KR19990008010A - Pineal gland specific gene-1 - Google Patents

Abstract

The present invention relates to human pineal gland specific gene-1 polypeptides, DNA (RNA) encoding such polypeptides, and methods of preparation. The invention also relates to methods of using such polypeptides to modulate the pineal gland and to adjust biological rhythms. Agonists and antagonists for such polypeptides and their use as therapeutic agents to modulate the action of such polypeptides are also described. In addition, the present invention relates to diagnostic assays for detecting mutations in polynucleotides encoding polypeptides and for detecting altered levels of polypeptides in a host.

Description

Pineal gland specific gene-1

The present invention relates to newly identified polynucleotides, to polypeptides encoding such polynucleotides, to the use of such polynucleotides and polypeptides and to methods of making such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention have been presumably identified as pineal gland specific genes, sometimes referred to as PGSG-1.

The pineal gland (pineal gland or cerebral living body) of humans and other mammals is considered endocrine in its functional activity. However, in its origin and evolution in vertebrates, there are other working relationships. The pineal photoreceptive capacity in the lower forms is the proposed main activity based on microscopic structure and neurophysiology.

The mammalian pineal gland is a distinct component of the neuroendocrine system. Neuronal and hormonal influx within the pineal gland interacts to regulate the synthesis and secretory activity of the pinealocytes, the only parenchymal cells of the pineal gland. These cells are believed to synthesize and secrete two chemical groups of hormones, namely indoleamines such as melatonin and peptides similar to those of the hypothalamic pituitary (hypothlamohyophyseal system). The main endocrine function of the pineal gland is the coordination or regulation of the time regulation of some biological rhythms known as circadian rhythms. This regulation relates to the change in seasonal or yearly rhythms (circannual) in response to 24 hour temporal control (circadian) and environmental cues. The physiological interrelationship between sympathetic neurodominance and stress and stimulation abundant in the pineal gland suggests that the endocrine activity of the pineal gland is also strongly related to these factors.

The pineal gland is also believed to act on brain chemistry and on excitability under certain conditions. A clear demonstration of pineal function was due to seasonal regeneration of regenerative organs in some Gwangju species. In the best studied golden hamster of the species, the regenerative sessions urged by cancer or short day photoperiod are dependent on the presence of the pineal gland. In humans, as in other species, pronounced 24-hour and seasonal rhythms occur due to blood levels of the pineal hormone melatonin.

The human pineal gland develops early during the second phase of the embryo. Although it is a single intermediate structure in adults, in embryos it originates from two sites, the anterior valgus of the anterior and solid regions originating from the rein drill zone and the region of the diencephalic roof between the reinforcement drill and the sagittal drill. Has a posterior and a cavity area. The pineal gland of mammals grows from infancy to adult mainly due to an increase in the size of the pinealocytes and secondaryly and more variably due to an increase in glial and stromal cells and their products. do.

The pineal gland of an adult human is 5 to 8 mm long and 3 to 5 mm wide. Their thin connective tissue inclusions are externally connected to the meninges and are basically blocked by the pineal gland.

The predominant observation is that pineal nerve domination is entirely autonomous and that the endocrine function of pineal cells is dependent on its sympathetic nervous system. The anatomical location of the pineal gland is critical for intracranial drainage. It is located adjacent to the union protruding from the deep cerebral veins and deep dural venous sinus in the center of the brain. Pineal tumors often obstruct or reposition these protrusions by squeezing the bulge against bulging of the corpus callosum.

Pinellosite is an organelle for active oxidation mechanisms and protein synthesis and generally has at least some of the structures involved in synaptic contact in brain nerves or retinal tissue. Pinellosite includes vesicles or compacts that are considered by some authors to contain presecretory substances. However, local concentrations and numbers of these follicles and dense bodies are generally not large. Pinellosite mitochondria exist in polymorphism and often in enormous size, with a relatively large number or concentration within the nucleus.

Many vesicles and inclusion bodies of pinellosite cause changes in the 24-hour cycle. Interest in these subjects began with the enzymatic activity that contributes to the synthesis of melatonin following a very wide 24-hour rhythm in pineal cell tonin (5-HT, 5-hydroxytryptamine). Chemical and hyperstructural components that contribute to melatonin synthesis and secretion are present in pinellosite. Within Pinellosite, cytoplasmic vesicles, microtubules, glycogen granules, synaptic ribbons and synaptic ribbon regions exhibit a prominent 24 hour cycle. Most of these components have a daily peak or acrophase. For mammalian pinellosite, synaptic ribbons may be more widely involved in the transport and release of chemical regulators.

The pineal product is hormonal in function and is thought to act on other organs and bodies in the brain. Pineal products are of two biochemical types: indeolamines and peptides or proteins. The pineal gland is required for normal concentrations of melatonin in the blood, as this concentration is reduced in pineal truncated animals. Serum melatonin concentrations in humans and other studied species vary with time of day, time of year, and season, and the natural periodicity of pineal biosynthesis and metabolic activity in animals immediately after birth is under sympathetic nervous system and organs are sympathetic nervous system. Necessary nerve domination is required. Sympathetic nervous system regulation occurs through the function of norepinephrine and a periodic amp.

Many peptides produced by the pineal gland are found in the hypothalamic pituitary gland. Other peptides produced by the pineal gland include arginine, vasopressin, arginine vasothocin, LH-RH, TRH, somatostatin, α-MSH, angiotensin 2 and substance P. Quay, WB, Histology Cell and Tissue Biology (5th ed.), pages 1079-1089 (1977), by Weiiss, L.].

Pineal tumors, also known as germinomas, are thought to destroy the inhibitory effect in the pituitary gland by the pineal gland, which causes precocious adolescence in children. Pineal tumors are known to be the most common in children.

According to one aspect of the present invention, novel mature polypeptides and biologically active and diagnostically or therapeutically useful fragments, homologues and derivatives thereof are provided. Polypeptides of the invention are of human origin.

According to another aspect of the invention, nucleic acid molecules, including mRNA, DNA, cDNA, genomic DNA and homologues, and fragments thereof are biologically active and diagnostically or therapeutically useful.

According to a further aspect of the invention, the method comprises culturing a recombinant prokaryotic cell and / or recombinant eukaryotic cell having a nucleic acid encoding a polypeptide of the invention under conditions that facilitate subsequent expression of such protein followed by subsequent recovery. Methods of producing such polypeptides by recombinant techniques are provided.

According to another aspect of the present invention, there is provided a method of using such polypeptides or polynucleotides encoding such polypeptides for therapeutic purposes, such as controlling the secretion of the pineal gland and adjusting the biological rhythm.

In accordance with aspects of the present invention, nucleic acid probes are provided comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.

According to another aspect of the invention, antibodies to such polypeptides are provided.

According to another aspect of the invention, there is provided a method for screening a protein to determine a compound that binds to or inhibits a receptor for a polypeptide of the invention and a compound that binds to or inhibits a receptor for a polypeptide of the invention. Is provided.

According to another aspect of the present invention, a method of using a compound for therapeutic purposes, which binds to and activates a receptor for a polypeptide of the invention, is provided.

According to a further aspect of the invention, a method of using a compound that binds to or inactivates a receptor for a polypeptide of the invention is provided.

According to one aspect of the present invention, a diagnostic assay is provided for detecting a disease associated with a mutation in a nucleic acid sequence encoding a polypeptide of the invention and for detecting altered levels of the polypeptide of the invention.

According to a further aspect of the present invention, for in vitro purposes relating to scientific investigations, DNA synthesis and the production of DNA vectors, methods are provided for using such polypeptides or polynucleotides encoding such polypeptides.

These and other aspects of the invention should be apparent to those skilled in the art from the teachings herein.

The following drawings are intended to list aspects of the invention and are not meant to limit the scope of the invention as covered by the claims.

1 shows the cDNA and corresponding inferred amino acid sequence of PGSG-1. The underlined regions represent putative signal sequences and standard one letter abbreviations for amino acids are used.

In accordance with an aspect of the present invention, a mature polypeptide having the inferred amino acid sequence of SEQ ID NO: 1 (SEQ ID NO: 2) or a mature polypeptide encoded by cDNA of a clone deposited with ATCC accession number _____ on 24 May 1995 is encoded. An isolated nucleic acid (polynucleotide) is provided.

Polynucleotides encoding the polypeptides of the invention have been found in cDNA libraries originating in human pineal gland tissue. The polynucleotides of the present invention have been found in cDNA libraries derived from the human pineal gland. This includes an open reading frame that encodes a protein of 344 amino acid residues, of which the mature protein contains 323 amino acids since approximately the first 21 amino acid residues are putative leader sequences. The putative soluble mature site of the protein comprises amino acids 262 from amino acids 1 of SEQ ID NO: 1. Proteins after amino acid 262 of SEQ ID NO: 1 are insoluble. This protein contains a transmembrane portion presumably identified as comprising amino acids 262-323 of SEQ ID NO: 2.

The polynucleotides of the present invention may be of RNA type or DNA type, and the DNA may be cDNA, genomic DNA and synthetic DNA. The DNA is double stranded or single stranded, and in the case of the single stranded strand, it may be a coding strand or an unencrypted (anti-sense) strand. The coding sequence encoding the mature polypeptide is identical to that of the deposited sequence or the deposited clone shown in FIG. 1 (SEQ ID NO: 1) or as a result of an excess or degeneracy of the genetic code, and the DNA or deposited cDNA of FIG. It may be a different coding sequence that encodes the same identical mature polypeptide.

Polynucleotides encoding the mature polypeptide of FIG. 1 (SEQ ID NO: 2) or the mature polypeptide encoded by the deposited cDNA may comprise the coding sequence for the mature polypeptide; Additional coding or proprotein sequences, such as coding sequences for mature polypeptides and leader or secretory sequences; Coding sequences for mature polypeptides (and optionally additional coding sequences) and non-coding sequences such as non-coding sequences 5 'and / or 3' of coding sequences for introns or mature polypeptides, but are not limited thereto. It doesn't work.

Thus, the term polynucleotide encoding a polypeptide includes polynucleotides comprising only the coding sequence for the polypeptide and polynucleotides comprising additional coding and / or non-coding sequences.

The present invention also relates to variants of the above-described polynucleotides encoding fragments, homologs and derivatives of the polypeptides encoded by the polypeptide having the inferred amino acid sequence of FIG. 1 (SEQ ID NO: 2) or the deposited clone's cDNA. Such variants of the polynucleotides may be naturally occurring allelic variants of the polypeptide or naturally occurring variants of the polynucleotides.

Accordingly, the present invention is directed to fragments or derivatives of polypeptides encoded by the polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO: 2) or the polypeptides of Figure 1 (SEQ ID NO: 2) or cDNAs of the deposited clones. Or variants of such polynucleotides encoding homologues. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As noted above, the polynucleotide may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in FIG. 1 (SEQ ID NO: 1) or the coding sequence of the deposited clone. As is known in the art, allelic variants are altered forms of polynucleotide sequences that may have substitutions, deletions or additions of one or more nucleotides that do not substantially alter the function of the encoded polypeptide.

The invention also provides that the coding sequence for the mature polypeptide acts as a polynucleotide sequence that assists in expressing and secreting the polypeptide from the host cell within the same reading frame, eg, a secretory sequence that regulates the transport of the polypeptide from the cell. Polynucleotides that can be fused to the leader sequence. A polypeptide having a leader sequence is a preprotein, which can form a mature form of the polypeptide by having the leader sequence degraded by the host cell. Polynucleotides can also encode proproteins, which are mature proteins and additional 5 'amino acid residues. Mature proteins with prosequences are proproteins, which are inactive forms of the protein. Degradation of the prosequence leaves the active mature protein.

Thus, for example, the polynucleotide of the present invention may encode a mature protein, a protein having a prosequence or a protein having both a prosequence and a presequence (leader sequence).

The polynucleotides of the present invention may also have coding sequences fused to marker sequences that allow purification of the polypeptides of the invention in a frame. This marker sequence is a hexa-histidine tag supplied by the pQE-9 vector to provide purification of the mature polypeptide fused to the marker in the case of bacterial cells, or for example a mammal, ie COS-7. In the case of cells, marker sequences, which may be hemagglutinin (HA), are used. HA tags correspond to epitopes derived from influenza hemagglutinin protein (Wilson, I., et al., Cell, 37: 767 (1984)).

The invention also relates to polynucleotides which hybridize to the above-mentioned sequences when at least 70%, preferably at least 90%, and more preferably at least 95% are homogeneous between sequences. The present invention relates in particular to polynucleotides which hybridize under stringent conditions for the polynucleotides described above. As used herein, the term stringent condition means that hybridization occurs only if at least 95% and preferably at least 97% of the sequences are homogeneous. In a preferred embodiment the polynucleotide hybridizing to the above-described polynucleotides has a biological activity or activity that is substantially the same as the mature polypeptide encoded by the cDNA or deposited cDNA of FIG. 1 (SEQ ID NO: 1), ie even the polypeptide is for example It encodes a polypeptide that acts as a soluble neuropeptide receptor by retaining the ability to bind a ligand to the receptor even when it does not act as a membrane bound neuropeptide receptor by causing a second messenger response.

Alternatively, polynucleotides are polynucleotides that hybridize to the polynucleotides of the present invention and have at least 20 bases, preferably 30 bases and more preferably 50 or more bases, which are homogeneous as described above, and which have no activity. Can be. Such polynucleotides may be used as recovery probes, diagnostic probes or PCR primers of the polynucleotides of SEQ ID NO: 1, eg, polynucleotides.

The deposits referred to herein will be maintained under the Budapest Treaty of International Approval in depositing microorganisms for patent procedural purposes. Such deposits are often conveniently provided to those skilled in the art, and the deposits may be 35 U.S.C. It does not require the approval required under § 112. The sequences of the polynucleotides included in the deposited material and the amino acid sequences of the polypeptides encoded thereby are incorporated herein by reference and are not inconsistent with any sequence description herein. Permits may be required to manufacture, use, or sell deposited materials, and no permits have been approved by the present application.

The invention also relates to polypeptides having the inferred amino acid sequence of FIG. 1 (SEQ ID NO: 2) or having amino acid sequences encoded by deposited cDNAs, fragments, homologs and derivatives of such polypeptides.

When referring to the polypeptide of FIG. 1 (SEQ ID NO: 2) or a polypeptide encoded by a deposited cDNA, the terms fragments, derivatives and homologs refer to polypeptides having substantially the same biological action or activity as those polypeptides. That is, homologues include proproteins that can be activated by degradation of proprotein sites to produce active mature polypeptides.

The polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or synthetic polypeptides, preferably recombinant polypeptides.

Fragments, derivatives or homologues of the polypeptide of FIG. 1 (SEQ ID NO: 2) or polypeptides encoded by deposited cDNA are (i) amino acid residues (preferably conserved amino acid residues) with or without one or more amino acid residues conserved. Substituted and such substituted amino acid residues may or may not be encoded by a genetic code, (ii) at least one amino acid residue comprises a substituent group, (iii) the half-life of the polypeptide by the mature polypeptide Fused to another compound, such as a compound that increases (e.g., polyethylene glycol), or (iv) additional amino acids are added to a mature polypeptide, ie, a sequence used for purification of a leader or secretory sequence or a mature polypeptide or proprotein sequence. It may be fused. Such fragments, derivatives and homologues are within the knowledge of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in isolated form and preferably in homogeneously purified form.

The term isolated refers to a substance removed from its original environment (ie, the natural environment if present naturally). For example, polynucleotides or polypeptides that are naturally present in living animals are not isolated, but the same polynucleotides or polypeptides that are separated from some or all of the materials present together in a natural system are separated. Such polynucleotides may be part of a vector and / or such polynucleotides or polypeptides may be part of a composition and are still isolated, in which case such vector or composition is not part of its natural environment.

Polypeptides of the invention have at least 70% similarity (preferably at least 70% homogeneity) with polypeptides of SEQ ID NO: 2 (particularly mature polypeptides) and polypeptides of SEQ ID NO: 2, more preferably at least 90% More similarly (more preferably at least 90% homogeneous) and even more preferably at least 95% similarity (more preferably at least 95% homogeneous) with the polypeptide of SEQ ID NO: 2 and at least 30 amino acids and More preferably it comprises a polypeptide comprising a site of a polypeptide having such a site of a polypeptide comprising at least 50 amino acids.

As is known in the art, the similarity between two polypeptides is determined by comparing the amino acid sequence and the conserved amino acid substituents of one polypeptide to the sequence of the second polypeptide.

Fragments or portions of the polypeptides of the present invention can be used to prepare corresponding full length polypeptides by peptide synthesis, so the fragments can be used as intermediates for making full length polypeptides. Fragments or sites of the polynucleotides of the invention can be used to synthesize the full length polynucleotides of the invention.

The present invention relates to the production of a polypeptide comprising the polynucleotide of the present invention, a host cell genetically processed with the vector of the present invention, and a polypeptide of the present invention by recombinant technology.

Host cells are genetically processed (transduced, transformed or transfected) by a vector of the invention, which can be, for example, a cloning vector or an expression vector. The vector may be in the form of, for example, a plasmid, viral particles, phage, or the like. The processed host cell can be cultured in a conventional nutrient medium modified to be suitable for activating the promoter, selecting transformants or amplifying the PGSG-1 gene. Culture conditions such as temperature, pH and the like are those already used with the host cell selected for expression and will be apparent to those skilled in the art.

The polynucleotides of the present invention can be used to prepare polypeptides by recombinant techniques. That is, for example, polynucleotides may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences, ie derivatives of SV40; Bacterial plasmids; Phage DNA; Baculovirus; Yeast plasmids; Vectors derived from the combination of plasmids and phage DNA, viral DNAs such as baccinia, adenovirus, foul pox virus and pseudorabies. However, any other vector can be used as long as it is replicable and alive in the host.

Appropriate DNA sequences can be inserted into the vector by a variety of processes. In general, DNA sequences are inserted into appropriate restriction endonuclease sites by processes known in the art. These and other processes are within the knowledge of those skilled in the art.

DNA sequences in expression vectors are operably linked to appropriate expression control sequences (promoters) to direct mRAN synthesis. Representative examples of such promoters include the LTR or SV40 promoter, E. E. coli lac or trp, phage lambda P _L promoters and other promoters known to modulate the expression of genes in prokaryotic or eukaryotic cells or their viruses may be mentioned. Expression vectors also include ribosomal binding sites for translational initiation and transcription terminators. The vector may also include appropriate sequences to amplify expression.

In addition, the expression vector preferably comprises one or more selectable marker genes so that in case of eukaryotic cell culture dihydrofolate reductase or neomycin resistance or E. coli. E. coli provides phenotypic properties for the selection of transformed host cells such as tetracycline or ampicillin resistance.

A host can be expressed by transforming the appropriate host with a vector comprising an appropriate DNA sequence as described above and an appropriate promoter or regulatory sequence.

Representative examples of suitable hosts include: E. coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, insect cells such as Drosophila S2 and Spodoptera Sf9, CHO, COS or Bowie Animal cells such as Bowes melanoma, adenoviruses, plant cells and the like can be mentioned. Selection of the appropriate host is within the knowledge of those skilled in the art from the teachings herein.

More particularly, the present invention includes recombinant constructs comprising one or more sequences as broadly described above. Such constructs include vectors, such as plasmids or viral vectors, in which the sequences of the present invention are inserted in either a forward or reverse orientation. In a preferred aspect of this aspect, the construct further comprises a regulatory sequence, eg, comprising a promoter operably linked to the sequence. A large number of suitable vectors and promoters are known to those skilled in the art and are commercially available. The following vectors are provided by way of example; Bacteria: pQE70, pQE60, pQE-9 (Qiagen), PBS, pD10, phargescript, psiX174, pbluescript SK, pbsks, pNG8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 from Pharmacia; Eukaryotic cells: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL from Pharmacia. However, other plasmids or vectors can be used as long as they are replicable and viable in the host.

Promoter regions can be selected from certain preferred genes using CAT (chloramphenicol cranferase) vectors or other vectors with selectable markers. Two suitable vectors are pKK232-8 and pCM7. Specially named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P _R , P _L and trp. Eukaryotic cell promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTR from retrovirus and mouse metallothionein-I. Selection of appropriate vectors and promoters is within the level of skill in the art.

In a further aspect, the invention relates to a host cell comprising the construct described above. The host cell can be a higher eukaryotic cell such as a mammalian cell or a lower eukaryotic cell such as a yeast cell or a prokaryotic cell such as a bacterial cell. Introduction of the construct into host cells can be performed by calcium phosphate transfection, DEAE-dextran regulated transfection or electroporation. Davis, L., Dibner, M., Battey, I , Basic Methods in Molecular Biology, (1986).

Constructs in host cells can be used in conventional manner to prepare gene products encoded by recombinant sequences. Alternatively, the polypeptides of the present invention can be prepared synthetically by conventional peptide synthesizers.

Fragments of the polypeptides of the invention can be used to prepare corresponding full length polypeptides by peptide synthesis, so fragments can be used as intermediates to produce full length polypeptides. Fragments of the polynucleotides of the present invention can be used in a similar manner to synthesizing the full length polynucleotides of the present invention.

Mature proteins can be expressed under the control of appropriate promoters in mammalian cells, yeast, bacteria or other cells. Cell free translation systems can also be used to prepare such proteins using RNAs derived from the DNA constructs of the invention. Suitable cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, second Edition, Cold Spring Harbor, NY, (1989). )].

Transcription of the DNA encoding the polypeptide of the invention by higher eukaryotic cells can be increased by inserting an enhancer sequence into the vector. Enhancers are generally cis-acting elements of DNA of 10 to 300 bp that act on the promoter and increase its transcription. Examples include the SV40 enhancer on the terminal region of replication origin 100 to 270 bp, the cytomegalovirus early promoter enhancer, the polyoma enhancer and the adenovirus enhancer on the terminal region of the replication origin.

In general, recombinant expression vectors are selectable markers that allow transformation of the origin of replication and host cells, ie, E. coli. Ampicillin resistance gene and S. coli S. cerevisiae TRP1 gene and a promoter originating from a highly expressed gene directing transcription of the downstream structural sequence. Such promoters may originate from operons, among others, encoding 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase or heat shock proteins and garton degrading enzymes. The heterologous structural sequence is assembled in an appropriate state with a leader sequence capable of directing the expression of the translated protein into the translation initiation and termination sequence, preferably into the cytoplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein comprising an N-terminal identifying peptide that confers the desired properties, ie, the stabilization or simplified purification of the expressed recombinant product.

Useful expression vectors for bacteria are constructed by inserting a structural DNA sequence encoding a suitable protein into a functional readout with a functional promoter along with a suitable translational initiation and termination signal. This vector will include one or more phenotypic selectable markers and replication origins that can retain and optionally propagate in the host. Suitable prokaryotic hosts for transformation are E. coli. Coli, Bacillus subtilis, Salmonella typhimurium and Pseudomonas, Streptomyces and Staphylococcus.

As a representative but non-limiting example, useful expression vectors for bacteria can include bacterial replication origins and selectable markers derived from commercially available plasmids comprising the genetic elements of the well known cloning vector pBR322 (ATCC37017). Such commercially available vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Swenden) and GEM1 (Promega Biotec, Madison, Wis., USA). These pBR322 backbone fragments are combined with appropriate promoters and structural sequences to be expressed.

Following transformation of the appropriate host strain and growth of the host strain to the appropriate cell density, the selected promoter is induced by appropriate means (eg, temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The cells are usually harvested by centrifugation, destroyed by physical or chemical means, and the crude extract obtained is stored for further purification.

Microbial cells used for protein expression can be disrupted by conventional convenient methods, including freeze-thaw cycles, sonication, mechanical disruption or the use of cytolytic agents, which methods are well known to those skilled in the art. .

Various mammalian cell culture systems can also be used to express recombinant protein. Examples of mammalian expression systems express COS-7 strains of monkey kidney fibroblasts (Gluzman, Cell, 23: 175 (1981)) and compatible vectors such as C127, 3T3, CHO, HeLa and BHK cell lines. Other cell lines that may be present. The mammalian expression vector will comprise a replication origin, a suitable promoter and enhancer and / or certain essential ribosomal binding sites, polyadenylation sites, splice donor and receptor sites, transcription termination sequences and 5 'flanking non-transcribed sequences. DNA sequences and polyadenylation sites derived from the SV40 splice can be used to provide the required non-transcribed genetic elements.

Polypeptides are prepared by methods comprising ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. It can be recovered and purified from recombinant cell culture. Protein refolding steps can be used as needed to complete the structure of the mature protein. Finally, high performance liquid chromatography (HPLC) can be used for the final purification step.

Polypeptides of the present invention may be naturally purified products or products of chemical synthesis processes or prepared by recombinant techniques from prokaryotic or eukaryotic cells (e.g., bacteria, yeast, higher plant, insect and mammalian cells in culture). Can be. Depending on the host used in the recombinant preparation method, the polypeptides of the invention can be glycosylated or aglycosylated. Polypeptides of the invention may also comprise initial methionine amino acid residues.

Pineal tumors occur at any age, but are most common in children. Precocious adolescence is the result of pineal tumors, especially in boys. This tumor squeezes Silvius canal causing hydrocephalus, congestive papilla and other signals of increased intracranial pressure. The area of the upper gut is also compressed, resulting in loss of upward gaze, sewage and pupil light and reflection control.

Thus, administration of a therapeutically effective amount of PGSG-1 polypeptide can be used to treat the conditions described above due to pineal gland tumors.

PSGS-1 genes and genetic products, in particular soluble forms of gene products, can also be used to regulate biological rhythms, especially circadian rhythms, which are known to produce melatonin, which is known to control the pineal gland circadian rhythms. Because there is.

The PGSG-1 gene and gene products can also be used to regulate hormones that regulate the onset of puberty, ie, progesterone (LH), reward stimulating hormone (FSH) and growth hormone (GH) released during puberty.

Fragments of the full-length PGSG-1 gene can be used as hybridization probes for cDNA to isolate the full-length PGSG-1 gene and to isolate other genes with high sequence similarity or similar biological activity to the gene. Probes of this type have at least 20 bases, preferably at least 30 and more preferably at least 50 bases. Probes can also be used to identify genomic clone (s) comprising cDNA clones corresponding to complete length of transcription and complete genes including regulatory and promoter regions, exons and introns. Examples of selection include separating the coding region of a gene by using known DNA sequences to synthesize oligonucleotide probes. The number of libraries to which the probe hybridizes is determined by selecting human cDNA, genomic DNA or mRNA using labeled oligonucleotides having sequences complementary to the gene sequences of the invention.

The polynucleotides and polypeptides of the invention can be used as investigative reagents and materials for treating and diagnosing human diseases.

The present invention provides a method for identifying a receptor for a PGSG1 polypeptide. Genes encoding receptors are known in a number of ways known to those of skill in the art, for example ligand panning and FACS classification [Coligna, et al., Current Protocls in Immun., 1 (2), Chapter 5, (1991). Preferably expression cloning is used, wherein the polyadenylated RNA is prepared from cells reactive to the PGSG-1 polypeptide, and the cDNA library created from such RNA is divided into mixtures to COS cells or PGSG-1 poly It is used to transform other cells that are not reactive to the peptide. Transfected cells growing on glass slides are exposed to labeled PGSG-1 polypeptide. This PGSG-1 polypeptide can be labeled by a variety of means including iodide or incorporation of a recognition site for site-specific protein kinases. Following fixation and incubation, the slides are subjected to auto-radiograph analysis. By identifying positive blends, preparing sub-blends and re-transfecting with repeated sub-blends and re-screening bubbles, ultimately a single clone encoding the putative receptor is obtained.

As another approach for receptor identification, the labeled ligand may be an extract formulation that expresses photoaffinity or receptor molecules associated with the cell membrane. The crosslinked material is dissolved by PAGE and exposed to X-ray film. Labeled complexes containing ligand-receptors can be stimulated to dissolve into peptide fragments and then subjected to protein microsequencing. Amino acid sequences obtained from fine sequencing can be used to design denatured oligonucleotide sets to select cDNA libraries for identifying genes encoding putative receptors.

The present invention also provides a method for screening compounds for identifying those that enhance (agonist) or block (antagonist) the interaction of PGSG-1 and its receptor. For example, when screening for a compound that binds to and activates a PGSG-1 receptor, a compound in which an isolated, immunized or cell bound form of PGSG-1 receptor is in contact with multiple compounds and that binds and interacts with the receptor Is selected. Binding or interaction can be measured directly by using a radioactively labeled compound in question or by a second messenger signal resulting from the interaction or binding of the candidate compound to the receptor.

When screening compounds that bind to PGSG-1 and inhibit its interaction with the receptor, the candidate compound is subjected to a competitive-screening assay, where preferably an analytically detectable reagent, most preferably radioactive Labeled PGSG-1 is introduced with the compound to be tested and the compound's ability to inhibit or enhance binding of labeled PGSG-1 is measured.

Another example of screening for compounds that inhibit the activation of the PGSG-1 receptor comprises contacting the compound to be screened with the PGSG-1 polypeptide with the PGSG-1 receptor in isolated or membrane-bound form. Inhibition of the signal produced by PGSG-1 in its receptor interaction means that the compound inhibits the activation of the receptor by blocking the receptor or preventing the interaction between PGSG-1 and its receptor. Second messenger signals include, but are not limited to, cANP guanylate cyclase, ion channel, or phosphinositide hydrolysis.

Special examples of compounds that inhibit the activation of the PGSG-1 receptor are oligos that block the receptor site by being closely related to the antibody or, in some cases, the protein that binds to or binds to the receptor site, but is an inactive form of the polypeptide. Peptides.

Another example is an antisense construct prepared using antisense technology. Antisense techniques can be used to regulate gene expression via triple-helix formation or antisense DNA or RNA (both of these methods are based on binding of polynucleotides to DNA or RNA). For example, the 5 'coding region of a polynucleotide sequence encoding a mature polynucleotide of the present invention can be used to design antisense RNA oligonucleotides of about 10 to 40 base pairs in length. DNA oligonucleotides are designed to be complementary to regions of the sequence involved in transcription (see triple helix; Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al, Science, 241: 456 (1988); and Dervan et al., Science, 251: 1360 (1991), preventing the transcription and production of PGSG-1. Antisense RNA oligonucleotides hybridize with mRNA in vivo to block the translation of mRNA molecules into PGSG-1 polypeptides. Antisense-Okano, J. Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of / Gene Expression, CRC Press, Boca Raton, FL (1988)]. The oligonucleotides described above can also be delivered intracellularly so that antisense RNA or DNA can be expressed in vivo and inhibit the production of PGSG-1.

Further examples also include small molecules that bind to and occupy the catalytic site of the polypeptide, making the catalytic site unacceptable for the substrate, thereby preventing normal biological activity. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules.

These compounds can be used to regulate the secretion of hormones such as LH, FSH and GH from the pituitary gland that regulates growth and differentiation. These can be used as compositions with pharmaceutically acceptable carriers as described below.

Polypeptides of the invention and their antagonists and antagonist compounds can be used with suitable pharmaceutical carriers. Such compositions comprise a therapeutically effective amount of the polypeptide and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should be suitable for the mode of administration.

The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the pharmaceutical compositions of the invention. Such containers are in the form described by government departments that control the manufacture, use, or sale of pharmaceutical or biological products, and are associated with instructions as evidenced by the manufacture, use, or vendor for human administration. In addition, the polypeptides or compounds of the present invention may be used with other therapeutic compounds.

The pharmaceutical composition may be administered in a conventional manner, for example parenterally. The pharmaceutical composition is administered in an amount effective for the treatment and / or prevention of specific symptoms. In general, they will be administered in an amount of about 10 μg / kg body weight and in most cases they will be administered in an amount of no greater than about 8 mg / kg body weight per day. In most cases, the dosage is from about 10 μg / kg body weight to about 1 mg / kg body weight per day with reference to the route of administration, symptoms, and the like.

PGSG-1 polypeptide compounds that activate or inhibit their receptors and which are also polypeptides can also be used by expressing such polypeptides in vivo in accordance with the present invention, commonly referred to as gene therapy.

That is, for example, cells from a patient can be provided to a patient using polynucleotides (DNA or RNA) encoding the ex vivo polypeptide, or processed using processed cells and then treated with these polypeptides. Such methods are well known in the art and are apparent from the teachings herein. For example, the cells can be processed using retroviral plasmid vectors containing RNA encoding the polypeptides of the invention.

Similarly, cells can be processed in vivo to express the polypeptide in vivo, for example, by processes known in the art. For example, the packaging cells are transduced with a retroviral plasmid vector comprising RNA encoding the polypeptides of the invention such that the packaging cells produce infectious viral particles containing the gene in question. These producing cells can be administered to a patient to process the cells in vivo and to express the polypeptide in vivo. Such and other methods of administering the polypeptides of the invention by such methods will be apparent to those skilled in the art from the teachings of the invention.

Retroviruses from which the above-mentioned retroviral plasmid vectors can be derived include Moloney Murine Leukemia Virus, Spleen Necrosis Virus, Rous Sarcoma Virus, and Harvey Sarcoma Virus. , Gold leukemia virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus, and mammalian tumor virus. In one embodiment, the retroviral prasmid vector is from the Moroni murine leukemia virus.

The vector contains one or more promoters. Suitable promoters that can be used include retrovirus LTR; Human cytomegalovirus (CMV) promoters described by the SV40 promoter and Miller et al. Biotechniques, Vol. 7, No. 9, 980-990 (1988)] or other promoters (ie, cellular promoters, such as eukaryotic promoters including but not limited to histones, Paul III, and β-actin promoters). . Other viral promoters that can be used include, but are not limited to, azeovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. Selection of suitable promoters will be apparent to those skilled in the art from the teachings herein.

Nucleic acid sequences encoding polypeptides of the invention are under the control of suitable promoters. Suitable promoters that can be used include adenovirus promoters such as adenovirus major rate promoters; Heterologous promoters such as cytomegalovirus (CMV) promoters; Inducible promoters such as the MMT promoter and the metallothionein promoter; Heat shock promoter; Albumin promoter; ApoAI promoter; Human globin promoter; Viral thymidine kinase promoters such as the herpes monoclonal thymidine kinase promoter; Retroviral LTRs (including the modified retrovirus LTRs described below); include, but are not limited to, β-actin promoter and human growth hormone promoter. The promoter may also be a natural promoter that regulates the gene encoding the polypeptide.

Producer cell lines are formed by transducing the packaging cell lines using retroviral plasmid vectors. Examples of packaging cells that can be transfected are PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E-86, GP + envAm12 and See Miller, Human gene Therapy, Vol. 1, pgs. 5-14 (1990), including but not limited to DNA cell lines. Vectors can be transduced into packaging cells by means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO ₄ precipitation. Alternatively, retroviral plasmid vectors can be enclosed into liposomes or coupled to lipids and then administered to a host.

Producer cell lines produce infectious retroviral vector particles comprising nucleic acid sequences encoding polypeptides. Such retroviral vector particles can then be used to transduce eukaryotic cells in vitro or in vivo. Transduced eukaryotic cells will express nucleic acid sequences encoding polypeptides. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic cancer cells and hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, kdratinocytes, endothelial cells and bronchial epithelial cells.

The invention also relates to the use of the genes of the invention as diagnostic agents. The detection of mutations in the polynucleotide sequences of the present invention enables the diagnosis of diseases resulting from reduced expression of PGSG-1, for example, precocious adolescence or the diagnosis of the likelihood for such diseases.

Individuals with mutations in the human PGSG-1 gene can be detected at the DNA level by various techniques. Diagnostic nucleic acids can be obtained from cells from a patient, ie, blood, urine, saliva, tissue biopsy and autopsy material. Genomic DNA can be used directly for detection or enzymatically amplified by using PCR prior to analysis (Saiki et al., Nature, 324: 163-166 (1986)). RNA or cDNA may also be used for the same purpose. By way of example, mutations can be identified and analyzed using PCR primers complementary to the nucleic acid encoding a polypeptide of the invention. Point mutations can be identified by hybridizing amplified DNA to radio-labeled PGSG-1 RNA or otherwise to radio-labeled PGSG-1 antisense DNA sequence. For example, deletions and insertions can be detected as changes in the size of the amplified product compared to normal genotypes. Point mutations can be identified by hybridizing amplified DNA to radiolabeled PGSG-1 RNA or otherwise radiolabeled PGSG-1 antisense DNA sequences. Completely paired sequences can be distinguished from unpaired double strands by differences in RNase A degradation or melting temperature.

Sequence differences between the reference gene and the gene with the mutation can be represented by direct DNA sequencing methods. In addition, cloned DNA sequences can be used as probes to detect specific DNA fragments. The sensitivity of this method is greatly improved when combined with PCR. For example, sequencing primers are used with single-stranded PCR products or single-chain template molecules produced by modified PCR. Sequencing is performed by conventional methods using radiolabeled nucleotides or by automated sequencing processes using fluorescent tags.

Genetic testing based on DNA sequence differences is accomplished by detecting alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturants. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences are delayed in the gel to different locations depending on the particular melting or partial melting temperature of the mobility of the different DNA fragments (Myers et al., Science, 230: 1242 (1985)).

Sequence changes at specific positions can also be identified by nuclease protection assays or chemical degradation methods such as RNases and S1 (Cotton et al., PNAS, USA, 85: 4397-4401 (1985)).

That is, detection of specific DNA sequences may be accomplished by methods such as hybridization, RNase protection, chemical digestion, direct DNA sequencing or the use of restriction enzymes (ie, restriction fragment length polymorphism (RFLP)) and Southern blotting of genomic DNA. Can be achieved.

In addition to the more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by analysis in the reaction system itself.

The present invention relates to diagnostic assays for detecting altered levels of polypeptides of the invention that are below normal and compared to normal control samples and that can be used to detect the presence of penile tumors. Assays for detecting levels of polypeptides of the invention in sample-derived proteins in samples derived from the host are well known to those skilled in the art and include radioimmunoassays, competitive-binding assays, western blot assays and preferably ELISAs. Contains the assay. The ELISA assay first comprises preparing an antibody, preferably a monoclonal antibody, specific for the PGSG-1 antigen. Reporter antibodies are also prepared against monoclonal antibodies. This reporter antibody is attached with a radioactive, fluorescent or detectable reagent such as, for example, horseradish peroxidase enzyme. The sample is now removed from the host and incubated, for example, on a solid support such as a polystyrene dish that binds the protein in the sample. Certain free protein binding sites on dishes are then incubated with nonspecific proteins such as bovine serum albumin and recovered. The monoclonal antibody is then incubated in the dish for the time that the monoclonal antibody is attached to the particular polypeptide of the invention attached to the polystyrene-protein attached to the polystyrene dish. All unbound monoclonal antibodies are washed with buffer. Reporter antibodies linked to horseradish peroxidase are now placed in a dish to obtain binding of the reporter antibody to certain monoclonal antibodies bound to the polypeptides of the invention. Unattached reporter antibodies are then washed. The amount of color developed for a given time while peroxidase substrate is added to the dish is a measure of the amount of polypeptide of the invention present in a given protein present in a given volume of patient sample as compared to the standard curve.

An antibody specific for PGSG-1 protein is attached to a solid support, a sample from the host and a labeled PGSG-1 protein pass over the solid support and attached to the solid support to detect the amount of label detected in the sample. Competitive assays relating to the amount of protein can be used.

The sequences of the invention are also effective for chromosomal identification. This sequence can be specifically targeted to and hybridize to specific locations on individual human chromosomes. Moreover, there is a current need to identify special locations on chromosomes. A few chromosomal marking reagents based on substantial sequence data (repeated polymorphism) are currently used to indicate chromosomal location. The mapping of DNA to chromosomes according to the invention is an important first step in associating sequences with genes associated with the disease.

In summary, sequences can be mapped to chromosomes by making PCR primers (preferably 15-25 bp) from cDNA. Computational analysis of the 3 'unread region of the gene is used to rapidly select primers that complicate the amplification method by not extending to one or more exons in genomic DNA. These primers are used for PCR selection of somatic hybrids containing individual human chromosomes. Only hybrids comprising the human gene corresponding to the primer will yield the amplified fragment.

PCR mapping of somatic cell hybrids is a rapid process of assigning specific DNA to specific chromosomes. Using the invention using the same oligonucleotide primers, it is possible to localize using a mixture of large genomic clones or spanners of fragments from specific chromosomes in the same manner. Other buried methods that can be similarly used to map to chromosomes include in situ hybridization, prescreening using labeled flow-classified chromosomes, and prescreening by hybridization to construct chromosome specific cDNA libraries.

In situ fluorescent hybridization (FISH) of cDNA clones to the mesophase chromosome can be used to provide the exact location in one step. This technique can be used with 50 or 60 or more cDNAs. See, eg, Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of this sequence on the chromosome can be associated with genetic map data. Such data are described, for example, in V. McKusick, Mendelian Inheritance in Man (available online via the Johns Hopkins University Welch Medical Library). Relationships between diseases mapped to the same chromosomal region of a gene are identified through subsequent chain analysis (cogeneity of physically adjacent genes).

Next, it is necessary to determine the difference in cDNA or genomic sequence between affected and unaffected individuals. If mutations are found in some or all of the affected individuals but not in normal individuals, these mutations will be the causative agent of the disease.

Using current physical mapping analysis and genetic mapping techniques, the cDNA located in the chromosomal region associated with the disease can be one of 50 to 500 potent trigger genes (this is one megabase mapping analysis and one gene per 20 kb). Indicates).

Antibodies to these can be prepared using polypeptides, fragments or other derivatives thereof, or their analogs or cells expressing them as immunogens. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain and humanized antibodies and products of Fab fragments or Fab expression libraries. Various processes known in the art can be used to prepare such antibodies and fragments.

Antibodies generated against a polypeptide corresponding to a sequence of the invention can be obtained by directly injecting the polypeptide into an animal or by administering the polypeptide to a human, preferably an animal other than a human. The antibody thus obtained will bind to the next polypeptide itself. In this way, even when a sequence encoding only one fragment of the polypeptide is used, an antibody is produced that binds to the entire natural polypeptide. Such antibodies can then be used to isolate such polypeptides from tissues expressing the polypeptides.

For the preparation of monoclonal antibodies, any technique can be used which provides the antibody obtained by continuous culture of the cell line. For example, hybridoma technology (Khoer and Milstein, 1975, Nature, 256: 495-497), trioma technique, human B-cell hybridoma technology (Kozbor et al., 1983, Immunology Today 4:72) and EBV-hydridoma technology for preparing human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, alan R. Lies, Inc., pp. 77-96).

Techniques described for single chain antibody production (US Pat. No. 4,946,778) can be employed to produce single chain antibodies against the immunogenic polypeptide products of the invention. In addition, transgenic mice can be used to express humanized antibodies against the immunogenic polypeptide products of the invention.

The present invention will be described in more detail with reference to the following examples, which should not be construed as limiting the invention thereto. All parts or amounts are by weight unless otherwise indicated.

In order to help the understanding of the following examples, frequent methods and / or terms of measurement will be described.

Plasmids are named with a lowercase p preceded and / or followed by an uppercase and / or number. Starting plasmids herein can be commercially available, non-limitingly used, or constructed from useful plasmids according to known processes. Plasmid equivalents to those described are also known in the art and will be apparent to those skilled in the art.

Degradation of DNA refers to catalytic degradation of DNA using restriction enzymes that act only on specific sequences in the DNA. Various restriction enzymes used herein are commercially available and their reaction conditions, officials and other requirements are used as known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5-50 μg of DNA is digested with 20 to 250 units of enzyme in a large volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. An incubation time of about 1 hour at 37 ° C. is generally used but may vary as directed by the supplier. After decomposition, the reaction is electrophoresed directly onto polyacrylate to separate the desired fragments.

Size separation of digested fragments is performed using an 8% polyacrylamide gel described in Goeddel, D. et al., Nucleic Acids Res., 8: 4057 (1980).

Oligonucleotides refer to single chain polydeoxynucleotides or two complementary polydeoxynucleotide chains that can be chemically synthesized. Such synthetic oligonucleotides do not have 5 'phosphate and thus cannot be linked to other oligonucleotides without the addition of phosphate with ATP in the presence of kinase. Synthetic oligonucleotides will be linked to fragments that are not dephosphorylated.

Linking refers to a method of forming phosphodiester bonds between two double-stranded nucleic acid fragments (Maniatis, T., et al., Id., P. 146). Unless otherwise indicated, ligation can be accomplished with 10 units of T4 DNA ligase (ligase) per 0.5 μg of approximately equimolar amount of DNA fragment to be linked using known buffer solutions and conditions.

Unless otherwise indicated, transformation is performed as described in the methods of Graham, F. and Van der Eb, A., Virology, 52: 456-457 (1973).

Example 1

In Vitro Expression and Purification of Soluble Forms of PGSG-1 Protein

DNA sequence encoding PGSG-1, a sequence having 24 nucleotides of PGSG-1 coding sequence comprising ATCC # _ as a 5 'oligonucleotide, comprising the BgLlII restriction enzyme site and then starting from the estimated terminal amino acid of the processed protein codon A sequence comprising GCAGATCTGACAAGTGTTACTGTCAGTCATC (SEQ ID NO: 3) and a sequence complementary to the BglII restriction enzyme as the 3 'sequence, followed by 28 nucleotides of the PGSG-1 coding sequence and further comprising a stop codon encoded at amino acid 262 of SEQ ID NO: 2 Amplify first using GCAAGATCTTAACGCAGGTTGGGCCGGCCTTTGGCTT (SEQ ID NO: 4). The restriction enzyme site corresponds to the restriction enzyme site on bacterial expression vector pQE-9. pQE-9 encodes antibiotic resistance (Amp '), bacterial replication origin (ori), ribosomal binding site (RBS), 6-His tag and restriction enzyme sites. The pQE-9 is then digested with BamHI. The amplified sequences are linked into pQE-9 and inserted in-frame with sequences encoding histidine tags and ribosomal binding sites (RBS). Vectors containing inserts of the proper orientation are identified by sequencing. Then using this linking mixture, Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, cold Spring Laboratory Press, (1989). E. coli strain M15 / rep 4 (Qiagen, Inc.) is transformed. M15 / rep4 contains multiple copies of plasmid pREP4, which expresses a lacI repressor and also confers kanamycin resistance (Kan ^r ). Transformants are identified by their ability to grow on LB medium and select ampicillin / kanamycin resistant colonies. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml). Incubate a large amount of culture at a ratio of 1: 100 to 1: 250 using O / N culture. The cells are grown to an optical density of 600 (OD ⁶⁰⁰ ) between 0.4 and 0.6. IPTG (isopropyl-BD-thiogalacto pyranoside) is added at a final concentration of 1 mM. IPTG is induced by inactivating the lacI repressor and sintering the P / O leading to increased gene expression. The cells are grown for an additional 3-4 hours. The cells are then harvested by centrifugation. The cell pellet is dissolved in 6 moles of guanidine HCl, a chaotropic agent. After purification, the dissolved PGSG-1 is purified from this solution by chromatography on a nickel-chelate column under conditions that allow strong binding by the protein containing 6-His tag. Hochuli, E. et al. , J. Chromatography 411: 177-184 (1984). 90% pure protein was columned in 6 moles of guanidine HCl pH 5.0 for renaturation purposes adjusted with 3 moles of guanidine HCl, 100 mM sodium phosphate, 10 mmol glutathione (reduced) and 2 mmolyl glutathione (oxidized) Elute from. After incubation for 12 hours in this solution, the protein is dialyzed against 10 mmol of sodium phosphate.

Example 2

Cloning and Expression of Soluble Forms of PGSG-1 Using a Baculovirus Expression System

DNA sequence encoding full-length PGSG-1 protein, ATCC #_, is amplified using oligonucleotide primers corresponding to 5 'and 3' of the gene:

The 5 'primer has the sequence 5' GC AGATCT ATC ATG AAAGGTGAACTGCTCCT 3 '(SEQ ID NO: 4) comprising the BglII restriction enzyme site (bold).

The 3 'primer has the sequence 5' GC AGATCT TTAACGCAGGTTGGCCGGCCTTGGCTT 3 'comprising a cleavage site for restriction endonuclease BglII and 24 nucleotides complementary to the 3' sequence of the PGSG-1 gene. This amplified sequence is isolated from 1% agarose gel using a commercially available kit (Geneclean, BIO 101 In., La Jolla, Ca.). This fragment is then digested with endonuclease BglII and purified again on 1% agarose gel. Specify this fragment as F2.

Vector pA2 (variant of the pVL941 vector described below) is used for the expression of PGSG-1 protein using the baculovirus expression system (Summers, MD and Smith, GE 1987, a manual of methods for baculovirus vectors and insect cell). cultreprocedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains a potent polyhedrin promoter of Autographa calofornica nuclear polyhedrosis virus (AcMNPV) followed by a recognition site for restriction endonuclease BamHI. E. coli to facilitate screening for recombinant viruses. The β-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the polar adenylation signal of the polyhedrin gene. This polyhedrin sequence is flanked on both sides by viral sequences for cell-mediated homogeneous recombination of co-transfected wild type viral DNA. Many other baculovirus vectors such as pRG1, pAc373, pVL941 and pAcIM1 can be used in place of pA2 (Lukekow, V. A. and Summers, M. D., Virology, 170: 31-39).

The plasmid is digested with the restriction enzyme BamHI and dephosphorylated using calf intestinal phosphatase by processes known in the art. The DNA is then isolated from 1% agarose gel using a commercially available kit (Geneclean BIO 101 Inc., La Jolla, Ca.). This vector DNA is named V2.

Fragment F2 and dephosphorylated plasmid V2 are linked with T4 DNA ligase. this. Bacteria are identified as whether they contain a plasmid (pBac PSGS-1) with PGSG-1 gene that transforms E. coli XL-1 blue cells and encodes the soluble form of the protein. Cloned fragments are identified by DNA sequencing using XhoII sequence and orientation.

5 μg of plasmid pBacPGSG-1 with 1.0 μg of commercially available linearized baculovirus DNA (BaculoGold ^™ baculovirus DNA, Pharmingen, San Diego, Calif.) Was analyzed by Felgner et al. Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)].

1 μg BaculoGold ^™ baculovirus DNA and 5 μg plasmid pBac PGSG-1 are mixed in 50 μl of serum free Grace medium (Grace's medium: Life technologies Inc., Gaithersburg, MD) in sterile wells. 10 μl of Lipofectin and 90 μl of Grace's medium are added, mixed, and incubated at room temperature for 15 minutes. The transfection mixture is then added dropwise to Sf9 insect cells (ATCC CRL 1711) spawned in 35 mm tissue culture plates containing 1 ml of Grace's medium without serum. Shake this plate back and forth to mix the newly added solution. This plate is then incubated at 27 ° C. for 5 hours. After 5 hours, the transfection solution is removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. Place the plate upside down in the incubator and continue incubating at 27 ° C. for 4 days.

After 4 days, supernatants are collected and plaque assays are performed similar to those described by Summers and Smith (see above). Use agarose gels containing Blue Gal (Life Technologies Inc., Gaithersburg) to facilitate separation of blue stained plaques as a variant (detailed description of plaque assays is also available for users for insect cell cultures). Guides and pages 9 to 10 of Baculobylogy, distributed by Life Technologies Inc., gaithersburg).

After 4 days of serial dilution, virus is added to the cells and the blue stained plaques are picked up with the tip of an Eppendorf pipette. Agar containing the recombinant virus is resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by centrifugation and the supernatant containing the recombinant baculovirus is used to infect the spawned Sf9 cells in a 35 mm dish. After 4 days, the supernatant of this culture dish is collected and stored at 4 ° C.

Sf9 cells are grown in grace medium supplemented with 10% heat-inactivated FBS. The cells are infected with recombinant baculovirus V-PGSG-1 at an infection redundancy (MOI) of 2. After 6 hours the medium is removed and replaced with SF900 II medium without methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later, and it is a ³⁵ S- methionine and 5μCi ³⁵ S cysteine (Amersham) 5μCi. The cells are incubated for an additional 16 hours before they are harvested by centrifugation and the labeled proteins are visualized by SDS-PAGE and autoradiography.

Example 3

Expression through gene therapy

Fibroblasts are obtained from the patient by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into bovine pieces. A small piece of tissue is placed on the wet surface of the tissue culture flask and approximately 10 pieces are placed in each flask. The flask is placed upside down and sealed and left overnight at room temperature. After 24 hours at room temperature, the flask is inverted and the pieces of tissue remain fixed at the bottom of the flask and fresh media containing 10% FBS, penicillin and streptomycin (ie Ham's F12 medium) are added. This is then incubated for approximately one week at 37 ° C. After this time, fresh medium is added and changed continuously every few days. After two weeks of culture, a monolayer of fibroblasts appears. This monolayer is trypsinized and scaled up into a large flask.

PMV-7 (Kirschmeier, PT et al, DNA, 7: 219-25 (1988)) flanked by the long terminal repeat units of Moroni murine sarcoma virus was digested with EcoRI and HindIII and subsequently calf intestinal phosphatase To be processed. Linear vectors are fractionated on agarose gels using glass beads and purified.

CDNA encoding the polypeptides of the invention are amplified using PCR primers corresponding to the 5 'and 3' ends, respectively. The 5 'promoter and 3' primer containing the EcoRI site further comprises the HindIII site. Equal amounts of Moroni murine sarcoma virus linear bone marrow and amplified EcoRI and HindIII fragments are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions suitable for linking the two fragments. Bacterial HB101 is transformed using the ligation mixture and then plated onto agar containing kanamycin to confirm that the vector has the gene of interest inserted appropriately.

Ampotropic pA317 or GP + am12 packaging cells are grown to a consistent density in Dulbecco's Modified Eagles Medium (DMEM) containing 10% calf serum (CS) in tissue culture. MSV bets containing the following genes are added to the medium and the packaging cells are transduced with the vector. Packaging cells produce infectious viral particles containing genes (packaging cells are referred to as producer cells).

Fresh medium is continuously serialized to the transduced producer cells and the medium is harvested from 10 cm plates of matched producer cells. The spent medium containing infectious virus particles is filtered through a Millipore filter to remove exfoliated producer cells and then the media is used to infect fibroblasts. The medium is removed from the sub-matching plates of the fibroblasts and quickly replaced with the medium from the producer cells. Remove this medium and replace with fresh medium. If the viral titer is high, virtually all fibroblasts will be infected and no screening is required. If the titer is very low, it is essential to use retroviral vectors with selectable markers such as neo or his.

The processed fibroblasts are then grown alone or on mating phases on cytodex 3 microcarrier beads and injected into the host. These fibroblasts produce protein products.

Since many modifications and variations of the present invention are possible in light of the above teachings, the invention may be practiced otherwise than as specifically described within the scope of the appended claims.

Sequence list

(1) General Information:

(i) Applicant: Hi et al.

(ii) Name of invention: pineal gland specific gene-1

(iii) SEQ ID NO: 6

(iv) Residential address:

(A) Nomenclature: Carella, Byrne, Vine, Gilphyllan, Cinch, Snortworth and Allstein

(B) A: Becker Farm Road 6

(C) Sea: Rowlands

(D) State: New Jersey

(E) Country: United States

(F) ZIP code (ZIP): 07068

(v) computer readable:

(A) Medium type: 3.5 inch diskette

(B) Computer: IBM PC / 2

(C) operating system: MS-DOS

(D) Software: Word Perfect 5.1

(vi) Current application data:

(A) Application number:

(B) Application date: same as the present application

(vii) Pre-Application Data:

(A) Application number: none

(B) filing date: none

(viii) Agent / Delegate Information:

(A) Statement: Ferraro Gregory Dee

(B) Registration Number: 36,134

(C) Reference / Document Number: 325800-

(viii) Communications Information:

(A) Phone number: 201-994-1700

(B) Fax number: 201-994-1744

(2) Information about SEQ ID NO: 1

(i) sequence properties:

(A) Length: 1198 base pairs

(B) Type: nucleic acid

(C) main chain type: Japanese chain

(D) mode: linear

(ii) Molecular Type: cDNA

(xi) sequence description:

(2) Information about SEQ ID NO:

(i) sequence properties:

(A) Length: 344 base pairs

(B) Type: Amino Acid

(C) chain type:

(D) mode: linear

(ii) Molecular Type: Protein

(xi) sequence description:

(2) information about SEQ ID NO:

(i) sequence properties:

(A) Length: 31 base pairs

(B) Type: nucleic acid

(C) main chain type: Japanese chain

(D) mode: linear

(ii) Molecular Type: Oligonucleotide

(xi) sequence description:

(2) information about SEQ ID NO:

(i) sequence properties:

(A) Length: 35 base pairs

(B) Type: nucleic acid

(C) main chain type: Japanese chain

(D) mode: linear

(ii) Molecular Type: Oligonucleotide

(xi) sequence description:

(2) information about SEQ ID NO:

(i) sequence properties:

(A) Length: 31 base pairs

(B) Type: nucleic acid

(C) main chain type: Japanese chain

(D) mode: linear

(ii) Molecular Type: Oligonucleotide

(xi) sequence description:

(2) Information about SEQ ID NO:

(i) sequence properties:

(A) Length: 34 base pairs

(B) Type: nucleic acid

(C) main chain type: Japanese chain

(D) mode: linear

(ii) Molecular Type: Oligonucleotide

(xi) sequence description:

Claims (20)

(a) a polynucleotide encoding the polypeptide of SEQ ID NO: 2; (b) a polynucleotide encoding a polypeptide comprising amino acids 1 to 262 of SEQ ID NO: 2; (c) may be hybridized to the polynucleotides of (a) or (b) and at least 70% of the same polynucleotides and (d) An isolated polynucleotide comprising a polynucleotide selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). The polynucleotide of claim 1, wherein the polynucleotide is DNA. The polynucleotide of claim 1, which is RNA. The polynucleotide of claim 1, wherein the polynucleotide is genomic DNA. The polynucleotide of claim 2, which encodes a polypeptide of SEQ ID NO: 2. (a) a polynucleotide encoding a mature polypeptide encoded by a DNA contained in ATCC Accession No. ___; (b) a polynucleotide encoding a polypeptide expressed by a DNA contained in ATCC Accession No. ___; (c) may be hybridized to the polynucleotides of (a) or (b) and at least 70% of the same polynucleotides and (c) An isolated polynucleotide comprising a polynucleotide selected from the group consisting of polynucleotide fragments of the polynucleotides of (a), (b) or (c). A vector comprising the DNA according to claim 2. A host cell genetically processed with the vector according to claim 7. A method for producing a polypeptide comprising expressing a polypeptide encoded by DNA from a host cell according to claim 8. A method for producing a cell capable of expressing a polypeptide, comprising the step of transforming or transfecting a cell with the vector according to claim 7. (i) a polypeptide having the inferred amino acid sequence of SEQ ID NO: 2 and fragments, homologs and derivatives thereof; (ii) a polypeptide comprising amino acids 1 to 262 of SEQ ID NO: 2 and (iii) a polypeptide selected from the group consisting of a polypeptide encoded by the cDNA of ATCC Accession No. ___ and fragments, homologs and derivatives of such polypeptide. A compound effective as an agonist for the polypeptide according to claim 11. Compounds effective as antagonists for the polypeptide according to claim 11. A method of treating a patient comprising administering a therapeutically effective amount of the polypeptide of claim 11 to a patient in need of PGSG-1. The method of claim 14, wherein the patient is administered a therapeutically effective amount of the polypeptide by providing a DNA encoding the polypeptide and expressing the polypeptide in vivo. A method of treating a patient comprising administering to the patient in need of PGSG-1 a therapeutically effective amount of the compound of claim 12. A method of treating a patient comprising administering to the patient in need of inhibiting PGSG-1 a therapeutically effective amount of the antagonist according to claim 13. A method of diagnosing a disease associated with or expression of a polypeptide according to claim 11 comprising detecting a mutation in a nucleic acid sequence encoding the polypeptide. A diagnostic method comprising assaying for the presence of a polypeptide according to claim 11 in a sample from a host. A cell expressing a receptor on the surface of the receptor for the polypeptide, which is associated with a second component that is capable of providing a detectable signal in response to binding of the receptor for the polypeptide according to claim 11 to a compound. Contacting the compound to be screened under conditions that permit binding, and Determining whether a compound binds to the receptor and activates or inhibits the receptor by detecting the presence or absence of a signal generated from the interaction of the compound with the receptor. A method of identifying compounds that bind to activate or inhibit.