KR102645729B1 - Method for producing Lacto-N-tetraose and Lacto-N-neotetraose using Corynebacterium glutamicum - Google Patents

Abstract

The present invention relates to a method for producing lacto-N-tetraose (Lacto-N-tetraose, LNT) and lacto-N-neotetraose (LNnT) using Corynebacterium glutamicum. , More specifically, in order to increase the productivity of LNT and LNnT, genes introduced from outside are expressed within Corynebacterium glutamicum , and the genes that Corynebacterium glutamicum possesses are expressed. It relates to a recombinant Corynebacterium glutamicum transformed to overexpress and a method for producing LNT and LNnT using the same. Through this, the present invention uses Corynebacterium glutamicum to produce lacto-N-tetraose (LNT) with high concentration, high yield, and high productivity while being safer than conventional E. coli. And lacto-N-neotetraose (LNnT) can be produced.

Description

Method for producing Lacto-N-tetraose and Lacto-N-neotetraose using Corynebacterium glutamicum}

The present invention relates to a method for producing lacto-N-tetraose (Lacto-N-tetraose, LNT) and lacto-N-neotetraose (LNnT) using Corynebacterium glutamicum. , More specifically, in order to increase the productivity of LNT and LNnT, genes introduced from outside are expressed within Corynebacterium glutamicum , and the genes that Corynebacterium glutamicum possesses are expressed. It relates to a recombinant Corynebacterium glutamicum transformed to overexpress and a method for producing LNT and LNnT using the same.

Human milk oligosaccharides (HMOs) are oligosaccharides contained in breast milk and are the third most abundant component in breast milk after lactose and fat. There are about 200 different types of breast milk oligosaccharides. Representative examples of breast milk oligosaccharides include 2'-fucosyllactose (2'-'-FL) and 3-fucosyllactose (3-fucosyllactose). -FL), Lacto-N-triose Ⅱ, Lacto-N-tetraose (LNT), Lacto-N-neotetraose (LNnT) ), Lacto-N-fucopentaose (LNFP), Lacto-N-neofucopentaose, Lacto-N-hexaose (LNH) , Lacto-N-neohexaose (LNnH), 6'-galactosylactose, and 3'-galactosylactose.

Since breast milk oligosaccharides have various benefits, such as strengthening immune function or having a positive effect on the child's development and behavior, continuous research is needed on technologies for producing various breast milk oligosaccharides. In existing research, technology for producing human milk oligosaccharides using microorganisms has been studied, and among them, recombinant Escherichia coli has been used. However, although E. coli is not actually a pathogen, it is strongly recognized by consumers as a harmful bacterium, and because the cell membrane components of E. coli can act as endotoxin, it costs a lot of money to isolate and purify the produced human milk oligosaccharides, and in the case of E. coli cells, lactose permease (lactose permease) is required. Because E. coli cells are killed by the action of lactose permease ('lactose killing'), its use is somewhat limited. Accordingly, there is a continued need for technology to produce human milk oligosaccharides using new microorganisms.

Korean Patent Publication No. 10-2017-0028438 (publication date: 2017.03.13) relates to the biotechnological production of LNT, LNNT and their fucosylated derivatives, (i) β1,3-N-acetylglucosaminyl A genetically engineered microorganism comprising a first transgene encoding a transferase, and (ii) a second transgene encoding β1,3-galactosyltransferase, and LNTs, LNNTs, and fucosylated derivatives thereof using the same The production method is described. Republic of Korea Patent Publication No. 10-2020-0096779 (publication date: 2020.08.13) relates to a spray-dried human milk oligosaccharide mixture, and describes a mixture of structurally different human breast milk oligosaccharides and a method for producing the same.

In the present invention, it is a host cell that produces lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT), which are food and pharmaceutical materials, and is safer than E. coli. We would like to develop and provide a method for producing LNT and LNnT at high concentration, high yield, and high productivity using Corynebacterium glutamicum .

The present invention relates to a gene encoding lactose permease, a gene encoding beta-1,3-N-acetylglucosaminyltransferase, and a gene encoding beta-1,3-N-acetylglucosaminyltransferase. The gene encoding galactosyltransferase (β-1,3-galactosyltransferase) is introduced from outside and transformed to express the gene in Corynebacterium glutamicum, and the gene that Corynebacterium itself possesses Gene encoding glutamine-fructose-6-phosphate aminotransferase, gene encoding phosphoglucosamine mutase, glucosamine-1-phosphate N-acetyl Gene encoding transferase (glucosamine-1-phosphate N-acetyltransferase), gene encoding UDP-N-acetylglucosamine pyrophosphorylase, phosphoglucomutase A gene encoding, UTP-glucose-1-phosphate uridylyltransferase, a gene encoding UDP-glucose-4-epimerase Provided is a recombinant Corynebacterium glutamicum , characterized in that it is transformed to overexpress one or more genes selected from among the genes encoding.

In addition, the present invention provides a method for producing lacto-N-tetraose, characterized in that the recombinant Corynebacterium glutamicum is cultured in a medium to which lactose is added. do.

Meanwhile, in the method for producing lacto-N-tetraose of the present invention, the medium preferably further contains glucose.

In addition, the present invention relates to a gene encoding lactose permease, a gene encoding beta-1,3-N-acetylglucosaminyltransferase, beta-1, A gene encoding 4-galactosyltransferase (β-1,4-galactosyltransferase) is introduced from outside and transformed so that the genes are expressed in Corynebacterium glutamicum, and Corynebacterium possesses its own Genes encoding glutamine-fructose-6-phosphate aminotransferase, genes encoding phosphoglucosamine mutase, and glucosamine-1-phosphate N. -Gene encoding acetyltransferase (glucosamine-1-phosphate N-acetyltransferase), gene encoding UDP-N-acetylglucosamine pyrophosphorylase, phosphoglucomutase ( A gene encoding phosphoglucomutase, a gene encoding UTP-glucose-1-phosphate uridylyltransferase, and a gene encoding UDP-glucose-4-epimerase. Provided is a recombinant Corynebacterium glutamicum characterized in that it is transformed to overexpress one or more genes selected from genes encoding epimerase.

In addition, the present invention provides a method for producing lacto-N-neotetraose, characterized in that the recombinant Corynebacterium glutamicum is cultured in a medium to which lactose is added. to provide.

Meanwhile, in the method for producing lacto-N-neotetraose of the present invention, the medium preferably further contains glucose.

The present invention uses Corynebacterium glutamicum to produce lacto-N-tetraose (LNT) and lactobacillus with high concentration, high yield, and high productivity while being safer than conventional E. coli. -N-neotetraose (Lacto-N-neotetraose, LNnT) can be produced.

Figure 1 is a diagram showing the biosynthesis pathway of lacto-N-tetraose (LNT) in the recombinant Corynebacterium glutamicum strain of the present invention.
Figure 2 is a diagram showing the biosynthesis pathway of Lacto-N-neotetraose (LNnT) in the recombinant Corynebacterium glutamicum strain of the present invention.
Figure 3 shows Lacto-N - triose II ( This is a graph comparing the production of Lacto-N-trioseⅡ, LNTⅡ).
Figure 4 compares the LNT/LNnT production (final production amount) of a recombinant Corynebacterium glutamicum strain prepared to overexpress pgm, galU, and galE of the production pathway of UDP-galactose, a precursor material in the present invention. This is a graph of the results.
Figure 5 shows the results of confirming the LNT/LNnT production over time of a recombinant Corynebacterium glutamicum strain prepared to overexpress pgm, galU, and galE of the production pathway of UDP-galactose, a precursor material in the present invention. It's a graph.

Since breast milk oligosaccharides have various benefits, such as strengthening immune function or having a positive effect on the child's development and behavior, research is continuously being conducted on technologies for producing various breast milk oligosaccharides. In existing research, technology for producing human milk oligosaccharides using microorganisms has been studied, and there is a high need for producing various human milk oligosaccharides using new microorganisms.

In the present invention, Corynebacterium glutamicum is used as a host cell to produce Lacto-N-neotetraose (LNnT) and Lacto-N-tetraose (LNT). glutamicum ) was used. Unlike E. coli, which was mainly used in existing research, this is not only a strain recognized as GRAS (generally recognized as safe), but also a strain that is widely used in the industrial production of amino acids and nucleic acids, which are food additives. In addition, E. coli is strongly recognized by consumers as a harmful bacterium, and because the cell membrane components of E. coli can act as endotoxin, there is a limitation in that it costs a lot of money to separate and purify the produced human milk oligosaccharides. In addition, in the case of E. coli cells, a phenomenon in which E. coli cells die ('lactose killing') occurs due to the action of lactose permease, so its use is somewhat limited. Therefore, Corynebacterium glutamicum used in the present invention can be said to be a safe and suitable strain for the production of food and pharmaceutical materials.

Accordingly, the present invention provides a gene encoding lactose permease, a gene encoding beta-1,3-N-acetylglucosaminyltransferase, beta-1,3 -A gene encoding galactose transferase (β-1,3-galactosyltransferase) is introduced from outside and transformed so that the genes are expressed in Corynebacterium glutamicum, and Corynebacterium possesses its own Gene encoding glutamine-fructose-6-phosphate aminotransferase, gene encoding phosphoglucosamine mutase, glucosamine-1-phosphate N- Gene encoding acetyltransferase (glucosamine-1-phosphate N-acetyltransferase), gene encoding UDP-N-acetylglucosamine pyrophosphorylase, phosphoglucomutase ), a gene encoding UTP-glucose-1-phosphate uridylyltransferase, UDP-glucose-4-epimerase ) provides recombinant Corynebacterium glutamicum , which is characterized in that it is transformed to overexpress one or more genes selected from among the genes encoding ). In addition, the present invention provides a method for producing lacto-N-tetraose, characterized in that the recombinant Corynebacterium glutamicum is cultured in a medium to which lactose is added. do.

In addition, the present invention relates to a gene encoding lactose permease, a gene encoding beta-1,3-N-acetylglucosaminyltransferase, beta-1, A gene encoding 4-galactosyltransferase (β-1,4-galactosyltransferase) is introduced from outside and transformed so that the genes are expressed in Corynebacterium glutamicum, and Corynebacterium possesses its own Genes encoding glutamine-fructose-6-phosphate aminotransferase, genes encoding phosphoglucosamine mutase, and glucosamine-1-phosphate N. -Gene encoding acetyltransferase (glucosamine-1-phosphate N-acetyltransferase), gene encoding UDP-N-acetylglucosamine pyrophosphorylase, phosphoglucomutase ( A gene encoding phosphoglucomutase, a gene encoding UTP-glucose-1-phosphate uridylyltransferase, and a gene encoding UDP-glucose-4-epimerase. Provided is a recombinant Corynebacterium glutamicum characterized in that it is transformed to overexpress one or more genes selected from genes encoding epimerase. In addition, the present invention provides a method for producing lacto-N-neotetraose, characterized in that the recombinant Corynebacterium glutamicum is cultured in a medium to which lactose is added. to provide.

The process of producing LNT and LNnT using the recombinant Corynebacterium glutamicum of the present invention is shown in Figures 1 and 2. When lactose meets UDP-N-acetylglucosamine (UDP-N-GlcNAc), one of the precursor substances, beta-1,3-N-acetylglucosamine transferase (β-1,3) Lacto-N-trioseⅡ (Lacto-N-trioseⅡ, LNTⅡ) is produced through the mediation of -N-acetylglucosaminyltransferase (lgtA encodes it). The produced LNTⅡ meets another precursor material, UDP-galactose, and at this time, it is mediated by beta-1,3-galactosyltransferase (β-1,3-galactosyltransferase, encoded by WbgO). When this happens, LNT is produced (Figure 1), and when beta-1,4-galactosyltransferase (β-1,4-galactosyltransferase, encoded by lgtB) is mediated, LNnT is produced (Figure 2).

Meanwhile, the recombinant Corynebacterium glutamicum of the present invention is transformed to express a gene encoding lactose permease, which is an enzyme involved in transporting lactose present outside the strain into the strain. It is preferable to use one derived from E. coli. An example may be the use of LacY.

Meanwhile, the recombinant Corynebacterium glutamicum of the present invention is transformed to express the gene encoding beta-1,3-N-acetylglucosaminyltransferase (lgtA), For example, it may be from Neisseria meningitidis or Neisseria cinerea. More preferably, those derived from Neisseria meningitidis M98 or Neisseria cinerea ATCC 14685 are used.

Meanwhile, the recombinant Corynebacterium glutamicum of the present invention is transformed to express the gene encoding beta-1,3-N-acetylglucosaminyltransferase (β-1,3-N-acetylglucosaminyltransferase) for LNT production. For example, it may be lgtA, and preferably, it is derived from Neisseria cinerea . In addition, it is transformed to express the gene encoding beta-1,3-galactosyltransferase. For example, it may be WbgO, and preferably, it may be derived from Lutiella nitroferrum . More preferably, it is good to use one derived from Lutiella nitroferrum ATCC BAA-1479.

In addition, the recombinant Corynebacterium glutamicum of the present invention is transformed to express the gene encoding beta-1,3-N-acetylglucosaminyltransferase to produce LNnT. For example, it may be lgtA, and preferably, it is derived from Neisseria meningitidis . In addition, it is transformed to express a gene encoding beta-1,4-galactosyltransferase, for example, it may be lgtB, preferably from Neisseria cinerea . It is good that it originated from

On the other hand, the recombinant Corynebacterium glutamicum of the present invention contains glutamine-fructose-6-phosphate aminotransferase, a gene possessed by Corynebacterium itself. aminotransferase), a gene encoding phosphoglucosamine mutase, a gene encoding glucosamine-1-phosphate N-acetyltransferase, UDP-N -Gene encoding acetylglucosamine pyrophosphorylase (UDP-N-acetylglucosamine pyrophosphorylase), gene encoding phosphoglucomutase, UTP-glucose-1-phosphate uridylyltransferase (UTP-glucose) It is better to be transformed to overexpress one or more genes selected from the genes encoding -1-phosphate uridylyltransferase and the genes encoding UDP-glucose-4-epimerase.

At this time, the gene encoding the glutamine-fructose-6-phosphate aminotransferase is preferably glmS, and the gene encoding the phosphoglucosamine mutase The gene is preferably glmM. In addition, the gene encoding the glucosamine-1-phosphate N-acetyltransferase and the UDP-N-acetylglucosamine pyrophosphorylase The encoding gene is preferably glmU, and in this case, glmU is UDP-N-acetylglucosamine pyrophosphorylase/glucosamine-1-phosphate N-acetyltransferase (glucosamine -1-phosphate N-acetyltransferase) is a gene that encodes a bifunctional enzyme (see Figures 1 and 2). In addition, the gene encoding the phosphoglucomutase is preferably pgm, and the gene encoding the UTP-glucose-1-phosphate uridylyltransferase is preferably galU, and the gene encoding UDP-glucose-4-epimerase is preferably galE. In this way, Corynebacterium glutamicum overexpresses its own genes to produce UDP-N-acetylglucosamine (UDP-N-GlcNAc), a precursor material for LNT and LNnT, and lacto-N- By producing large quantities of Triose II (Lacto-N-triose II, LNT II), the productivity of LNT and LNnT can be increased.

Meanwhile, the term 'expression' used in the present invention refers to expression by introducing an external gene into the strain to artificially express an enzyme that the Corynebacterium glutamicum strain of the present invention cannot express on its own. The term 'overexpression' refers to the fact that the Corynebacterium glutamicum strain of the present invention has its own gene encoding the enzyme and can express it on its own, but for the purpose of mass production, its expression level is This means overexpression by artificially increasing the expression level of the enzyme in question in order to increase it.

Meanwhile, in the production method of Lacto-N-tetraose or Lacto-N-tetraose of the present invention, the medium preferably further contains glucose. . By adding additional media components in this way, the growth of the strain becomes active, making it possible to produce Lacto-N-tetraose or Lacto-N-tetraose with higher productivity.

Meanwhile, according to the following experiment, the recombinant Corynebacterium glutamicum of the present invention contains glmS, glmM, and glmU in the production pathway of UDP-N-acetylglucosamine (UDP-N-GlcNAc), a precursor material. By manufacturing to overexpress , we were able to significantly increase the production of LNTⅡ, the precursor of LNT/LNnT, and by manufacturing to overexpress pgm, galU, and galE in the production pathway of UDP-galactose, another precursor material. , LNT/LNnT production could be excellently improved. In this way, using the recombinant Corynebacterium glutamicum of the present invention, Lacto-N-tetraose (LNT) is safer than conventional E. coli, and has high concentration, high yield, and high productivity. ) and lacto-N-neotetraose (LNnT) can be produced.

Hereinafter, the contents of the present invention will be described in more detail through the following examples. However, the scope of the present invention is not limited to the following examples, but also includes modifications of the technical idea equivalent thereto.

[Example 1: Preparation of recombinant Corynebacterium glutamicum and plasmid]

1. Construction of production strains of LNT and LNnT

Plasmid construction and lacto-N-triose Ⅱ (Lacto-N-triose, LNTⅡ), lacto-N-tetraose (LNT) and lacto-N-neotetraose, For the production of LNnT) , Escherichia coli TOP10 and Corynebacterium glutamicum ATCC 13032 were used, respectively.

(1) Construction of pAY, a LNTⅡ production plasmid (construction of plasmid for lgtA-lacY expression)

Neisseria meningitidis From M98, the gene (lgtA) encoding beta-1,3-N-acetylglucosaminyltransferase was generated through a PCR reaction using two DNA primers, 21RBS-lgtA F and lgtA R. amplified. In addition, the lacY gene was amplified from the genomic DNA of E. coli K-12 MG1655 through a PCR reaction using two DNA primers RBS-lacY F and LacY R, and then overlapped using two DNA primers 21RBS-lgtA F and LacY R. (overlap) After synthesizing the lgtA-lacY DNA fragment through a PCR reaction, it was inserted into plasmid pCN013 treated with restriction enzyme EcoRI to construct the pAY plasmid.

(2) Construction of pABY, a LNnT production plasmid (construction of plasmid for lgtA-lgtB-lacY expression)

Neisseria meningitidis The gene (lgtA) encoding beta-1,3-N-acetylglucosaminyltransferase was amplified from M98 through a PCR reaction using two DNA primers lgtA_t F and lgtA_20B R. , the gene encoding beta-1,4-galactosyltransferase (β-1,4-galactosyltransferase) was identified from Neisseria cinerea ATCC 14685 through PCR reaction using two DNA primers, 20_B1 F and 15_B1 R. After amplifying lgtB), lgtA-lgtB DNA fragments were synthesized through an overlap PCR reaction using two DNA primers lgtA_t F and 15_B1 R. Afterwards, the lacY gene was amplified from the genomic DNA of E. coli K-12 MG1655 through a PCR reaction using two DNA primers lacY_B F and 20ABY R3, and then through an overlap PCR reaction using two DNA primers lgtA_t F and 20ABY R3. After synthesizing the lgtA-lgtB-lacY DNA fragment, it was inserted into plasmid pCN013 treated with restriction enzyme EcoRⅠ to construct the pABY plasmid.

(3) Construction of pAWY, an LNT production plasmid (construction of plasmid for expression of lgtA-WbgO-lacY)

The pgk promoter was amplified from Corynebacterium glutamicum ATCC 13032 through a PCR reaction using two DNA primers, pgk F and pgk R. The gene encoding beta-1,3- N -acetylglucosaminyl transferase ( lgtA (i.e. NclgtA; where Nc means that lgtA is derived from Neisseria cinerea ) was amplified, and beta- was obtained from Lutiella nitroferrum ATCC BAA-1479 through a PCR reaction using two DNA primers, LnW F and LnW R. The gene encoding 1,3-galactosyltransferase (WbgO, i.e. LnWbgO; Ln is (meaning that WbgO originated from Lutiella nitroferrum ) was amplified. The lacY gene was amplified from the genomic DNA of E. coli K-12 MG1655 through a PCR reaction using two DNA primers 20ABY F3 and 20ABY R3, and then pgk-lgtA was amplified through an overlap PCR reaction using two DNA primers pgk F and 20ABY R3. -WbgO-lacY (i.e. pgk-NclgtA-LnWbgO-lacY; where Nc means lgtA originated from Neisseria cinerea , Ln means After synthesizing the DNA fragment (meaning that WbgO originated from Lutiella nitroferrum ), it was inserted into pCN013 plasmid treated with restriction enzymes EcoRI and EcoRV to construct pAWY plasmid.

2. Construction of an overproducing strain of ‘UDP-N-acetylglucosamine (UDP-N-GlcNAc)’, the precursor of LNT and LNnT

To construct LNT and LNnT producing strains, a strain overproducing the precursor material 'UDP-N-acetylglucosamine (UDP-N-GlcNAc)' was constructed. To this end, a total of three integration plasmids, pK19mobsacB-tuf-glmS, pK19mobsacB-tuf-glmM, and pK19mobsacB-tuf-glmU, were created to overexpress glmS, glmM, and glmU in the biosynthetic pathway as shown in Figures 1 and 2.

(1) Construction of pK19mobsacB-tuf-glmS plasmid (Construction of plasmid for overexpression of glmS)

After amplifying three genes from the genomic DNA of Corynebacterium glutamicum through PCR reaction using three pairs of primers (glmS F1, glmS R1) (glmS F2, glmS R2) (glmS F3, glmS R3), A DNA fragment was synthesized through an overlap PCR reaction using two DNA primers glmS F1 and glmS R3, and then inserted into the Xba</em>I-treated plasmid pK19mobsacB to construct the pK19mobsacB-tuf-glmS plasmid.

(2)pK19mobsacB-tuf-glmM Plasmid construction (plasmid construction for glmM overexpression)

After amplifying three genes from the genomic DNA of Corynebacterium glutamicum using three pairs of primers (glmM F1, glmM R1) (glmM F2, glmM R2) (glmM F3, glmM R3), two A DNA fragment was synthesized through an overlap PCR reaction using DNA primers glmM F1 and glmM R3, and then inserted into the HindIII and EcoRI-treated plasmid pK19mobsacB to construct the pK19mobsacB-tuf-glmM plasmid.

(3) Construction of pK19mobsacB-tuf-glmU plasmid (construction of plasmid for glmU overexpression)

After amplifying three genes from the genomic DNA of Corynebacterium glutamicum using three pairs of primers (glmU F1, glmU R1) (glmU F2, glmU R2) (glmU F3, glmU R3), two A DNA fragment was synthesized through an overlap PCR reaction using DNA primers glmU F1 and glmU R3, and then inserted into the XbaI-treated plasmid pK19mobsacB to construct the pK19mobsacB-tuf-glmU plasmid.

3. Precursor of LNT and LNnT Construction of 'UDP-galactose' overproducing strain

A strain overproducing 'UDP-galactose', another precursor material for the biosynthesis of LNT and LNnT, was constructed. To this end, a total of three integration plasmids, pK19mobsacB-tuf-pgm, pK19mobsacB-tuf-galU1, and pK19mobsacB-tuf-galE, were created to overexpress pgm, galU1, and galE in the biosynthetic pathway as shown in Figures 1 and 2.

(1) Construction of pK19mobsacB-tuf-pgm plasmid (construction of plasmid for pgm overexpression)

Three genes were amplified from the genomic DNA of Corynebacterium glutamicum through a PCR reaction using six DNA primers (pgm F1, pgm R1), (pgm F2, pgm R2), and (pgm F3, pgm R4). Afterwards, a DNA fragment was synthesized through an overlap PCR reaction using two DNA primers pgm F1 and pgm R4, and then inserted into the Xba I-treated plasmid pK19mobsacB to construct the pK19mobsacB-tuf-pgm plasmid.

(2) Construction of pK19mobsacB-tuf-galU1 plasmid (construction of plasmid for galU overexpression)

Three genes were amplified from the genomic DNA of Corynebacterium glutamicum through a PCR reaction using six DNA primers (galU1 F1, galU1 R1), (galU1 F2, galU1 R2), (galU1 F3, galU1 R3). Afterwards, a DNA fragment was synthesized through an overlap PCR reaction using two DNA primers galU1 F1 and galU1 R3, and then inserted into the XbaI-treated plasmid pK19mobsacB to construct the pK19mobsacB-tuf-galU1 plasmid.

(3) Construction of pK19mobsacB-tuf-galE plasmid (construction of plasmid for galE overexpression)

Three genes were amplified from the genomic DNA of Corynebacterium glutamicum through a PCR reaction using six DNA primers (galE F1, galE R1) (galE F2, galE R2), (galE F3, galE R3). , a DNA fragment was synthesized through an overlap PCR reaction using two DNA primers galE F1 and galE R3, and then inserted into the XbaI-treated plasmid pK19mobsacB to construct the pK19mobsacB-tuf-galE plasmid.

Meanwhile, the primers, strains, plasmids, and gene sequences used in this example are listed in Tables 1 to 5 below.

primer primer name Sequence (5'->3') 21RBS-lgtA F TCCAGGAGGACATACAACCGAGAAGGAGGGTTATTAGATGCCGTCTGAAGCCT lgtA R CCTTTATGCGCAACGTTAAATCTCCTGTTCTTTCCCTGCC RBS-lacY F AACAGGAGATTTAACGTTGCGCATAAAGGAGCATCTACAATGTACTATTTAAAAAACA LacY R TTGTCGACGGAGCTCGAATTCTTTAAGCGACTTCATTCACCCTGACG lgtA_tF TCCAGGAGGACATACAACCGAGAAGGAGGGTTATTAGtctagaGATGCAGCCCCTAGTCAGC lgtA_20B R CATTAATAATCCTCCTTCTGTCAACGGTTTTTCAACAACCGG 20_B1 F TGACAGAAGGAGGATTATTAATGGAAAACCGTATTATCAG 15_B1 R ATGCTCCTTTATGCGCAACGCCGCGGTTACCGGAACGGTATGATAA lacY_B F TTATCATACCGTTCGGTAACCGCGGCGTTGCGCATAAAGGAGCATCTACAATGTACTATTTAAAAAACACAAACTTTTG 20ABY R3 AAGCTTGTCGACGGAGCTCGTTAAGCGACTTCATTCACCT pgk F GCAAACTATGATGGGTCTTGTTGTTGGATTCTAGATAACGTGGGCGATCGATG pgk R GGGGCTGCATCTAATAACCCTCCTTCTGATATCGCCGTACTCCTTGGAGAT 21NcA F ATCAGAAGGAGGGTTATTAGATGCAGCCCCCTAGTCAG NcA R ATGCTCCTTTCCGAAACTCCGTATACTCAACGGTTTTTCAACAACCG LnW F TTCGGAAAGGAGCATCTAGGATGGATAAGATTAAACAAGGATCTGC LnW R CTTTATGCGCAACGGGATCCTTACTTTCTCCATAGCGTCACC 20ABY F3 CGTTGCGCATAAAGGAGCATCTACAATGTACTATTTAAAAACAC

primer primer name Sequence (5'->3') glmS F1 TGCATGCCTGCAGGTCGACTTCACGAGCCCCTCATTGCCT glmS R1 CATTCGCAGGGTAACGGCCAGACTTTACAACAACTTTTTC glmS F2 GAAAAAGTTTGTTGTAAAGTCTGGCCGTTACCCTGCGAATG glmS R2 ACAATTCCACACATGCGCATTGTATGTCCTCCTGGACTTC glmS F3 GAAGTCCAGGAGGACATACAATGCGCATGTGTGGAATTGT glmS R3 GCTCGGTACCCGGGGATCCTAAAGCACCCTCAAGGGCGCTG glmM F1 CTATGACCATGATTACGCCACTCCGGCGAGTTCAAG glmM R1 CATTCGCAGGGTAACGGCCAGCGATTAATTATGCACGGGC glmM F2 AGGCCGTGCATAATTAATCGCTGGGCCGTTACCCTGC glmM R2 GTTCCAAATAGTCGAGTCATTGTATGTCCTCCTGGACTT glmM F3 GAAGTCCAGGAGGACATACAATGACTCGACTATTTGGAACTG glmM R3 TTGTAAAACGACGGCCAGTGTTCAGGTGCTCTAGGTAACGG glmU F1 TGCATGCCTGCAGGTCGACTCTCTGGAATCTGGTCGGATC glmU R1 CATTCGCAGGGTAACGGCCAGATTATCTCAAATCCTTAAA glmU F2 TTTAAGGATTTGAGATAATCTGGCCGTTACCCTGCGAATG glmU R2 GAGAAATCGCTTGCGCTCAATGTATGTCCCTCCTGGACTTC glmU F3 GAAGTCCAGGAGGACATACATTGAGCGCAAGCGATTTCTC glmU R3 GCTCGGTACCCGGGGATCCTTGCTCAACGATGGCGGTGAC pgmF1 TGCATGCCTGCAGGTCGACTACACGCCAGGGTATTCGCCG pgmR1 CATTCGCAGGGTAACGGCCAGTTTGCTCCTTAAAACACCA pgmF2 TGGTGTTTTAAGGAGCAAACTGGCCGTTACCCTGCGAATG pgmR2 CCGGCGCGTTCATGTGCCATTGTATGTCCTCCTGGACTTC pgmF3 GAAGTCCAGGAGGACATACAATGGCACATGAACGCGCCGG pgm R4 GCTCGGTACCCGGGGATCCTTTGTATTTGAATCCGCCATC galU1F1 TGCATGCCTGCAGGTCGACTTCGTAGAAACCGCCACCTTTT galU1R1 CATTCGCAGGGTAACGGCCAGGAACCAAGAGTACCTGCCC galU1F2 GGGCAGGTACTCTTGGTTCCTGGCCGTTACCCTGCGAATG galu1 R2 TCATCGATAGGCAAACTCATTGTATGTCCTCCTGGACTTC galU1F3 GAAGTCCAGGAGGACATACAATGAGTTTGCCTATCGATGA galU1R3 GCTCGGTACCCGGGGATCCTCAAAGGACAGATCCACCG galE F1 TGCATGCCTGCAGGTCGACTCTCCAGAGGGAACGTTCCCTC galE R1 CATTCGCAGGGTAACGGCCACGTGTGTTAGCCCTCAACCT galE F2 AGGTTGAGGGCTAACACACGTGGCCGTTACCCTGCGAATG galE R2 CCGGTAACCAGAAGCTTCATTGTATGTCCTCCTGGACTTC galE F3 GAAGTCCAGGAGGACATACAATGAAGCTTCTGGTTACCGG galE R3 GCTCGGTACCCGGGGATCCTAAGTAGCGCAAGCTGGTTGC

strain strain Related Features E. coli TOP10 F, mrcA △( mrr - hsd RMS - mcr BC) ϕ80 lac Z △ M15
lacX74 recA1 araD139 △( ara-leu )7697 galU galK rpsL (Str ^R ) endA1 nupG E.Coli K-12 MG1655 F ^- , lambda ^- , rph-1 C. glutamicum Wild-type strain, ATCC13032 C. glutamicum P P _tuf -pgm C. glutamicum U _Ptuf -galU1 C. glutamicum E P _tuf-g alE C. glutamicum PU P _tuf -pgm, P _tuf -galU1 C. glutamicum PE P _tuf -pgm, P _tuf -galE C. glutamicum UE P _tuf -galU1, P _tuf -galE C. glutamicum PUE P _tuf -pgm, P _tuf -galU1, P _tuf -galE C. glutamicum S ATCC13032 P _tuf -glmS C. glutamicum M ATCC13032 P _tuf -glmM C. glutamicum U ATCC13032 P _tuf -glmU C. glutamicum SM ATCC13032 P _tuf -glmS P _tuf -glmM C. glutamicum SU ATCC13032 P _tuf -glmS P _tuf -glmU C. glutamicum MU ATCC13032 P _tuf -glmM P _tuf -glmU C. glutamicum SMU ATCC13032 P _tuf -glmS P _tuf -glmM P _tuf -glmU

plasmid plasmid Related Features pCN013 Kan ^R, pUC origin of replication, Tuf(p), T7 terminator, 6xHis affinity tag pAY pCN013+21RBS-lgtA-LacYA pAWY pCN013+lgtA-WbgO-lacY pABY pCN013+lgtA-lgtB-lacY pKmobsacB Kan ^R , mobilizable E.coli vector for the construction of insertion and deletion mutants of C.glutamicum (oriV, sacB, lacZ) pK19mobsacB-tuf-glmS pKmobsacB + 500base pair upstream of glmS gene-Tuf(p) glmS 500base pair pK19mobsacB-tuf-glmM pKmobsacB + 500base pair upstream of glmM gene-Tuf(p)-glmM 500base pair pK19mobsacB-tuf-glmU pKmobsacB + 500base pair upstream of glmU gene-Tuf(p)-glmU 500base pair pK19mobsacB-tuf-pgm pKmobsacB + 500base pair upstream of pgm gene-Tuf(p)-pgm 500base pair pK19mobsacB-tuf-GalU1 pKmobsacB + 500base pair upstream of GalU1 gene-Tuf(p)-GalU1 500base pair pK19mobsacB-tuf-GalE pKmobsacB + 500base pair upstream of GalE gene-Tuf(p)-GalE 500base pair

gene sequence gene name sequence number Codon optimization for expression in Corynebacterium glutamicum lgtA (β-1,3-N-acetylglucosaminyltransferase)
- Neisseria cinerea ATCC 14685 SEQ ID NO: 1 X lgtA (β-1,3-N-acetylglucosaminyltransferase) - Neisseria meningitidis M98 SEQ ID NO: 2 X lgtB (β-1,4-galactosyltransferase)
Neisseria cinerea ATCC 14685 SEQ ID NO: 3 X WbgO (β-1,3-galactosyltransferase)
Lutiella nitroferrum ATCC BAA-1479 SEQ ID NO: 4 X lacY (lactose permease) SEQ ID NO: 5 X

[Example 2: Culture conditions and methods of recombinant Corynebacterium glutamicum]

For seed culture, a glass test tube containing 4 mL BHI (Brain Heart Infusion) medium containing an appropriate antibiotic (kanamycin 25 μg/mL) was used, and the culture was maintained at 30°C and a stirring speed of 250 rpm for 12 hours.

This culture was performed in a flask, and 40 mL CGXII containing appropriate antibiotics (kanamycin 25 μg/mL) (Urea 5 g/L, MgSO4 0.25 g/L, MOPS 42 g/L, Potassium phosphate monobasic 1 g/L, Potassium phosphate dibasic 1 g/L, CaCl2 10 mg/L, Biotin 0.2 mg/L, Protocatechuic acid 30 mg/L, FeSO47H2O 10 mg/L, MnSO4H2O 10 mg/L, ZnSO47H2O 1 mg/L, CuSO4 0.2 mg/L , NiCl26H2O 0.02 mg/L, Glucose 20 g/L, Lactose 5 g/L, pH 7.0) medium was used, and the culture was cultured for 72 hours while maintaining the temperature at 25°C and the stirring speed at 200 rpm.

[Experimental Example 1: Determination of concentration of cells and metabolites and comparison of productivity]

1) Experimental method for determining the concentration of cells and metabolites and comparing productivity

To compare LNT, LNnT, and LNTⅡ productivity, a glass test tube containing 4 mL BHI (Brain Heart Infusion) medium containing antibiotics (kanamycin 25 μg/mL) was used, and the temperature was 30°C and the stirring speed was 250 rpm. After culturing for 12 hours, it was inoculated into a shake flask containing 40 mL CGXII medium containing 25 μg/mL kanamycin at an initial O.D (optical density) of 0.3. The culture temperature was maintained at 25°C and the stirring speed was maintained at 200 rpm and cultured for 72 hours. After culturing for 72 hours, 1 ml of culture medium was dispensed into a 1.7 ml tube and boiled at 95°C. The boiled culture was centrifuged at 15,000 rpm for 1 minute, the supernatant was diluted 100 times, and the concentration was analyzed using HPLC. Concentrations of LNT, LNnT, LNTⅡ, Lactose, Lactate, Glucose and Acetic acid were determined using HPLC (high performance liquid chromatography) equipped with 'Carbohydrate Analysis column (Aminex HPX87H column, Bio-rad)' and 'RI (refractive index)' detector. It was measured using (Agilent 1260, USA). 20 μl of culture medium was analyzed by applying a column heated at 60°C. A 5 mM H2SO4 solution was used as the mobile phase at a flow rate of 0.6 mL/min.

2) Comparison of productivity of LNTⅡ

For the production of LNT/LNnT, the strain of Example 1 was prepared to overexpress glmS, glmM, and glmU in the production pathway of UDP-N-acetylglucosamine, a precursor material, to produce LNT/LNnT precursors using the productivity comparison test method. The production volume of phosphorus LNTⅡ was compared.

As a result, as shown in Figure 3, it was confirmed that the production of LNTII was significantly improved in glmSMU O/E in which glmS, glmM, and glmU of the UDP-N-acetylglucosamine production pathway were all overexpressed.

3) Comparison of productivity of LNT and LNnT

For the production of LNT/LNnT, the production of LNT/LNnT was compared using the above productivity comparison test method using the strain of Example 1 prepared to overexpress pgm, galU, and galE in the production pathway of UDP-galactose, a precursor material. (PU O/E: pgm GalU O/E; PE O/E: pgm GalE O/E; UE O/E: GalU GalE O/E; PUE O/E: pgm GalU GalE O/E).

As a result, as shown in Figure 4, it was confirmed that the production (final production amount) was most improved when pgm, galU, and galE were all overexpressed (PUE O/E), and in the production of LNnT, It was confirmed that overexpressing pgm and galU (PU O/E) increased the production (final production amount) the most compared to overexpressing pgm, galU, and galE (PUE O/E).

Meanwhile, when this was confirmed by changes in LNT and LNnT production over time, as shown in Figure 5, the production of LNT was most improved when pgm, galU, and galE were all overexpressed (PUE O/E). It was confirmed that the production of LNnT was most improved when pgm and galU were overexpressed (PU O/E) compared to when pgm, galU, and galE were all overexpressed (PUE O/E). I was able to.

Claims (6)

A gene encoding lactose permease, a gene encoding beta-1,3-N-acetylglucosaminyltransferase, and a gene encoding beta-1,3-galactose transferase. The gene encoding (β-1,3-galactosyltransferase) is introduced from outside and transformed so that the gene is expressed in Corynebacterium glutamicum,
The gene encoding glutamine-fructose-6-phosphate aminotransferase, a gene possessed by Corynebacterium, encodes phosphoglucosamine mutase. A gene encoding glucosamine-1-phosphate N-acetyltransferase, a gene encoding UDP-N-acetylglucosamine pyrophosphorylase A gene encoding phosphoglucomutase, a gene encoding UTP-glucose-1-phosphate uridylyltransferase, and UDP-glucose-4-epi. Recombinant Corynebacterium glutamicum , characterized in that it is transformed to overexpress the gene encoding merase (UDP-glucose-4-epimerase).
delete glucose and A method for producing lacto-N-tetraose, comprising culturing the recombinant Corynebacterium glutamicum of claim 1 in a medium to which lactose has been added. delete delete delete