KR102618553B1 - Biomarker for predicting the onset of breast cancer in diabetic patients and prognosis of breast cancer patients - Google Patents

Abstract

We disclose the use of the ratio of TRIP-Br and IR/IGF1R as a biomarker for predicting or determining the prognosis of breast cancer in diabetic patients. This study is based on the finding that TRIP-Br regulates the ratio of IR/IGF1R and that this is associated with the development of breast cancer or poor prognosis in diabetic patients, and can provide useful information for such judgments.

Description

Biomarker for predicting the onset of breast cancer in diabetic patients and prognosis of breast cancer patients {Biomarker for predicting the onset of breast cancer in diabetic patients and prognosis of breast cancer patients}

This study is related to biomarkers for predicting the development of breast cancer in diabetic patients and prognosis in breast cancer patients.

According to the World Health Organization (WHO), cancer is the biggest threat to health. Among them, breast cancer is the most common cancer in women, with 19.3 million cases reported in 2020, and 10 million deaths related to it. The relationship between breast cancer and diabetes has been previously studied, and women with diabetes are known to have a greater risk of developing breast cancer compared to women without diabetes (Garg SK, et al. Diabetes and cancer: two diseases with obesity as a common risk factor. Diabetes Obes Metab. 2014;16(2):97-110; Martin SD, and McGee SL. Metabolic reprogramming in type 2 diabetes and the development of breast cancer. J Endocrinol. 2018;237(2):35-46 ).

Insulin receptor (IR) and insulin-like growth factor-1 receptor (IGF1R) are common targets for the treatment of breast cancer and diabetes. They are activated by insulin and IGF1 and are known to be important factors for growth and survival. IR and IGF1R are overexpressed in most cancers, including breast cancer, and activate signaling pathways associated with these receptors, making them targets for cancer prevention and treatment (Ostoker R, et al. Highly specific role of the insulin receptor in breast cancer progression. Endocr Relat Cancer. 2015;22(2):145-157; Sun Y, et al. Molecular Imaging of IGF-1R in Cancer. Mol Imaging., 2017;16:1536012117736648)

However, most studies have focused on the activation of IR and IGF1R individually, and there is no integration of IR and IGF1R to associate them with breast cancer development and/or prognosis in diabetic patients.

We aim to provide biomarkers that can predict the development of breast cancer or the prognosis after breast cancer in diabetic patients.

In one aspect, in order to provide information on predicting the development of breast cancer in diabetic patients, our institute examines TRIP-Br1 (Transcriptional regulator interacting with the PHD-bromodomain 1), IR (Insulin Receptor) and A method of detecting the expression level of IGF1R (Insulin-like growth factor-1 receptor) or a method of providing the above information is provided.

In one embodiment, the method includes providing cells derived from breast tissue of a diabetic patient; Measuring the expression levels of TRIP-Br1, IR and IGF1R in the cells; Determining the IR/IGF1R expression level ratio of the cells from the measurement results; And when the TRIP-Br1 expression level and IR/IGF1R ratio are increased compared to the control group, determining that the probability of developing breast cancer in the diabetic patient is increased, wherein the control group is cells derived from breast tissue of a non-diabetic patient, and The increase in the IR/IGF1R ratio is due to an increase in the IR expression level compared to the control group and a decrease in the IGF1R expression level compared to the control group, and the diabetic patient has never developed breast cancer before.

In another aspect, the present institution provides a method for detecting the expression level of TRIP-Br1, IR and IGF1R proteins in breast cancer cells in vitro or a method for providing the information in order to provide information on the prognosis of diabetic patients with breast cancer. do.

In one embodiment, the method includes providing breast cancer cells from a diabetic patient who has developed breast cancer; Measuring the expression levels of TRIP-Br1, IR, and IGF1R in the cells; Determining the IR/IGF1R expression level ratio of the cells from the measurement results; And when the TRIP-Br1 expression level and IR/IGF1R ratio are increased compared to the control group, determining that the prognosis for breast cancer of the diabetic patient is poor, wherein the control group is the patient's non-cancerous breast cells or breast cells. In tissue cells, the increase in the IR/IGF1R ratio is due to an increase in the IR expression level compared to the control group and a decrease in the IGF1R expression level compared to the control group.

In one embodiment, the diabetes in the method includes type 1 or type 2 diabetes.

In another aspect, the present application provides a composition or kit for predicting the occurrence of breast cancer in diabetic patients, including a substance for detecting TRIP-Br1, IR, and IGF1R.

We found that the TRIP-Br1 oncogene increases the expression of IR (Insulin Receptor), while lowering the expression of IGF1R (Insulin-like growth factor-1 receptor), increasing the IR/IGF1R ratio. This not only increases the probability of developing breast cancer in diabetic patients but also worsens the prognosis of breast cancer patients. By measuring the expression level of TRIP-Br1 and the ratio of IR/IGF1R, not only is it possible to predict the occurrence of breast cancer in diabetic patients, but also the prognosis of breast cancer patients. It can be effectively used as a biomarker to predict.

Figure 1 shows that the IR/IGF1R ratio increased due to increased IR expression by TRIP-Br1. A, Expression levels of TRIP-Br1, IGF1R, and IR in normal and breast cancer cell lines. β-Actin was used as a loading control. B, IR/IGF1R ratio was quantified using ImageJ. was the expression level of IR in CD, MEF ^WT-TRIP-Br1 or MEF ^KO-TRIP-Br1 cells. Quantification of Western blots was expressed as mean ± standard deviation based on three independent experiments (n = 3). An asterisk (*) indicates a statistically significant difference at p < 0.05. EF, Endogenous IR expression was assessed in MEF ^WT-TRIP-Br1 or MEF ^KO-TRIP-Br1 cells by immunofluorescence (n >30; *, p < 0.05). IR protein levels in adipocytes and cardiac tissues collected from GH, TRIP-Br1 wild-type or knockout mice were assessed by Western blot (n = 3; *, p < 0.05). IJ, Relative IR/IGF1R ratios are shown for MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells. JK, indicated protein levels were assessed in MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells. Expression of IGF1R and IR was co-analyzed using co-antibodies that recognize both IGF1R and IR. Data are expressed as mean ± standard deviation (n = 3, *, p < 0.05). L, MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells were treated with MG132 (10 μM) and/or CQ (25 μM) for 24 h, then endogenous IR was immunoprecipitated with anti-IR antibody. Ubiquitinated IR was analyzed with anti-Ub using Western blot. M, data are expressed as mean ± standard deviation (n > 3, *, p < 0.05).
Figure 2 shows that the IR/IGF1R ratio was increased through TRIP-Br1-mediated downregulation of IGF1R. AB, TRIP-Br1 was overexpressed by transfecting pcDNA3.1/TRIP-Br1 into MCF7 and MDA-MB-231 cells, where pcDNA3.1 empty was used as a control. Cells were collected and prepared for Western blot analysis. Western blotting results were quantified using ImageJ. Analyzes were performed in triplicate and data are expressed as mean ± standard deviation (n = 3; *, p <0.05;**, p < 0.01). CD, TRIP-Br1 silencing RNA (siTRIP-Br1) was transfected into MCF7 and MDA-MB-231 breast cancer cell lines, where scrambled RNA (scRNA) was used as a non-silencing control. Data are expressed as mean ± standard deviation (n = 3; *, p <0.05; **, p <0.01; ***, p < 0.005). EF, ^{TRIP-Br1 and IGF1R expression levels in MCF7 WT-} TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells. Data were expressed as mean ± standard deviation (n = 3; *, p <0.05; **, p < 0.01). TRIP-Br1 and IGF1R expression levels in GH, MEF ^WT-TRIP-Br1 or MEF ^KO-TRIP-Br1 cells. MEF cells were isolated from TRIP-Br1 wild-type or knockout mice as mentioned in Materials and Methods. Data were expressed as mean ± standard deviation (n > 3, *, p < 0.05, ***, p < 0.005). IJ, Protein levels of TRIP-Br1 and IGF1R in adipocytes and heart tissue collected from TRIP-Br1 wild-type or knockout mice. Results are expressed as mean ± standard deviation (n = 3, *, p < 0.05, ***, p < 0.005).
Figure 3 shows the reduction of IGF1R protein levels by TRIP-Br1 adopter protein and NEDD4-1 E3 ligase. AB, TRIP-Br1, or NEDD4-1 silencing RNA (siTRIP-Br1 and siNEDD4-1) were transfected into MCF7 and MDA-MB-231 cells, and IGF1R expression was analyzed using Western blot analysis. CD, NEDD4-1 was knocked down by siNEDD4-1 in the presence of 200mM CHX, and the indicated proteins were subjected to Western blot analysis. Data are expressed as mean ± standard deviation (n >3; *, p <0.05; **, p <0.01; ***, p < 0.005). EF, the interaction between IGF1R and TRIP-Br1 was determined using co-immunoprecipitation assay. Endogenous TRIP-Br1 from MCF7 cells was immunoprecipitated with the corresponding antibody. GH, Representative images of NEDD4-1 and IGF1R expression observed using confocal microscopy are shown. MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells were cultured in confocal dishes for 24 hours and their immunofluorescence was analyzed. Co-localization between NEDD4-1 and IGF1R was determined by counting more than 50 cells in ImageJ. Data are expressed as mean ± standard deviation (n > 50, **, p < 0.01).
Figure 4 shows that TRIP-Br1/NEDD4-1 mediated IGF1R degradation through proteasome/ubiquitination and lysosome-dependent pathways. AB, MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells were transfected with siNEDD4-1 in the absence or presence of MG132 (10 μM) for 24 h. Cells were collected and Western blot was performed. Quantitative results were expressed as mean ± standard deviation (n = 3, *, p <0.05; **, p <0.01; ***, p < 0.005).CD, MCF7 ^WT-TRIP-Br1 and MCF7 ^{KD-TRIP -Br1} cells were transfected with siNEDD4-1 with or without CQ (25 μM) for 24 h. Whole cells were used to lyse and Western blot analysis was performed. Data are expressed as mean ± standard deviation (n = 3; *, p <0.05; **, p <0.01; ***, p < 0.005).EF, MCF7 ^WT-TRIP-Br1 and MCF7 ^{KD-TRIP- Br1} cells were transfected with siNEDD4-1, treated with MG132 (10 μM) for the indicated times, and cells were collected for Western blot analysis. Quantification of Western blot was expressed as mean ± standard deviation (n = 3, *, p < 0.05).
Figure 5: Enhanced tumor formation and growth is associated with higher IR/IGF1R ratio due to TRIP-Br1 expression. A, MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells were injected subcutaneously into the flanks of nude mice. Tumor volumes were measured at the indicated times and calculated as described in Materials and Methods. B, Tumors were collected and photographed from null mice. Scale bar, 1 cm. C, Tumor weight was measured after mouse resection. Data are expressed as mean ± standard deviation (n = 4, ***, p < 0.005). DE, quantification of results was expressed as mean ± standard deviation (n = 4; *, p <0.05; **, p < 0.01). F, Relative IR/IGF1R ratios are expressed as mean ± standard deviation (n = 4, ***, p < 0.005). G, MCF7 cells were transfected with IR silencing RNA for 24 h, seeded in 96-well plates, and treated with three different treatments: doxorubicin (1 μM), staurocephalin (0.1 μM), and paclitaxel (0.5 μM) for 24 h. treated with a type of anticancer drug. hour. Cell viability was measured as mentioned in the Materials and Methods section. Data are expressed as mean ± standard deviation (n = 3, *, p < 0.05).
Figure 6 shows that the IR/IGF1R ratio was increased by TRIP-Br1 in insulin-deficient mice. A, Tissue samples of heart, liver, and adipocytes were collected from 5-week-old insulin-producing mice (control) or insulin-deficient mice (IDM). Tissues were used to assess the levels of TRIP-Br1, IR and IGF1R IR by Western blot analysis using insulin and glucagon as controls. B, Quantification of results expressed as mean ± standard deviation (n >3; *, p <0.05; **, p <0.01; ***, p < 0.005). Relative IR/IGF1R ratios were also shown. C, Representative images of IHC analysis showing the expression levels of TRIP-Br1, IR, and IGF1R in heart, liver, and adipocytes from control or IDM groups. D, Expression levels of TRIP-Br1, IR and IGF1R are expressed as mean ± standard deviation (n >3; *, p <0.05; ***, p < 0.005). Relative IR/IGF1R ratios were also shown.
Figure 7 is the correlation between TRIP-Br1 and IR/IGF1R ratio in single cells from breast cancer patients. A, Relationship between TRIP-Br1 and IR expression in four different types of breast cancer: TNBC, HER2, LumA, and LumB. B, Relationship between TRIP-Br1 and IGF1R expression in four different subtypes of breast cancer: C, Relationship between TRIP-Br1 and IR/IGF1R ratio in four different subtypes of breast cancer. Each dot represents a single cell. D, The relationship between TRIP-Br1 and IGF1R expression was analyzed using the timer2.0 tool (http://timer.cistrome.org/).
Figure 8 is a bioinformatic analysis of the relationship between TRIP-Br1 expression, IR/IGF1R ratio and survival rate in patients with three different types of cancer. The relationship between survival days and TRIP-Br1 expression or IR/IGF1R ratio was analyzed in two groups (stages i-ii and iii-v) of indicated cancer patients using the TCGA database.
Figure 9 schematically shows the regulation mechanism of the IR/IGF1R ratio by TRIP-Br1 in breast cancer cells identified herein. This suggests that TRIP-Br1 does not interact directly with IR and inhibits proteasome-mediated ubiquitination and IR degradation, suggesting a negative effect on an unknown E3 ligase, possibly CHIP or MARCH1. In contrast, TRIP-Br1 interacts directly with both IGF1R and NEDD4-1 E3 ubiquitin ligase, where TRIP-Br1/NEDD4-1 has been shown to degrade IGF1R through the ubiquitin/proteasome system rather than the lysosomal pathway. Ultimately, TRIP-Br1 increased the IR/IGF1R ratio, which was found to worsen the prognosis of breast cancer patients. Additionally, downregulated IGF1R is known to induce IR activation, which ultimately activates PI3K/AKT and MAPK signaling pathways, resulting in cancer cell proliferation and survival.

This study is based on the discovery that TRIP-Br1 identifies the mechanism by which a high IR/IGF1R ratio occurs in diabetes and can relate this to the probability of developing breast cancer in diabetic patients and the prognosis of diabetic patients who have already developed breast cancer.

Specifically, we found that the TRIP-Br1 oncogene increases the expression of IR (Insulin receptor), while decreasing the expression of IGF1R (insulin-like growth factor receptor), increasing the IR/IGF1R ratio. This not only increases the probability of developing breast cancer in diabetic patients but also worsens the prognosis of breast cancer patients. By measuring the expression level of TRIP-Br1 and the ratio of IR/IGF1R, not only does it predict the occurrence of breast cancer in diabetic patients, it also predicts the prognosis of breast cancer patients. It can be effectively used as a biomarker to predict.

Accordingly, this study is concerned with using the IR/IGF1R ratio by TRIP-Br1 as a biomarker to predict the development of breast cancer in diabetic patients or to determine the prognosis of diabetic patients who have already developed breast cancer.

Accordingly, in one aspect, our method is to detect the expression levels of TRIP-Br1, IR, and IGF1R proteins in breast cancer cells in vitro in order to provide information on predicting the development of breast cancer in diabetic patients.

In one embodiment, the method includes providing cells derived from breast tissue of a diabetic patient; Measuring the expression level of each protein, TRIP-Br1, IR and IGF1R, in the cells; determining the IR/IGF1R ratio of the cell from the measured value; And when the TRIP-Br1 protein expression level and IR/IGF1R ratio are increased compared to the control group, it includes determining that the probability of developing breast cancer in the diabetic patient is increased.

In the method, the control group is cells derived from breast tissue of a non-diabetic person, and the diabetic patient is a patient who has never previously developed breast cancer.

In the method, TRIP-Br1 increases the expression of IR, while decreasing the expression of IGF1R, so that an increase in the IR/IGF1R ratio increases the IR expression level compared to the control group, and the IGF1R expression level compared to the control group. This is due to a decrease.

In another aspect, the present invention also provides a method for detecting the expression levels of TRIP-Br1, IR, and IGF1R proteins in breast cancer cells in vitro in order to provide information on the prognosis of breast cancer in diabetic patients who have developed breast cancer.

In one embodiment, the method includes providing cells derived from breast tissue of a diabetic patient who has developed breast cancer; Measuring the expression level of each protein, TRIP-Br1, IR and IGF1R, in the cells; determining the IR/IGF1R ratio of the cell from the measured value; And when the TRIP-Br1 protein expression level and IR/IGF1R ratio are increased compared to the control group, it includes determining that the diabetic patient has a poor prognosis for breast cancer.

In the above method, the control group is normal cells that have not developed breast cancer derived from the patient's breast tissue.

In the method, TRIP-Br1 increases the expression of IR, while decreasing the expression of IGF1R, so that an increase in the IR/IGF1R ratio increases the IR expression level compared to the control group, and the IGF1R expression level compared to the control group. This is due to a decrease.

The biomarker according to the present invention can be used to determine the likelihood of developing breast cancer in diabetic patients and the prognosis of patients developing breast cancer.

According to our institute, as a result of experiments with insulin-deficient mice, which are substitutes for diabetic patients, the level of TRIP-Br1 expression was very high, and therefore the IR/IGF1R ratio was found to be high. Additionally, other researchers have found that TRIP-Br1 is expressed at high levels in several types of cancer, and according to our research team, it is believed to be an oncogene that is particularly specific to breast cancer. The reason is that under various environmental stresses that induce programmed cell death, the expression of TRIP-Br1 is particularly high in breast cancer cell lines compared to other cancer cell lines, and the elevated TRIP-Br1 inhibits cell death and promotes the development of breast cancer. It helps survival and especially promotes metastasis of breast cancer. This indicates that the biomarker according to the present invention can be effectively used to predict the development of breast cancer in diabetic patients before breast cancer diagnosis.

Additionally, the biomarker according to the present invention can be usefully used to determine the prognosis of patients with breast cancer. Research has shown that when the IR/IGF1R ratio of cells increases, the prognosis of breast cancer patients is much worse than that of breast cancer patients with a low IR/IGF1R ratio, but this mechanism has not been identified. Herein, we found that TRIP-Br1 regulates the IR/IGF1R ratio. In other words, as TRIP-Br1 increases, the IR/IGF1R ratio increases, and in this case, the prognosis of breast cancer patients is much worse than that of breast cancer patients with low TRIP-Br1 or IR/IGF1R ratio.

TRIP-Br1 (Transcriptional regulator interacting with the PHD-bromodomain 1; also known as SERTAD1, SEI-1, SEI1, p34SEI-1), which constitutes the biomarker according to the present application, is a tumor protein that acts on cells under nutrient-deficient conditions. It is known to cause autophagy, apoptosis, and cell necrosis. The sequence is known and the human protein sequence is published under NCBI ID: NP_037508.

IR (Insulin Receptor) and IGF1R (Insulin-like growth factor-1 receptor), which constitute the biomarkers according to the present application, are common targets for the treatment of breast cancer and diabetes. They are activated by insulin and IGF1 and are known to be important factors for growth and survival. IR and IGF1R are overexpressed in most cancers, including breast cancer, and activate signaling pathways associated with these receptors, making them targets for prevention and treatment of cancer. Each sequence is known as follows: IR (INSR): GenBank-AAA59452.1, IGF1R: GenBank-AAI43722.1 or BAG11657.2.

At our hospital, diabetes is a metabolic syndrome that causes hyperglycemia. Diabetes is diagnosed when one or more of the following criteria is met: When fasting plasma blood sugar is 126 mg/dL or higher; Random non-fasting plasma glucose of 200 mg/dl or higher; If the plasma glucose level is more than 200 mg/dl 2 hours after the 75g oral glucose tolerance test; If glycated hemoglobin is 6.5% or higher.

Also included herein are both type 1 and type 2 diabetes.

The expression level of the biomarker according to the present application is detected. for quantitative analysis Such methods, including expression level detection, are known in the art, and those skilled in the art will be able to select appropriate methods for the practice of the present application.

Biomarkers according to the present application can be detected at the level of nucleic acids, especially mRNA and/or protein expression level itself, changes in expression level, and differences in expression level, and various methods for qualitatively or quantitatively detecting known nucleic acids and proteins can be used. You can. For example, Western blot, ELISA, radioimmunoassay, immunodiffusion, immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, or array systems such as protein arrays such as antibodies or nucleic acid arrays, and nucleic acid transcription and amplification systems. , an eTag system, a system based on labeled beads, binding to a labeled antibody in solution/suspension and detection through flow cytometry, or a method using mass spectrometry, etc. can be used. Such methods are known, for example, chip-based capillary electrophoresis: Colyer et al. 1997. J Chromatogr A. 781(1-2):271-6; mass spectroscopy: Petricoin et al. 2002. Lancet 359: 572-77; eTag systems: Chan-Hui et al. 2004. Clinical Immunology 111:162-174; microparticle-enhanced nephelometric immunoassay: Montagne et al. 1992. Eur J Clin Chem Clin Biochem. 30:217-22, etc.

The subjects from which the samples according to the present application are derived are diabetic patients and include before and after breast cancer.

The sample used herein is breast tissue. In the case of diabetic patients, cells are collected from breast tissue before breast cancer diagnosis, the expression levels of TRIP-Br1, IR, and IGF1R are examined, and the IR/IGF1R ratio is detected. In the case of diabetic patients who have already developed breast cancer, after breast cancer diagnosis, breast cancer cells are collected from the breast of the breast cancer patient, the expression levels of TRIP-Br1, IR, and IGF1R are examined, and the IR/IGF1R ratio is detected.

If the TRIP-Br1 protein expression level and IR/IGF1R ratio are significantly increased compared to the detection results in the control group as a result of biomarker detection according to the present application, the subject from which the sample is derived can be judged to have a high probability of developing breast cancer, Subjects who have already developed breast cancer have a poor prognosis.

At our hospital, prognosis means predicting the future course or outcome of the disease in advance, and in the case of cancer, it is usually calculated based on the 5-year survival rate. A good prognosis means that treatment is easy and the survival rate is high. Therefore, prognosis in breast cancer means predicting the course or outcome of breast cancer. Breast cancer is a cancer that is relatively treatable when discovered early, with an average 5-year survival rate of about 76% after treatment. In particular, stage 0 cancer (carcinoma in situ) and stage 1 cancer show a 5-year survival rate of 90-100%. This is a disease in which early detection and early treatment are particularly important. Therefore, due to these characteristics, this biomarker will be used to detect and treat diabetic patients with a high risk of breast cancer or breast cancer patients with a poor prognosis at an early stage, and this is expected to greatly improve the prognosis of breast cancer patients.

According to one embodiment of the present application, this linking step may be performed by comparing a normal control group and a sample of the subject, setting a specific threshold, and then comparing the detection result of the subject with the threshold.

The control group used in the method according to the present application is normal cells other than breast tissue or breast cancer tissue derived from the same subject.

In another aspect, the disclosure also provides TRIP-Br1, The present invention relates to a composition or kit for predicting the occurrence of breast cancer in diabetic patients or determining the prognosis of diabetic patients with breast cancer, including a detection reagent for IR and IGF1R markers.

The detection reagent included in the composition and kit according to the present application may refer to the above-mentioned information, and the kit may additionally include instructions for use.

Below, examples are presented to aid understanding of the present invention. However, the following examples are provided only for easier understanding of the present invention, and the present invention is not limited to the following examples.

Example

Experimental methods and materials

Cell culture.

All cell lines were purchased from Korean Cell Line Bank or American Type Culture Collection (ATCC). Normal human mammary epithelial cell lines were cultured in DMEM/F12 medium (Invitrogen, Cat#11330-032, U.S.A), which was supplemented with 20 μg/ml epidermal growth factor (EGF) (Sigma-Aldrich, Cat#E9644, U.S.A), 100 μg/ml. μg/ml cholera toxin (Sigma-Aldrich, Cat#C-8052, U.S.A), 10 μg/ml insulin (Sigma-Aldrich, Cat#I-9278, U.S.A), 0.5 mg/ml hydrocortisone (Sigma-Aldrich, Cat# H-0888, U.S.A), 5% horse serum (Invitrogen, Cat#16050-122, Korea), and 1% antibiotic-antimycotic solution. Breast cancer cell lines and mouse embryonic fibroblasts (MEFs) were cultured in Dulbecco's modified DMEM medium (Cat#31966-021; Life Technologies) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% antibiotics. All cells were maintained at 37°C in a humidified atmosphere containing 95% air and 5% CO2. Reagents were purchased from the following manufacturers. MG132 (Cat#M-1157; A.G. Scientific Inc.), chloroquine (CQ) (Cat#C6628; Sigma-Aldrich), cycloheximide (CHX) (Cat#C7698; Sigma), and OSI-906 (Cat#S1091) ; Selleckchem).

Inhibition or overexpression of TRIP-Br1, NEDD4-1, and IR. To inhibit TRIP-Br1 expression, Opti-MEM (Cat#31985; Invitrogen), a scrambled small interfering RNA (scRNA), was used as a control. MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 stable cell lines were established as described in our previous study [2]. To establish TRIP-Br1 overexpression cells, cells were transfected with TRIP-Br1 overexpression plasmid (pcDNA3.1/TRIP-Br1) using Lipofectamine 2000 in Opti-MEM medium. NEDD4-1 and IR genes were silencing using TurboFect Transfection Reagent (Cat #R0531; Thermo Scientific) with NEDD4-1 silencing siRNA (siNEDD4-1) or IR silencing RNA (siIR) from BIONEER Corporation (Korea) as follows. It has been done. siNEDD4-1: UUCCAUGAAUCUAGAAAGAACATT/UGUUCUUCUAGAUUCAUGGAATTsiIR: GCAGGUCCCCUUGGCGAUGU/ACAAGACCUAGUGCCACUG=tt

Measurement of cell viability. Cell viability assay. Cell viability was analyzed using the Cell Viability, Proliferation & Cytotoxicity Assay Kit (Cat#EZ-3000; EZ-CYTOX) according to the manufacturer's instructions by measuring absorbance at 450 nm using a Gemini XPA Microplate Reader.

Western blot analysis. Cells were centrifuged, washed with cold PBS buffer, and then added to RIPA lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% standard deviation S, 0.5% sodium deoxycholate, 1% TritonX-100, 1 mM DTT, 1 mM PMSF, pH 7.4). The amount of protein was quantified using a protein assay kit (Bio-Rad, Korea). Samples were separated by SDS-PAGE and transferred to Immobilon transfer membrane (Millipore, Cat#IPVH00010). Membranes were incubated with antibodies, and immune detection was performed using PowerOpti-ECL Western blotting detection reagent (Bio-Rad, Korea). The antibodies used in this study are as follows. TRIP-Br1 (Cat #ALX -804-645; Enzo Life Sciences), IR (Cat#57982; Cell Signaling), IGF1R (Cat#sc-81464; Santa Cruz Biotechnology, or Cat#ab39675; Abcam), IGF1R/IR (Cat#ab172965; Abcam), NEDD4-1 (Cat#sc-25508; Santa Cruz Biotechnology), insulin (Cat#ab63820; Abcam), glucagon (Cat#ab92517; Abcam), β-actin (Cat#sc-47778 ; Santa Cruz Biotechnology).

Immunohistochemical (IHC) analysis. Mouse organs were dissected and fixed in 4% formalin overnight at room temperature. Samples were washed with PBS and incubated in 70%, 80%, 95%, and 100% ethanol for 30 min each. It was then transferred to xylene for 4 hours, embedded in paraffin, cut into 5 μm sections using a microton, dried at room temperature, and deparaffinized at 60°C for 1 hour. The slides were then incubated in 10mM sodium citrate buffer (pH 6.0) for 20 min at 100°C, cooled, and washed with distilled water for 5 min. Peroxidase activity was removed in methanol buffer containing 0.3% H2O2, washed three times with PBS for 5 min, and blocked with 5% BSA in PBS-T for 1 h at room temperature. Primary antibodies were diluted in blocking solution and used to incubate sections overnight at 4°C. The next day, slides were washed three times with PBS and incubated with specific biotinylated secondary antibodies for 1 hour at room temperature. Colors were developed using ABC KIT (Cat#pk-4000; VECTASTAIN®). Finally, slides were dehydrated and covered using mounting media.

Immunoprecipitation. Cells were lysed in NP-40 lysis buffer (Cat #BA1049; Elpis Biotech) supplemented with protease inhibitor cocktail for 20 min at 4°C. Lysates were centrifuged and the supernatants were incubated with the respective antibodies overnight on a Rotospin (SLRM-2M; Mylab Intelli Mixer) at 4°C and then incubated with protein G- or A-agarose beads (Cat#sc-2003; Santa Cruz Biotechnology) and placed at 4°C for 4 hours, then the samples were centrifuged and washed with NP40 lysis buffer. Proteins were eluted from washed beads by boiling for 5 min in 4x standard deviation S gel loading dye and subjected to immunoblotting analysis. Normal mouse IgG (Cat#sc-2025; Santa Cruz Biotechnology) and normal rabbit IgG (Cat#sc-2027; Santa Cruz Biotechnology) were used as controls. To analyze IGF1R and IR ubiquitination, cells were treated with 10 μM MG132 and/or 25 μM CQ for 24 h. Cells were lysed with RIPA buffer containing protease inhibitor cocktail and centrifuged to obtain cytosolic proteins. Ubiquitinated IGF1R and IR were immunoprecipitated using IGF1R (Cat#ab39675; Abcam) or IR (Cat#3025S; Cell Signaling) antibodies and then immunoblotted with Ub antibody (Cat#sc-8017; Santa Cruz Biotechnology).

Immunofluorescence. Cells were plated at a density of 5 × 104 cells in confocal dishes (Coverglass-Bottom Dish, Cat# 100350; SPL) for 24 h. Cells were fixed in 4% paraformaldehyde for 15 minutes and washed three times with PBS. Cells were blocked with IF blocking buffer (PBS, 2% BSA, 0.3% Triton-X 100) for 1 hour and stained with NEDD4-1 (Cat#sc-25508; Santa Cruz Biotechnology) and IGF1R (Cat#sc-81464). did. Santa Cruz Biotechnology) and IR (Cat#3025S; Cell Signaling) in IF buffer for 12 hours. Alexa Fluor® 568 (Cat#ab150115; Abcam) and Alexa Fluor® 647 (Cat#ab175473; Abcam) were diluted 1:100 in IF blocking buffer. Nuclei were washed with PBS and then stained with DAPI (Cat#P36931; Invitrogen) for 10 min. Confocal images were obtained using a Zeiss confocal microscope (A1 confocal microscope, Nikon).

Animal testing. TRIP-Br1 knockout mice (RRID: MGI:4437096) with C57BL/6 genetic background were kindly provided by Dr. Huang (Hong Kong University of Science and Technology, Hong Kong, China). Mouse strains were genotyped using PCR analysis as previously described. Insulin-deficient mice (C57BL/6-Tg(pH1-siRNAinsulin/CMV-hIDE)Korl) (5 weeks old) were purchased from the Laboratory Animal Resource Bank (https://lareb.nifds.go.kr/). Mouse embryonic fibroblasts (MEFs) were isolated as follows. Embryos were dissected and decapitated from 13.5-day-old mice carrying wild-type or knockout TRIP-Br1, from which internal organs had been removed. The tissue was then washed with cold PBS, cut into pieces, and incubated with trypsin/EDTA. Finally, cells were transferred to DMEM supplemented with 10% FBS after each culture. These cells were maintained in DMEM after removal of non-adherent cells after 2 hours.

Xenotransplantation research. Exponentially growing MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells (1 × 107 cells) were collected and resuspended in 0.1 ml of PBS. The cells were then injected subcutaneously into 5-week-old female null mice. The volume of the generated tumor was calculated as 0.523 × length × width 2. Mice were sacrificed one month later and tumor weights were measured after resection.

Single cell RNA sequencing analysis. Single-cell RNA-seq data for 11 breast cancer patients were downloaded from GEO (SRP066982). Sequencing reads from raw fastq were aligned using the human reference genome GRCh38 and Genecode.v38 annotations using STAR v2.7.8a and transcript per million (TPM) values were estimated using RSEM v1.3.1 with the following options: paired-end--estimate-rspd--single-cell-prior. The log2-tansformed TPM value, log2(TPM + 1), was considered the relative expression level of each gene. Cells of reliable quality were collected after cell type annotation as defined in the original paper before further analysis. To assess the association between two factors, Pearson's correlation coefficient was calculated and linear regression analysis was performed using the 'lm' function in R's basic package. IR/IGF1R ratio is IR and IGF1R. Missing values due to lack of IGF1R expression were removed from the association analysis.

Statistical analysis. Statistical analysis was performed using the Student's t-test using SPSS Statistics version 23 (IBM Corporation, Armonk, NY, USA) to compare the two groups. Additionally, Bonferroni's multiple comparisons test was used to compare multiple groups. Three numbers were used in each analysis method, and statistical significance of the data was accepted when the test statistic (P value) was less than 0.05.

Example 1. Higher rate of IR/IGF1R induction due to positive effect of TRIP-Br1 on IR expression

The effect of TRIP-Br1 on the IR/IGF1R ratio was evaluated in normal (MCF10A) and breast cancer cell lines (Figure 1A, B). While normal cells had similar expression levels of IR and IGF1R, most breast cancer cell lines showed a high IR/IGF1R ratio, with IR expression significantly higher than IGF1R expression (Figure 1, A, B). In particular, four cancer cell lines (MDA-MB-453, MDA-MB-468, BT20, BT549) with very high TRIP-Br1 expression showed a much higher IR/IGF1R ratio than other cancer cell lines (Figure 1, A, B). . According to our previous and unpublished research results, TRIP-Br1 gene expression is always very high in the above four cell lines regardless of stress stimulus, whereas TRIP-Br1 expression in MCF7 and MDA-MB-231 breast cancer cell lines is expressed in various cells. It was found to greatly increase under stress conditions that cause death.

First, we tested the effect of TRIP-Br1 on IR expression in MEFs isolated from TRIP-Br1 wild-type (MEF ^WT-TRIP-Br1 ) and knockout (MEF ^KO-TRIP-Br1 ) mice. Interestingly, we found higher expression levels of IR in MEF ^WT-TRIP-Br1 compared to MEF KO ^-TRIP-Br1 cells (Fig. 1C,D). TRIP-Br1 knockout was confirmed by genotyping. Similar results were obtained in confocal immunofluorescence experiments (Figure 1, E, F). Additionally, TRIP-Br1 wild-type mice showed approximately 2- to 4-fold higher levels of IR expression in adipocyte and heart tissue samples compared to TRIP-Br1 knockout mice (Figure 1G,H). MCF7 cells expressing wild-type TRIP-Br1 (MCF7 ^WT-TRIP-Br1 ) also showed a significantly higher IR/IGF1R ratio than stable MCF7 cells in which TRIP-Br1 was knocked down (MCF7 ^KD-TRIP-Br1 ) ( Figure 1I-J). MCF7 ^WT-TRIP-Br1 cells showed higher IR but lower IGF1R expression levels than MCF7 ^KD-TRIP-Br1 cells (Figure 1J,K). We also analyzed the total amount of IR and IGF1R using a common antibody that recognizes both IGF1R and IR. No significant differences were detected between MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells, implying an inverse or compensatory relationship between them (Fig. 1J,K). Interestingly, we found an inverse relationship between IR and IGF1R expression, i.e., IR silencing significantly increased IGF1R protein levels in MCF7 and MDA-MB-231 cells. In further studies, significantly higher levels of IR ubiquitination were detected in MCF7 ^{KD-TRIP-Br1 cells than in MCF7 WT-TRIP- Br1} cells after treatment with a proteasome inhibitor (MG132), but not an autophagy inhibitor (CQ), which We show that TRIP-Br1 inhibits proteasome-mediated degradation of IR (Figure 1L,M).

These results clearly indicate that TRIP-Br1 enhances the IR/IGF1R ratio by increasing the expression of IR at the protein level.

Example 2. TRIP-Br1 mediated IGF1R downregulation results in higher rates of IR/IGF1R

Herein, we found that TRIP-Br1 has a positive effect on IR expression and contributes to a relatively high IR/IGF1R ratio. Furthermore, we also analyzed the effect of TRIP-Br1 on IGF1R expression. First, the effect of TRIP-Br1 on IGF1R expression was tested in MCF7 and MDA-MB-231 breast cancer cell lines. TRIP-Br1 overexpression significantly reduced IGF1R expression (Fig. 2A, B), whereas silencing of TRIP-Br1 significantly increased IGF1R expression (Fig. 2C, D). Additionally, MCF7 ^KD-TRIP-Br1 cells also showed much higher IGF1R expression than MCF7 ^WT-TRIP-Br1 cells (Figure 2E,F). In addition, MEF ^KO-TRIP-Br1 cells also showed a significant increase in IGF1R expression compared to MEF ^WT-TRIP-Br1 (Figure 2G, H). Finally, TRIP-Br1 knockout mice showed elevated IGF1R in adipocytes (~20-fold) and heart (~2-fold) compared to controls (Figure 2 I, J).

Overall, these data strongly indicate that TRIP-Br1 negatively affects IGF1R expression and eventually increases the IR/IGF1R ratio in breast cancer cells.

Example 3. High IR/IGF1R ratio due to reduced IGF1R protein concentration in TRIP-Br1 as an adopter protein and NEDD4-1 E3 ligase

Next, we analyzed the mechanism by which TRIP-Br1 downregulates IGF1R protein levels. TRIP-Br1 is an adaptor protein that directly binds to two E3 ubiquitin ligases, NEDD4-1 and XIAP. Additionally, there is multiple evidence that NEDD4-1 is an E3 ubiquitin ligase responsible for IGF1R degradation. For example, oxidative stress-mediated NEDD4-1 upregulation degrades IGF1R during neurodegeneration. However, direct interaction between IGF1R and NEDD4-1 has not been reported, suggesting possible constraints such as the need for adaptor proteins. Therefore, herein, we analyzed whether TRIP-Br1 interacts with NEDD4-1 or XIAP and is responsible for ubiquitination and degradation of IGF1R. Interestingly, IGF1R expression levels were significantly increased in MCF7 and MDA-MB-231 breast cancer cell lines in which TRIP-Br1 and/or NEDD4-1 were silenced (Figure 3, A and B). However, little change was observed in TRIP-Br1/XIAP double knockdown cells. The effect of NEDD4-1 on IGF1R degradation was also evaluated. IGF1R protein levels were significantly increased after NEDD4-1 silencing in the presence of the protein synthesis blocker cycloheximide (CHX) ( Fig. 3 C, D). Co-immunoprecipitation experiments showed direct interaction between TRIP-Br1, IGF1R, and NEDD4-1 ( Fig. 3E,F ). However, no direct interaction was observed between TRIP-Br1 and IR (Figure 3E). Co-immunofluorescence experiments also showed higher co-localization of endogenous NEDD4-1 and IGF1R in MCF7 WT ^{-TRIP-Br1 cells than in MCF7 KD- TRIP-Br1} cells, suggesting that TRIP-Br1 brings NEDD4 close enough to IGF1R. This means that it acts as an adapter protein (Figure 3, G, H)

Taken together, these data herein strongly suggest that TRIP-Br1 functions as an adopter protein and plays an important role in NEDD4-1 mediated downregulation of IGF1R.

Example 4. Mediating IGF1R degradation through proteasome/ubiquitination of TRIP-Br1/NEDD4-1

Degradation of many ligand-induced receptors is mediated through ubiquitination of the receptor, followed by proteasome- or lysosome-dependent degradation. When IGF1 binds to IGF1R, IGF1R is polyubiquitinated. Our previous and unpublished data showed that TRIP-Br1 plays an important role in both pathways. Therefore, in this example, we analyzed which pathway is responsible for TRIP-Br1/NEDD4-1-mediated IGF1R degradation. To test this hypothesis, siNEDD4-1 was transfected into MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells in the absence or presence of MG132 or CQ. NEDD4-1 silencing significantly increased IGF1R protein levels in the presence of MG132 (Fig. 4A, B), but only slightly increased in MCF7 ^WT-TRIP-Br1 cells after CQ treatment (Fig. 4C, D). Similar results were obtained for IGF1R expression levels after treatment with MG132 ( Fig. 4E,F ), but not CQ treatment (data not shown). These findings suggest that TRIP-Br1/NEDD4-1-mediated IGF1R degradation occurs primarily through the proteasome/ubiquitination pathway rather than the lysosomal pathway.

Example 5. Higher IR/IGF1R ratio and increased tumor formation due to TRIP-Br1 expression

Next, we investigated the IR/IGF1R ratio in TRIP-Br1-mediated tumor formation and growth using a xenograft model. MCF7 ^WT-TRIP-Br1 and MCF7 ^KD-TRIP-Br1 cells were injected subcutaneously into nude mice and tumor size was measured on the indicated days (Figure 5A). Our results showed a significant reduction in tumor volume in MCF7 ^KD-TRIP-Br1 pretreated mice (Figure 5A, B). A significant reduction (>90%) in tumor weight was observed in tumors collected from null mice injected with MCF7 ^KD-TRIP-Br1 compared to MCF7 ^WT -TRIP-Br1, suggesting that TRIP-Br1 is responsible for tumor formation and growth in vivo. It is shown to be effective in increasing (Figure 5C). Consistent with the in vitro results, approximately 10-fold higher IR/IGF1R ratio was detected in MCF7 ^WT-TRIP-Br1 cells grown in null mice, due to higher IR but lower IGF1R. This suggests that a higher ratio of IR/IGF1R can increase the growth and proliferation of breast cancer cells (Figure 5D, F). These results are consistent with previous results. Inhibition of IGF1R was previously reported to have no effect on tumor growth in preclinical trials, but was found to enhance the IR signaling pathway and consequently multistage tumor growth.

Our results indicate that IR is more relevant to the growth and survival of cancer cells than IGF1R. Our hypothesis was tested by examining the MCF7 cell response to three different anticancer drugs (doxorubicin, staurosporine, and paclitaxel), i.e., resistance to anticancer-mediated cell death, and the effect of IR on the survival of MCF7 cells. The MCF7 cell line is well known for its high resistance to programmed cell death against various anticancer drugs. Cell survival rate was found to be lower in IR-silenced MCF7 cells than in control cells after treatment with anticancer drugs (Figure 5G).

Taken together, these results indicate that TRIP-Br1 increases the proliferation and viability of breast cancer cells by increasing the IR/IGF1R ratio even after treatment with anticancer drugs.

Example 6, Higher rate of IR/IGF1R induction by TRIP-Br1 in insulin-deficient mice mimicking diabetes

The effect of TRIP-Br1 on the IR/IGF1R ratio and the inverse relationship between IR and IGF1R expression were further tested in insulin-deficient mice mimicking diabetic patients, in which decreased insulin and increased glucagon concentrations were used as controls ( 6A, B). As in previous studies showing that insulin or IGF1 deficiency causes TRIP-Br1 upregulation in breast cancer cells, a similar pattern was observed in our animal model (Figure 6A, B). Insulin-deficient mice showed significantly elevated TRIP-Br1 protein levels, and also increased IR in all three tissue samples examined (heart, liver, and adipocytes), but this was accompanied by a decrease in IGF1R, which was associated with increased TRIP-Br1 protein levels. This shows a positive effect on the IR/IGF1R ratio (Figure 6A, B). Representative images of immunohistochemical staining for TRIP-Br1, IR, and IGF1R in insulin-deficient mice and corresponding normal mouse tissues are in Figure 6C. Again, significantly higher TRIP-Br1 and IR expression levels but lower IGF1R expression levels were observed in insulin-deficient mice compared to normal mouse tissues, resulting in a higher IR/IGF1R ratio observed in insulin-deficient mice. (D in Figure 6). These results strongly indicate that TRIP-Br1 positively regulates IR but negatively regulates IGF1R expression, resulting in a higher IR/IGF1R ratio in insulin-deficient mice.

Taken together, these results indicate that TRIP-Br1 is at least partially involved in the induction of higher IR/IGF1R ratios in patients with diabetes and diabetic breast cancer.

Bioinformatics analysis (http://timer.cistrome.org/) of a database of up to 568 patients showed an inverse relationship between TRIP-Br1 and IGF1R expression, similar to the in vitro results (Figure 7) D). Interestingly, an inverse relationship between IR and IGF1R expression was observed in these two subtypes.

In this study, TRIP-Br1-mediated high IR/IGF1R ratio was found to enable proliferation and survival of breast cancer cells. In addition to our study on the importance of the IR/IGF1R ratio in breast cancer research, our results can be extended to other types of cancer. Therefore, we investigated the effect of TRIP-Br1-mediated IR/IGF1R ratio on the survival time of patients with other types of cancer in addition to breast cancer patients using the TCGA (Cancer Genome Atlas) database. The survival time of patients with three types of cancer at two different stages (stages i-ii and iii-x) was analyzed based on the mRNA levels of TRIP-Br1, IGF1R and IR in the TCGA database. As a result of our bioinformatics analysis, TRIP-Br1 was found to be positively correlated with the IR/IGF1R ratio and inversely correlated with the survival time of breast cancer patients (n=152). However, no significant relationship with lung (n=396) or liver cancer (n=130) was observed (Figure 8A, B, C). This indicates that TRIP-Br1 is a breast cancer-specific oncogenic adapter protein. In our bioinformatics analysis, we found that TRIP-Br1 can shorten the survival period of breast cancer patients by increasing the IR/IGF1R ratio, but not in lung cancer and liver cancer patients.

In conclusion, we identified the regulatory mechanism of the IR/IGF1R ratio and showed that the higher the TRIP-Br1-mediated IR/IGF1R ratio, the higher the survival rate of breast cancer cells and the worse the prognosis of cancer patients. Therefore, the TRIP-Br1-mediated IR/IGF1R ratio can be useful as a factor predicting the prognosis and progression of cancer.

Although the exemplary embodiments of the present application have been described in detail above, the scope of the rights of the present application is not limited thereto, and various modifications and improvements made by those skilled in the art using the basic concept of the present application defined in the following claims are also included in the scope of the rights of the present application. belongs to

All technical terms used in the present invention, unless otherwise defined, are used with the same meaning as commonly understood by a person skilled in the art in the field related to the present invention. The contents of all publications incorporated by reference herein are hereby incorporated by reference.

Claims (5)

To provide information on predicting the development of breast cancer in diabetic patients, TRIP-Br1 (Transcriptional regulator interacting with the PHD-bromodomain 1), IR (Insulin Receptor), and IGF1R (Insulin-like growth factor-1) of breast cells were tested in vitro. A method of detecting the expression level of receptor), the method is
Providing cells derived from breast tissue of a diabetic patient;
Measuring the expression levels of TRIP-Br1, IR and IGF1R in the cells;
Determining the IR/IGF1R expression level ratio of the cells from the measurement results; and
When the TRIP-Br1 expression level and the IR/IGF1R ratio are increased compared to the control group, determining that the probability of developing breast cancer in the diabetic patient is increased, the control group is cells derived from breast tissue of a non-diabetic patient, and the IR The increase in the /IGF1R ratio is due to an increase in the IR expression level compared to the control group, a decrease in the IGF1R expression level compared to the control group, and the diabetic patient has never previously developed breast cancer. Method for detecting the expression levels of TRIP-Br1, IR, and IGF1R proteins in cells.
In order to provide information on the prognosis of diabetic patients with breast cancer, the method detects the expression levels of TRIP-Br1, IR, and IGF1R proteins in breast cancer cells in vitro.
Providing breast cancer cells from a diabetic patient who has developed breast cancer;
Measuring the expression levels of TRIP-Br1, IR, and IGF1R in the cells;
Determining the IR/IGF1R expression level ratio of the cells from the measurement results; and
When the TRIP-Br1 expression level and IR/IGF1R ratio are increased compared to the control group, determining that the prognosis for breast cancer of the diabetic patient is poor, wherein the control group is breast cells in which the patient has not developed cancer. The increase in the IR/IGF1R ratio is due to an increase in the IR expression level compared to the control group and a decrease in the IGF1R expression level compared to the control group. Expression of TRIP-Br1, IR and IGF1R proteins in breast cancer cells in vitro. How to detect quantity.
The method of claim 1 or 2, wherein the diabetes is type 1 or type 2 diabetes, and the expression level of TRIP-Br1, IR and IGF1R proteins in breast cancer cells in vitro.
A composition for predicting the occurrence of breast cancer in diabetic patients, comprising a substance for detecting TRIP-Br1, IR, and IGF1R. A kit for predicting the occurrence of breast cancer in diabetic patients, containing substances for detection of TRIP-Br1, IR, and IGF1R.