et al., Science, 238: 650-656 (1987); Bunzow, JR, et al., Nature, 336: 783-787 (1988)], agonist proteins such as G-protein, phospholipase C, adenyl cyclase, phosphodiesterase, and protein kinase A Agonist proteins such as protein kinase C (Simon, MI, et al., Science 252: 802-8 (1991)).

For example, the hormonal binding effect of some form of signal transduction is the activation of the enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones depends on the presence of nucleotide GTP and GTP also affects hormone binding. G-proteins bind hormone receptors to adenylate cyclase. When G-proteins are activated by hormone receptors, it appears to exchange GTP for binding GDP. The GTP-carrying form then binds to activated adenylate cyclase. When GTP is hydrolyzed to GDP by the G-protein itself, the G-protein returns to its basic inactive form. Thus, G-proteins serve as a relay for transmitting signals from receptors to effectors and as a clock for controlling the duration of the signals.

The membrane protein gene family of G-protein coupled receptors is characterized by having eight putative membrane domains. This domain represents the permeable membrane α-helix connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of physiologically active receptors such as hormones and viral growth factors and neuroreceptors.

G-protein coupled receptors are characterized as comprising seven conservative hydrophobic stretches of about 20 to 30 amino, linking at least eight different hydrophilic loops. G-protein systems of binding receptors include dopamine receptors that bind neurological drugs used in the treatment of mental and neurological diseases. Another G-protein family includes calcitonin, adrenaline, endothelin, cAMP, adenosine, muscarin, acetylcholine, serotonin, histamine, thrombin, kinin, polyclerate stimulating hormone, opsin, endothelial differential gene-1 receptor and rhodopsin, fragrance , Cytomegalovirus receptors, and the like.

Most of the G-protein coupled receptors have a single conserved cysteine residue in each of the two first extracellular loops that form a disulfide bond that is believed to stabilize the functional protein structure. Seven permeable membrane regions are designated TM1, TM2, TM3, TM4, TM5, TM6, TM7. TM3 is closely related to signal conversion.

Phosphorylation and lipidation of cysteine residues (palmitoxidation or farnes oxidation reactions) can affect the signal transduction of certain G-protein coupled receptors. Most G-protein coupled receptors have a phosphorylation site in the third cytoplasmic loop and / or carboxy terminus. For many G-protein coupled receptors, such as β-adrenoceptors, phosphorylation by protein kinase A and / or specific receptor kinases is associated with receptor desensitization.

The ligand binding site of the G-protein binding receptor comprises a hydrophilic socket formed by several G-protein binding receptor permeable membrane domains and surrounded by hydrophobic residues of the G-protein binding receptor. The hydrophilic sites of each G-protein coupled receptor permeable membrane helix are considered to form inwardly polar ligand binding sites. TM3 is closely associated with several G-protein binding receptors by having a ligand binding site, such as comprising a TM3 aspartate residue. In addition, TM5 serine, TM6 asparagine, TM6 or TM7 phenylalanine or tyrosine are involved in ligand binding.

G-protein coupled receptors are bound intracellularly with various intracellular enzymes, ion channels and carriers by heterotrimeric G-proteins. Johnson et al., Endoc., Rev., 10: 317-331 ( 1989). Different G-protein α-subunits preferentially stimulate specific effectors to regulate various physiological functions in the cell. Phosphorylation of cytoplasmic residues of G-protein coupled receptors has been found to be an important mechanism for regulating G-protein binding of certain G-protein coupled receptors. G-protein coupled receptors are found in many places in mammalian hosts.

According to one aspect of the present invention, novel mature receptor polypeptides and fragments, analogs and derivatives thereof are physiologically active and diagnostically or therapeutically useful. Receptor polypeptides of the invention are of human origin.

According to another aspect of the invention, an isolated nucleic acid encoding a receptor polypeptide of the invention, including mRNA, DNA, cDNA, genomic DNA and antisense analogs thereof and fragments thereof physiologically active and diagnostically and therapeutically useful Provide a molecule.

According to another aspect of the invention, a recombinant technique comprising culturing a recombinant prokaryotic and / or eukaryotic host cell having a nucleic acid sequence encoding a receptor polypeptide under conditions that enhance expression and recovery of the receptor polypeptide of the invention. The present invention provides a method for producing a receptor polypeptide.

According to another aspect of the invention, an antibody against a polypeptide of the invention is provided.

According to another aspect of the invention, there is provided a method for screening a compound that binds to and activates or inhibits its activity of a receptor polypeptide of the invention.

According to another aspect of the invention, there is provided a method of administering to a host a compound that binds to and activates a receptor polypeptide of the invention useful for inducing platelet clotting to prevent and / or treat hemophilia and promote wound healing.

According to another aspect of the present invention, activation in combination with a receptor polypeptide of the present invention useful for preventing and / or treating allergy, flu, restenosis after angioplasty, unstable eye, myocardial infarction, and pulmonary or pulmonary preemic disease Provided are methods for administering a compound to a host.

According to another aspect of the invention, there is provided a nucleic acid probe consisting of a nucleic acid molecule having a length sufficient to specifically hybridize a polynucleotide sequence of the invention.

According to another aspect of the present invention, there is provided a diagnostic assay for detecting a disease associated with a mutation in a nucleic acid sequence encoding a polypeptide of the invention and for detecting the level of alteration of the soluble form of the receptor polypeptide.

According to another aspect of the present invention, there is provided a method of using the receptor polypeptide of the present invention or a polynucleotide encoding the same for scientific research, DNA synthesis, and DNA vector production.

These or other aspects of the invention will be apparent to those of skill in the art.

The following drawings illustrate embodiments of the invention and do not limit the scope of the invention, which is included in the claims.

1 shows the cDNA sequence of the G-protein receptor of the invention identified as platelet activator receptor and the corresponding estimated amino acid sequence. Use standard one letter abbreviations for amino acids. 373 automated DNA sequencer (Applied Biosystems, Inc.).

Figure 3 shows the amino acid alignment of the G-protein (upper row) of the invention and that of human PAF receptor (lower row).

According to an aspect of the invention, an isolation encoding a mature polypeptide having the inferred amino acid sequence of FIG. 1 (SEQ ID NO: 2) or a mature polypeptide encoded by cDNA of a clone deposited with ATCC Accession No. 1, June 1, 1995. Nucleic acid (polynucleotide) is provided.

Nucleotides encoding the polypeptides of the invention are found in white blood cells, lungs, kidneys. The polynucleotides of the present invention have been found in cDNA libraries extracted from human thyroid and are structurally related to the G protein-PAF receptor family. It has an open reading frame that encodes a protein of 337 amino acid residues. The protein has a high degree of similarity, showing 29.375% identity and 53.438% similarity with the human PAF receptor in the 334 amino acid chain.

The polynucleotides of the present invention may be in the form of RNA or in the form of DNA including cDAN, genomic DNA and synthetic DNA. DNA is a double strand or single strand, and in the case of the Japanese strand, it is either a coding strand or a non-coding (antisense) strand. The coding sequence encoding the mature polypeptide matches the genetic coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone, or due to duplication or denaturation of the genetic code, the coding sequence appears in FIG. 1 (SEQ ID NO: 1) or DNA. Or may be a different genetic coding sequence encoding the same mature polypeptide as the deposited cDNA.

The polynucleotide encoding for a mature polypeptide of FIG. 1 (SEQ ID NO: 2) or a mature polypeptide encoded by cDNA may comprise a mature polypeptide coding sequence; Mature polypeptide coding sequence and additional coding sequence; Mature polypeptide coding sequences (and optionally additional coding sequences) and non-coding sequences such as introns or non-coding sequences 5 'and / or 3' of mature polypeptide coding sequences.

The term polynucleotide encoding a polypeptide refers to a polynucleotide comprising a polypeptide coding sequence as well as a polynucleotide comprising additional coding and / or noncoding sequences.

The invention also relates to variants of the polynucleotides described above encoding fragments, analogs and derivatives of the polypeptides having the putative amino acid sequence of FIG. 1 (SEQ ID NO: 2) or polypeptides encoded by cDNA of deposited clones. Variants of polynucleotides are naturally occurring alleles of a polypeptide or artificial variants of polynucleotides.

Thus, the present invention is directed to fragments, derivatives or analogues of the polypeptide of FIG. 1 (SEQ ID NO: 2) or variants of the polynucleotide encoding the polypeptide encoded by the cDNA of the deposited clone, as shown in FIG. 1 (SEQ ID NO: 2). Polynucleotides encoding the same mature polypeptide encoded by the mature polypeptide or cDNA of a deposited clone. Such nucleotide variants include deletion and replacement variants, addition or insertion variants.

As noted above, the polynucleotide has a naturally occurring allelic variant of the coding sequence shown in FIG. 1 (SEQ ID NO: 2) or the coding sequence of the deposited clone. As is known in the art, allelic variants do not substantially alter the function of the coding polypeptide as a variant form of polynucleotide in which one or more nucleotides have been replaced, deleted or added.

The polynucleotide also encodes an soluble form of the PAF receptor polypeptide, the extracellular portion of the polypeptide digested from the TM and the intracellular domain of the full length polypeptide of the invention.

Since the polynucleotide of the present invention is fused with a marker sequence in a frame to a coding sequence, the polypeptide of the present invention can be purified. The marker sequence is a hexahistidine tag supplied by the pQE-9 vector to purify the mature polypeptide fused to the label for bacterial hosts or a hemagglutinin (HA) tag for mammalian hosts such as COS-7 cells. . HA tags correspond to epitopes extracted from influenza hemagglutinin protein (Wilson, I., et al., Cell, 37: 767 (1984)).

The present invention also relates to polynucleotides which hybridize sequences when the sequences described above are at least 70%, preferably at least 90%, more preferably at least 95% identical. The present invention relates to polynucleotides which hybridize to the polynucleotides described above under particularly stringent conditions. Stringent conditions mean that hybridization occurs only when the identity between sequences is at least 95%, preferably at least 97%. In one embodiment, the polynucleotide hybridized to the polynucleotide functions as a soluble PAF by retaining the ability to bind a ligand of the receptor by inducing a second messenger response even if the polypeptide does not function as a membrane binding PAF receptor. A polypeptide that retains the same physiological function or activity as the mature polypeptide encoded by the cDNA or deposited cDNA of FIG. 1 (SEQ ID NO: 1) is encoded.

In addition, the polynucleotide hybridizes to the polynucleotide of the present invention and has at least 20 bases, preferably at least 30 bases, more preferably 50 bases, which are identical as described above and which may or may not retain activity. Have more than For example, such polynucleotides can be used as the polynucleotide of SEQ ID NO: 1 or a variant thereof, or used to recover nucleotides as diagnostic probes or PCR primers.

Therefore, the present invention provides at least 30, preferably at least 50 polynucleotides and bases that match at least 70%, preferably at least 90%, more preferably at least 95% of the polynucleotides encoding the polypeptide of SEQ ID NO: 2. To fragments thereof and polypeptides encoded by such polypeptides.

The deposits referred to herein are maintained under the Budapest Treaty, an international convention on microbial deposits for the purpose of patent application. Such deposits may simply be provided for convenience to those of ordinary skill in the art, but 35 U.S.C. It is not approved if required under § 112. The polynucleotide sequences included in the deposited material as well as the amino acid sequences of the polypeptides encoded thereby are controllable in the case of conflict with any description of the sequences herein. A license may be required to make, use or market a deposited material, but such a license is not approved.

The present invention also relates to PAF receptor polypeptides having the amino acid sequence of FIG. 1 (SEQ ID NO: 2) or having an amino acid sequence encoded by deposited cDNA, and fragments, analogs and derivatives thereof.

The meaning of fragments, analogs and derivatives referring to the polypeptide of FIG. 1 (SEQ ID NO: 2) means that the polypeptide binds to the ligand of the receptor even if it does not function as a G-protein PAF receptor, such as a polypeptide or a soluble form of the receptor. A polypeptide that maintains physiological function or activity, such as a polypeptide having the ability to do so.

Polypeptides according to the invention are recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

In fragments, derivatives or analogs of the polypeptide of FIG. Substituted amino acid residues are polypeptides encoded or unencoded by a genetic code, (ii) polypeptides in which one or more amino acid residues comprise a substituent, (i) a compound in which a mature polypeptide increases the half-life of the polypeptide, such as polyethylene Polypeptides that bind to other compounds, such as glycols), or (iii) additional amino acids bind to mature polypeptides or protein precursor sequences used for purification of mature polypeptides, or (iii) fragments of polypeptides are soluble, i.e., associated with membranes. Ligand binding to the membrane-bound receptor It includes Li peptide.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form and are homogeneously purified.

The polypeptide of the present invention is at least 70% similar (preferably at least 70% identical) to the polypeptide of SEQ ID NO: 2, more preferably at least 90% similar (preferably at least 90% identical) to the polypeptide of SEQ ID NO: 2, and Preferably, in addition to a polypeptide that is at least 95% similar (preferably at least 95% identical) to the polypeptide of SEQ ID NO: 2, the polypeptide of SEQ ID NO: 2 (particularly a mature polypeptide) comprises at least 30 amino acids, more preferably at least 50 Polypeptide portions having amino acids.

Similarity between two polypeptides is determined by comparing the amino acid sequence of one polypeptide and its conservative amino acid sequence with that of another polypeptide.

Fragments or portions of the polypeptides according to the invention can be used to produce corresponding full length polypeptides by peptide synthesis, so that fragments can be used as intermediates to produce full length polypeptides. Fragments or portions of the polypeptides of the invention can be used to synthesize full length polynucleotides of the invention.

The term gene means a DNA segment involved in making a polypeptide chain; In addition to intervening arrangements (introns) between individual cryptographic segments (exons), they include domain leaders and trailers before and after the cryptographic domain.

The term isolated means the removal of a substance from its original environment (eg the natural environment if it is a natural occurrence). For example, natural polynucleotides or polypeptides present in a living animal body cannot be separated, but the same polynucleotides or polypeptides isolated from some or all of the coexisting material in a natural system can be isolated. Such polynucleotides may be part of a vector and / or such polynucleotides or polypeptides may be part of a composition and may be isolated if the vector or composition is not part of the natural environment.

The polypeptide of the present invention is at least 70% similar (preferably at least 70% identical) to the polypeptide of SEQ ID NO: 2, more preferably at least 90% similar (preferably at least 90% identical) to the polypeptide of SEQ ID NO: 2, and Preferably, in addition to a polypeptide that is at least 95% similar (preferably at least 95% identical) to the polypeptide of SEQ ID NO: 2, the polypeptide of SEQ ID NO: 2 (particularly a mature polypeptide) comprises at least 30 amino acids, more preferably at least 50 Polypeptide portions having amino acids.

As is known in the art, the similarity between two polypeptides is determined by comparing the amino acid sequence of one polypeptide and its conservative amino acid substitutions with that of the second polypeptide.

Fragments or portions of the polypeptides of the invention can be used to produce corresponding full length polypeptides by peptide synthesis: the fragments can therefore be used as intermediates to prepare full length polypeptides. Fragments or portions of the polypeptides of the invention can be used to synthesize full length polynucleotides of the invention.

The invention also relates to the production of a polypeptide comprising the polynucleotide of the invention, a host cell genetically engineered with the vector of the invention, and a polypeptide of the invention by recombinant technology.

Host cells are genetically engineered (transduced, transformed or transfected) using vectors of the invention such as replication vectors or expression vectors. Vectors are in the form of plasmids, viral particles, phages and the like. Engineered host cells are cultured in conventional flotation medium that is suitably adapted to activate promoters, select transformants, or amplify the genes of the invention. Culture conditions, such as temperature, pH, etc., are those of the host cell chosen for the expression experiment, which will be apparent to those of ordinary skill in the art.

Nucleotides of the present invention can be used for the production of polypeptides by recombinant techniques. Thus, for example, the polynucleotide can be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences such as derivatives of SV40; Bacterial plasmids; Phage DNA; Baculovirus; Yeast plasmids; A vector extracted from a combination of plasmid and phage DNA and viral DNA such as vaccinas; Adenovirus; Foul fox virus; And pseudorabies. However, other vectors can be used as long as they are replicable and viable in the host.

There are many ways to insert suitable DNA sequences into a vector. In general, DNA sequences are inserted into appropriate restriction endonuclease sites by methods known in the art. All such methods are considered to be within the scope of the art.

The DNA sequence in the expression vector binds to an expression control sequence (promoter) that directs mRNA synthesis. Representative examples of these promoter genes include LTR or SV40 promoter genes; this. E. Coli, lac or trc, pizi lambda P _L promoters, and other promoters that control gene expression in prokaryotic or eukaryotic cells or viruses thereof. Expression vectors may also include ribosomal binding sites for initiation and termination of translation and sequences for amplifying expression.

In addition, the expression gene is preferably dihydrofolate reductase or neomycin resistance to eukaryotic cell culture, or E. coli. E. coli contains one or more selectable marker genes that provide a phenotype for selection of modified host cells such as tetracycline or ampicillin resistance.

As well as suitable promoters or control sequences, a vector having a suitable DNA sequence as described above can be used to transform into a suitable host capable of expressing the protein.

Representative examples of suitable hosts include E. coli. Bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium; Strain cells such as yeast; Insect cells such as Drosophilla and Spodoptera Sf9; Animal cells such as CHO, COS or Bowes melanoma; Adenovirus; Plant cells and the like can be mentioned.

More particularly, the present invention also encompasses recombinant constructs comprising one or more sequences described above. Recombinant constructs include vectors such as plasmids or viral vectors into which the sequences of the invention have been inserted. In a preferred aspect of this embodiment, the recombinant construct consists of regulatory sequences comprising a promoter linked to the sequence. Many vectors and promoters are known and commercially available. The following vectors are provided in the present invention. Bacterial cell vectors: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic cell vectors: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia). Other plasmids or vectors are available as long as they are replicable and viable in the host.

A promoter (chloramphenicol transferase) vector or other vector with selectable markers can be used to select the promoter region from any desired gene. Two suitable vectors are PKK232-8 and PCM7. Specially named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P _R , P _L and trp. Eukaryotic cell promoters include CMV, HSV, thymidine coenzyme, early and recent SV40, LTRs from retroviruses, and mouse metallothionein-I. Selection of suitable vectors and promoters is well within the skill level of the art.

In another embodiment, the present invention provides a host cell having the recombinant construct described above. The host cell is a higher eukaryotic cell such as a mammalian cell or a lower eukaryotic cell such as a yeast cell, or the host cell is a prokaryotic cell such as a bacterial cell. Recombinant constructs can be introduced into host cells by calcium phosphate transfection, DEAE-dextran intervening transmission, or electroporation. Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)].

Recombinant constructs in host cells can be used in conventional manner to produce a gene product encoded by the recombinant sequence. In addition, the polypeptide of the present invention can be produced synthetically using a conventional peptide synthesizer.

Under the control of appropriate promoters, mature proteins are expressed in mammalian cells, yeast, bacteria, or other cells. In addition, a cell-free translation system is employed to prepare the protein using RNA derived from the DNA constructs of the invention. Suitable replication and expression vectors for use with prokaryotic and eukaryotic cell hosts are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989). , Which is cited in the present invention.

Insertion of an enhancer sequence into the vector increases the transcription of the DNA encoding the polypeptide of the invention by higher eukaryotic cells. Enhancers are cis-acting elements of DNA that are about 10 to 300 bp that act on the promoter and increase its transcription. Examples include recent SV40 enhancers of replication origins bp 100 to 270, cytomegalovirus early promoter enhancers, recent polyoma enhancers of replication origin, and adenovirus enhancers.

In general, recombinant expression vectors are E. coli. Ampicillin resistance gene and E. coli. Replication origin and selectable markers that allow the transformation of host cells, such as the S. cerevisiae TRP1 gene, and promoters derived from expression genes directing transcription of down-structure sequences. Such promoters are derived from operons encoding corresponding reactive enzymes, such as 3-phosphocliseric acid coenzyme (PGK), α-factor, dephosphatase, or heat treated protein. The heterologous structural sequence is assembled by a translational initiation and termination sequence in a suitable phase, preferably by a leader region that can direct the release of the translated protein into the cytoplasmic gap or extracellular medium. Optionally, a fusion protein can be encoded comprising an N-terminal determinant peptide having desirable properties such as the ability to stabilize or simply purify a recombinant expressed heterologous sequence.

Expression vectors useful for bacteria are constructed by inserting a structural DNA sequence encoding a desired protein by a translational initiation and termination signal into an operable reader with a functional promoter. A vector consists of a selectable marker gene having one or more phenotypes and a replication initiation region that maintains the vector and, if necessary, amplifies the gene in the host. Eukaryotic hosts suitable for transformation include E. coli. Several species belonging to E. coli, Bacillus subtilis, Salmonella typhimurium and Pseudomonas, Streptomyces, and Staphylococcus are optionally available.

As a non-limiting but representative example, an expression vector useful for bacteria can include a selectable marker gene and a bacterial replication initiation gene obtained from a commercial plasmid comprising the genetic elements of the well-known cloning vector pBR322 (ATCC 37017). Such commercially available vectors include pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These pBR322 templates are linked with appropriate promoters and structural gene sequences to be expressed.

The appropriate host strain is transformed and the host strain is propagated to a suitable cell density, then the selected promoter is induced by a suitable method (eg temperature change or chemical induction) and the cells are incubated for an additional period of time.

Cells are typically harvested by centrifugation, milled by physical or chemical methods, and the resulting crude extract is retained for further purification.

Microbial cells used for expression of proteins can be pulverized by conventional methods, including methods that are well known to those skilled in the art, such as freezing thaw circulation, sonication, mechanical grinding, or the use of cell lysates.

In addition, several mammalian cell culture systems can be used to express recombinant protein. Examples of mammalian expression systems include, but are not limited to, COS-7 strains of monkey kidney fibroblasts described in Gluzman, Cell, 23: 175 (1981), and other cell lines capable of expressing conformation vectors, for example C127. , 3T3, CHO, HeLa, and BHK cell lines. Mammalian expression vectors include origins of replication, suitable promoters and enhancers, and essential ribosomal binding sites, polyadenylation sites, split donor and receptor sites, transcription termination sequences, and 5 'flanking non-transcription sequences. SV40 splits and DNA sequences derived from polyadenylation sites are used to provide the necessary nontranscribed gene components.

G-protein PAF receptor polypeptides of the invention can be prepared by ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectins It can be recovered and purified from recombinant cell culture by a method comprising chromatography. Protein refolding steps can be used to complete the arrangement of mature proteins, if necessary. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

Polypeptides of the invention are products that are produced by recombinant technology from naturally purified products, or from chemical synthesis processes, prokaryotic or eukaryotic cell hosts (eg, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Can be. Depending on the host used in the recombinant preparation process, the polypeptides of the invention can be glycosylated or aglycosylated. Polypeptides of the invention may comprise starting methionine amino acid residues.

The polynucleotides and polypeptides of the present invention can be used as investigational reagents and materials for the discovery of therapeutic and diagnostic agents for human diseases.

The G-protein PAF receptor according to the present invention is used in a method for selecting a compound that activates (agonizes) or inhibits activation (antagonist) of a receptor polypeptide of the present invention.

In general, this screening process involves providing suitable cells to express the receptor polypeptide of the invention on a surface. Such cells include mammalian, yeast, fruit flies or E. coli. Cells of E. coli. In particular, polynucleotides encoding the receptors of the present invention are used to infect cells to express G-protein PAF receptors. The expressed receptor is contacted with the test compound to observe binding, stimulation or inhibition of the functional response.

The screening process involves the use of melanin bearing cells that are transfected to express the G-protein PAF receptor of the invention. The screening technique is described in PCT WO 92/01810 published February 6, 1992.

Thus, for example, to screen for compounds that inhibit the activity of the receptor polypeptides of the invention, both the compounds that bind to the receptor and known ligands are contacted with melanin bearing cells. Inhibition of the signal generated by the ligand means that the compound is a potent antagonist to the receptor, ie inhibits the activity of the receptor.

Screening can be used to determine the compound that binds to and activates a receptor by contacting the cell with the compound to be screened and to determine whether the compound generates a signal, ie activates the receptor.

Other examples are described in G, the present invention in a system for measuring extracellular pH changes caused by receptor activity, as described in Science, volume 246, pages 181-296 (October 1989). The use of cells expressing protein PAF receptors (eg, transfected CHO cells). For example, whether a compound can be brought into contact with a cell expressing a receptor polypeptide of the invention and is likely to be effective as an activator or inhibitor in a second messenger response, e. Can be measured to determine

In another method, the RNA encoding the G-protein PAF receptor is introduced into a chisenoplast cyst to express the receptor. If the cyst is in contact with a receptor ligand and a compound to be tested, then a compound that inhibits the activation of the receptor can detect the inhibition or activation of calcium signals.

In another method of selecting a compound by expressing a G-protein PAF receptor, the receptor is linked to phospholipase C or D. Such cells may include endothelial cells, smooth muscle cells, embryonic kidney cells, and the like. The action of activating or inhibiting the activation of the receptor can be detected from the phospholipase secondary signal.

In another method, the method comprises selecting a compound that inhibits the activation of a receptor polypeptide of an antagonist according to the present invention by inhibiting binding of a labeled ligand to a cell having a receptor on its surface. The method involves transforming eukaryotic cells with DNA encoding the G-protein PAF receptor to allow the cell to express a receptor on its surface and contacting the cell with the compound in the presence of a labeled ligand. The ligand can be labeled by radioactivity or the like. The radioactivity of the receptor is measured to determine the amount of labeled ligand that binds to the receptor. When the compound as measured by the reduction of the labeled ligand bound to the receptor is bound to the receptor, the binding of the labeled ligand to the receptor is inhibited.

G-protein PAF receptors are ubiquitous in mammalian hosts and can be responsible for many physiological functions, including pathological symptoms. Thus, it is desirable to find compounds and drugs that stimulate the G-protein PAF receptor on the one hand and inhibit the function of the G-protein PAF receptor on the other.

For example, compounds that activate the G-protein PAF receptor can be used for therapeutic purposes such as the treatment of asthma, Parkinson's disease, acute heart failure, hypotension, urinary obstruction, and osteoporosis.

In general, compounds that inhibit the activation of the G-protein PAF receptor include hypotension, angina, myocardial infarction, ulcers, asthma, allergies, benign prostatic hyperplasia, and schizophrenia, madness, depression, sclerosis, dementia or severe mental retardation, and Huntington's disease. It can be used to treat mental and neurological diseases, including dyskinesias, such as Gilles dila Tourett syndrome. Compounds that inhibit the G-protein PAF receptor are also useful for reversing resistant appetite loss and controlling bullia.

The antibody can antagonize the G-protein PAF receptor according to the present invention, or it can antagonize an oligopeptide that binds to the G-protein PAF receptor but does not induce a secondary messenger response, thereby activating the G-protein PAF receptor. Suppress Such antibodies include antigenic antibodies that recognize specific determinants that bind to the antigen binding site of the antibody. Potential antagonist compounds include proteins that are closely related to ligands of the G-protein PAF receptor, such as fragments of ligands that lose physiological function and do not induce a response when bound to the G-protein PAF receptor.

Antisense constructs prepared by antisense technology can be used to control gene expression by forming triple helices of antisense DNA or RNA based on the polynucleotide binding to DNA or RNA. For example, the 5 'coding portion of a polynucleotide sequence encoding a mature polypeptide of the invention is used to design antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed complementary to gene regions involved in transcription [triple helix— see Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988); Dervan et al., Science, 251: 1360 (1991). This inhibits the transcription and production of G-protein PAF receptors. Antisense RNA oligonucleotides hybridize to mRNA and block the mRNA molecule from being translated into the G-protein PAF receptor [antisense-Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)]. When the oligonucleotides described above are transferred to cells, antisense RNA or DNA may be expressed to inhibit the production of the G-protein PAF receptor.

Small molecules, such as small peptides or peptide-based molecules that bind to the G-protein PAF receptor and block its access to the ligand to block normal physiological activity can be used to inhibit activation of the receptor polypeptide according to the invention.

Soluble forms of G-protein PAF receptors, such as fragments of G-protein PAF receptors, can be used to inhibit activation of the receptor by binding to the ligand of the polypeptide of the invention and inhibiting the ligand from interacting with the membrane-bound G-protein PAF receptor. Can be.

The present invention also provides a method of reacting a mammalian cell expressing a G-protein PAF receptor with a ligand under conditions that allow the ligand to bind a G-protein PAF receptor, and A method of determining whether a ligand known to be unable to bind a G-protein PAF receptor can bind to the receptor, including detecting presence and determining whether the ligand is binding to a G-protein PAF receptor. to provide. The system for measuring agonists and / or antagonists can also be used to determine ligands that bind to receptors.

In addition, the present invention provides a nucleic acid molecule of 10 or more nucleotides capable of obtaining total mRNA from a cell and specifically hybridizing the obtained mRNA to a sequence contained within a sequence of a nucleic acid molecule encoding a receptor under hybridization conditions. A method of detecting expression on the surface of a cell of a G-protein PAF receptor polypeptide of the invention by contacting with a containing nucleic acid probe and detecting the presence of a hybridized mRNA with the probe to detect expression of the receptor by the cell. To provide.

The present invention also provides a method for identifying a receptor associated with a receptor polypeptide of the invention. Interacting with similar, low stringency cross hybridization, or related natural or synthetic ligands to the G-protein PAF receptor polypeptides of the invention and inducing similar behavior after genetic or pharmacological blockade of the G-protein PAF receptor polypeptides of the invention By identifying receptors, these related receptors can be identified.

The agents identified by the screening methods described above can be used to treat hemophilia because they induce platelet coagulation and stimulate wound healing.

Antagonist compounds for the G-protein PAF receptor can be used to prevent and / or treat angioplasty, unstable eyes, or stenosis or pulmonary antenatal seizures, allergies, inflammation, and restenosis after myocardial infarction.

An antagonist may be used in combination with a composition having a pharmaceutically acceptable carrier described later, ie as described later.

Antagonists or antagonist compounds can be used in combination with suitable pharmaceutical carriers. Such compositions comprise a therapeutically effective amount of a polypeptide and a pharmaceutically acceptable carrier or excipient. Such carriers include saline, buffered saline, dextrose, water, cglycerol, ethanol and combinations thereof. The gelling should be suitable for the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical composition of the invention. The matter relating to the container may be a notice in the form prescribed by a governmental authority that regulates the manufacture, use or sale of a medicament or biological product, which is approved by the agency of manufacture, use or sale for human administration. Reflect. In addition, the pharmaceutical compositions of the present invention can be used with other pharmaceutical compounds.

The pharmaceutical composition can be administered by conventional methods, for example by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route. The pharmaceutical composition is administered in an amount effective to treat and / or prevent specific symptoms. In general, pharmaceutical compositions should be administered in an amount of at least about 10 μg / kg body weight and in most cases in an amount of no greater than about 8 mg / kg body weight per day. In most cases, the dosage is about 10 μg / kg body weight to about 1 mg / kg body weight daily, taking into account the route of administration, symptoms, and the like.

G-protein PAF receptor polypeptides and polypeptides that are antagonists or polypeptides that are polypeptides can be used in accordance with the invention by expression, which is called gene therapy.

Thus, for example, a patient's cells may be genetically engineered with a polynucleotide (DNA or RNA) that encodes the polypeptide in vitro and then provided to the patient who is able to treat the engineered cells with the polypeptide. Such methods are well known in the art. For example, cells can be genetically engineered by methods known in the art using retroviral particles containing RNA encoding the polypeptides of the invention.

Similarly, it can be manipulated in vivo to express the polypeptide in vivo by, for example, methods known in the art. As is known in the art, producer cells for preparing retroviral particles containing RNA encoding a polypeptide of the invention can be administered to a patient to manipulate the cells in vivo and to express the polypeptide in vivo. have. All methods for administering a polypeptide of the present invention by this method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for manipulating the cells may differ from retroviruses, for example, using adenoviruses to manipulate the cells in vivo after binding to a suitable delivery vehicle.

Retroviruses from which the above-mentioned retroviral plasmid vectors may be derived include retroviruses such as leukemia virus, splenic necrosis virus, Loose sarcoma virus, Molecular sarcoma virus, avian leukemia virus, and Gibbon ape ape) leukemia viruses, human immunodeficiency viruses, adenoviruses, myeloproliferative sarcoma viruses, and mammalian tumor viruses. In one embodiment, the retroviral plasmid vector is derived from the leukemia virus of Moroni murine.

Such vectors include one or more promoters. Suitable promoters that can be used include retroviral LTRs; SV40 promoter; And Miller, et al., Biotechniques, Vol. 7, No. 9,980-990 (1989), eukaryotic cells, including but not limited to human cytomegalovirus (CMV) promoters, or other promoters (eg, histone, pol III, and β-actin promoters). Intracellular promoters such as promoters), but is not limited to such. Other nonviral promoters that can be used include, but are not limited to, adenovirus promoter, thymidine kinase (TK) promoter, and B19 parvovirus promoter. Selection of suitable promoters will be apparent to those skilled in the art from the teachings herein.

Nucleic acid sequences encoding polypeptides of the invention are under the control of suitable promoters. Suitable promoters that can be used include adenovirus promoters such as adenovirus main rate promoters; Heterologous promoters such as cytomegalovirus (CMV) promoters; Respiratory syncytial virus (RSV) promoter; Inducible promoters such as MMT promoter, metallothionein promoter; Heat shock promoters; Albumin promoter; ApoAI promoter; Human globin promoter; Viral thymidine kinase promoters such as the herpes simplex thymidine kinase promoter; Retroviral LTRs (including modified retroviral LTRs as mentioned above); β-actin promoter; And human growth hormone promoters. Such promoters may also be native promoters that regulate the genes encoding the polypeptide.

Retroviral plasmid vectors can be used to transduce packaging cell lines to form producer cell lines. Examples of packaging cells that can be transfected include Miller, Human Gene Therapy, Vol. 1, p. 5-14 (1990)] PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E-86, GP + envAm12, and DNA cell lines, including but not limited to. Such vectors can transduce packaging genes by any means known in the art. Such means include, but are not limited to, electroporation, use of liposomes, and CaPO ₄ precipitation. In another embodiment, the retroviral plasmid vector can be embedded into liposomes or PAFs or coupled to lipids and then administered to a host.

Producer cell lines produce infectious retroviral vector particles comprising nucleic acid sequence (s) encoding the polypeptide. Such retroviral vector particles can be used to transduce eukaryotic cells in vitro or in vivo. Such transduced eukaryotic cells will express nucleic acid sequence (s) encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic liver cells, embryonic carcinoma cells, and hematopoietic stem cells, blood cells, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

The present invention intends the use of the gene of the present invention as a diagnostic for, for example, a specific disease resulting from a defective gene originally. These genes can be detected by comparing the sequences of defective genes with those of normal genes. As a result, it may be demonstrated that mutant genes are associated with abnormal receptor activity. In addition, mutant genes can be inserted into a vector suitable for expression in a functional assay system (e.g., colorimetric analysis in receptor defective strains of HEK293 cells, expression in MacConkey plates, complementarity experiments) if a mutation gene is to be demonstrated or confirmed. can do. When mutant genes are identified, populations of carriers for mutant receptor genes can be screened.

Individuals possessing mutations in the genes of the present invention can be detected at various DNA concentrations by various techniques. Diagnostic nucleic acids can be obtained from cells of a patient, including but not limited to, for example, blood, urine, saliva, tissue biopsies and autopsy materials. Genomic DNA can be used directly for detection or can be enzymatically amplified using PCR (Saiki et al., Nature, 324: 163-166 (1986)) prior to analysis. RNA or cDNA can also be used for the same purpose. For example, PCR primers complementary to the nucleic acids of the invention can be used to identify and analyze mutations in genes of the present invention. For example, deletions and insertions can be detected by changes in the size of the amplified product compared to normal genotypes. Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA of the invention or radiolabeled antisense DNA sequences of the invention. Preferably the matched sequence can be distinguished from an improperly matched duplex by RNase A digestion or difference in melting point temperature. The diagnostic agent is particularly useful for testing fetuses or newborns.

Sequence differences between reference genes and mutations can be revealed by direct DNA sequencing methods. Cloned DNA fragments can also be used as probes to detect specific DNA fragments. The sensitivity of these methods is greatly enhanced when combined with PCR. For example, sequence primers are used with single-chain PCR products or single-chain template molecules produced by modified PCR. Sequencing is performed by conventional methods using radiolabeled nucleotides or by automatic sequencing methods using fluorescent tags.

Genetic tests based on DNA sequence differences can be performed by detecting the mutation by electrophoretically shifting the DNA fragments in the gel in the presence or absence of denaturing agents. Sequence changes at specific positions can also be indicated by nuclease protection assays or chemical cleavage methods such as RNase and S1 protection (eg, Cotton et al., PNAS, USA, 85: 4397-4401 (1985)).

In addition, certain diseases are characterized by the results of or changes in gene expression that can be detected by changes in mRNA. In addition, the genes of the present invention can be used as a reference to identify individuals that express a decrease in function associated with this type of receptor.

The invention also relates to diagnostic assays for detecting altered levels of G-protein PAF receptor polypeptides of the soluble forms of the invention in various tissues. Assays used to detect the level of soluble receptor polypeptide in a sample derived from the host are well known to those skilled in the art and include radioimmunoassays, competitive binding assays, western blot assays and preferably ELISA assays.

The ELISA assay involves first preparing an antibody against a specific antigen, preferably a monoclonal antibody, against an antigen of a G-protein PAF receptor polypeptide. Reporter antibodies are also prepared against these monoclonal antibodies. To such reporter antibodies are attached radioactive, fluorescent, or detectable reagents such as horseradish peroxidase enzymes in this example. The sample is removed from the host and cultured on a solid support, such as a polystyrene dish, that binds to the protein in the sample. The free protein binding site on the dish is then protected by culturing with a nonspecific protein such as bovine serum albumin. The monoclonal antibody is then incubated in the dish for the time that the monoclonal antibody is attached to the polypeptide of the invention attached to the polystyrene dish. All unbound monoclonal antibodies are removed by washing with buffer. By placing the reporter antibody bound to horseradish peroxidase in a dish, the reporter antibody is bound to the monoclonal antibody bound to the PAF receptor protein. The unattached reporter antibody is then washed away. The amount developed within a given time by adding the peroxidase substrate to the dish is then a measure of the amount of the PAF receptor protein of the present invention present in the given patient sample volume when compared to a standard curve.

The sequences of the invention are also useful for chromosome identification. The sequence is specifically targeted and can hybridize to a specific location on the human chromosome of the individual. There is also a common need to identify specific sites on chromosomes. Chromosomal marking reagents based on actual sequence data (repeat polymorphism) for marking chromosomal positions are currently rarely available. The mapping of DNA to chromosomes according to the invention is an important first step in correlating these sequences with genes associated with the disease.

Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from cDNA. Computer analysis of the 3 'untranslated region of the sequence is used to quickly select one or more exons in the genomic DNA to hybridize the amplification method. The primers are then used for PCR screening of celiac cell hybrids containing human chromosomes of the individual. Only hybrids containing human genes corresponding to the primers can obtain amplified fragments.

PCR mapping of celiac cells is a rapid way to distribute specific DNA to specific chromosomes. Using the same oligonucleotide primers in the present invention, localization can be accomplished in a similar manner using panels of fragments from pools of specific chromosomes or large genomic clones. Other mapping methods that can be similarly used to map to their chromosomes include hybridization in situ to construct chromosome specificity-cDNA libraries, prescreening using labeled flow-classified chromosomes and preselection by hybridization. It includes.

The cDNA clones can be fluorescently hybridized (FISH) in situ with the mid-term chromosomal diffusion culture to provide the correct chromosome location in one step. This technique can use cDNAs as short as 50 or 60 bases. For a review of these techniques, reference may be made to Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence on the chromosome is correlated with the genetic map data. Such data are obtained, for example, from V. McKusick, Mendelian Inheritance in Man (available online from Johns Hopkins University Welch Medical Library). The relationship between the next gene and disease mapped to the same chromosomal region is identified through binding analysis (physically contiguous cogenetics).

Next, it is necessary to measure the difference in cDNA or genomic sequence between infected and uninfected. If the mutation is observed in some or all infected individuals but not in normal individuals, the mutation is probably the agent of disease.

With conventional physical mapping decomposition and genetic mapping techniques, a cDNA precisely located in the chromosomal region associated with a disease may be one of 50 to 500 potential small genes (which is 1 megabase mapping resolution and 20 kb). Take one gene per year).

Antibodies can be prepared using polypeptides, fragments or other derivatives thereof, or analogs thereof, or cells expressing them as immunogens. This antibody can be, for example, a polyclonal or monoclonal antibody. The invention also encompasses the products of chimeric, single-chain, and humanized antibodies, and Fab fragments, or Fab expression libraries. Various methods known in the art can be used to prepare the antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by injecting the polypeptide directly into an animal or by administering the polypeptide to an animal, preferably non-human. The antibody thus obtained is then bound to the polypeptide itself. In this manner, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind the entire natural polypeptide. The antibody can then be used to isolate the polypeptide from tissue expressing the polypeptide.

For the preparation of monoclonal antibodies, techniques can be used to provide antibodies prepared by continuous cell line cultures. Examples include hybridoma technology (Kohler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B-cell hybridoma technology (Kozbor et al., 1983, Immunology Today 4:72], EBV-hybridoma technology for the production of human monoclonal antibodies [Cole, et al., 1985, Monoclonal Antibodies and Caner Therapy, Alan R. Liss, Inc., pp. 77-96].

Techniques described for the preparation of single chain antibodies [U.S. Pat. Patent 4,946,778 can be adapted to prepare single-chain antibodies against the immunogenic polypeptides of the present invention. In addition, transgenic mice can be used to express humanized antibodies against the immunogenic polypeptide products of the invention.

The present invention will be described with reference to the following examples; This is construed that the present invention is not limited to this embodiment. Unless otherwise specified, all parts or quantities are by mass.

The methods and / or terms that appear often are described in order to facilitate understanding of the following examples.

Plasmids are first denoted by lowercase p and / or uppercase and / or numeric characters. The disclosed plasmids of the present invention may be publicly purchased under commercially available, non-limiting conditions, or commercially available plasmids may be constructed according to the published methods. In addition, plasmids equivalent to those described are known in the art and will typically be apparent to those skilled in the art.

Digestion of DNA refers to catalytic cleavage of DNA with restriction enzymes that act only on specific sequences of DNA. Various restriction enzymes used in the present invention are commercially available and their reaction conditions, cofactors and other requirements are commonly used as known to the skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA is used with about 2 units of enzyme in about 20 μl of buffer. For the purpose of isolating DNA fragments for plasmid construction, typically 5-50 μg of DNA is digested in larger volumes using 20 to 250 units of enzyme. Suitable buffers and base masses for certain restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 ° C. are conventionally used but may be varied as directed by the supplier. After digestion, the reaction is directly electrophoresed on a polyacrylamide gel to separate the desired fragments.

Size separation of the cleaved fragments is performed using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980).

Oligonucleotides refer to oligonucleotides of a Japanese chain or two complementary polyoxynucleotide chains that can be synthesized chemically. The synthetic oligonucleotides do not have 5 'phosphate at all and therefore are not linked to other oligonucleotides unless phosphate is added with ATP in the presence of kinase. Synthetic oligonucleotides are not linked to fragments that are not dephosphorylated.

Ligation refers to a method of forming phosphodiester bonds between two double-stranded nucleic acid fragments. See Maniatis, T, et al., Id., P. 146]. Linking with 10 units of T4 DNA ligase (ligase) per 0.5 μg of DNA fragment to be linked is carried out using known buffers and conditions, unless otherwise provided.

Unless otherwise indicated, transformation is performed as described by Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1

Bacterial Expression and Purification of G-protein Coupled Receptor HTNAD29 (PAF Receptor)

Amplification of the DNA sequence encoding the PAF receptor, ATCC No., is first performed using PCR oligonucleotide primers corresponding to the 5 'sequence of the processed protein (signal peptide sequence iii) and the vector sequence 3' for the PAF receptor gene. Additional nucleotides corresponding to the PAF receptor are added to the 5 'and 3' sequences, respectively. The 5 'oligonucleotide primer has the sequence 5' CGAATTCCTCCATGAACAGCACATGTATT 3 'containing 18 nucleotides of the PAF receptor coding sequence starting from the estimated termination amino acid of the disclosed protein codon following the EcoRI restriction enzyme site. 3 ′ sequence 5 ′ CGGAAGCTTCGTCAAGGACCTCTAATTCC 3 ′ has a sequence complementary to the 18 nucleotides encoding the PAF receptor following the HindIII site. The restriction enzyme site corresponds to the restriction enzyme site on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA). pQE-9 encodes antibiotic resistance (Amp ^r ), bacterial replication origin (ori), IPTG-regulated promoter effector (P / O), ribosomal binding site (RBS), 6-His tag and restriction enzyme site. PQE-9 is then digested using EcoRI and HindIII. The amplified sequences are linked to pQE-9 and inserted into the same frame using sequences encoding histidine tags and RBS. Then, using the linking mixture, this method was described by Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). E. coli strain M15 / rep4 (Source: Qiagen, Inc.) is transformed. M15 / rep 4 contains multiple copies of plasmid pREP4, which expresses a lacI inhibitor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow in LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 ug / ml) and Kan (25 ug / ml). O / N cultures are used to inoculate large cultures at a ratio of 1: 100 to 1: 250. The cells are grown to an optical density of 600 (OD ⁶⁰⁰ ) of 0.4 to 0.6. IPTG (isopropyl-BD-thiogalacto pyranoside) is then added to bring the final concentration to 1 mM. IPTG is induced by inactivating the lacI inhibitors, making it clear that P / O causes increased gene expression. The cells are grown for another 3-4 hours. The cells are then harvested by centrifugation. Cell pellets are solubilized in 6 molar guanidine HCl from chaotropic agent. After clarification, the solubilized PAF receptor is purified from the solution by chromatography on a nickel-chelate column under conditions that are tightly bound by a protein containing a 6-His tag. Hochuli, E. et al., J. Chromatography 411: 177-184 (1984). PAF receptors are adjusted with 3 mol guanidine HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced) and 2 mM glutathione (oxidized) to elute and regenerate from the column in 6 mol guanidine HCl, pH 5.0. After incubation for 12 hours in this solution, the protein is dialyzed with 10 mM sodium phosphate.

Example 2

Expression of Recombinant PAF Receptor in COS Cells

The expression of the plasmid, PAF receptor HA, is: 1) the origin of SV40 replication, (2) the ampicillin resistance gene, (3) E. E. coli origin of replication, (4) polylinker region followed by CMV promoter, followed by vector pcDNAI / Amp (Invitrogen) containing SV40 intron and polyadenylation site. DNA fragments encoding the complete PAF receptor precursor and HA tags fused in frame at the 3 'end thereof are cloned into the polylinker region of the vector to induce recombinant protein expression under the CMV promoter. HA tags correspond to epitopes derived from influenza hemagglutinin protein as described above. I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984 , Cell 37. 767]. Injection of the HA tag into the target protein facilitates detection of the recombinant protein with an antibody that recognizes an HA epitope.

Plasmid construction methods are described below:

DNA sequence encoding PAF receptor, ATCC No. 2 primer: 5 'primer 5' GTCCAAGCTTGCCACCATGAACAGCACATGTATT 3 ', containing 18 nucleotides of the PAF receptor coding sequence starting from the start codon followed by two primers: HindIII site; Construct by PCR using a 3 'sequence 5' CTAGCTCGAGTCAAGCGTAGTCTGGGACGTCGTATGGGTAGCAAGGACCTCTAATTCCATA 3 'containing a complementary sequence to the last 18 nucleotides of the XhoI site, the translation stop codon, the HA tag, and the PAF receptor coding sequence, but not the stop codon. . Thus, the PCR product contains a site, a PAF receptor coding sequence followed by an HA tag fused in frame followed by a translation stop codon and a XhoI site. PCR amplified DNA sequences and vectors, pcDNAI / Amp, are digested and linked with HindIII and XhoI restriction enzymes. This coupling mixture. Transform into E. coli strain SURE (Source: Stratagene Cloning Systems, La Jolla, Calif.), Transformed cultures are applied on ampicillin medium plates and resistant colonies are selected. Plasmid DNA is isolated from the transformants and examined by restriction analysis for the presence of correct fragments. For expression of recombinant PAF receptors, COS cells are transfected with expression vectors by the DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). Expression of PAF receptor HA protein is detected by radiolabeling and immunoprecipitation methods (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Laboratory Press, (1988)). Cells are labeled with ³⁵ S-cysteine for 8 hours and transfected 2 days later. Collect the following culture medium and lyse the cells with a surfactant (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.1% DOC, 50 mM Tris, pH 7.5). , I. et al., Id. 37: 767 (1984)] Both cell lysates and culture media are precipitated with HA specific monoclonal antibodies The precipitated proteins are analyzed on a 15% SDS-PAGE gel.

Example 3

Cloning and Expression of G-protein Coupled Receptor (PAF Receptor) Using Baculovirus Expression System

DNA sequence encoding full length PAF receptor protein, ATCC number, is amplified using PCR oligonucleotide primers corresponding to 5 'and 3' sequences of genes:

The 5 'primer has the sequence 5' CGGGATCCCTCCATGAACAGCACATGTATT 3 'and is a signal effective for initiating translation in eukaryotic cells following the BamH restriction site (in bold) [J. Mol. Biol. 1987, 196, 947-950, Kozak, M], which contains four nucleotides (underlined, start codon ATG for translation).

The 3 ′ primer has the sequence 5 ′ CGGGATCCCGCTCAAGGACCTCTAATTCCATA 3 ′ and contains a cleavage site for 18 nucleotides that is complementary to the 3 ′ untranslated sequence of the restriction endonuclease BamHI and PAF receptor gene. Amplified sequences are separated from 1% agarose gels using a commercial kit (Genene, trade name: BIO 101 Inc., La Jolla, Ca.). The fragment is digested with endonuclease BamHI and then purified as above. The fragment is designated F2.

The vector pRG1 (a modification of the pVL941 vector mentioned below) is used for the expression of PAF receptor proteins using the baculovirus expression system. Summer, M.D. and Smith, G.E. 1987, A mannual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Exprimental Station Bulletin No. 1555]. The expression vector contains a strong polyhedrin promoter of Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by a recognition site for restriction endonuclease BamHI. The polyadenylation site of monkey virus (SV) 40 is used for efficient polyadenylation. For easy selection of recombinant viruses. The beta-galactosidase gene from E. coli is inserted in the same direction as the polyadenylation signal of the polyhedrin gene followed by the polyhedrin promoter. The polyhedrin sequence can be located on both sides by a viral sequence for cell-mediated similar recombination of the cotransfected wild type viral virus. Many other baculovirus vectors can be used in place of pRG1, such as pAc373, pVL941 and pAcIM1. Luckow, V.A. and Summers, M.D., Virology, 170: 31-39.

Plasmids are digested using the restriction enzyme BamHI and then dephosphorylated by methods known in the art using calf phosphatase. Next, the DNA is separated from the 1% agarose gel as above. The fragment is designated as V2.

Fragment F2 and dephosphorylated V2 are linked with T4 DNA ligase. Next, this. E. coli HB101 was transformed and the bacterium was identified as containing the plasmid (pBacPAF receptor) together with the PAF receptor gene using the enzyme BamHI. The sequence of the cloned fragments is confirmed by DNA sequencing.

5 μg of the plasmid pBac receptor was subjected to lipofection method (Felgner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987), is cotransfected with 1.0 μg of a linearized Baculovirus (trade name: BaculoGold ^™ Baculovirus DNA, Pharmingen, San Diego, Calif.).

1 μg of baculogold ^TM virus DNA and 5 μg of plasmid pBacPAF receptor are mixed in sterile wells of microtiter plates containing 50 μl of serum-free Grace medium [Life Technologies Inc., Gaithersburg, MD]. After adding 10 μl of lipofectin and 90 μl of Grace's medium, mix and incubate for 15 minutes at room temperature. The transfection mixture is then added drop wise to Sf9 insect cells (ATCC CRL 1711) inoculated in 35 mm tissue culture plates with serum free medium. Shake the plate back and forth to mix the newly added solution. The plate is then incubated at 27 ° C. for 5 hours. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace insect medium with 10% fetal calf serum added. The plate is placed in an incubator and incubated at 27 ° C. for 4 days.

After 4 days the supernatant is collected and plaque analysis is performed in the same manner as described by Summer and Smith (supra). Agarose gels are used in conjunction with Blue Gal (Life Technologies Inc., Gaithersburg) to facilitate separation of blue stained plaques as a variant. (Detailed descriptions of plaque analysis can be found in the user guide to insect cell culture and baculoviruses distributed by Life Technologies Inc., Gaithersburg, page 9-10).

After 4 days, after serial dilution, the virus is added to the cells and the blue stained plaques are harvested with an Eppendorf pipette tip. The agar containing the recombinant virus is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by short centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells inoculated in 35 mm dishes. After 4 days the supernatant of the culture dish is collected and stored at 4 ° C.

Sf9 cells are grown in Grace medium with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-PAF receptor at multiplicity of infection (MOI) 2. After 6 hours the medium is removed and replaced with methionine and cysteine free SF900 II medium (Life Technologies Inc., Gaithersburg). 42 hours later, ³⁵ S- methionine and ³⁵ S cysteine 5μCi 5μCi: it is a (source Amersham). Cells are further incubated for 16 hours prior to harvest by centrifugation and labeled proteins are visualized by SDS-PAGE and radiographs.

Example 4

Expression through gene therapy

Skin biopsy yields fibroblasts from certain subjects. The resulting tissue is placed in tissue culture medium and separated into small pieces. This small piece is placed on the wet surface of the tissue culture flask, about 10 pieces are placed in each flask. The flask is inverted, tightly sealed and allowed to stand at room temperature overnight. After 24 hours at room temperature, the flask is inverted and the tissue pieces are left fixed at the bottom of the flask and fresh medium is added (eg F12 medium of ham containing 10% FBS, penicillin and streptomycin). It is then incubated at 37 ° C. for about 1 week. At this time, fresh medium is added and replacement is continued every few days. After two more weeks of culture, a monolayer of fibroblasts appears. This monolayer is treated with trypsin and transferred to a larger flask.

PMV-7 (Kirschmeier, PT et al., DNA, 7: 219-25 (1988)) flanked by long terminal repeats of sarcoid sarcoma in Moroni, was digested with EcoR I and Hind III and subsequently in calf intestine. Treat with phosphatase. Linear vectors are fractionated on agarose gels and purified using glass beads.

CDNA encoding the polypeptides of the invention are amplified using PCR primers corresponding to the 5 'and 3' terminal sequences, respectively. The 5 'primer contains the EcoRI site and the 3' primer also contains the HindIII site. Molecular murine sarcoma virus linear contraction and equivalent amounts of amplified EcoRI and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for joining the two fragments. The ligation mixture is used to transform bacterial HB101 and plated onto kanamycin containing agar to determine whether the vector contains the gene of interest, as appropriately inserted.

Ampotropic pA317 or GP + am12 packaging cells are grown in tissue culture at a confluent density in Dulbecco's Modified Eagle's Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. MSV vectors containing the genes are added to the medium and packaging cells are transduced with the vectors. The packaging cells then produce infectious viral particles containing the gene (packaging cells are referred to herein as producer cells).

Fresh medium is added to the transduced producer cells and the medium is harvested from 10 cm plates of confluent producer cells in succession. The spent medium containing the infectious viral particles is filtered through a microporous filter to remove isolated producer cells and the medium is used to infect fibroblasts. The medium is removed from the subfused plate of fibroblasts and quickly replaced with medium from producer cells. Remove this medium and replace with fresh medium. If the titers of viruses are high, virtually all fibroblasts will be infected and no selection is necessary. If the titer is extremely low, it is necessary to use retroviral vectors with selectable markers such as neo or his.

The genetically engineered fibroblasts are then introduced into the host either alone or after propagation to fusion on cytodex 3 microcarrier beads. At this time, the fibroblasts produce protein products.

Many modifications and variations of the present invention are possible in light of the above teachings, and therefore, the invention may be practiced otherwise than as specifically described in the appended claims.

Claims (20)

(a) a polynucleotide encoding a polypeptide shown in FIG. 1; (b) a polynucleotide encoding a mature polypeptide encoded by DNA contained in ATCC Accession No .; (c) a polynucleotide capable of hybridizing to a polynucleotide of (a) or (b) and at least 70% identical thereto; And (d) An isolated polynucleotide comprising one member selected from the group consisting of polynucleotide fragments of the polynucleotide of (a) or (b). The polynucleotide of claim 1 wherein the polynucleotide is DNA. The polynucleotide of claim 1 comprising nucleotides 523-1533 shown in FIG. 1. The polynucleotide of claim 1 encoding a soluble form of the polypeptide of FIG. 1. A vector containing the DNA according to claim 2. A host cell transformed or transfected with the vector according to claim 5. A method for producing a polypeptide comprising expressing a polypeptide encoded by the DNA from a host cell according to claim 8. A method for producing a cell capable of expressing a polypeptide, including transforming or transfecting a cell with a vector according to claim 5. (Iii) a polypeptide having the deduced amino acid sequence of FIG. 1 and fragments, analogs and derivatives thereof; And (Ii) a receptor polypeptide comprising one member selected from the group consisting of a polypeptide encoded by the cDNA of ATCC Accession No. and fragments, analogs and derivatives thereof. An antibody against a polypeptide according to claim 9. A compound that activates a polypeptide according to claim 9. A compound that inhibits the activation of a polypeptide according to claim 9. A method of treating a patient in need of activating the G-protein PAF receptor, comprising administering a therapeutically effective amount of a compound according to claim 11 to a patient in need of activating the G-protein PAF receptor. A method of treating a patient in need of inhibiting a G-protein PAF receptor, comprising administering a therapeutically effective amount of a compound according to claim 12 to a patient in need of inhibiting a G-protein PAF receptor. The method of claim 13, wherein the compound is a polypeptide and the patient is administered a therapeutically effective amount of the compound by providing DNA encoding the agent and expressing the agent in vivo. A method for diagnosing a disease or susceptibility to a low expression of a polypeptide according to claim 9 comprising measuring a mutation in a nucleic acid sequence encoding the polypeptide. The polypeptide of claim 9, wherein the polypeptide is a soluble fragment of the polypeptide and capable of binding to a ligand for the receptor. A method of analyzing the presence of a polypeptide in a sample derived from the host. Contacting the cell under conditions sufficient to allow the compound to bind to the receptor polypeptide, wherein the cell expresses at the surface a receptor polypeptide associated with a second component that can provide a detectable signal in response to binding of the compound to the receptor polypeptide; A method of identifying a compound that binds to, activates and inhibits the receptor polypeptide of claim 9, including identifying the compound as an effective agent or antagonist by detecting the presence or absence of a signal generated by the second component. A method for diagnosing a disease or susceptibility to a low expression of a polypeptide according to claim 9 comprising measuring a mutation in a nucleic acid sequence encoding the polypeptide.