KR102664856B1 - Antibacterial and antifungal composition comprising the Novel Lactiplantibacillus plantarum WiKim0125 - Google Patents

Abstract

Lactiplantibacillus plantarum WiKim0125 strain according to the present invention is a lactic acid bacterium isolated from kimchi and exhibits excellent antibacterial and antifungal activity, so it is suitable for use in antibacterial and antifungal compositions containing lactic acid bacteria as an active ingredient. It can be used in various ways.

Description

Antibacterial and antifungal composition comprising the Novel Lactiplantibacillus plantarum WiKim0125}

The present invention relates to Lactiplantibacillus plantarum WiKim0125 strain, a novel lactic acid bacterium isolated from kimchi, and an antibacterial and antifungal composition containing the same.

There are many types of microorganisms such as bacteria and molds, and they are widely distributed in the natural world. They can grow and reproduce at any time if the growth conditions are right, so they can cause human diseases, food spoilage, housing, clothing, and industrial products. Damage caused by microorganisms is serious. As a preventive measure against this, research has been actively conducted to prevent biological decay and deterioration caused by microorganisms.

Food, household goods, medicines, and cosmetics are subject to corruption and deterioration caused by various microorganisms, and such corruption and deterioration not only deteriorate the quality of the product but also make the production of the product itself impossible. Therefore, in order to maintain efficient product quality, it is essential to remove microorganisms or control bacteria or mold using preservatives during the manufacturing and distribution process.

Until recently, these microorganisms have been chemically synthesized and used as preservatives in products that are added to products such as food, medicine, cosmetics, household goods, paint, biological samples, and wood in order to prevent corruption due to proliferation or unwanted chemical changes. , Recently, as consumer interest in health increases, the demand for natural preservatives is increasing. Preservatives used in products such as food and cosmetics must have a clear preservation effect even when only a small amount is used, must have a long-lasting effect and be simple to use, and must be effective against a variety of microorganisms while being non-toxic.

Recently, there has been a growing need to develop natural antibacterial agents using microorganisms or substances produced by microorganisms, but many problems remain to be solved from economic, sensory and practical aspects in order to apply them to actual foods. And because various factors come into play, there is a significant difference from the antibacterial activity of actual foods. For example, the active site that shows the antibacterial effect of an antibacterial agent is mainly surrounded by food particles (protein, fat, sugar, salt, etc.) in food, so only a part of the antibacterial agent added to the food can act.

There have been efforts to develop safe food antibacterial or antifungal agents using lactic acid bacteria among microorganisms, but because lactic acid bacteria have a narrow antibacterial spectrum, it is difficult to apply them to foods as a natural antibacterial agent.

Therefore, there is a need for the development of lactic acid bacteria with excellent antibacterial and antifungal activities and a diverse spectrum of inhibitory activities.

Accordingly, the present inventors studied lactic acid bacteria with excellent antibacterial and antifungal activities and compositions containing them, and as a result, found that Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain and compositions containing it have excellent antibacterial and antifungal activities. It was confirmed that the strain with excellent antibacterial and antifungal activity can be used in various fields such as antibacterial or antifungal food, pharmaceuticals, cosmetics, and feed additives.

The purpose of the present invention is to provide Lactiplantybacillus Plantarum WiKim0125 strain with accession number KFCC11871P.

Another object of the present invention is to provide an antibacterial food composition containing Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

Another object of the present invention is to provide an antifungal food composition containing the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

Another object of the present invention is to provide an antibacterial pharmaceutical composition containing Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

Another object of the present invention is to provide an antifungal pharmaceutical composition containing Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

Another object of the present invention is to provide an antibacterial feed composition containing the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

Another object of the present invention is to provide an antifungal feed composition containing the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

Another object of the present invention is to provide an antibacterial cosmetic composition containing Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

Another object of the present invention is to provide an antifungal cosmetic composition containing the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

Hereinafter, the present invention will be described in detail.

One aspect of the present invention is Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P.

In the present invention, the Lactiplantibacillus plantarum WiKim0125 strain is a rod-shaped Gram-positive strain, a facultative anaerobe that grows regardless of the presence or absence of oxygen, and contains rhamnose, inulin, and raffinose ( Raffinose) is metabolized, but D-Turanose and D-Arabitol are not utilized.

In the present invention, the Lactiplantibacillus plantarum WiKim0125 strain may exist as live or dead cells, and may also exist in dried or freeze-dried form. Additionally, a culture of the Lactiplantibacillus plantarum WiKim0125 strain may be an active ingredient, and the culture may include a live cell culture medium or a dead cell supernatant. Forms and formulation methods of lactic acid bacteria suitable for inclusion in various compositions are well known to those skilled in the art. For example, the Lactiplantybacillus plantarum WiKim0125 strain is a culture obtained by culturing the strain in a known liquid medium or solid medium, a fermented product obtained by culturing the strain with additional components, or the strain is organically produced. It can be formulated in the form of an extract extracted with a solvent, a lysate (or lysate) obtained by dissolving the cell membrane of the strain, or crushed or homogenized, but is not limited thereto.

Another aspect of the present invention relates to an antibacterial food composition comprising the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

In the present invention, the antibacterial food composition includes Staphylococcus aureus, Salmonella typhimurium , Escherichia coli, Bacillus cereus , Pseudomonas aeruginosa , and Micrococcus roux. It may inhibit the activity of one or more strains selected from the group consisting of Micrococcus luteus , but is not limited thereto.

In the present invention, the antibacterial food composition may be related to the improvement or prevention of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory system infection, sinus infection, and inflammatory disease, but is not limited thereto.

In the present invention, the amount of Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain included in the composition may be about 10 ⁶ to 10 ¹² cfu/g per time, for example, 10 ⁷ to 10 It may be ¹¹ cfu/g, 10 ⁸ to 10 ¹⁰ cfu/g. When administering a strain, it is preferable to administer it in a live state, and it can be killed before ingestion or administered in an attenuated state. In addition, when manufacturing using culture supernatant, etc., it may additionally undergo a sterilization process through a heat treatment process. The amount of strain and daily intake required to have minimal efficacy may vary depending on the body or health condition of the ingestor, but may generally be about 10 ⁶ to 10 ¹² cfu/g, for example, 10 ⁷ to 10 ¹¹ cfu/g, 10 ⁸ to 10 ¹⁰ cfu/g, for example, 10 ⁸ cfu/g.

In the present invention, the food composition is a food preservative, and the shelf life of the food can be extended by treating food such as meat, dairy, and beverages with a high possibility of hygienic contamination to preserve the food from bacteria that cause food poisoning.

In the present invention, the food preservative can be used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, vitamin complexes, and health supplements.

Unless otherwise specified, the suitability of the above food preservative as a "food additive" is determined in accordance with the specifications and standards for the relevant item in accordance with the general provisions of the Food Additives Code and general test methods approved by the Ministry of Food and Drug Safety.

In the present invention, the food composition includes items listed in the "Food Additives Code", such as chemical compounds such as ketones, glycine, potassium citrate, nicotinic acid, and cinnamic acid, subchromic pigment, licorice extract, crystalline cellulose, guar gum, etc. It can be used with mixed preparations such as natural additives, L-glutamate sodium preparation, noodle additive alkaline preparation, preservative preparation, and tar coloring preparation.

Foods containing the food composition of the present invention include confectionery such as bread, rice cake, dried fruit, candy, chocolate, chewing gum, and jam, ice cream products such as ice cream, frozen confectionery, and ice cream powder, milk, low-fat milk, and lactose-digested milk. , processed milk, goat milk, fermented milk, butter oil, concentrated milk, milk cream, butter oil, natural cheese, processed cheese, powdered milk, whey, processed meat, processed egg, meat products such as hamburgers, fish cake, ham. , fish products such as processed fish products such as sausage and bacon, noodles such as ramen, dried noodles, fresh noodles, fried noodles, deluxe dried noodles, improved sleep noodles, frozen noodles, pasta, fruit drinks, vegetable drinks, carbonated drinks, soy milk , lactic acid beverages such as yogurt, beverages such as mixed drinks, seasonings such as soy sauce, soybean paste, red pepper paste, chunjang, cheonggukjang, mixed soybean paste, vinegar, sauces, tomato ketchup, curry, dressing, margarine, shortening, and pizza. It is not limited.

In addition to the above, the food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, and alcohol. , carbonating agents used in carbonated beverages, etc. Additionally, the composition of the present invention can be added to fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks.

The beverage composition including the food composition of the present invention has no particular restrictions on other ingredients and may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional beverage.

Another aspect of the present invention is an antifungal food composition comprising the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

In the present invention, the antifungal food composition includes Aspergillus flavus, Aspergillus fumigatus , Fusarium oxysporum , and Aspergillus nidulans. nidulans ), but is not limited to this.

In the present invention, the antifungal food composition may be related to the improvement or prevention of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties, but is not limited thereto.

Another aspect of the present invention is an antibacterial pharmaceutical composition comprising Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

In the present invention, the antibacterial pharmaceutical composition includes Staphylococcus aureus, Salmonella typhimurium , Escherichia coli , Bacillus cereus , Pseudomonas aeruginosa , and Micrococcus. It may inhibit the activity of one or more strains selected from the group consisting of Micrococcus luteus , but is not limited thereto.

In the present invention, the antibacterial pharmaceutical composition may be related to the prevention or treatment of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease, but is not limited thereto.

When used as a pharmaceutical composition in the present invention, the pharmaceutical composition of the present invention can be prepared using pharmaceutically suitable and physiologically acceptable adjuvants in addition to the Lactiplantibacillus plantarum WiKim0125 strain, As auxiliaries, excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants, lubricants, or flavoring agents can be used.

For administration, the pharmaceutical composition may be preferably formulated as a pharmaceutical composition containing one or more pharmaceutically acceptable carriers in addition to the active ingredients described above.

For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacance or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate. Includes sodium acetate, sodium chloride, etc. Disintegrants include, but are not limited to, starch, methylcellulose, agar, bentonite, xanthan gum, etc. Acceptable pharmaceutical carriers in compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

Another aspect of the present invention is an antifungal pharmaceutical composition comprising the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

In the present invention, the antifungal pharmaceutical composition includes Aspergillus flavus, Aspergillus fumigatus , Fusarium oxysporum , and Aspergillus nidulans ( It may inhibit the activity of one or more strains selected from the group consisting of Aspergillus nidulans , but is not limited to this.

In the present invention, the antifungal pharmaceutical composition may be related to the prevention or treatment of one or more diseases selected from the group consisting of fungal infections of grains, allergic diseases, and respiratory difficulties, but is not limited thereto.

Another aspect of the present invention is an antibacterial feed composition containing the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

In the present invention, the antibacterial feed composition includes Staphylococcus aureus, Salmonella typhimurium , Escherichia coli , Bacillus cereus , Pseudomonas aeruginosa , and Micrococcus roux. It may inhibit the activity of one or more strains selected from the group consisting of Micrococcus luteus , but is not limited thereto.

In the present invention, the antibacterial feed composition may be related to the improvement or prevention of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease, but is not limited thereto.

In the present invention, the feed composition may be administered to one or more animals selected from the group consisting of mammals, for example, cows, pigs, horses, sheep, goats, dogs, cows, cats, and monkeys, but is limited thereto. It doesn't work.

Another aspect of the present invention is an antifungal feed composition containing the Lactiplantibacillus plantarum WiKim0125 strain of accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient.

In the present invention, the antifungal feed composition includes Aspergillus flavus, Aspergillus fumigatus , Fusarium oxysporum , and Aspergillus nidulans. nidulans ), but is not limited to this.

In the present invention, the antifungal feed composition may be related to the improvement or prevention of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties, but is not limited thereto.

Another aspect of the present invention is an antibacterial cosmetic composition comprising Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

In the present invention, the antibacterial cosmetic composition includes Staphylococcus aureus, Salmonella typhimurium , Escherichia coli , Bacillus cereus , Pseudomonas aeruginosa , and Micrococcus roux. It may inhibit the activity of one or more strains selected from the group consisting of Micrococcus luteus , but is not limited thereto.

In the present invention, the antibacterial cosmetic composition may be related to the improvement or prevention of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease, but is not limited thereto.

In the present invention, the cosmetic composition includes softening lotion, nourishing lotion, moisturizing cream, nourishing cream, massage cream, nourishing lotion, essence, ampoule, gel, eye cream, oil, foundation, cleansing cream, cleansing foam, cleansing water, mask pack, It may be formulated with one or more selected from the group consisting of spray and powder, but is not limited thereto.

In the present invention, the cosmetic composition can be formulated by conventional methods. It can be prepared in the form of a general emulsified formulation and solubilized formulation. For example, lotion such as softening lotion or nourishing lotion; Emulsions such as facial lotion and body lotion; Creams such as nutritional cream, moisture cream, eye cream, etc.; essence; cosmetic ointment; spray; gel; pack; sunscreen; makeup base; Foundation, such as liquid type, solid type, or spray type; powder; Make-up removers such as cleansing creams, cleansing lotions, and cleansing oils; Alternatively, it may be formulated as a cleansing agent such as cleansing foam, soap, or body wash, but is not limited to this. Additionally, the skin external preparation may be formulated as an ointment, patch, gel, cream, or spray, but is not limited thereto.

In the present invention, when the cosmetic composition is formulated as a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, or mixtures thereof may be used as the carrier component, and in the case of a spray, chloro It may further include propellants such as fluorohydrocarbon, propane, butane or dimethyl ether.

In the present invention, when the cosmetic composition is formulated as a solution or emulsion, a solvent, solubilizing agent, or emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl benzoate, Propylene glycol, 1,3-butylglycol oil may be used, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan. You can.

In the present invention, when the cosmetic composition is formulated as a suspension, liquid diluents such as water, ethanol or propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester are used as carrier ingredients. Suspending agents, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.

In the present invention, when the cosmetic composition is formulated as soap, the carrier ingredients include alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oil, glycerol, Sugar, etc. may be used.

In the present invention, the cosmetic composition includes fatty substances, organic solvents, solubilizers, thickeners, gelling agents, softeners, antioxidants, suspending agents, stabilizers, and foaming agents commonly used in the industry depending on the quality or function of the final product. ), fragrances, surfactants, water, ionic or non-ionic emulsifiers, fillers, sequestering agents, chelating agents, preservatives, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic activators, common in cosmetics. It may additionally contain auxiliaries commonly used in the fields of cosmetology or dermatology, such as any other ingredients used.

However, the auxiliaries and their mixing ratio may be appropriately selected so as not to affect the desirable properties of the cosmetic composition according to the present invention.

Another aspect of the present invention is an antifungal cosmetic composition containing Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain of accession number KFCC11871P, its culture, lysate thereof, or extract thereof as an active ingredient.

In the present invention, the antifungal cosmetic composition includes Aspergillus flavus, Aspergillus fumigatus , Fusarium oxysporum , and Aspergillus nidulans. nidulans ), but is not limited to this.

In the present invention, the antifungal cosmetic composition may be related to the improvement or prevention of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties, but is not limited thereto.

The advantages and features of the present invention and methods for achieving them will become clear with reference to the embodiments described in detail below. However, the present invention is not limited to the embodiments disclosed below and will be implemented in various different forms. The present embodiments are merely provided to ensure that the disclosure of the present invention is complete and to provide common knowledge in the technical field to which the present invention pertains. It is provided to fully inform those who have the scope of the invention, and the present invention is only defined by the scope of the claims.

Lactiplantibacillus plantarum WiKim0125 strain according to the present invention is a lactic acid bacterium isolated from kimchi and exhibits excellent antibacterial and antifungal activity, so it is suitable for use in antibacterial and antifungal compositions containing lactic acid bacteria as an active ingredient. It can be used in various ways.

Figure 1 is a diagram showing a system diagram of Lactoplantibacillus plantarum WiKim0125 according to an embodiment of the present invention.
Figure 2 is a graph showing the results of evaluating the antibacterial activity of Lactoplantibacillus platarum WiKim0125 and 49 selected strains against Staphylococcus aureus according to an embodiment of the present invention.
Figure 3 shows the Lactiplantybacillus plantarum WiKim0125 strain according to an embodiment of the present invention and the Lactiplantybacillus plantarum WiKim0126 strain (accession number KFCC11872, October 15, 2020), known as a lactic acid bacteria derived from conventional kimchi, and Lacti This diagram shows the results of comparing the carbohydrate fermentation aspects of the Plantibacillus plantarum WiKim0127 (accession number KFCC11873, October 15, 2020) strain using the API system.

Hereinafter, the present invention will be described in detail through examples. The following examples are merely illustrative of the present invention and the scope of the present invention is not limited to the following examples.

Example 1. Isolation and culture of Lactiplantibacillus plantarum WiKim0125

Five types of kimchi sold in a domestic traditional market were purchased, and kimchi lactic acid bacteria were isolated according to fermentation time using the purchased kimchi. For this purpose, kimchi crushed liquid for each fermentation time was prepared and diluted, spread on MRS agar, and cultured for more than 48 hours. Single colonies formed after culturing were subcultured to select single colonies, and the selected single colonies were extracted with DNA using a genomic DNA extraction kit (iNtRON Biotechnology, Korea). Next, the extracted genomic DNA was amplified using a template. The primer sequences used for amplification are listed in Table 1.

sequence number designation Sequence (5' ------------------>3') One 27F
(Forward primer) AGAGTTTGATCCTGGCTCAG 2 1492R
(Reverse primer) GGCTACCTTGTTACGACTT

PCR conditions were denaturation at 95°C for 1 minute, annealing at 45°C for 1 minute, and extension at 72°C for 1 minute and 30 seconds for 30 cycles. The obtained PCR product was submitted to Macrogen (Seoul, Korea) for sequence analysis. Then, the 16S rRNA sequence was analyzed using the Basic Local Alignment Search Tool (BLAST) of the National Center for Biotechnology Information (NCBI), and 49 strains were isolated and identified from kimchi as shown in Table 2.

designation Separate sympathy JK1 Latilactobacillus sakei JK2 Latilactobacillus sakei JK3 Latilactobacillus sakei JK4 Weissella cibaria JK5 Latilactobacillus sakei JK6 Weissella cibaria JK7 Latilactobacillus sakei JK8 Weissella cibaria JK9 Weissella cibaria JK10 Weissella koreensis JK11 Weissella cibaria JK12 Latilactobacillus sakei JK13 Weissella cibaria JK14 Weissella confusa JK15 Latilactobacillus sakei JK16 Weissella confusa JK17 Weissella confusa JK18 Lactobacillus curvatus JK19 Lactobacillus curvatus JK20 Weissella cibaria JK21 Latilactobacillus sakei JK22 Weissella confusa WiKim0125 Lactiplantibacillus plantarum JK24 Leuconostoc citreum JK25 Lactobacillus curvatus JK26 Lactobacillus curvatus JK27 Lactobacillus curvatus JK28 Weissella confusa JK29 Lactococcus lactis JK30 Weissella confusa JK31 Lactococcus lactis JK32 Lactobacillus paralimentarius JK33 Lactococcus lactis JK34 Weissella cibaria JK35 Latilactobacillus sakei JK36 Weissella cibaria JK37 Weissella cibaria JK38 Leuconostoc citreum JK39 Leuconostoc mesenteroides JK40 Lactobacillus curvatus JK41 Weissella confusa JK42 Lactococcus lactis JK43 Weissella cibaria JK44 Lactiplantibacillus plantarum JK45 Leuconostoc lactis JK46 Leuconostoc lactis JK47 Latilactobacillus sakei JK48 Latilactobacillus sakei JK49 Latilactobacillus sakei

Example 2. Strain screening

2-1. Evaluation of antibacterial activity of strains

Among the 49 selected strains, the final strains were selected through antibacterial activity screening. To evaluate the antibacterial activity against Staphylococcus aureus (hereinafter referred to as S.aureus ), a strain that causes skin infections or respiratory infections, growth inhibitory rings were measured. S.aureus is cultured in TSB (Tryptic Soy Broth) medium at 37°C for 24 hours, suspended to a standard turbidity concentration of 0.5 McFarland (1×10 ⁸ CFU/mL), and used as stock culture. It was diluted 10 times to a concentration of 1×10 ⁷ CFU/mL, dispensed in 0.1 mL portions, spread uniformly using a disposable spreader, dried, and cultured at 37°C for 24 hours. After concentrating the fermented kimchi lactic acid bacteria cultured in each culture medium 10 times and treating 10 μL each, the diameter of the clear zone (mm) was measured and the results are shown in Figure 2, and the antibacterial activity was compared to determine the most antibacterial Strains with excellent activity were selected.

2-2. Genetic identification of strains

Newly isolated kimchi-derived lactic acid bacteria were genetically identified using 16S rRNA gene analysis. As a result of the analysis, the Lactiplantybacillus plantarum WiKim0125 strain of SEQ ID NO: 3 with 100% homology was identified.

The Lactiplantibacillus plantarum WiKim0125 strain was deposited with the Korea Microorganism Conservation Center under the accession number KFCC11871P on October 15, 2020.

2-3. Evaluation of strain morphology and biochemical characteristics

The morphology and biochemical characteristics of the selected Lactiplantibacillus plantarum WiKim0125 strain were analyzed. The morphology of the isolated strain was observed by culturing it for 24 hours, gram staining it with crystal violet, and then observing it with an optical microscope. In addition, in order to analyze culture characteristics, growth was confirmed by culturing under aerobic and anaerobic conditions.

As a result of the experiment, it was confirmed that WiKim0125 is a rod-shaped Gram-positive strain and is a facultative anaerobe (Aerobic/anaerobic +/+) that proliferates regardless of the presence or absence of oxygen.

Example 3. Analysis of carbohydrate fermentation pattern of lactic acid bacteria derived from kimchi

Lactiplantybacillus plantarum WiKim0125 strain, Lactiplantybacillus plantarum WiKim0126 strain (accession number KFCC11872, October 15, 2020) and Lactiplantybacillus plantarum WiKim0127 (accession number KFCC11873), known as lactic acid bacteria derived from kimchi. , October 15, 2020) To compare the carbohydrate fermentation patterns of the strains, the fermentation of 49 types of carbohydrates was analyzed using the API system (La Balme-les-Grottes, France). Colonies of each strain were suspended in sterile distilled water to prepare a suspension with turbidity adjusted to MccFaland Standard Solution No. 2. Next, the suspension was added to the liquid medium of the API 50CH kit and homogenized, and then inoculated into each tube of the API 50CH kit, and mineral oil was added. Next, the culture was incubated at 30°C for 48 hours, and the results were measured as positive (+) and negative (-), and are shown in Table 3 and Figure 3 below.

number reaction substrate WiKim0125 WiKim0126 WiKim0127 0 control - - - One glycerol - - - 2 Erythritol - - - 3 D-arabinose - - - 4 L-arabinose + + + 5 D-ribose + + + 6 D-xylose - - - 7 L-xylose - - - 8 D-Adonitol - - - 9 Methyl-β D-xylopyranoside - - - 10 D-galactose + + + 11 D-glucose + + + 12 D-fructose + + + 13 D-mannose + + + 14 L-sorbose - - - 15 rhamnose + - - 16 Dulcitol - - - 17 inositol - - - 18 Mannitol + + + 19 Sorbitol + + + 20 α-methyl-D-mannoside + + + 21 α-methyl-D-glucoside - - - 22 N-acetyl-glucosamine + + + 23 Amygdalin + + + 24 arbutin + + + 25 Esculin - - - 26 salicin + + + 27 cellobiose + + + 28 maltose + + + 29 lactose + + + 30 melibius + + + 31 sucrose + + + 32 trehalose + + + 33 Inulin + - - 34 Melezitos + + + 35 Raffinose + - + 36 starch - - - 37 glycogen - - - 38 xylitol - - - 39 gentiobios + + + 40 D-Turanos - + + 41 D-Rixos - - - 42 D-Tagatose - - - 43 D-fucose - - - 44 L-fucose - - - 45 D-arabitol - + - 46 L-arabitol - - - 47 gluconate + + + 48 2-keto-gluconate - - - 49 5-keto-gluconate - - -

As can be seen in Table 3, Lactiplantibacillus plantarum WiKim0125 strain metabolizes Rhamnose, Inulin, and Raffinose, unlike the WiKim0126 strain and WiKim0127 strain, but D-turanose (D -Turanose) and D-Arabitol were confirmed to be unusable.

Example 4. Evaluation of antibacterial and antifungal activity of kimchi lactic acid bacteria

Growth inhibitory rings were measured to evaluate the antibacterial activity against pathogenic bacteria and bacteria involved in food spoilage. Indicator strains for antibacterial activity tests are shown in Table 4.

division Strain name culture medium Incubation temperature
(℃) pathogenic microorganisms Staphylococcus aureus ATCC12692 Tryptic Soy Broth 37 Salmonella Typhimurium ATCC13311 Tryptic Soy Broth 37 Escherichia coli ATCC25922 Tryptic Soy Broth 37 Bacillus cereus KCCM40935 Tryptic Soy Broth 30 spoilage microorganisms Pseudomonas aeruginosa KCTC22063 Tryptic Soy Broth 37 Micrococcus luteus ATCC4698 Tryptic Soy Broth 30

The indicator strain was cultured in TSB medium for 24 hours at each culture temperature, suspended to a standard turbidity concentration of 0.5 McFarland (1 × 10 ⁸ CFU/mL), and used as a stock culture. 1% was inoculated into TSA medium, dried for 20 minutes, and holes with a diameter of 5 mm were made with a cork borer. Each lactic acid bacteria culture supernatant was concentrated 10 times and treated at 30 μL each. Next, the culture was incubated at 30 to 37°C for 24 hours and the diameter of the clear zone (mm) was measured to evaluate the antibacterial activity. The results are shown in Table 5 below.

instruction
microbe Restraint band (mm) WiKim0125 WiKim0126 WiKim0127 S. aureus 10.18 ± 0.10 9.51 ± 0.08 9.66 ± 0.07 S. typhimurium 10.02 ± 0.16 9.42 ± 0.23 9.38 ± 0.31 E. coli 10.28 ± 0.36 9.79 ± 0.24 9.99 ± 0.25 B. cereus 11.59 ± 0.19 11.17 ± 0.17 11.41 ± 0.19 P. aeruginosa 8.56 ± 0.14 7.89 ± 0.33 7.81 ± 0.38 M. luteus 11.00 ± 0.23 11.05 ± 0.17 10.92 ± 0.33

As can be seen in Table 5, the Lactiplantibacillus plantarum WiKim0125 strain showed a wide range of activity against six types of food poisoning bacteria and spoilage bacteria, and formed a high growth inhibitory ring of up to 9.6% when compared to lactic acid bacteria of the same species. .

Example 5. Evaluation of antifungal activity against pathogenic microorganisms and putrefactive microorganisms

Growth inhibitory rings were measured to evaluate antifungal activity against pathogenic molds and fungi involved in food spoilage. Indicator strains for antifungal activity tests are shown in Table 6.

division Strain name culture medium Incubation temperature
(℃) pathogenic microorganisms Aspergillus flavus ATCC26873 Potato Dextrose Broth 25 Aspergillus fumigatus ATCC9197 Potato Dextrose Broth 25 spoilage microorganisms Fusarium oxysporum KCTC16909 Potato Dextrose Broth 25 Aspergillus nidulans ATCC10074 Potato Dextrose Broth 25

The indicator strain was cultured in PDB medium at 25°C for 5 days, and the mycelium was filtered out by washing three times with sterile gauze and sterilized water. Next, the mycelium was diluted to a concentration of 50 mg/mL, homogenized with a bead homogenizer, and used as a stock culture. Inoculate PDA medium at 1%, add 20,000 ppm streptomycin sulfate (streptomycin sulfate) 1%, dry for 20 minutes, drill holes with a diameter of 5 mm using a cork borer, and then concentrate each lactic acid bacteria culture supernatant 10 times to 30 Each μL was treated. Antifungal activity was evaluated by culturing at 25°C for more than 48 hours and measuring the diameter of the clear zone (mm). The results are shown in Table 7 below.

instruction
microbe Restraint band (mm) WiKim0125 WiKim0126 WiKim0127 A. flavus 7.58 ± 0.15 6.96 ± 0.33 7.15 ± 0.05 A. fumigatus 8.79 ± 0.21 7.52 ± 0.34 8.12 ± 0.11 F. oxysporum 8.06 ± 0.09 6.91 ± 0.26 7.21 ± 0.47 A. nidulans 7.26 ± 0.17 6.79 ± 0.12 6.82 ± 0.16

As can be seen in Table 7 above, the Lactiplantibacillus plantarum WiKim0125 strain showed a wide range of activity against four types of pathogenic and putrefactive molds and formed up to 16.9% higher growth inhibitory rings compared to lactic acid bacteria of the same species. could be confirmed.

Korea Center for Microbial Conservation (KCCM) KFCC11871P 20201015

Claims (25)

It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient, and contains Escherichia coli , Bacillus cereus , and micro An antibacterial food composition that inhibits the activity of one or more strains selected from the group consisting of Micrococcus luteus.
The antibacterial food composition according to claim 1, which is related to the improvement or prevention of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate or its extract as an active ingredient, and contains Aspergillus flavus and Aspergillus fu An antifungal food composition that inhibits the activity of one or more strains selected from the group consisting of Aspergillus fumigatus and Aspergillus nidulans.
The antifungal food composition of claim 3, wherein the antifungal food composition is related to the improvement or prevention of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient, and contains Escherichia coli , Bacillus cereus , and micro An antibacterial pharmaceutical composition that inhibits the activity of one or more strains selected from the group consisting of Micrococcus luteus.
The antibacterial pharmaceutical composition of claim 5, wherein the antibacterial pharmaceutical composition is related to the prevention or treatment of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease. Composition.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate or its extract as an active ingredient, and contains Aspergillus flavus and Aspergillus fu An antifungal pharmaceutical composition that inhibits the activity of one or more strains selected from the group consisting of Aspergillus fumigatus and Aspergillus nidulans.
The antifungal pharmaceutical composition according to claim 7, wherein the antifungal pharmaceutical composition is related to the prevention or treatment of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient, and contains Escherichia coli , Bacillus cereus , and micro An antibacterial feed composition that inhibits the activity of one or more strains selected from the group consisting of Micrococcus luteus.
The antibacterial feed composition according to claim 9, which is related to the improvement or prevention of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate or its extract as an active ingredient, and contains Aspergillus flavus and Aspergillus fu An antifungal feed composition that inhibits the activity of one or more strains selected from the group consisting of Aspergillus fumigatus and Aspergillus nidulans .
The antifungal feed composition of claim 11, wherein the antifungal feed composition is related to the improvement or prevention of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate, or its extract as an active ingredient, and contains Escherichia coli , Bacillus cereus , and micro An antibacterial cosmetic composition that inhibits the activity of one or more strains selected from the group consisting of Micrococcus luteus.
The antibacterial cosmetic composition of claim 13, wherein the antibacterial cosmetic composition is related to the improvement or prevention of one or more diseases selected from the group consisting of food poisoning, skin infection, respiratory infection, sinus infection, and inflammatory disease.
It contains Lactiplantibacillus plantarum WiKim0125 ( Lactiplantibacillus plantarum WiKim0125) strain with accession number KFCC11871P, its culture, its lysate or its extract as an active ingredient, and contains Aspergillus flavus and Aspergillus fu An antifungal cosmetic composition that inhibits the activity of one or more strains selected from the group consisting of Aspergillus fumigatus and Aspergillus nidulans .
The antifungal cosmetic composition of claim 15, wherein the antifungal cosmetic composition is related to the improvement or prevention of one or more diseases selected from the group consisting of fungal infections, allergic diseases, and breathing difficulties.
delete delete delete delete delete delete delete delete delete