KR102604849B1 - Minicircle vector expressing anti-cd25 antibody, il-10 and cxcr3 - Google Patents

Abstract

The present invention relates to the use of minicircle vectors expressing anti-CD25 antibody, IL-10 and CXCR3 to treat transplant rejection, and the minicircle vectors of the present invention are fused with anti-CD25 antibody/IL-10/CXCR3 in vivo. By expressing antibodies, it is possible to reduce development costs compared to existing biological immunosuppressants, and the anti-CD25 antibody, which is a combination of IL-10 and CXCR3 expressed therefrom, promotes cell migration during transplantation and suppresses non-specific immunity. By compensating for the shortcomings in effectiveness, it balances immune tolerance and has a more effective treatment effect on various transplant rejection diseases.

Description

MINICIRCLE VECTOR EXPRESSING ANTI-CD25 ANTIBODY, IL-10 AND CXCR3}

The present invention relates to the use of minicircle vectors expressing anti-CD25 antibodies, IL-10 and CXCR3 in the treatment of transplant rejection.

The immune system must be able to distinguish between self and non-self. If it cannot distinguish between self and non-self, the immune system destroys the body's cells and tissues, resulting in autoimmune diseases. Regulatory T cells actively suppress the activation of the immune system, preventing pathological self-reactivity and consequently autoimmune diseases. Regulatory T cells (Treg) are a class of CD4 ⁺ CD25 ⁺ T cells that suppress the activity of other immune cells. The immune system is well-equipped to quickly identify and rapidly destroy foreign organisms, germs, or inflamed tissue. This has been a major barrier to tissue, organ and cell transplantation, as well as gene therapy. The major problems were generally chronic immunosuppression, encapsulation, and immune sequestration. Unwanted side effects of chronic immunosuppression include increased susceptibility to opportunistic infections and tumor formation.

The mechanisms by which T cell responses against foreign (homogeneous or xenogeneic) proteins or cells or organs act are fairly well known. Antigen-presenting cells (APCs) are attracted to sites of inflammation or injury (triggered by transplant surgery), and the peripheral T cell repertoire constantly monitors the presence of foreign tissues (allogeneic or xenogeneic) or pathogens. Once these warning signals are recognized, APCs engulf the protein, digest it, and present it to the host's immune system. Allogeneic or syngeneic tumor cells were engineered to express viral IL-10, which induced a local immune response against the tumor, but this treatment had no effect on rejection of non-transgenic tumors at a distant site (Suzuki et al., 1995). Topically administered IL-10 is thought to change the T cell repertoire reactive to transplanted cells to a Th2 phenotype that is not cytolytic and may even be protective.

Organ, tissue or cell transplants can be used to save the lives of patients suffering from a variety of diseases. Allotransplantation of organs such as human kidneys, liver, heart, kidney, lung and pancreas, tissues such as skin, and cells such as bone marrow is already commonly performed in hospitals as a method of treating incurable diseases such as end-stage organ failure. . In addition, xenotransplantation using mammals other than humans as donors is also being actively studied as a method to replace the shortage of allograft donors. In particular, recently, transplantation of stem cells, which can permanently regenerate themselves and differentiate into various types of cells that make up the body under appropriate conditions, has emerged as one of the cell replacement treatments for various intractable diseases. According to the National Organ Transplant Center, approximately 20,000 patients in Korea are waiting for organ transplants each year, but the number of donations is reported to be less than 10% of the demand. Additionally, in the United States, the number of people on the waiting list in need of organs increases at a rate of one every 16 minutes, but 11 people on the waiting list die each day before receiving surgery. In addition to this situation, the development of life science and technology serves as the background for the development of xenograft transplantation technology. In 2010, a total of 28,664 transplants were performed in the United States, including 16,899 kidneys, 6,291 livers, 2,333 hearts, and 1,770 lungs. was performed (Engels et al., 2011, JAMA, 306(17):1891-1901). Although significant improvements have been made in immunosuppressive therapy and pre- and post-transplant patient care, graft rejection still affects approximately 60% of transplanted individuals, and thus graft rejection occurs in less than 40% of transplanted individuals within the first year after transplantation. It is a risk factor for multiple graft loss along with the observation of graft rejection (Jain et al., 2000, Ann Surg. 232(4):490-500). Acute rejection is also a known risk factor for progression to chronic rejection and therefore detection and treatment of acute rejection episodes as early as possible is a primary goal to minimize graft damage and arrest downstream rejection episodes. In most cases, the adaptive immune response to the transplanted tissue is a major obstacle to successful transplantation. Rejection is caused by an immune response to alloantigens on the graft, which are proteins that vary across individuals within a species and are therefore recognized as foreign by the recipient (Janeway, et al., 2001, Immunobiology: The Immune System in Health and Disease. 5th edition. New York: Garland Science).

Over the past decade, advances in surgical techniques, immunosuppressive therapy, and infectious monitoring and treatment have revolutionized patient and graft survival. However, despite these successes, transplant recipients still exhibit much higher rates of morbidity and mortality than the general population. This is partly due to the effects of chronic allograft injury, but the main cause is comorbidity affected by chronic immunosuppressive drug use (Soulillou and Giral 2007, Transplantation 72 (Suppl 12): S89-93, Hourmant et al., 1998, Lancet 351: 623-628; Halloran, 2004, N Engl J Med 351: 2715-2729).

Immunosuppression-related toxicities may be significant. For example, in adult liver transplant recipients, multiple studies have demonstrated a time-dependent sequential decline in renal function following exposure to immunosuppressive therapy. Other important complications of long-term immunosuppression include new onset diabetes mellitus after transplantation (NODAT), hypertension, hyperlipidemia, and the need for statin therapy (Srinivas et al., 2008, CJASN: (Supplement 2) S101-S116]). . To correct this situation, research priorities in organ transplantation are shifting from the search for new potent immunosuppressive drugs to strategies to minimize immunosuppression and to ensure that transplanted tissue is maintained for long periods of time without persistent immunosuppression. It is becoming a goal.

Meanwhile, the IL-2 receptor has three types: (1) IL-2RA, a low-affinity receptor that does not signal; (2) an intermediate affinity receptor (IL-2Rαβγ) consisting of IL-2RB and IL-2RG, widely expressed on conventional T cells (Tcon), NK cells, eosinophils, and monocytes; and (3) as a high-affinity receptor (IL-2Rαβγ) consisting of IL-2RA, IL-2RB, and IL-2RG, transiently expressed on activated T cells and constitutively expressed on Treg cells. Additionally, interleukin-10 (IL-10), initially known as cytokine synthesis inhibitory factor or CSIF, is a potent immunomodulator of hematopoietic cells, especially immune cells. Cells such as activated Th2 cells, B cells, keratinocytes, monocytes and macrophages produce IL-10 (Moore et al., Annu. Rev. Immunol. 11:165 (1993)). IL-10 inhibits the activation and effector functions of a number of cells, including T cells, monocytes, and macrophages. In particular, IL-10 inhibits cytokine synthesis, including the synthesis of IL-1, IFN-γ, and TNF, by cells such as Th1 cells, natural killer cells, monocytes, and macrophages (Fiorentino et al., J. Exp. Med., 170:2081-2095 (1989); Fiorentino et al., J. Immunol. 146:3444 (1991); Hsu et al., Int. Immunol. 4:563 (1992); Hsu et al. al., Int. Immunol. 4:563 (1992); D'Andrea et al., J. Exp. Med. 178:1041 (1993); de Waal Malefyt et al., J. Exp. Med. 174:915 (1991); Fiorentino et al., J. Immunol. 147:3815 (1991)). In addition, C-X-C motif chemokine receptor 3 (CXCR3) is a chemokine receptor primarily expressed on antigen-experienced (memory), effector, and activated T cells, and regulates these T cell subsets with its primary ligands CXCL9 (MIG), CXCL10 (IP-10) ), and is involved in recruiting to sites of tissue inflammation in response to CXCL11 (ITAC). CXCR3 and CXCL10 are expressed in human T1D patients (Uno et al., Endocr J 57: 991-96 (2010); Roep et al., Clin Exp Immunol 159: 338-43 (2003); Tanaka et al., Diabetes 58: 2285-2291 (2009)).

The object of the present invention is to provide a pharmaceutical composition for inhibiting transplant rejection.

Additionally, an object of the present invention is to provide an anti-CD25 antibody or fragment thereof having immunological activity combined with IL-10 and CXCR3.

Additionally, an object of the present invention is to provide an antibody composition for inhibiting transplant rejection.

Additionally, an object of the present invention is to provide a method for producing a minicircle vector for suppressing transplant rejection.

Additionally, an object of the present invention is to provide a method for producing an anti-CD25 antibody combining IL-10 protein and CXCR3 protein.

To achieve the above object, the present invention provides a pharmaceutical composition for inhibiting transplant rejection, comprising a first minicircle vector and a second minicircle vector as active ingredients.

Additionally, the present invention provides an anti-CD25 antibody bound to IL-10 and CXCR3, or a fragment thereof with immunological activity.

Additionally, the present invention provides an antibody composition for inhibiting transplant rejection comprising the antibody or an immunologically active fragment thereof as an active ingredient.

Additionally, the present invention provides a method for producing a minicircle vector for suppressing transplant rejection.

In addition, the present invention provides a method of producing an anti-CD25 antibody bound to IL-10 protein and CXCR3 protein.

According to the present invention, the minicircle vectors of the present invention can reduce development costs compared to existing biological immunosuppressants by expressing a fusion antibody of anti-CD25 antibody/IL-10/CXCR3 in the body, and IL expressed therefrom Anti-CD25 antibody, which is a combination of -10 and CXCR3, promotes cell migration during transplantation and balances immune tolerance by compensating for the shortcomings of non-specific immunosuppressive effects, making it more effective in treating various transplant rejection diseases. .

Figure 1 is a schematic diagram showing the structure of MTA (anti-CD25HC-IL-10-CXCR3 and anti-CD25LC) that simultaneously targets CD25, IL-10, and CXCR3 (CXC motif chemokine receptor 3).
Figure 2 is a diagram showing the process of producing a minicircle vector.
Figure 3 is a diagram comparing and confirming the produced minicircle vector with the parent plasmid:
A: Gel electrophoresis data of NheI- and BamHI-treated PP;
B: Gel electrophoresis data of PP before and after arabinose induction;
C: Gel electrophoresis data of NheI- and BamHI-treated MCs;
Arrow: insert;
PP: parent plasmid; and
MC: Minicircle plasmid.
Figure 4 is a diagram confirming minicircle vector-derived MTA in vitro :
A: Expression of minicircle vector confirmed by RFP expression;
B to D: Expression of each protein of MTA confirmed by ELISA;
MTA: multiple target-directed agent; and
MC: minicircle plasmid DNA (minicircle vector).
Figure 5 is a diagram confirming minicircle vector-derived MTA in vivo :
A: In vivo images of mice injected with saline or mc-MTA;
B: LUC quantification from in vivo imaging;
C: RFP expression in mouse liver tissue 1 to 40 days after injection; and
LUC: luminescence.
Figure 6 is a diagram showing the results of MTA detection in mouse plasma using ELISA:
A to C: Concentrations of anti-CD25, IL-10, and CXCR3 in plasma of mice injected with mc-mock or mc-MTA; and
D to F: Concentrations of anti-CD25, IL-10, and CXCR3 in mouse plasma 3 days after pp-MTA or mc-MTA injection.
Figure 7 is a diagram confirming the cell migration promotion effect of MC encoding MTA:
A and B: Schematic diagram of cell migration assay;
C: Quantitative data on cell migration by CXCLs;
D: In vivo image of mc-MTA (LUC tag) in transplanted skin;
Arrow: LUC activity in mc-MTA treatment group; and
E: Section of mc-MTA (RFP tag) injected skin graft stained with anti-RFP antibody;
Figure 8 is a diagram confirming the survival rate for allogeneic skin transplant rejection in mice injected with a minicircle vector encoding MTA:
A and B: Survival curves and mean survival time for mc-mock, mc-DTA, or mc-MTA treatment groups;
C: Histological changes on day 5 of allogeneic skin transplantation; and
DTA: dual target-directed agent.
Figure 9 is a diagram confirming the effect of MC treatment encoding MTA on pro-inflammatory T cells and regulatory T cells.
Figure 10 is a diagram confirming the survival rate for allogeneic skin transplant rejection in mice by combined treatment with tacrolimus (Tac) and minicircle vector:
A: Drug processing schedule;
B and C: Survival curve and mean survival time; and
D: Histological changes on day 5 of allogeneic skin transplantation.
Figure 11 is a diagram confirming the effect of combined treatment of tacrolimus and minicircle vector on pro-inflammatory T cells and regulatory T cells in an allogeneic skin transplant mouse model.

Hereinafter, the present invention will be described in detail through embodiments of the present invention with reference to the attached drawings. However, the following embodiments are provided as examples of the present invention, and if it is judged that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , the present invention is not limited thereby. The present invention is capable of various modifications and applications within the description of the claims described below and the scope of equivalents interpreted therefrom.

In addition, the terminology used in this specification is a term used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator or the customs of the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part is said to “include” a certain element, this means that it may further include other elements rather than excluding other elements, unless specifically stated to the contrary.

All technical terms used in the present invention, unless otherwise defined, are used with the same meaning as commonly understood by a person skilled in the art in the field related to the present invention. In addition, preferred methods and samples are described in this specification, but similar or equivalent methods are also included in the scope of the present invention. The contents of all publications incorporated herein by reference are hereby incorporated by reference.

Throughout this specification, the usual one- and three-letter codes for naturally occurring amino acids are used, as well as generally acceptable codes for other amino acids such as Aib (α-aminoisobutyric acid), Sar (N-methylglycine), etc. A three-character code is used. Additionally, amino acids referred to by abbreviations in the present invention are described according to the IUPAC-IUB nomenclature as follows:

Alanine: A, Arginine: R, Asparagine: N, Aspartic Acid: D, Cysteine: C, Glutamic Acid: E, Glutamine: Q, Glycine: G, Histidine: H, Isoleucine: I, Leucine: L, Lysine: K, Methionine : M, phenylalanine: F, proline: P, serine: S, threonine: T, tryptophan: W, tyrosine: Y and valine: V.

In one aspect, the present invention provides a first minicircle vector comprising an anti-CD25 (anti-CD25) antibody heavy chain gene, an interleukin-10 (IL-10) gene, and a C-X-C motif chemokine receptor 3 (CXCR3) gene; and a second minicircle vector containing an anti-CD25 antibody light chain gene as an active ingredient. The present invention relates to a pharmaceutical composition for inhibiting transplant rejection.

In one embodiment, the first minicircle vector may include the polynucleotide of SEQ ID NO: 1 in which the anti-CD25 antibody heavy chain gene, IL-10 gene, and CXCR3 gene are operably linked.

In one embodiment, the second minicircle vector may include the polynucleotide of SEQ ID NO:2.

In one embodiment, the anti-CD25 antibody heavy chain/IL-10/CXCR3 fusion protein and the anti-CD25 light chain expressed in the two minicircle vectors are combined in vivo to form an anti-CD25 antibody to which the IL-10 protein and the CXCR3 protein are bound. Antibodies can be formed (Figure 1).

In one embodiment, the pharmaceutical composition for inhibiting transplant rejection of the present invention includes an anti-CD25 antibody heavy chain containing the amino acid sequence of SEQ ID NO: 3, a fusion protein of IL-10 and CXCR3; and an anti-CD25 antibody bound to IL-10 and CXCR3, including an anti-CD25 antibody light chain containing the amino acid sequence of SEQ ID NO: 4, or a fragment thereof with immunological activity.

In one embodiment, the composition of the present invention may further include another immunosuppressant, and the immunosuppressant may be tacrolimus.

In one embodiment, the composition of the present invention can be administered simultaneously, separately, or sequentially with other immunosuppressants.

In one embodiment, the transplant rejection may be rejection of one or more types of transplant selected from the group consisting of cells, blood, tissues, and organs.

In one embodiment, the transplant rejection may be one or more types selected from the group consisting of rejection of bone marrow transplant, heart transplant, corneal transplant, intestinal transplant, liver transplant, lung transplant, pancreas transplant, kidney transplant, and skin transplant.

In the present invention, the polynucleotide of SEQ ID NO: 1 encoding the heavy chain/IL-10/CXCR3 fusion protein of the anti-CD25 antibody is a polypeptide encoding the heavy chain of the anti-CD25 antibody, encoding the IL-10 protein. There is an in-frame genetic linkage of the polynucleotide encoding the CXCR3 protein and the polynucleotide encoding the CXCR3 protein, so that during transcription/translation, the IL-10 protein and the CXCR3 protein are linked in sequence to the C-terminus of the heavy chain of the anti-CD25 antibody. A “fusion protein” is created. “Operably connected” is intended to mean a functional connection between two or more elements. For example, an operable linkage between three polypeptides fuses the three polypeptides together in frame to create a single polypeptide fusion protein. In certain aspects, the fusion protein may further comprise a fourth polypeptide, which may further comprise a linker sequence.

As used herein, the term “CD25” refers to any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats) and, unless otherwise indicated, livestock or agricultural mammals. refers to any native or recombinant CD25 from. The term also includes naturally occurring variants of CD25, such as splice variants or allelic variants or non-naturally occurring variants. Human IL-2 exerts its biological effects through signaling through its receptor system, CD25 (IL-2R).

When preparing the expression cassette included in the minicircle vector of the present invention, various polynucleotides can be manipulated to provide the polynucleotide sequence in an appropriate orientation and, if appropriate, in an appropriate reading frame. For this purpose, adapters or linkers may be used to link polynucleotides or manipulations may be involved to provide convenient restriction sites, removal of unnecessary DNA, removal of restriction sites, etc. For example, a linker, such as two glycines, can be added between polypeptides. Methionine residues encoded by the atg nucleotide sequence can be added to allow initiation of gene transcription. This may include in vitro mutagenesis, primer recovery, restriction, annealing, re-substitution, such as transitions and transversions.

The polynucleotide encoding the anti-CD25 antibody heavy chain/IL-10/CXCR3 fusion protein of the present invention has a coding region due to codon degeneracy or in consideration of the preferred codon in the organism in which the antibody is to be expressed. Various modifications can be made to the coding region as long as they do not change the amino acid sequence of the antibody expressed from the antibody, and various modifications or modifications can be made to parts other than the coding region as long as they do not affect gene expression. Those skilled in the art will understand that such modified genes are also included within the scope of the present invention. That is, as long as the polynucleotide of the present invention encodes a protein with equivalent activity, one or more nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included within the scope of the present invention. The sequence of these polynucleotides may be single or double stranded, and may be DNA molecules or RNA (mRNA) molecules.

The "minicircle vector" or "minicircle DNA" of the present invention refers to a circular DNA having an antibody or genetically engineered antibody gene expression cassette, wherein the expression cassette is expressed as an antibody by the gene sequence of the signal peptide and/or the gene sequence of the tag. or a promoter operably linked to the genetically engineered antibody gene. In one embodiment, the minicircle vector of the present invention may include a CMV7 promoter, an antibody or genetically engineered antibody gene, an EF1 promoter, a reporter gene, polyA tailing, and attR.

In one aspect, the invention provides a fusion protein of anti-CD25 antibody heavy chain, IL-10 and CXCR3; and an anti-CD25 antibody bound to IL-10 and CXCR3, including an anti-CD25 antibody light chain, or a fragment thereof with immunological activity.

In one embodiment, the fusion protein of the anti-CD25 antibody heavy chain, IL-10, and CXCR3 may comprise the amino acid sequence of GGGGSGGGGSGGGGS as a linker between the anti-CD25 antibody heavy chain and IL-10, and between the IL-10 and CXCR3. As a linker, it may contain the amino acid sequence of GGGGSGGGGS.

In one embodiment, the fusion protein of the anti-CD25 antibody heavy chain, IL-10, and CXCR3 may comprise the amino acid sequence of SEQ ID NO:3, and the anti-CD25 antibody light chain may comprise the amino acid sequence of SEQ ID NO:4.

The anti-CD25 antibody of the present invention is an antibody used as a treatment for xenograft transplant rejection and is an antibody against CD25, the alpha chain of the IL-2 receptor on T cells. This antibody binds to CD25 on T cells and blocks IL-2 from binding and reacting to T cells, inhibiting the proliferation of T cells or eliminating activated T cells expressing CD25, thereby causing tissue transplant rejection by T cells. It is used to prevent. CD25 is expressed primarily on activated T cells, but also on activated B cells, some thymocytes, and promyeloid cells. Anti-CD25 antibodies have recently been used clinically to prevent destruction of CD4 + T and CD8 + T cell-dependent glioma cells.

The antibodies are in whole antibody form as well as functional fragments of the antibody molecule. A full antibody has a structure of two full-length light chains and two full-length heavy chains, and each light chain is connected to the heavy chain by a disulfide bond. A functional fragment of an antibody molecule refers to a fragment that possesses an antigen-binding function. Examples of antibody fragments include (i) the variable region (VL) of the light chain, the variable region (VH) of the heavy chain, the constant region (CL) of the light chain, and Fab fragment consisting of the first constant region (CH1) of the heavy chain; (ii) Fd fragment consisting of VH and CH1 domains; (iii) an Fv fragment consisting of the VL and VH domains of a single antibody; (iv) a dAb fragment consisting of a VH domain (Ward ES et al., Nature 341:544-546 (1989)); (v) an isolated CDR region; (vi) a bivalent fragment comprising two linked Fab fragments. F(ab')2 fragment; (vii) single chain Fv molecule (scFv) joined by a peptide linker that joins the VH domain and VL domain to form an antigen binding site; (viii) bispecific single chain Fv dimer (PCT/US92/09965) and (ix) diabody WO94/13804, which is a multivalent or multispecific fragment produced by gene fusion.

In the present invention, the antibody or immunologically active fragment thereof may be selected from the group consisting of animal-derived antibodies, chimeric antibodies, humanized antibodies, human antibodies, and immunologically active fragments thereof. The antibody may be recombinantly or synthetically produced.

In the present invention, “antibody” refers to a substance produced by stimulation of an antigen within the immune system, the type of which is not particularly limited, and can be obtained naturally or unnaturally (e.g., synthetically or recombinantly). You can. Antibodies are very stable not only in vitro but also in vivo and have a long half-life, making them advantageous for mass expression and production. In addition, antibodies inherently have a dimer structure, so their adhesion ability (avidity) is very high. A complete antibody has a structure of two full-length light chains and two full-length heavy chains, and each light chain is connected to the heavy chain by a disulfide bond. The constant region of an antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant region has gamma (γ), mu (μ), alpha (α), delta (δ), and epsilon (ε) types, and subclasses. It has gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1), and alpha 2 (α2). The constant region of the light chain has kappa (κ) and lambda (λ) types.

As used herein, the term "heavy chain" refers to a variable region domain V _H and three constant region domains C _H1 , C _H2 and C _H3 comprising an amino acid sequence with sufficient variable region sequence to confer specificity to an antigen. It is interpreted to include both the full-length heavy chain including the hinge and fragments thereof. Additionally, the term "light chain" refers to both a full-length light chain and fragments thereof comprising a variable region domain V _L and a constant region domain C _L comprising an amino acid sequence with sufficient variable region sequence to confer specificity to an antigen. It is interpreted to mean inclusive.

In the present invention, the term "specifically binds" or "specifically recognizes" has the same meaning commonly known to those skilled in the art, and means that an antigen and an antibody specifically interact to produce an immunological reaction. .

In the present invention, the term "fragment with immunological activity" refers to a fragment of the entire structure of an immunoglobulin and a portion of a polypeptide containing a portion to which an antigen can bind. For example, it may be scFv, (scFv) 2, scFv-Fc, Fab, Fab' or F(ab') 2, but is not limited thereto. Among the antigen-binding fragments, Fab has one antigen-binding site with a structure that includes the variable regions of the light and heavy chains, the constant region of the light chain, and the first constant region (C _H1 ) of the heavy chain. Fab' differs from Fab in that it has a hinge region containing one or more cysteine residues at the C-terminus of the heavy chain C _H1 domain. The F(ab') 2 antibody is produced when the cysteine residue in the hinge region of Fab' forms a disulfide bond. Fv is a minimal antibody fragment containing only the heavy chain variable region and the light chain variable region, and recombinant techniques for producing Fv fragments are widely known in the art. A two-chain Fv (two-chain Fv) is a non-covalent bond in which the heavy chain variable region and a light chain variable region are connected, while a single-chain Fv (single-chain Fv) is generally shared between the heavy chain variable region and the short chain variable region through a peptide linker. They can be connected by a bond or directly connected at the C-terminus to form a dimer-like structure, such as double-chain Fv. The linker may be a peptide linker consisting of 1 to 100 or 2 to 50 amino acids, and suitable sequences are known in the art. The antigen-binding fragment can be obtained using a proteolytic enzyme (for example, Fab can be obtained by restriction digestion of the entire antibody with papain, and F(ab') 2 fragment can be obtained by digestion with pepsin), It can be produced through genetic recombination technology.

The antibody according to the present invention can be mass-produced by transforming the first minicircle vector and the second minicircle vector according to the present invention into appropriate host eukaryotic cells and then culturing the transformed host cells. Appropriate culture methods and medium conditions depending on the type of host cell can be easily selected by a person skilled in the art from known techniques known to those skilled in the art. The host cell may be a eukaryotic cell derived from yeast such as Saccharomyces cerevisiae , insect cells, plant cells, or animal cells. Any method known to those skilled in the art may be used to introduce the expression vector into the host cell.

The antibody or fragment thereof of the present invention can be produced using various phage display methods known in the art [Brinkman et al., 1995, J. Immunol. Methods, 182:41-50]; [Ames et al., 1995, J. Immunol. Methods, 184, 177-186]; [Kettleborough et al. 1994, Eur.J. Immunol, 24, 952-958]; [Persic et al., 1997, Gene, 187, 9-18]; and [Burton et al., 1994, Advances in Immunol, 57, 191-280]; WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; and WO 95/20401; and US 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743; and those disclosed in 5,969,108.

Other organisms, including transgenic (e.g., genetically engineered) mice, or other mammals, can be used to produce antibodies to which the proteins of the invention are bound (see, for example, US 6,300,129). For example, only the variable regions of mouse immune genes (heavy chain V, D, and J segments, and light chain V and J segments) are replaced with the corresponding human variable sequences, so that engineered mice produce high-affinity antibodies with human variable sequences. It is known that they can be used for mass production (see, for example, US 6,586,251; US 6,596,541, and US 7,105,348).

The pharmaceutical composition of the present invention may further include a known immunosuppressant or transplant rejection inhibitor as an active ingredient in addition to the first minicircle vector and the second minicircle vector, or an antibody or fragment thereof expressed from the vectors. , can be combined with other known treatments for the treatment associated with these transplant rejection diseases.

In the present invention, the term "transplant rejection inhibition" refers to all preventive actions and transplant rejection that suppress or delay the occurrence, spread, and recurrence of transplant rejection or immunity induced by transplantation by administration of the pharmaceutical composition according to the present invention. It refers to any treatment that improves or beneficially changes the symptoms of any disease caused by a reaction. Anyone with ordinary knowledge in the technical field to which the present invention pertains can refer to the data presented by the Korean Medical Association, etc. to know the exact criteria for diseases for which our composition is effective and to determine the degree of improvement, improvement, and treatment. will be.

The term "therapeutically effective amount" used in combination with an active ingredient in the present invention refers to an amount effective in preventing or treating diseases caused by transplant rejection, and the therapeutically effective amount of the composition of the present invention is determined by several factors, including: For example, it may vary depending on the administration method, target area, and patient's condition. Therefore, when used in the human body, the dosage must be determined as appropriate by considering both safety and efficiency. It is also possible to estimate the amount used in humans from the effective amount determined through animal testing. These considerations in determining an effective amount include, for example, Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and E.W. Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. As used in the present invention, the term "pharmaceutically effective amount" refers to an amount that is sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level is determined by the patient's Factors including health status, type and severity of transplant, activity of drug, sensitivity to drug, method of administration, time of administration, route of administration and excretion rate, duration of treatment, drugs combined or used simultaneously, and other factors well known in the field of medicine. It can be decided depending on The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.

The pharmaceutical composition of the present invention may contain a carrier, diluent, excipient, or a combination of two or more commonly used in biological products. As used in the present invention, the term “pharmaceutically acceptable” means that the composition exhibits non-toxic properties to cells or humans exposed to the composition. The carrier is not particularly limited as long as it is suitable for in vivo delivery of the composition, for example, Merck Index, 13th ed., Merck & Co. Inc. The compounds described in, saline solution, sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these ingredients can be mixed and used, and if necessary, other ingredients such as antioxidants, buffers, and bacteriostatic agents. Normal additives can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate dosage forms such as aqueous solutions, suspensions, emulsions, etc., into pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or ingredient using an appropriate method in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

In one embodiment, the pharmaceutical composition may be one or more formulations selected from the group including oral formulations, topical formulations, suppositories, sterile injectable solutions, and sprays, with oral or injectable formulations being more preferable.

As used in the present invention, the term "administration" means providing a predetermined substance to an individual or patient by any appropriate method, and is administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally) according to the desired method. Alternatively, it can be applied topically as an injection formulation) or orally administered, and the dosage range varies depending on the patient's weight, age, gender, health status, diet, administration time, administration method, excretion rate, and severity of the disease. Liquid preparations for oral administration of the composition of the present invention include suspensions, oral solutions, emulsions, syrups, etc., and in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives are used. etc. may be included together. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. The pharmaceutical composition of the present invention may be administered by any device capable of transporting the active agent to target cells. Preferred administration methods and formulations include intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, and drip injection. Injections include aqueous solvents such as physiological saline solution and Ringer's solution, non-aqueous solvents such as vegetable oil, higher fatty acid esters (e.g., ethyl oleate, etc.), and alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.). It can be manufactured using stabilizers to prevent deterioration (e.g., ascorbic acid, sodium bisulfite, sodium pyrosulphite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers for pH adjustment, and agents to prevent microbial growth. It may contain pharmaceutical carriers such as preservatives (e.g., phenylmercuric nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.).

As used in the present invention, the term "individual" refers to a monkey, cow, horse, sheep, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, or This refers to all animals, including guinea pigs, and the transplant rejection reaction or diseases caused by transplant rejection can be effectively prevented or treated by administering the pharmaceutical composition of the present invention to the subject. The pharmaceutical composition of the present invention can be administered in combination with existing therapeutic agents.

The pharmaceutical composition of the present invention may further include pharmaceutically acceptable additives, wherein the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, and calcium hydrogen phosphate. , lactose, mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, lead carnauba, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, Calcium stearate, white sugar, dextrose, sorbitol, and talc may be used. The pharmaceutically acceptable additive according to the present invention is preferably contained in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.

In one aspect, the present invention relates to an antibody composition for inhibiting transplant rejection, comprising as an active ingredient an antibody expressed and assembled from the first minicircle vector and the second minicircle vector, or a fragment thereof with immunological activity. .

In one aspect, the invention relates to a parent plasmid comprising an anti-CD25 antibody heavy chain/IL-10/CXCR3 fusion gene expression cassette or an anti-CD25 antibody light chain gene expression cassette.

In one embodiment, the parent plasmid completes the recombination process of minicircle DNA in the host strain to exclude prokaryotic plasmid elements, thereby producing the first and second minicircle vectors of the present invention (FIG. 2).

In one aspect, the present invention includes the steps of inserting a polynucleotide containing the base sequence of SEQ ID NO: 1 into a first parent plasmid containing the base sequence of SEQ ID NO: 5; Inserting a polynucleotide containing the base sequence of SEQ ID NO: 2 into a second parent plasmid containing the base sequence of SEQ ID NO: 5; Transforming the first parent plasmid and the second parent plasmid prepared in steps 1) and 2) into a host cell; Treating host cells with a minicircle inducing combination; and a method of producing a minicircle vector for suppressing transplant rejection, comprising the step of purifying the minicircle vector.

In one embodiment, the parent plasmids can be transformed into host cells separately or simultaneously.

In one embodiment, the formulation for inducing minicircles may include arabinose.

In one embodiment, the host cell transformed with the parent plasmid may be E. coli.

In one aspect, the present invention includes the steps of transforming the first minicircle vector and the second minicircle vector of the present invention into a host cell; Culturing host cells; and a method of producing an anti-CD25 antibody bound to IL-10 protein and CXCR3 protein, including the step of isolating the antibody from host cells.

In one embodiment, the anti-CD25 antibody bound to the IL-10 protein and the CXCR3 protein may include the amino acid sequence of SEQ ID NO: 3 and the amino line sequence of SEQ ID NO: 4.

The present invention will be described in more detail through the following examples. However, the following examples are only for illustrating the content of the present invention and are not intended to limit the present invention.

Example 1. Construction of a minicircle vector expressing multiple target-directed agent (MTA)

1-1. Construction of minicircle vector expressing triple-specific fusion protein

To construct a minicircle vector expressing the fusion protein MTA (anti-CD25HC-IL-10-CXCR3 and anti-CD25LC) of Figure 1, which simultaneously targets CD25, IL-10, and CXCR3 (C-X-C motif chemokine receptor 3). , the nucleotide sequence of the anti-CD25 heavy chain (HC) and the nucleotide sequence of the anti-CD25 light chain (LC) (Table 1) attached to the 3'-end of the sequence encoding IL-10 and the CXCR3 sequence, respectively, were cloned from the parental plasmid. plasmid, PP) was subcloned into pMC.EF1-MCS-T2A-RFP (or LUC)-SV40 PolyA (pp-anti-CD25HC-IL-10-CXCR3 and pp-anti-CD25LC). 1 μg of DNA from the two parental plasmids was introduced together into competent cells (ZYCY10P3S2T) using heat shock transformation. Competent cells into which DNA was introduced were subjected to S.O.C. After adding the medium and cultivating with agitation at 37°C at 220rpm for 1 hour, 100 μl of this was plated on an LB plate containing kanamycin (Lysogeny Broth agar plate) and cultured at 37°C overnight. Select one of the colonies formed on the LB plate and inoculate it into LB liquid medium (5 ml) containing kanamycin. After culturing with agitation at 37°C and 200 rpm for 8 hours, it was inoculated into TB (Terrific Broth) medium (900 ml) containing kanamycin. The cells were inoculated and expanded overnight under the same conditions. The next day, this was mixed with LB liquid medium (900 ml) (minicircle induction mix) containing 1 N NaOH (36 ml) and 20% L-arabinose (900 μl) and incubated at 200 rpm at 30°C. Agitated culture was performed for 5 hours. After incubation, cells were collected by centrifugation at 7000 rpm for 15 minutes at 4°C and fused with anti-CD25/IL-10/CXCR3 using Nucleobond Xtra Midi kit (Macherey-nagel, Cat #REF 740410.50.) Minicircle vectors encoding proteins (mc-anti-CD25HC-IL-10-CXCR3 and mc-anti-CD25LC) were extracted (Figure 2).

nucleotide Sequence (5'->3') sequence number Anti-CD25HC
/IL-10/CXCR3 CATGGCAACCATGGGTTGGAGTTACATAATACTGTTTTTGGTGGCGACCGCAGCGGACGTCCATTCCCAATTGCAACAGTCCGGCACAGTTCTGGCCAGGCCTGGAGCCAGTGTGAAAATGTCCTGTAAAGCCAGCGGTTACTCATTTACACGATACTGGATGCACTGGATTAAGCAACGGCCCGGTCAAGGCTTGGAGTGGATCGGGGCGATTTACCCCGGTAACTCAGACACGTCATATAACCAAAAGTTTGAAGGT AAGGCTAAGCTGACTGCTGTCACATCAGCAAGTACTGCATATATGGAGCTGAGTAGTTTGACCCACGAAGACTCAGCAGTATACTACTGCTCCCGAGATTATGGCTACTATTTTGACTTCTGGGGTCAGGGGACGACGCTCACGGTTAGCTCTGCAAGTACCAAAGGTCCAAGTGTCTTTCCTCTCGCCCCCTCCAGTAAGAGTACTAGTGGCGGAACTGCGGCTCTCGGTTGCCTCGTAAAGGACTACTTCCCGGAACC GGTCACGGTCTCATGGAACTCTGGGGCGTTGACCTCCGGCGTTCACACCTTTCCGGCCGTACTGCAATCTAGTGGACTCTACTCTCTCTCAGTAGTGTCGTCACGGTTCCCTCCAGCTCCCTGGGCACACAGACTTATATATGCAACGTAAACCATAAGCCATCAAATACTAAGGTCGATAAAAGAGTGGAGCCCCCAAAAAGTTGCGATAAGACTCACACTTGCCCGCCATGCCCAGCGCCTGAGCTTTTGGGAGGTCCAT CAGTTTTTCTGTTTCCGCCAAAACCGAAGGACACACTGATGATCAGCCGGACTCCTGAGGTTACATGTGTCGTCGTTGATGTGTCTCACGAAGATCCCGAAGTAAAGTTCAATTGGTATGTAGATGGCGTAGAGGTACATAATGCTAAAACTAAACCGCGGGAAGAGCAATATAATTCCACATACAGAGTAGTTTCTGTGCTGACAGTACTTCATCAGGATTGGCTTAACGGCAAGGAGTATAAATGTAAAGTTTCAA ATAAAGCGTTGCCTGCGCCCATCGAGAAGACGATCAGCAAAGCGAAAGGACAGCCGAGAGAACCTCAAGTGTATACTCTCCCTCCTTCTCGGGACGAGCTTACTAAAAAACCAAGTCAGCCTCACCTGCCTGGTAAAGGGTTTCTATCCTTCTGATATAGCAGTAGAGTGGGAATCCAAATGGACAACCAGAGAATAACTATAAGACCACCCCTCCAGTACTTGATTCAGACGGTTCCTTTTTTCTGTATAGCAAACTTACTG TAGACAAGAGTAGGTGGCAACAAGGGAACGTGTTCTCTTGCTCAGTGATGCATGAAGCACTTCATAACCACTATACTCAAAAGAGCCTTTCACTGAGCCCAGGTAAGGGAGGGGGAGGTAGCGGCGGAGGAGGGAGTGGGGGCGGGGGCTCTAGCAGGGGGCAATATTCCAGGGAAGATAATAATTGTACTCATTTTCCCGTAGGCCAATCCCATATGCTGCTGGAGCTTCGAACCGCCTTTAGTCAGGTGAAAACTTTCTT TCAAACAAAAGACCAGTTGGACAACATTTTGCTTACCGACAGTCTTATGCAAGATTTCAAGGGATATCTTGGATGCCAAGCACTTAGTGAGATGATACAGTTTTACTTGGTTGAGGTAATGCCACAAGCTGAGAAGCACGGCCCAGAAATCAAGGAGCACCTCAACAGCTTGGGGGAAAAACTTAAAACACTGCGGATGCGACTGCGGAGGGTGCCATCGCTTCCTCCCCTGCGAAAACAAGTCTAAAGCCGTTGAGCAGGTG AAATCCGACTTTAATAAGCTCCAGGACCAGGGAGTATACAAGGCAATGAATGAATTCGACATCTTTATAAACTGCATTGAAGCATATATGATGATCAAGATGAAAAGTGGAGGAGGAGGGTCTGGCGGAGGAGGGTCAATGGTTCTCGAAGTCTCTGACCATCAGGTCCTTAATGATGCAGAGGTCGCAGCCCTTTTGGAGAACTTTTCTAGCTCTTATGATTATGGTGAAAATGAGTCAGATTCTTGTTGCACAAGCCCA CCTTGCCCCCAAGATTTCAGCTTGAACTTCGACAGGGGATCC One Anti-CD25LC GCTAGCATGGCCACCATGGGATGGAGCTATATCATCCTCTTTTTGGTGGCCACAGCGGCCGATGTCCACTCGCAGATTGTGTCTACACAGAGCCCCGCCATCATGAGCGCCTCTCCAGGCGAGAAAGTGACCATGACATGTAGCGCCAGCAGCAGCAGATCCTACATGCAGTGGTATCAGCAGAAGCCCGGCACAAGCCCCAAGAGATGGATCTACGATACCAGCAAGCTGGCCTCTGGCGTGCCAGCCAGATTTTCTGG CTCTGGCAGCGGCACCAGCTACAGCCTGACAATCTCTAGCATGGAAGCCGAGGACGCCGCCACCTACTACTGTCACCAGAGAAGCAGCTACACCTTCGGCGGAGGCACCAAGCTGGAAATCAAGAGAACAGTGGCCGCTCCGAGCGTGTTCATCTTTCCACCAAGCGACGAGCAGCTGAAGTCTGGCACAGCCTCTGTCGTGTGCCTGCTGAACAACTTCTACCCTCGGGAAGCCAAGGTGCAGTGGAAGGTGGA CAATGCCCTGCAGAGCGGCAATAGCCAAGAGAGCGTGACCGAGCAGGACAGCAAGGACTCTACCTACTCTCTGAGCAGCACCCTGACACTGAGCAAGGCCGACTACGAGAAGCACAAGGTGTACGCCTGTGAAGTGACACACCAGGGCCTGAGCAGCCCTGTGACCAAGAGCTTCAATAGAGGCGAGGGATCC 2

1-2. Confirm creation of minicircle vector

To the minicircle vector prepared in Example 1-1, BamHI, The production of minicircle vectors was compared and confirmed by electrophoresis on a 0.6% agarose gel with the sample. As a result, DNA sequences capable of expressing each protein drug (Anti-CD25HC/IL-10/CXCR3 and Anti-CD25LC) were subcloned into PP (Figure 3A), and the PP was transformed into a minicircle vector by L-araminose treatment. It was confirmed that the cells were properly converted to (MCs) (Figure 3B). In addition, it was confirmed that the insert was created in the correct size when cut with NheI and BamHI (Figure 3C)

Example 2. Minicircle vector in vitro Expression confirmation

In order to confirm whether the synthesis of the anti-CD25/IL-10/CXCR3 fusion protein was properly induced in the minicircle vector constructed in Example 1, it was confirmed in vitro using RFP introduced as a reporter gene. ^Specifically , 2 0.2 μg of minicircle DNA prepared in was added to 25 μl of opti-MEM, and 0.5 μl of Lipofectamine 2000 (invitrogen, Carlsbad, CA, USA) was added to 25 μl of opti-MEM and reacted at room temperature for 5 minutes. These two were reacted at room temperature for 20 minutes. Afterwards, the cells were treated with distributed HEK293T cells and cultured at 37°C for 16 hours, then replaced with growth medium, and RFP expression was confirmed 24 hours later. As a result, RFP was observed to be expressed in cells transfected with the minicircle vector (Figure 4A). Additionally, the culture medium of the transfected cells was collected, and the expression level of anti-CD25/IL-10/CXCR3 fusion protein was assessed by ELISA using plates coated with CD25, anti-IL10, and anti-CXCR3, respectively. , it was confirmed that anti-CD25, IL10, and CXCR3 were expressed in cells by transduction of the minicircle vector (Figures 4B to D).

Example 3. Anti-CD25/IL-10/CXCR3 fusion protein in vivo Expression confirmation

3-1. mini circle vector in vivo Expression confirmation

In order to confirm whether the minicircle (mc-MTA) is expressed in the body to produce an anti-CD25/IL-10/CXCR3 fusion protein (triple specific protein, MTA) and is persistent, mc, the minicircle vector of the present invention, -40 μg of anti-CD25HC-IL-10-CXCR3 and 40 μg of mc-anti-CD25LC were injected through the tail vein of BALB/c (Orient Bio Inc., Seongnam-si, Korea) male mice by hydrodynamic delivery. After 1 to 40 days, the mice were removed and luminescence was examined using an Optical in vivo Imaging System-IVIS Lumina XRMS (PerkinElmer, Waltham, MA, USA) equipment. As a result, RFP levels increased from 1 to 13 days after injection of the minicircle vector, and this increased expression persisted until day 40 (Figures 5A and B). In addition, as a result of evaluating RFP-positive cells in the liver tissue of mice injected with MC, RFP-expressing cells were detected at 13 days, and this expression persisted for 40 days, consistent with the in vivo imaging results (Figure 5C).

3-2. Anti-CD25/IL-10/CXCR3 in vivo Confirmation of secretion and expression

To confirm the expression and secretion of anti-CD25/IL-10/CXCR3 derived from mc-MTA, the minicircle vector of the present invention mc-anti-CD25HC-IL-, which produces anti-CD25/IL-10/CXCR3 fusion protein. 40 μg of 10-CXCR3 and 40 μg of mc-anti-CD25LC were injected by hydrodynamic delivery through the tail vein of BALB/c (Orient Bio Inc., Seongnam-si, Korea) male mice at 1, 7, and 30 days. Serum from mice was collected, and ELISA was performed for anti-CD25, IL-10, and CXCR3, respectively. First, in the case of anti-CD25, 100 μl of human CD25 (1 μg/ml; TONBO biosciences, San Diego, CA, USA) was dispensed into a 96-well plate, reacted overnight at room temperature, and the coated plate was washed the next day. And blocking was performed (1% BSA in PBS, pH 7.2-7.4, 0.2um filtered) to block non-specific reactions. Afterwards, 100 μl/well of Basiliximab (Simulect Injection; Novartis, Rotkreuz, Switzerland) used as a standard and serum collected from mice were dispensed and reacted at room temperature for 2 hours. After washing, the detection antibody, anti-hIgG-HRP (EMD Millipore Corporation, Temecula, CA, USA) was diluted at a ratio of 1:5,000 and treated at room temperature for 2 hours. After the final wash, the reaction mixture was reacted with TMB substrate solution (iNtRON Biotechnology, Inc., Seongnam-si, Korea) at room temperature for 20 minutes, then treated with a reaction stop solution (2 N H2SO4), and the absorbance was measured at 450 nm and 570 nm. In the case of IL-10, anti-mIL-10 (10 μg/ml; Peprotech, Rocky Hill, NJ, USA) was dispensed at 100 μl each, reacted at room temperature overnight, coated, washed the next day, and blocked in the same manner as above. Afterwards, recombinant mIL-10 (R&D systems Inc., Minneapolis, MN, USA) used as a standard and serum collected from mice were dispensed at 100 μl/well, reacted at room temperature for 2 hours, washed, and then incubated with the detection antibody. Anti-hIL10-biotinylated (0.4 μg/ml; R&D systems Inc.) was treated for 2 hours at room temperature. After additional washing, anti-steptavidin-HRP (R&D systems Inc.) was diluted at a ratio of 1:40 and reacted at room temperature for 20 minutes. After the final washing, the TMB substrate solution and reaction stop solution were treated in the same manner as above, and the reaction solution was incubated at 450 nm. and absorbance was measured at 570 nm. In the case of CXCR3, it was detected using the same method using anti-mCXCR3 (1 mg/ml; Novus Biologicals, Centennial, CO, USA) and recombinant mCXCR3 (MyBioScouce, San Diego, CA, USA). As a result, anti-CD25, IL-10, and CXCR3 were expressed in the serum of mice from the 7th day after injection of the MC of the present invention containing the DNA sequence of mc-MTA, and were maintained until the 30th day of injection (FIG. 6A to C). In addition, as a result of comparing the concentrations of anti-CD25, IL-10, and CXCR3 in each serum collected from the 3rd day after injection of pp-DTA or mc-MTA, the group injected with mc-MTA showed a significant difference in the group injected with pp-DTA. There was a significant increase in the concentrations of anti-CD25, IL-10, and CXCR3 compared to the group (Figures 6D-F).

Example 4. Promoting cell migration of minicircle vectors effect

4-1. in vitro Promotes cell migration

To confirm the effect in an allogeneic skin transplant animal model of CXCR3, which plays an important role in migration to the site of injury or inflammation, among the anti-CD25/IL-10/CXCR3 fusion proteins encoded by the minicircle vector of the present invention, cell Movement analysis was performed. Specifically, HEK293T cells were seeded in an upper chamber (Corning Incorporated, Kennebunk ME, USA) with a membrane with 8 um-sized pores, and transfected with a minicircle vector (mc-MTA). After 48 hours, CXCR3 ligands, CXCL9 (chemokine (C-X-C motif) ligand 9), CXCL10, and CXCL11, were added to the medium in the lower chamber and cultured for 24 hours. Afterwards, the cells that moved from the upper chamber to the lower chamber were fixed with methanol, stained with 1% toluidine blue, and the number of cells was counted. As a result, the migration of cells transfected with the minicircle vector (mc-MTA) was shown to be significantly increased in the presence of the CXCR3 ligand (Figures 7A to C).

4-2. Promoting cell migration in an allogeneic skin transplant animal model

To confirm in vivo movement of the minicircle vector (mc-MTA) of the present invention into an allograft, delivery of mc-MTA (luciferase or RFP tagging) in an allogeneic skin transplant mouse model (recipient) was confirmed. As a result, LUC was detected around the allogeneic skin graft (Figure 7D), and RFP fluorescence was also confirmed (Figure 7E).

That is, it was confirmed that cells expressing the minicircle vector (mc-MTA) encoding the anti-CD25/IL-10/CXCR3 fusion protein of the present invention increased their migration to the periphery of the graft.

Example 5. Effect of minicircle vector on transplant rejection treatment in an allogeneic skin transplant animal model

To investigate the therapeutic effect of a minicircle vector expressing a triple-specific protein in transplant rejection, the experimental animal groups were divided into a minicircle-mock injection group and a minicircle vector injection group expressing anti-CD25/IL-10 (DTA). ) and the minicircle vector injection group (MTA) (mc-anti-CD25HC-IL-10-CXCR3 and mc-anti-CD25LC) of the present invention, and the minicircle vector appropriate for each group is injected by the method mentioned above. Allogeneic skin transplantation was performed the next day. In this model, the donor mouse was a male C57BL/c mouse (Orient Bio Inc.), and the recipient mouse was a male BALB/c mouse (Orient Bio Inc.). The tail skin of the donor mouse was peeled off to form the recipient mouse. It was transplanted into the skin of the back. After transplantation, changes in the skin were observed every day, and if scab formation or skin atrophy occurred in more than 70% of the transplanted skin, it was considered a rejection reaction and the survival rate was calculated. In addition, desmoplasia, hyalinization, and inflammatory cell infiltration were observed in each mouse group through H & E staining.

As a result, mice injected with mc-mock showed a median survival time (MST) of 7.1 ± 0.3 days, and mice injected with mc-DTA showed a median survival time of 10.4 ± 0.4 days, indicating that mc-DTA The survival period of mice injected was found to be significantly increased (P < 0.05), but in the case of mice injected with mc-MTA, the median survival period was 11.4 ± 0.6 days, which was longer than that of the mc-DTA administered group. appeared to be significantly increased (P < 0.05) (Figure 8A and B). In addition, desmoplastic formation, hyalinization, and inflammatory cell infiltration observed in the mc-mock-treated mouse group were decreased in the mc-DTA-treated group, and the most significant decrease was observed in the mc-MTA-treated group (Figure 8C).

Example 6. Confirmation of transplant rejection treatment mechanism of minicircle vector in allogeneic skin transplant animal model

To determine whether long-term skin allograft survival by mc-MTA treatment is associated with the induction of pro-inflammatory T cell subsets and T regulatory (Treg) cells, treatment with mc-mock, mc-DTA or mc-MTA On day 5, lymphocytes were obtained from the spleen of each allogeneic skin transplant mouse, and Th1, Th2, Th17, and Treg cells were evaluated by flow cytometry. As a result, the number of CD4+IFNr+ cells, the number of CD4+IL4+ cells, and the number of CD4+IL17+ cells (i.e., the number of Th1, Th2, and Th17 cells, respectively) were significantly higher in the mc-DTA treatment group and the mc-MTA treatment group compared to the mc-mock treatment group. It was significantly lower in the treatment group, and the number of positive cells was lowest in the mc-MTA treatment group (Figures 9A to F). Additionally, the CD4+Treg cell (defined as CD4+CD25+Foxp3+ cells) population was significantly increased in the mc-DTA-treated group than in the mc-mock-treated group, with the greatest increase observed in the mc-MTA-treated group (Figures 9G and H).

Example 7. Combined treatment of tacrolimus (Tac) and minicircle vector

The survival rates of allogeneic skin transplant animal models were compared according to the combined treatment of tacrolimus (Tac), a conventional immunosuppressant, and the minicircle vector of the present invention. For this purpose, they were divided into a Tac-only group, a Tac+mc-DTA combination group, and a Tac+mc-MTA combination group. Tac was administered daily to recipient BALB/c mice starting 3 days before transplantation, and mc-MTA was administered 1 day before skin transplantation. was injected (Figure 10A). Afterwards, the animals were sacrificed and H&E staining was performed to confirm connective tissue formation, hyalinization, and inflammatory cell infiltration, and the effect on pro-inflammatory T cells and regulatory T cells was confirmed through flow cytometry.

As a result, the survival period of the Tac + mc-MTA treatment group (MST, 14.4 ± 1.1 days) was significantly increased compared to the survival period of the Tac + mc-DTA treatment group (MST, 12.3 ± 0.6 days) (Figure 10B and C) . Also, consistent with this, fewer infiltrating cells were observed in the Tac+mc-MTA treatment group than in the Tac+mc-DTA treatment group (Figure 10D). Additionally, the numbers of CD4+IFNr+, CD4+IL4+, and CD4+IL17+ cells were significantly lower in the Tac+mc-MTA-treated group than in the Tac+mc-DTA-treated group, and the CD4+CD25+Foxp3+ cell population was significantly lower in the Tac+ It was significantly higher in the Tac+mc-MTA treated group than in the mc-DTA treated group (FIG. 11).

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> MINICIRCLE VECTOR EXPRESSING ANTI-CD25 ANTIBODY, IL-10 AND CXCR3 <130> PN2102-058 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211 > 2125 <212> DNA <213> Artificial Sequence <220> <223> Anti-CD25HC/IL-10/CXCR3 <400> 1 catggcaacc atgggttgga gttacataat actgtttttg gtggcgaccg cagcggacgt 60 ccattcccaa ttgcaacagt ccggcacagt tctggcca gg cctggagcca gtgtgaaaat 120 gtcctgtaaa gccagcggtt actcatttac acgatactgg atgcactgga ttaagcaacg 180 gcccggtcaa ggcttggagt ggatcggggc gatttacccc ggtaactcag acacgtcata 240 taaccaaaag tttgaaggta aggctaagct gactgctgtc acatcagcaa gtactgcata 300 tatggagctg agtagtttga cccacgaaga ctcagcagta tactactgct cccgagatta 3 60 tggctactat tttgacttct ggggtcaggg gacgacgctc acggttagct ctgcaagtac 420 caaaggtcca agtgtctttc ctctcgcccc ctccagtaag agtactagtg gcggaactgc 480 ggctctcggt tgcctcgtaa aggactactt cccggaaccg gtcacggt ct catggaactc 540 tggggcgttg acctccggcg ttcacacctt tccggccgta ctgcaatcta gtggactcta 600 ctctctcagt agtgtcgtca cggttccctc cagctccctg ggcacacaga cttatatatg 660 caacgtaaac cataagccat caaatactaa ggtcgataaa agagtggagc ccccaaaaag 720 ttgcgataag actcacactt gcccgccatg cccagcgcct gagcttttgg gaggtccat c 780 agtttttctg tttccgccaa aaccgaagga cacactgatg atcagccgga ctcctgaggt 840 tacatgtgtc gtcgttgatg tgtctcacga agatcccgaa gtaaagttca attggtatgt 900 agatggcgta gaggtacata atgctaaaac taaaccgcgg ga agagcaat ataattccac 960 atacagagta gtttctgtgc tgacagtact tcatcaggat tggcttaacg gcaaggagta 1020 taaatgtaaa gtttcaaata aagcgttgcc tgcgcccatc gagaagacga tcagcaaagc 1080 gaaaggacag ccgagagaac ctcaagtgta tactctccct ccttctcggg acgagcttac 1140 taaaaaccaa gtcagcctca cctgcctggt aaagggtttc tatccttctg atatagcagt 1200 agagtgggaa tcaaatggac aaccagagaa taactataag accacccctc cagtacttga 1260 ttcagacggt tccttttttc tgtatagcaa acttactgta gacaagagta ggtggcaaca 1320 agggaacgtg ttctcttgct cagtgatgca tgaagcactt cataaccact atactca aaa 1380 gagcctttca ctgagcccag gtaagggagg gggaggtagc ggcggagaggag ggagtggggg 1440 cggggggctct agcagggggc aatattccag ggaagataat aattgtactc attttcccgt 1500 aggccaatcc catatgctgc tggagcttcg aaccgccttt agtcaggtga aaactttctt 1560 tcaaacaaaa gaccagttgg acaacatttt gcttaccgac agtcttatgc aagatttcaa 1620 gggatat ctt ggatgccaag cacttagtga gatgatacag ttttacttgg ttgaggtaat 1680 gccacaagct gagaagcacg gcccagaaat caaggagcac ctcaacagct tgggggaaaa 1740 acttaaaaca ctgcggatgc gactgcggag gtgccatcgc ttcctcccct gcgaaaacaa 1800 gtctaaagcc gttgagcagg tgaaatccga ctttaataag ctccaggacc agggagtata 1860 caaggcaatg aatgaattcg acatctttat aaactgcatt gaagcatata tgatgatcaa 1920 gatgaaaagt ggaggaggag ggtctggcgg aggagggtca atggttctcg aagtctctga 1980 ccatcaggtc cttaatgatg cagaggtcgc agcccttttg gagaactttt ctagctctta 2040 tgattatggt gaaaatgagt cagattcttg ttgcacaagc ccaccttgcc cccaagattt 2100 cagcttgaac ttcgacaggg gatcc 2125 <210> 2 <211> 708 <212> DNA <213> Artificial Sequence <220> < 223> Anti-CD25LC <400> 2 gctagcatgg ccaccatggg atggagctat atcatcctct ttttggtggc cacagcggcc 60 gatgtccact cgcagattgt gtctacacag agccccgcca tcatgagcgc ctctccaggc 120 gagaaagtga ccatgacatg tagcgccagc agcagcaga t cctacatgca gtggtatcag 180 cagaagcccg gcacaagccc caagagatgg atctacgata ccagcaagct ggcctctggc 240 gtgccagcca gattttctgg ctctggcagc ggcaccagct acagcctgac aatctctagc 300 atggaagccg aggacgccgc cacctactac tgtcacca ga gaagcagcta caccttcggc 360 ggaggcacca agctggaaat caagagaaca gtggccgctc cgagcgtgtt catctttcca 420 ccaagcgacg agcagctgaa gtctggcaca gcctctgtcg tgtgcctgct gaacaacttc 480 taccctcggg aagccaaggt gcagtggaag gtggacaatg ccct gcagag cggcaatagc 540 caagagagcg tgaccgagca ggacagcaag gactctacct actctctgag cagcaccctg 600 acactgagca aggccgacta cgagaagcac aaggtgtacg cctgtgaagt gacacaccag 660 ggcctgagca gccctgtgac caagagcttc aatagaggcg aggga tcc 708 <210> 3 <211> 708 <212> PRT <213> Artificial Sequence <220> <223> Anti-CD25HC/IL-10/CXCR3 <400> 3 Met Ala Thr Met Gly Trp Ser Tyr Ile Ile Leu Phe Leu Val Ala Thr 1 5 10 15 Ala Ala Asp Val His Ser Gln Leu Gln Gln Ser Gly Thr Val Leu Ala 20 25 30 Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Ser 35 40 45 Phe Thr Arg Tyr Trp Met His Trp Ile Lys Gln Arg Pro Gly Gln Gly 50 55 60 Leu Glu Trp Ile Gly Ala Ile Tyr Pro Gly Asn Ser Asp Thr Ser Tyr 65 70 75 80 Asn Gln Lys Phe Glu Gly Lys Ala Lys Leu Thr Ala Val Thr Ser Ala 85 90 95 Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Thr His Glu Asp Ser Ala 100 105 110 Val Tyr Tyr Cys Ser Arg Asp Tyr Gly Tyr Tyr Phe Asp Phe Trp Gly 115 120 125 Gln Gly Thr Thr Leu Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser 130 135 140 Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala 145 150 155 160 Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val 165 170 175 Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val 195 200 205 Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His 210 215 220 Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Pro Lys Ser 225 230 235 240 Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu 245 250 255 Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu 260 265 270 Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser 275 280 285 His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu 290 295 300 Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr 305 310 315 320 Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn 325 330 335 Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro 340 345 350 Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln 355 360 365 Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val 370 375 380 Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val 385 390 395 400 Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro 405 410 415 Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 420 425 430 Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val 435 440 445 Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu 450 455 460 Ser Pro Gly Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly 465 470 475 480 Gly Gly Ser Ser Arg Gly Gln Tyr Ser Arg Glu Asp Asn Asn Cys Thr 485 490 495 His Phe Pro Val Gly Gln Ser His Met Leu Leu Glu Leu Arg Thr Ala 500 505 510 Phe Ser Gln Val Lys Thr Phe Phe Gln Thr Lys Asp Gln Leu Asp Asn 515 520 525 Ile Leu Leu Thr Asp Ser Leu Met Gln Asp Phe Lys Gly Tyr Leu Gly 530 535 540 Cys Gln Ala Leu Ser Glu Met Ile Gln Phe Tyr Leu Val Glu Val Met 545 550 555 560 Pro Gln Ala Glu Lys His Gly Pro Glu Ile Lys Glu His Leu Asn Ser 565 570 575 Leu Gly Glu Lys Leu Lys Thr Leu Arg Met Arg Leu Arg Arg Cys His 580 585 590 Arg Phe Leu Pro Cys Glu Asn Lys Ser Lys Ala Val Glu Gln Val Lys 595 600 605 Ser Asp Phe Asn Lys Leu Gln Asp Gln Gly Val Tyr Lys Ala Met Asn 610 615 620 Glu Phe Asp Ile Phe Ile Asn Cys Ile Glu Ala Tyr Met Met Ile Lys 625 630 635 640 Met Lys Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Met Val Leu 645 650 655 Glu Val Ser Asp His Gln Val Leu Asn Asp Ala Glu Val Ala Ala Leu 660 665 670 Leu Glu Asn Phe Ser Ser Ser Tyr Asp Tyr Gly Glu Asn Glu Ser Asp 675 680 685 Ser Cys Cys Thr Ser Pro Pro Pro Cys Pro Gln Asp Phe Ser Leu Asn Phe 690 695 700 Asp Arg Gly Ser 705 <210> 4 <211> 234 <212> PRT <213> Artificial Sequence <220> <223 > Anti-CD25LC <400> 4 Met Ala Thr Met Gly Trp Ser Tyr Ile Ile Leu Phe Leu Val Ala Thr 1 5 10 15 Ala Ala Asp Val His Ser Gln Ile Val Ser Thr Gln Ser Pro Ala Ile 20 25 30 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser 35 40 45 Ser Ser Arg Ser Tyr Met Gln Trp Tyr Gln Gln Lys Pro Gly Thr Ser 50 55 60 Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile 85 90 95 Ser Ser Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys His Gln Arg 100 105 110 Ser Ser Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Thr 115 120 125 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 130 135 140 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 145 150 155 160 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 165 170 175 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 180 185 190 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 195 200 205 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 210 215 220 Thr Lys Ser Phe Asn Arg Gly Glu Gly Ser 225 230 <210> 5 <211> 7044 <212> DNA <213> Artificial Sequence <220> <223> pMC.CMV-MCS-EF1alpha-RFP-SV40PolyA vector (PP) <400> 5 acattaccct gttatcccta gatacattac cctgttatcc cagatgacat accctgttat 60 ccctagatga cattaccctg ttatcccaga tgacattacc ctgttatccc tag atacatt 120 accctgttat cccagatgac ataccctgtt atccctagat gacattaccc tgttatccca 180 gatgacatta ccctgttatc cctagataca ttaccctgtt atcccagatg acataccctg 240 ttatccctag atgacattac cctgttatcc cagatgacat taccctgtta tccctagata 300 cattaccctg ttatcccaga tgacataccc tgttatccct agatgacatt accctgttat 36 0 cccagatgac attaccctgt tatccctaga tacattaccc tgttatccca gatgacatac 420 cctgttatcc ctagatgaca ttaccctgtt atcccagatg acattaccct gttatcccta 480 gatacattac cctgttatcc cagatgacat accctgttat ccctagatga cattaccctg 540 ttatcccaga tgacatta cc ctgttatccc tagatacatt accctgttat cccagatgac 600 ataccctgtt atccctagat gacattaccc tgttatccca gatgacatta ccctgttatc 660 cctagataca ttaccctgtt atcccagatg acataccctg ttatccctag atgacattac 720 cctgttatcc cagataaact caatgatgat gatgatgatg gtcgagactc agcggccgcg 7 80 gtgccagggc gtgcccttgg gctccccggg cgcgactagt gaattgatac tagtattatg 840 cccagtacat gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg 900 ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact 960 cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa 1020 atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta 1080 ggcgtgtacg gtgggaggtt tatataagca gagctcgttt agtgaaccgt cagatcgcct 1140 ggagacgcca tccacgctgt tttgacctcc atagaagatt ctagagctag c gaattcgaa 1200 tttaaatcgg atccgcggcc gcgaaggatc tgcgatcgct ccggtgcccg tcagtgggca 1260 gagcgcacat cgcccacagt ccccgagaag ttggggggag gggtcggcaa ttgaacgggt 1320 gcctagagaa ggtggcgcgg ggtaaactgg gaaag tgatg tcgtgtactg gctccgcctt 1380 tttcccgagg gtgggggaga accgtatata agtgcagtag tcgccgtgaa cgttcttttt 1440 cgcaacgggt ttgccgccag aacacagctg aagcttcgag gggctcgcat ctctccttca 1500 cgcgcccgcc gccctacctg aggccgccat ccacgccggt tgagtcgcgt tctgccgcct 1560 cccgcctgtg gtgcctcctg aactgcgtcc gccgtctagg taagtttaaa g ctcaggtcg 1620 agaccgggcc tttgtccggc gctcccttgg agcctaccta gactcagccg gctctccacg 1680 ctttgcctga ccctgcttgc tcaactctac gtctttgttt cgttttctgt tctgcgccgt 1740 tacagatcca agctgtgacc ggcg cctacg ctagacgcca ccatggccct tagtaagcac 1800 ggcctgacta aggacatgac catgaagtac catatggagg gctcggtgga cgggcacaag 1860 ttcgtgatta cgggccacgg gaacggcaac ccattcgagg ggaaacagac aatgaacctg 1920 tgtgtggtgg aaggcggacc cctgcccttc tcggaggaca tcctgtccgc aacctttgac 1980 tacggcaatc gcgtgttcac agagtatcca cagggtatgg tggatttctt taagaacagc 2040 t gtcccgcag gatacacctg gcaccgcagc ctgctcttcg aggacggggc ggtgtgtacc 2100 acctccgctg atatcaccgt gtccgtcgag gagaactgct tctaccacaa cagcaaattc 2160 cacggcgtga actttcctgc cgacgggcct gtgatgaaga aaatgactac gaattgggag 2220 cccagctgcg agaaaatcat cccggtccct cgtcagggaa tcttgaaggg cgacatcgca 2280 atgtacctcc tgctcaagga cgggggaaga taccgatgcc agttcgatac catctacaag 2340 gcaaagtccg atcccaagga gatgccagag tggcacttca tccagcacaa actcacccgc 2400 gaggaccgct cagatgccaa gaaccagaag tggcaactgg tcgagcacgc cgtggcatcc 2460 cgtagcgccc tgccagggta agtc gacaat caacctctga ttacaaaatt tgtgaaagat 2520 tgactggtat tcttaactat gttgctcctt ttacgctatg tggatacgct gctttaatgc 2580 ctttgtatca tgctattgct tcccgtatgg ctttcatttt ctcctccttg tataaatcct 2640 ggttgctg tc tctttatgag gagttgtggc ccgttgtcag gcaacgtggc gtggtgtgca 2700 ctgtgtttgc tgacgcaacc cccactggtt ggggcattgc caccacctgt cagctccttt 2760 ccgggacttt cgctttcccc ctccctattg ccacggcgga actcatcgcc gcctgccttg 2820 cccgctgctg gacaggggct cggctgttgg gcactgacaa ttccgtggtg ttgtcgggga 2880 aatcatcgtc ctttcc ttgg ctgctcgcct gtgttgccac ctggattctg cgcgggacgt 2940 ccttctgcta cgtcccttcg gccctcaatc cagcggacct tccttcccgc gccctgctgc 3000 cggctctgcg gcctcttccg cgtcttcgcc ttcgccctca gacgagtcgg atct cccttt 3060 gggccgcctc cccgcctggt acctttaaga ccaatgactt acaaggcagc tgtagatctt 3120 agccactttt taaaagaaaa ggggggactg gaagggctaa ttcactccca acgaagataa 3180 gatctgcttt ttgcttgtac tgggtctctc tggttagacc agatctgagc ctgggagctc 3240 tctggctaac tagggaaccc actgcttaag cctcaataaa gcttgccttg agtgcttcaa 3300 gtagtgtgtg cccgtctgtt gtgtgactct ggtaactaga gatccctcag acccttttag 3360 tcagtgtgga aaatctctag cagtagtagt tcatgtcatc ttattattca gtatttataa 3420 cttgcaaaga aatgaatatc agagagtgag aggaacttgt ttattgcagc ttataatggt 3480 tacaaataaa gcaatagcat cacaaattt c acaaataaag catttttttc actgcattct 3540 agttgtggtt tgtccaaact catcaatgta tcttatcatg tctggctcta gctatcccgc 3600 ccctaactcc gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg 3660 gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc 3720 agaagtagtg aggaggcttt tttggaggcc tagacttttg cagatcga cc catggggggcc 3780 cgcccccaact ggggtaacct ttgagttctc tcagttgggg gtaatcagca tcatgatgtg 3840 gtaccacatc atgatgctga ttataagaat gcggccgcca cactctagtg gatctcgagt 3900 taataattca gaagaactcg tcaagaaggc gatagaaggc gatgc gctgc gaatcgggag 3960 cggcgatacc gtaaagcacg aggaagcggt cagcccattc gccgccaagc tcttcagcaa 4020 tatcacgggt agccaacgct atgtcctgat agcggtccgc cacacccagc cggccacagt 4080 cgatgaatcc agaaaagcgg ccattttcca ccatgatatt cggcaagcag gcatcgccat 4140 gggtcacgac gagatcctcg ccgtcgggca tgctcgcctt gagcctggcg aacagttcgg 4200 ctggcgcgag cccctgatgc tcttcgtcca gatcatcctg atcgacaaga ccggcttcca 4260 tccgagtacg tgctcgctcg atgcgatgtt tcgcttggtg gtcgaatggg caggtagccg 4320 gatcaagcgt atgcagccgc cgcat tgcat cagccatgat ggatactttc tcggcaggag 4380 caaggtgtag atgacatgga gatcctgccc cggcacttcg cccaatagca gccagtccct 4440 tcccgcttca gtgacaacgt cgagcacagc tgcgcaagga acgcccgtcg tggccagcca 4500 cgatagccgc gctgcctcgt cttgcagttc attcagggca ccggacaggt cggtcttgac 4560 aaaaagaacc gggcgcccct gcgctgacag ccggaacacg gcggcatcag agcagccgat 4620 tgtctgttgt gcccagtcat agccgaatag cctctccacc caagcggccg gagaacctgc 4680 gtgcaatcca tcttgttcaa tcatgcgaaa cgatcctcat cctgtctctt gatcagagct 4740 tgatcccctg cgccatcaga tccttggcgg cga gaaagcc atccagttta ctttgcaggg 4800 cttcccaacc ttaccagagg gcgccccagc tggcaattcc ggttcgcttg ctgtccataa 4860 aaccgcccag tctagctatc gccatgtaag cccactgcaa gctacctgct ttctctttgc 4920 gcttgcgttt tcccttgtcc agatagccca gtagctgaca ttcatccggg gtcagcaccg 4980 tttctgcgga ctggctttct acgtgctcga ggggggccaa acggtctcca gcttggctgt 504 0 tttggcggat gagagaagat tttcagcctg atacagatta aatcagaacg cagaagcggt 5100 ctgataaaac agaatttgcc tggcggcagt agcgcggtgg tcccacctga ccccatgccg 5160 aactcagaag tgaaacgccg tagcgccgat ggtagtgtgg ggtctcccca tgcgagag ta 5220 gggaactgcc aggcatcaaa taaaacgaaa ggctcagtcg aaagactggg cctttcgttt 5280 tatctgttgt ttgtcggtga acgctctcct gagtaggaca aatccgccgg gagcggattt 5340 gaacgttgcg aagcaacggc ccggagggtg gcgggcagga cgcccgc cat aaactgccag 5400 gcatcaaatt aagcagaagg ccatcctgac ggatggcctt tttgcgtttc tacaaactct 5460 tttgtttat tttctaaata cattcaaata tgtatccgct catgaccaaa atcccttaac 5520 gtgagttttc gttccactga gcgtcagacc ccgtagaa aa gatcaaagga tcttcttgag 5580 atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 5640 tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 5700 gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 5760 actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 5820 gtggc gataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 5880 agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 5940 ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaaggg agaa 6000 aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 6060 cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 6120 gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 6180 cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt cctg cgttat 6240 cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca 6300 gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc ctgatgcggt 6360 attttctcct tacgcatctg tgcggtattt cacacc gcat atggtgcact ctcagtacaa 6420 tctgctctga tgccgcatag ttaagccagt atacactccg ctatcgctac gtgactgggt 6480 catggctgcg ccccgacacc cgccaacacc cgctgacgcg ccctgacggg cttgtctgct 6540 cccggcatcc gcttacagac aagctgtgac cgtctccggg agctgcatgt gtcagaggtt 6600 ttcaccgtca tcaccgaaac gcgcgaggca gcagatcaat tcgcgcgcga aggcgaagcg 6660 gcatg cataa tgtgcctgtc aaatggacga agcagggatt ctgcaaaccc tatgctactc 6720 cgtcaagccg tcaattgtct gattcgttac caattatgac aacttgacgg ctacatcatt 6780 cactttttct tcacaaccgg cacggaactc gctcgggctg gccccggtgc attttttaaa 68 40 tacccgcgag aaatagagtt gatcgtcaaa accaacattg cgaccgacgg tggcgatagg 6900 catccgggtg gtgctcaaaa gcagcttcgc ctggctgata cgttggtcct cgcgccagct 6960 taagacgcta atccctaact gctggcggaa aagatgtgac agacgcgacg gcgacaagca 7020aacatgctgt gcgacgctgg cgat 7044

Claims (15)

A first minicircle vector comprising an anti-CD25 antibody heavy chain gene, an interleukin-10 (IL-10) gene, and a CXC motif chemokine receptor 3 (CXCR3) gene; and
A pharmaceutical composition for inhibiting transplant rejection, comprising as an active ingredient a second minicircle vector containing an anti-CD25 antibody light chain gene. The pharmaceutical composition for inhibiting transplant rejection according to claim 1, wherein the first minicircle vector comprises the polynucleotide of SEQ ID NO: 1 in which the anti-CD25 antibody heavy chain gene, IL-10 gene, and CXCR3 gene are operably linked. The pharmaceutical composition for inhibiting transplant rejection according to claim 1, wherein the second minicircle vector comprises the polynucleotide of SEQ ID NO: 2. The pharmaceutical composition for suppressing transplant rejection according to claim 1, further comprising another immunosuppressant. delete The pharmaceutical composition for inhibiting transplant rejection according to claim 1, wherein the transplant rejection is one or more types of transplant rejection selected from the group consisting of cells, blood, tissues, and organs. The method of claim 1, wherein the transplant rejection reaction is one or more types selected from the group consisting of rejection reactions of bone marrow transplantation, heart transplantation, corneal transplantation, intestinal transplantation, liver transplantation, lung transplantation, pancreas transplantation, kidney transplantation, and skin transplantation. Pharmaceutical composition for reaction inhibition. fusion protein of anti-CD25 antibody heavy chain, IL-10, and CXCR3; and
An anti-CD25 antibody comprising an anti-CD25 antibody light chain and combining IL-10 and CXCR3, or an immunologically active fragment thereof. The method of claim 8, wherein the anti-CD25 antibody heavy chain, IL-10, and CXCR3 fusion protein is an anti-CD25 antibody combining IL-10 and CXCR3, or an immunological activity thereof, comprising the amino acid sequence of SEQ ID NO: 3. snippet. The anti-CD25 antibody or immunologically active fragment thereof according to claim 8, wherein the anti-CD25 antibody light chain includes the amino acid sequence of SEQ ID NO: 4. An antibody composition for inhibiting transplant rejection comprising the antibody of claim 8 or an immunologically active fragment thereof as an active ingredient. 1) Inserting a polynucleotide containing the base sequence of SEQ ID NO: 1 into the first parent plasmid containing the base sequence of SEQ ID NO: 5;
2) Inserting a polynucleotide containing the base sequence of SEQ ID NO: 2 into the second parent plasmid containing the base sequence of SEQ ID NO: 5;
3) Transforming the first parent plasmid and the second parent plasmid prepared in steps 1) and 2) into a host cell;
4) treating host cells with a minicircle inducing combination; and
5) A method of producing a minicircle vector for suppressing transplant rejection, comprising the step of purifying the minicircle vector. The method of producing a minicircle vector for suppressing transplant rejection according to claim 12, wherein the minicircle inducing combination contains arabinose. Transforming the first minicircle vector and the second minicircle vector of claim 1 into a host cell;
Culturing host cells; and
A method of producing an anti-CD25 antibody bound to IL-10 protein and CXCR3 protein, comprising the step of isolating the antibody from host cells. The method of claim 14, wherein the anti-CD25 antibody bound to the IL-10 protein and the CXCR3 protein is an anti-CD25 antibody bound to the IL-10 protein and the CXCR3 protein, comprising the amino acid sequence of SEQ ID NO: 3 and the amino acid sequence of SEQ ID NO: 4. Method for making CD25 antibody.