KR102583540B1 - Use of ZBTB16 in Neurodegenerative Disorders - Google Patents

Abstract

The present invention can not only diagnose degenerative brain diseases through ZBTB16 (Zinc finger and BTB domain-containing protein 16), but also improve, prevent, or treat mental and behavioral symptoms of degenerative brain diseases when the expression of ZBTB16 is suppressed. As confirmed, the above substances can be used not only as biomarkers for degenerative brain diseases, but also for the prevention or treatment of degenerative brain diseases.

Description

{Use of ZBTB16 in Neurodegenerative Disorders}

The present invention can diagnose degenerative brain diseases through ZBTB16 (Zinc finger and BTB domain-containing protein 16), and includes a biomarker composition for diagnosing degenerative brain diseases using ZBTB16, a composition for diagnosing degenerative brain diseases, and a composition comprising the same. It relates to kits, methods for providing information necessary for the diagnosis of degenerative brain diseases, pharmaceutical compositions for treating or preventing degenerative brain diseases, and methods for screening substances that can prevent or treat degenerative brain diseases.

Degenerative brain disease refers to a disease that occurs in the brain as one ages. Due to causes that are not well known to date, certain groups of brain cells in the brain gradually lose their functions, death of brain nerve cells that are most important in transmitting information in the brain nervous system, and problems with the shape or function of synapses that transmit information between brain nerve cells. Alternatively, it is known to be caused by an abnormal increase or decrease in the electrical activity of cranial nerves.

These degenerative brain diseases, especially when accompanied by psychotic symptoms such as delusions and hallucinations in dementia patients, have a negative impact on the course of the disease and the patient's daily life functions, ultimately leading to the patients' early institutionalization and the resulting enormous social and economic damage. It causes an increase in economic costs. Understanding the neuropathological mechanisms of psychotic symptoms in dementia is very important for early diagnosis and treatment, but it has not yet been clarified. Therefore, there is an urgent need for research to develop new treatments not only for diagnosing but also treating degenerative brain diseases.

Patent Document 1. Korean Patent Publication No. 10-2012-0004965

The present invention was created to solve the above problems, and the purpose of the present invention is to provide a biomarker composition for diagnosing degenerative brain diseases.

Another object of the present invention is to provide a composition for diagnosing degenerative brain diseases and a kit for diagnosing degenerative brain diseases.

Another object of the present invention is to provide a method of providing information necessary for diagnosing degenerative brain diseases.

Another object of the present invention is to provide a screening method for a treatment substance for degenerative brain diseases.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating degenerative brain diseases.

In order to achieve the above object, the present invention provides a biomarker composition for diagnosing degenerative brain diseases containing ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it as an active ingredient.

The ZBTB16 protein may be represented by the amino acid sequence of SEQ ID NO: 1.

In order to achieve the above other objects, the present invention provides a composition for diagnosing degenerative brain diseases containing as an active ingredient an agent capable of measuring the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it. do.

The agent for measuring the gene expression level is at least one selected from the group consisting of probes, primers, and antisense oligonucleotides that specifically bind to the gene encoding the ZBTB16 protein, and the agent for measuring the protein expression level is the ZBTB16 It may be any one or more selected from the group consisting of antibodies, peptides, aptamers, and compounds that specifically bind to proteins.

The ZBTB16 protein may be represented by the amino acid sequence of SEQ ID NO: 1.

In order to achieve the above other object, the present invention provides a kit for diagnosing degenerative brain diseases including a composition.

In order to achieve the above other object, the present invention provides a method of providing information necessary for diagnosing a degenerative brain disease, including the following steps.

(1) measuring the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it from a biological sample isolated from the subject;

(2) comparing the expression level of the ZBTB16 protein or the gene encoding it with a normal control sample; and

(3) If the expression level of the ZBTB16 protein or the gene encoding it is higher than that of the normal control sample, determining that it is a degenerative brain disease.

It may further include measuring LC3 and p62 protein expression levels from the biological sample of the subject.

In order to achieve the above object, the present invention includes the steps of: a) treating a candidate substance in a sample isolated from an animal or patient with a degenerative brain disease; b) measuring the expression level of ZBTB16 protein or the gene encoding it in the candidate treatment group; and c) if the expression level of the ZBTB16 protein or the gene encoding it measured in the above step is lower than the candidate substance untreated group (control group), selecting it as a degenerative brain disease treatment substance; A screening method is provided.

The ZBTB16 protein may be represented by the amino acid sequence of SEQ ID NO: 1.

The expression level can be measured using polymerase reaction (PCR), quantitative polymerase reaction (qPCR), reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (competitive RT-PCR), and quantitative real-time polymerase reaction (qRT). It may be measured using any one method selected from the group consisting of - PCR), real time reverse transcription polymerase reaction (real time RT-PCR), RNase protection assay, northern blot analysis, and DNA chip analysis. there is.

It may further include measuring the protein expression levels of LC3 and p62 in the serum of the candidate treatment group.

If the LC3 protein expression level increases compared to the candidate material untreated group (control group) and the p62 protein expression level decreases compared to the candidate material untreated group (control group), a step of determining the candidate material as a treatment material for degenerative brain disease is further performed. It can be included.

In order to achieve the above other objects, the present invention provides a pharmaceutical composition for preventing or treating degenerative brain diseases containing as an active ingredient an agent capable of inhibiting the expression or activity of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein. do.

Agents that can inhibit the expression include siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, etc. that specifically bind to the mRNA of the gene encoding the ZBTB16 protein. It is characterized in that it contains at least one selected from the group consisting of PNA (peptide nucleic acids) and antisense oligonucleotides, and agents capable of inhibiting the activity include compounds, peptides, and compounds capable of specifically binding to the ZBTB16 protein. It may include any one or more selected from the group consisting of aptamers, proteins, and antibodies.

The shRNA is used in any one carrier selected from the group consisting of recombinant adenovirus, adeno-associated viruses (AAV), retrovirus, lentivirus, herpes simplex virus, bassinia virus, liposome, and niosome. It may be transmitted by.

The shRNA may be any one or more selected from the group consisting of the nucleotide sequence represented by SEQ ID NO: 7, the nucleotide sequence represented by SEQ ID NO: 8, the nucleotide sequence represented by SEQ ID NO: 9, and the nucleotide sequence represented by SEQ ID NO: 10.

The degenerative brain diseases include Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, It may be any one or more selected from the group consisting of Down's syndrome and Huntington's disease.

The composition can improve, prevent, or treat mental and behavioral disorders (Behavioral and Psychological Symptoms of Dementia, BPSD) caused by degenerative brain diseases.

The mental and behavioral disorders (Behavioral and Psychological Symptoms of Dementia (BPSD)) include delusions, hallucinations, agitation, aggression, activity disturbances, depression, and anxiety. (anxiety), diurnal rhythm disturbances, mood swings, irritability, lability, affective lability, defective self-regulation, abnormal repetitive behavior ( It may be any one or more selected from the group consisting of aberrant motor behavior, anxiety and phobias, and sleep disorders.

According to the present invention, it relates to a biomarker composition for diagnosing degenerative brain diseases containing ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it as an active ingredient, wherein ZBTB16 is detected in the brain striatum of an animal model of degenerative brain diseases. It was confirmed that the expression of It can be used as a marker.

According to the present invention, it has been confirmed that when the expression of ZBTB16 is suppressed, mental and behavioral symptoms of degenerative brain diseases are improved, prevented, or treated. The above substances are not only biomarkers of degenerative brain diseases, but also prevent degenerative brain diseases. Alternatively, it can be used for treatment.

Figure 1 is a diagram showing the locations of the dorsal striatum and nucleus accumbens (NAc) in brain tissue (Brain) isolated from a control group (WT) and a dementia animal model (APPPS1).
Figure 2 shows the level of ZBTB16 protein expression measured in the dorsal striatum and nucleus accumbens (NAc) in brain tissue (Brain) isolated from the control group (WT) and dementia animal model (APPPS1) using immunohistostaining. It is a result.
Figure 3 is a graph showing the results of the Y-maze test (YMT) for the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16).
Figure 4 is a graph showing the results of a novel object recognition test (NOR) for the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16).
Figure 5 is a diagram showing the results of the 3-chamber test (3CT) of the dementia animal model (APPPS1+GFP), the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP) prepared according to the present invention. 5a shows interest in inanimate objects (0) and living mice (S1) of the dementia animal model (APPPS1+GFP) prepared according to the present invention, the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP). It is a diagram showing the degree, and Figure 2b is a familiar mouse (S1) and a new mouse of the dementia animal model (APPPS1+GFP), ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and control group (WT+GFP) prepared according to the present invention. This is a diagram showing the level of interest in the mouse (S2).
Figure 6 is a diagram showing the results of the elevated cross maze test (EMP) of the dementia animal model (APPPS1+GFP), the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP) prepared according to the present invention.
Figure 7 is a diagram showing the results of the light-dark locomotion test (LDB) of a dementia animal model (APPPS1+GFP), a ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and a control group (WT+GFP).
Figure 8 shows the results of measuring the expression levels of LC3 and p62 in the dorsal striatum of brain tissue isolated from the dementia animal model (APPPS1+GFP) prepared according to the present invention by immunohistostaining.
Figure 9 shows the results of measuring the expression levels of LC3 and p62 in the dorsal striatum of brain tissue isolated from the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to the present invention using immunohistostaining.
Figure 10 shows green fluorescent protein (GFP) expressed together with the knockdown virus carrier from the dorsal striatum in brain tissue isolated from the dementia animal model (APPPS1+GFP, APPPS1+shZbtb16) prepared according to the present invention. This is the result of measuring the amount and expression area using immunohistostaining.
Figure 11 shows the results of measuring the expression levels of ZBTB16 and p62 in the dorsal striatum of brain tissue isolated from a 12-month-old normal animal model (WT+GFP (12mo)) using immunohistostaining.
Figure 12 shows the results of measuring the expression levels of ZBTB16 and p62 in the dorsal striatum of brain tissue isolated from a 12-month-old dementia animal model (APP/PS1+GFP (12mo)) using immunohistostaining.
Figure 13 shows the results of measuring the expression levels of ZBTB16 and p62 in the dorsal striatum of brain tissue isolated from a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16(12mo)) using immunohistostaining.
Figure 14a shows an inanimate object (0) and a living object in a 12-month-old dementia animal model (APPPS1+GFP), a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and a 12-month-old control group (WT+GFP) prepared according to the present invention. This is a diagram showing the degree of interest (3CT: sociability) in the mouse (S1).
Figure 14b shows familiar mice (S1) and new mice of a 12-month-old dementia animal model (APPPS1+GFP), a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and a 12-month-old control group (WT+GFP) prepared according to the present invention. This is a diagram showing the level of interest (3CT: novelty) in mice (S2).
Figure 15 shows the Y-maze of a 12-month-old normal animal model (control group (WT+GFP)), a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to the present invention. A graph showing the results of the test (YMT) (left) and a graph showing the results of the novel object recognition test (NOR) (right).

Below, we will look at various aspects and various implementations of the present invention in more detail.

As a result of diligent efforts to obtain a method for finding a substance capable of diagnosing degenerative brain diseases, the present inventors identified the interaction between degenerative brain diseases and ZBTB16, and based on this, completed the present invention.

One aspect of the present invention relates to a biomarker composition for diagnosing degenerative brain diseases containing ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it as an active ingredient.

The biomarker composition may additionally include p62 and LC3, which are known autophagosome markers. The LC3 protein is LC3 II (mitrotubule-associated protein light chain 3), and p62 is Sequestosome 1, SQSTM1.

In the present invention, 'ZBTB16 (Zinc finger and BTB domain-containing protein 16)' is a protein encoding the ZBTB16 gene. The gene is one of the Krueppel C2H2 type zinc-finger protein members and encodes a zinc finger transcription factor containing nine Kruppel-type zinc finger domains at the carbosyl terminus. The above protein is located in the nucleus, is involved in cell cycle progression, and is known to interact with Histone Deacetylase (HDAC).

Additionally, the amino acid sequence of ZBTB16 can be represented by SEQ ID NO: 1 registered at uniprot.org. At this time, it may include an amino acid sequence having sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% with the amino acid sequence represented by SEQ ID NO: 1. .

Additionally, the base sequence of the gene encoding ZBTB16 is registered at ncbi.nlm.nih.gov. You can check in more detail. At this time, it may include an amino acid sequence having sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% with the base sequence represented by SEQ ID NO: 2. .

In the present invention, 'degenerative brain disease' is a disease that causes various symptoms as degenerative changes occur in the nerve cells of the central nervous system. In most cases, the onset of the disease begins slowly and symptoms appear after normal functioning for a long period of time after birth. Additionally, once the disease develops, the disease continues to progress over several years or decades until death, and it often runs in families. Specific examples of the degenerative brain disease of the present invention are not limited thereto, but include Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, Down's syndrome, Huntington's disease, amyotrophic lateral sclerosis, Spinocerebellar Atrophy, Tourette's syndrome s Syndrome, Friedrich`s Ataxia, Machado-Joseph`s disease, Lewy Body Dementia, Dystonia, and Progressive Supranuclear Palsy. ) may be any one or more selected from the group consisting of

In the present invention, the degenerative brain disease may be more preferably a degenerative brain disease induced by beta-amyloid accumulation, and even more preferably may be dementia. The dementia is not particularly limited and includes, for example, Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, and Parkinson's disease. ), mild cognitive impairment, Down's syndrome, and Huntington's disease.

In addition, the present invention can diagnose early-stage degenerative brain disease or dementia without the core symptoms of degenerative brain disease or dementia, such as cognitive impairment.

The early degenerative brain disease or dementia is characterized by delusions, hallucinations, agitation, aggression, activity disturbances, depression, anxiety, Diurnal rhythm disturbances, mood elation, irritability, lability, affective lability, defective self-regulation, aberrant motor behavior , includes having only one or more mental and behavioral disorders selected from the group consisting of anxiety and phobias and sleep disorders.

In the present invention, 'diagnosis' in a broad sense means judging the actual condition of the patient's disease in all aspects. The contents of the judgment include the name of the disease, etiology, type, severity, detailed condition of the disease, presence or absence of complications, and prognosis. Specifically, determining the susceptibility of an object to a specific disease or disorder, determining whether an object currently has a specific disease or condition, and prognosis of an object suffering from a specific disease or condition. determining or therametrics (e.g., monitoring the condition of an object to provide information about treatment efficacy).

In the present invention, 'prognosis' refers to the outlook for future symptoms or progress determined by diagnosing a disease. In particular, for patients with degenerative brain diseases, prognosis usually refers to the pattern of the degenerative brain disease, the development of mental and behavioral symptoms, or the survival period within a certain period of time after the onset or treatment of the degenerative brain disease. Prediction of prognosis is particularly important because it provides clues to the direction of future treatment of degenerative brain diseases in patients with degenerative brain diseases.

In the present invention, 'biomarker' refers to an indicator that can detect changes in the body using proteins, DNA, RNA (ribonucleic acid), metabolites, etc. Using biomarkers, it is possible to objectively measure the normal or pathological state of a living organism and the degree of response to drugs, and is an effective method for diagnosing various incurable diseases such as degenerative brain diseases, stroke, and cancer. In addition, it can be reflected in the new drug development process, ensuring safety as well as cost reduction effects.

The relationship between ZBTB16 of the present invention and degenerative brain disease has not yet been known, but through the present invention, it has been found that the expression of ZBTB16 increases due to beta amyloid accumulation. In addition, it was confirmed that when ZBTB16 is inhibited in animals, mental and behavioral disorders induced by degenerative brain diseases can be restored to normal levels. This means that ZBTB16 can be used as a biomarker for diagnosis or early diagnosis of degenerative brain diseases. In other words, measuring the expression level of the ZBTB16 protein or the gene encoding it can provide information necessary for the diagnosis of degenerative brain disease.

In the present invention, “expression” means the production of a protein or nucleic acid in a cell. 'Protein' is used interchangeably with 'polypeptide' or 'peptide' and refers to a polymer of amino acid residues, for example, as commonly found in proteins in their natural state. ‘Polynucleotide’ or ‘nucleic acid’ refers to deoxyribonucleotide (DNA) or ribonucleotide (RNA) in single- or double-stranded form. Unless otherwise limited, known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides are also included. 'mRNA' refers to RNA that transfers genetic information (gene-specific base sequence) from a specific gene to a ribosome that specifies the amino acid sequence during the protein synthesis process.

Another aspect of the present invention relates to a composition for diagnosing degenerative brain diseases containing as an active ingredient an agent capable of measuring the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it.

The agent for measuring the gene expression level may be any one or more selected from the group consisting of probes, primers, and antisense oligonucleotides that specifically bind to the gene encoding the ZBTB16 protein.

The agent for measuring the protein expression level may be any one or more selected from the group consisting of antibodies, peptides, aptamers, and compounds that specifically bind to the ZBTB16 protein.

In the present invention, 'probe' refers to a nucleic acid fragment such as RNA or DNA, ranging from a few bases to several hundred bases long, that can specifically bind to mRNA, and is labeled to determine the presence or absence of a specific mRNA and the expression level. can confirm. Probes may be manufactured in the form of oligonucleotide probes, single strand DNA probes, double strand DNA probes, RNA probes, etc. Selection of appropriate probes and hybridization conditions can be appropriately selected according to techniques known in the art.

In the present invention, a 'primer' is a nucleic acid sequence with a short free 3' hydroxyl group that can form base pairs with a complementary template and acts as a starting point for copying the template strand. It refers to the sequence. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.

In the present invention, the primer or probe can be chemically synthesized using phosphoramidite solid support synthesis or other well-known methods. Additionally, primers or probes can be modified in various ways according to methods known in the art to the extent that they do not interfere with hybridization with ZBTB16 mRNA. Examples of such modifications include methylation, capping, substitution of a native nucleotide with one or more homologs, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) ) or charged linkers (e.g. phosphorothioate, phosphorodithioate, etc.), and binding of labeling material using fluorescence or enzymes.

In the present invention, 'antibody' is a term known in the art and refers to a specific immunoglobulin directed against an antigenic site. The antibody in the present invention refers to an antibody that specifically binds to ZBTB16 of the present invention, and the antibody can be prepared according to conventional methods in the art. The types of antibodies include polyclonal antibodies or monoclonal antibodies, and all immunoglobulin antibodies are included. The antibody is meant to be intact, having two full-length light chains and two full-length heavy chains. Additionally, the above antibodies also include special antibodies such as humanized antibodies.

In the present invention, the 'peptide' has the advantage of high binding capacity to the target substance and does not undergo denaturation even during heat/chemical treatment. Additionally, because the molecule size is small, it can be used as a fusion protein by attaching it to another protein. Specifically, it can be used by attaching it to a polymer protein chain, so it can be used as a diagnostic kit and drug delivery material.

In the present invention, 'aptamer' refers to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure as a substance that can specifically bind to the analyte to be detected in the sample. Specifically, the presence of the target protein in the sample can be confirmed. The production of an aptamer involves determining and synthesizing the sequence of an oligonucleotide with selective and high binding affinity for the target protein to be identified (ZBTB16 protein in the present invention) according to a general aptamer production method, and then 5' of the oligonucleotide. This may be achieved by modifying the terminal or 3' end with -SH, -COOH, -OH or NH ₂ so that it can bind to the functional group of the aptamer chip, but is not limited thereto.

Since the nucleic acid sequences of the genes of the present invention are registered in gene banks, those skilled in the art can design antisense oligonucleotides, primer pairs, or probes that specifically amplify specific regions of these genes based on the sequences.

The diagnostic composition of the present invention containing the ZBTB16 protein-specific agent may additionally contain agents necessary for the method of detecting a known protein, and the method of detecting a known protein using the present composition can be used without limitation. The expression level of ZBTB16 protein can be measured in the sample.

In addition, another aspect of the present invention relates to a kit for diagnosing degenerative brain diseases containing ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it as an active ingredient.

The kit includes an antibody that specifically binds to the marker component, a secondary antibody conjugate conjugated with a label that develops color by reaction with the substrate, a chromogenic substrate solution for color development with the label, a washing solution, and an enzyme reaction stopping solution. etc., and may be manufactured into a number of separate packaging or compartments containing the reagent components used.

In a specific embodiment, the diagnostic kit may be a diagnostic kit characterized by including essential elements required to perform a reverse transcription polymerase reaction. The reverse transcription polymerase reaction kit includes each primer pair specific for the marker gene. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and is about 7bp to 50bp in length, more preferably about 10bp to 30bp in length. It may also include primers specific to the nucleic acid sequence of the control gene. Other reverse transcription polymerase reaction kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNAse, and the RNAse inhibitor DEPC. -Can include DEPC-water, sterilized water, etc.

In another aspect, it may be a diagnostic kit that includes essential elements required to perform a DNA chip. A DNA chip kit may include a substrate to which a cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and reagents, agents, enzymes, etc. for producing a fluorescent probe. The substrate may also include cDNA or oligonucleotides corresponding to control genes or fragments thereof.

Samples used for analysis include degenerative brain diseases that can be distinguished from normal conditions, such as blood, blood cells, brain tissue, nerve cells, cerebrospinal fluid, saliva, nasal fluid, sputum, joint sac fluid, amniotic fluid, ascites, cervical or vaginal secretions and urine. Includes biological samples from which specific proteins related to can be identified. Preferably, it can be measured from a biological sample, for example, any sample selected from the group consisting of blood, blood cells, brain tissue, nerve cells, and cerebrospinal fluid. The sample can be prepared to increase the detection sensitivity of the protein marker, for example, a serum sample obtained from a patient can be subjected to anion exchange chromatography, affinity chromatography, size exclusion chromatography, liquid chromatography, It can be pretreated using methods such as sequential extraction or gel electrophoresis.

Another aspect of the present invention relates to a method of providing information necessary for diagnosing a degenerative brain disease, comprising the following steps.

(1) measuring the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it from a biological sample isolated from the subject;

(2) comparing the expression level of the ZBTB16 protein or the gene encoding it with a normal control sample; and

(3) determining that the ZBTB16 protein is a degenerative brain disease when the expression level of the ZBTB16 protein or the gene encoding it is higher than that of a normal control sample.

First, (1) a biological sample is separated from the subject, and the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it is measured from the biological sample.

In the present invention, 'subject' refers to any single object that is suspected of having a degenerative brain disease and for which a diagnosis of a degenerative brain disease is required, including humans, cows, dogs, guinea pigs, rabbits, chickens, insects, mice, mice, etc. do. Additionally, subjects include any subjects who participated in clinical research trials without clinical signs of any degenerative brain disease, or subjects who participated in epidemiological studies, or subjects used as controls. In one embodiment of the present invention, mice or mice were targeted.

In the present invention, a 'subject suspected of having a degenerative brain disease' is expected to have a degenerative brain disease because it has core symptoms of a degenerative brain disease or mental and behavioral disorders (BPSD) caused by a degenerative brain disease. It may be a target. BPSD is a mental and behavioral disorder that occurs frequently as degenerative brain disease, especially dementia, progresses from moderate to severe. BPSD is characterized by delusions, hallucinations, agitation, aggressive behavior, and abnormal behavior ( activity disturbances, depression, anxiety, diurnal rhythm disturbances, mood elation, irritability, lability, affective lability, self-regulation deficits It includes one or more selected from the group consisting of defective self-regulation, abnormal motor behavior, anxiety and phobias, and sleep disorders.

The 'biological sample' can be used without limitation as long as it is collected from a subject for which degenerative brain disease is to be diagnosed, for example, blood, blood cells, brain tissue, nerve cells, cerebrospinal fluid, saliva, nasal fluid, sputum, joint sac fluid, It may be any one selected from the group consisting of amniotic fluid, ascites, cervical or vaginal secretions, and urine, but is not particularly limited thereto, and is preferably selected from the group consisting of blood, blood cells, brain tissue, nerve cells, and cerebrospinal fluid. It may be any one sample.

In the present invention, 'measurement' may preferably mean 'analysis', which means 'qualitative analysis' which means measuring and confirming the presence or absence of the target substance or the presence level (expression level) of the target substance. Alternatively, it may mean 'quantitative analysis' that measures and confirms changes in quantity. In the present invention, measurement can be performed including both qualitative and quantitative methods, and preferably, quantitative measurement can be performed.

The sample may be pretreated before use for detection or diagnosis. For example, it may include homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, etc.

The measurement method is not particularly limited as long as the protein expression level is measured by a protein expression measurement method known in the art, for example, Western blot, ELISA, radioimmunoassay, radioimmunodiffusion method, Ouchterlony immunodiffusion method. It may be one or more selected from the group consisting of immunodiffusion, rocket immunoelectrophoresis, immunostaining, immunoprecipitation analysis, complement fixation analysis, FACS, and protein chip.

The measurement of the gene expression level is not particularly limited as long as it is a gene expression measurement method known in the art, but preferably polymerase reaction (PCR), quantitative polymerase reaction (qPCR), reverse transcription polymerase reaction (RT-PCR), competitive method. Competitive RT-PCR, quantitative real-time polymerase reaction (qRT-PCR), real time RT-PCR, RNase protection assay, northern blot analysis, and DNA chip. It may be any one method selected from the group consisting of analysis, and more preferably quantitative polymerase reaction (qPCR) or northern blot analysis.

Next, the expression level of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein or the gene encoding it in the subject sample measured by the method in step (1) described above, and ZBTB16 in the normal control sample measured by the same method. Compare with the expression level of the protein or the gene encoding it (step (2)). At this time, the sample is preferably of the same type or obtained by the same method between the subject and the normal control group.

Finally, if the expression level of the ZBTB16 protein or the gene encoding it is higher than that of the normal control sample, it can be judged or diagnosed as a degenerative brain disease (step (3)). Specifically, if the ZBTB16 expression level of the subject sample measured by the above method is increased compared to the healthy control sample, it can be judged or diagnosed as having a degenerative brain disease.

That is, the expression level of the biomarker (ZBTB16) of the present invention is measured in a biological sample obtained from a subject suspected of having a degenerative brain disease, and the biological sample of the present invention is measured from a biological sample of the same type or a normal control obtained by the same method. After measuring the expression level of the biomarker (ZBTB16), the two are compared. If the expression level of the subject is lower than that of the normal control group, the subject can be determined to have a degenerative brain disease.

Another aspect of the present invention relates to a screening method for a treatment substance for degenerative brain disease comprising the following steps.

a) Processing candidate substances in samples isolated from animals or patients with degenerative brain disease;

b) measuring the expression level of ZBTB16 protein or the gene encoding it in the candidate treatment group; and

c) If the expression level of the ZBTB16 protein or the gene encoding it measured in the above step is lower than the candidate material untreated group (control group), selecting it as a treatment material for degenerative brain disease.

In the present invention, an 'animal with induced degenerative brain disease' is an animal in which various symptoms are caused by degenerative changes in the neurons of the central nervous system, and more preferably, an animal in which dementia is induced by the accumulation of beta-amyloid, and is used in humans. It may be any mammal other than a mouse, preferably a mouse, a guinea pig, a pig, or a bird.

The ‘isolated sample’ may be tissue or cells derived from an animal in which a degenerative brain disease has been induced. The sample includes tissue or cells capable of detecting the expression level of ZBTB16 in an animal in which a degenerative brain disease is induced, and may preferably be a tissue or cells isolated from the brain of an animal in which a degenerative brain disease is induced. It is not limited to this.

In the present invention, the 'candidate material' refers to a substance to be tested for therapeutic activity in degenerative brain diseases, and may include any molecule such as extracts, proteins, oligopeptides, small organic molecules, polysaccharides, polynucleotides, and a wide range of compounds. there is. Additionally, the 'candidate material' may be a cell transfected with a liposome or vector. The transfection may be performed using microinjection, calcium phosphate co-precipitation, electroporation, or liposome use, but is not limited thereto.

In the present invention, the 'untreated group' is also referred to as the control group, which is an animal or a sample separated from an animal induced with a degenerative brain disease that was not treated with the candidate material, and is a degenerative brain disease parallel to the group treated with the candidate material. This refers to animals with induced brain disease or samples isolated from them.

In the present invention, the 'screening method' may be performed by checking the expression of ZBTB16, a biomarker for degenerative brain disease, and comparing the candidate substance with an untreated group (control group).

In the present invention, for experiments on degenerative brain diseases, Alzheimer's dementia was induced by genetically altering the brain to overproduce beta amyloid (Aβ). Therefore, the degenerative brain disease may specifically be a degenerative brain disease caused by beta-amyloid accumulation. In particular, the degenerative brain disease may be dementia, and the dementia may include Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, and Parkinson's disease. It may be any one or more selected from the group consisting of Parkinson's disease, mild cognitive impairment, Down's syndrome, and Huntington's disease.

In an example of the present invention, ZBTB16 expression was significantly higher in the brain tissue of the dementia animal model compared to the normal animal model, and it was confirmed that the dementia animal model had mental and behavioral disorders. However, in the knockout animal model in which ZBTB16 expression was suppressed in the dementia animal model, ZBTB16 expression was significantly reduced, and it was confirmed that mental and behavioral disorders were significantly less expressed compared to the normal animal model.

In addition, as a result of examining the correlation between ZBTB16 expression and autophagy, when ZBTB16 expression was knocked out in a dementia animal model, autophagy increased (LC3, p62, and autophagy marker protein expression increased and decreased, respectively). ), it was confirmed that it can reduce the occurrence of disease proteins in the striatum and resolve mental and behavioral disorders caused by degenerative brain diseases such as Alzheimer's.

In other words, it was confirmed that inhibition of ZBTB16 normalized the mental and behavioral disorders of degenerative brain disease induced by beta-amyloid accumulation compared to the control group. It can be seen that it can be usefully applied not only to the core symptoms of degenerative brain disease, but also to its BPSD.

In the present invention, 'prevention' includes all actions that suppress or delay the onset and symptoms of the degenerative brain disease, and includes not only prevention before disease occurrence but also prevention of disease recurrence after treatment. In the present invention, 'treatment' includes all of curing the symptoms of the degenerative brain disease, improving the symptoms, and suppressing the progression of the symptoms.

The present invention measures the expression level of the ZBTB16 protein or the gene encoding it in b) the candidate treatment group, and determines the expression level of the ZBTB16 protein or the gene encoding it measured in step b) in the candidate material untreated group (control group). ), it can be selected as a treatment substance for degenerative brain diseases (step c)).

Specifically, the present invention measures the expression level of ZBTB16 protein or the gene encoding it in animals with induced degenerative brain diseases or samples isolated therefrom, in the absence of candidate substances capable of preventing or treating the degenerative brain diseases (candidate After measuring the expression level of the ZBTB16 protein or the gene encoding it in the presence of the candidate material (untreated group) and the gene encoding it (candidate material treatment group), the two are compared, and then the ZBTB16 protein or the gene coding for it in the presence of the candidate material. A substance that suppresses the expression level of a gene compared to the level in the absence of the candidate substance can be predicted or judged as a substance for preventing or treating degenerative brain diseases.

In the present invention, 'expression level measurement' is a process of confirming the expression level of the ZBTB16 protein or the gene encoding it in animals or samples isolated from animals with induced degenerative brain disease in the absence and presence of candidate substances.

The expression level can be measured using Western blot, ELISA, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip, polymerase reaction (PCR), quantitative polymerase reaction (qPCR), reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (competitive RT-PCR), quantitative real-time polymerase reaction (qRT- It may be any one method selected from the group consisting of PCR), real time reverse transcription polymerase reaction (real time RT-PCR), RNase protection assay, northern blot analysis, and DNA chip analysis.

The screening method for a treatment substance for degenerative brain disease of the present invention may further include measuring the expression levels of LC3 and p62 proteins in the serum of the group treated with the candidate substance. If the LC3 protein expression level increases compared to the candidate material untreated group (control group) and the p62 protein expression level decreases compared to the candidate material untreated group (control group), a step of determining the candidate material as a treatment material for degenerative brain disease is further performed. It can be included.

In the present invention, 'LC3 and p62' are widely known as marker proteins for autophagy. In the present invention, it can be seen that when degenerative brain disease occurs, ZBTB16 expression increases, reduces autophagy, and inhibits autophagy, so that disease proteins in the striatum are not reduced and accumulate, thereby inducing degenerative brain disease. Therefore, when degenerative brain disease occurs, if ZBTB16 is inhibited in brain tissue, autophagy is activated within the brain, increasing the expression level of LC3 and decreasing the expression level of p62.

The relationship between the ZBTB16 gene of the present invention and degenerative brain disease and between ZBTB16 and LC3 and p62 was not yet known, but through the present invention, it was discovered that the expression of the ZBTB16 gene increases during degenerative brain disease. In addition, it was confirmed that when ZBTB16 was inhibited in animals, LC3 protein expression, a biomarker related to autophagy, increased and p62 protein expression significantly decreased. This not only reveals that the ZBTB16 protein is involved in degenerative brain diseases, but also reveals the mechanism of action involved in degenerative brain diseases, meaning that it can function as a diagnostic, therapeutic, and screening marker.

Candidate substances selected through the above degenerative brain disease prevention or treatment substance screening method can suppress or inactivate the expression level of the ZBTB16 gene when compared to a candidate substance untreated group (control group) that did not administer the candidate substance.

Another aspect of the present invention relates to a composition or kit for screening a treatment substance for degenerative brain disease, which contains as an active ingredient an agent capable of inhibiting the expression or activity of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein.

The relationship between ZBTB16 of the present invention and degenerative brain disease and between ZBTB16 and LC3 and p62 proteins has not been known yet, but through the present invention, it has been found that the expression of ZBTB16 increases in degenerative brain disease. In addition, it was confirmed that when ZBTB16 was inhibited in animals, LC3 protein expression, a biomarker related to autophagy, increased and p62 protein expression significantly decreased. This means that ZBTB16 can function as a screening marker for treatment substances for degenerative brain diseases. In other words, if the expression level of the ZBTB16 protein or the gene encoding it can be measured, substances for preventing or treating degenerative brain diseases can be screened.

The agent capable of measuring the expression level has been previously described in detail, so this will be referred to and repeated explanation will be omitted.

Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating degenerative brain diseases, which contains as an active ingredient an agent capable of inhibiting the expression or activity of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein.

The expression of ZBTB16 may include expression of the gene into mRNA, expression of the mRNA into protein, and mRNA degradation or protein degradation. The activity of ZBTB16 includes the biological function/activity of the ZBTB16 protein in cells or tissues.

In the present invention, 'activity' refers to the biological action that allows the expressed protein to perform its original function within the cell.

In the present invention, 'expression' includes all steps in the process of making a gene into a protein in vitro or in a cell, for example, transcription from gene to mRNA and translation from mRNA to protein.

Agents that can inhibit the expression of the ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein include siRNA (small interference RNA) and shRNA (short hairpin RNA) that specifically bind to the mRNA of the gene encoding the ZBTB16 protein. , may include any one or more selected from the group consisting of miRNA (microRNA), ribozyme, DNAzyme, PNA (peptide nucleic acids), and antisense oligonucleotide.

The siRNA (small interfering RNA), shRNA (small hairpin RNA), or miRNA (microRNA) acts through RNA interference, for example, a short-length interfering RNA (siRNA) binds to the transcript in a sequence-specific manner. , RISC (RNA Induced Silencing Complex) is formed to prevent transcribed RNA from being expressed as protein in cells (silencing). siRNA, shRNA or miRNA has a sequence that is significantly complementary to its target sequence. By significantly complementary sequence, we mean at least about 70% complementarity, at least about 80% complementarity, at least about 90% complementarity, or about 100% complementarity with a sequence of at least 15 contiguous bases in length of the target gene. Antisense oligonucleotides, siRNA, shRNA and/or miRNA targeting the CTRP3 gene according to the present application, of various origins, can be used as long as they bind to the target nucleic acid and function as silencing, and their biological equivalents, derivatives and analogs. It also includes. Antisense oligonucleotides, as known in the art, are short synthetic nucleic acids that, for example, bind to any coding sequence of a target protein and inhibit/reduce the expression of the target protein. Antisense RNA may have an appropriate length depending on the target gene and delivery method, for example, from about 6, 8 or 10 to 40, 60 or 100 nucleotides.

Since the siRNA has the disadvantage of having to be prepared in vitro and delivering the knockdown gene transiently, typically for 6-10 days, it is preferable to use shRNA.

The shRNA is a molecule of about 20 bases or more that has a double-stranded structure within the molecule and a hairpin-like structure by partially containing a palindromic base sequence in single-stranded RNA.

The shRNA that suppresses ZBTB16 expression in the present invention has a sequence complementary to part of the ZBTB16 gene and can degrade the mRNA of the ZBTB16 gene or inhibit translation. When complementarity is 80-90%, translation of mRNA can be inhibited, and when complementarity is 100%, mRNA can be degraded. Therefore, the shRNA that suppresses ZBTB16 expression in the present invention is complementary to SEQ ID NO: 3 (GACTGGAGGATAGAGAAGACGTACCTCTA), SEQ ID NO: 4 (AATGGCTGTGGGCAAGAAGTTCAGCCTCAA), SEQ ID NO: 5 (GCAAGCCAAGGCGGAGGACCTGGATGACC), and SEQ ID NO: 6 (ATCTCGAAGCATTCCAGCGAGGAGAGTGG) of common mRNAs in mice and humans. It is preferable to include a base sequence with 100% homology to the sequence.

The shRNA relates to shRNA that inhibits ZBTB16 expression, and may be any one or more of the base sequences shown in SEQ ID NOs: 7 to 10 below.

Specifically, the shRNA may be a complementary sequence to any one of SEQ ID NOs: 3 to 6 commonly found in mouse and human ZBTB16 mRNA, preferably SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10. It may be any one sequence selected from among the displayed base sequences. Each of the base sequences may be palindromically connected by a loop region of 4 to 10 bp to form a hairpin structure.

SEQ ID NO: 7: TAGAGGTACGTCTTCTCTATCCTCCAGTC

SEQ ID NO: 8: TTGAGGCTGAACTTCTTGCCACAGCCATT

SEQ ID NO: 9: GGTCATCCAGGTCCTCCGCCTTGGCTTGC

SEQ ID NO: 10: CCACTCTCCTCGCTGGAATGCTTCGAGAT

As a substance that inhibits the expression of ZBTB16 by RNAi, shRNA (short hairpin RNA) consisting of a short hairpin structure with a protrusion at the 3' end can also be used. The substance that inhibits the expression of ZBTB16 by RNAi may be artificially chemically synthesized, or DNA with a hairpin structure in which the DNA sequences of the sense strand and antisense strand are linked in the reverse direction can be synthesized under laboratory conditions (in vitro) using T7 RNA polymerase. It is okay to produce it by synthesizing RNA. When synthesized under laboratory conditions, antisense and sense RNA can be synthesized from template DNA using T7 RNA polymerase and the T7 promoter. After annealing them under laboratory conditions, when introduced into cells, RNAi is induced and the expression of ZBTB16 is suppressed. Introduction into cells can be performed, for example, by the calcium phosphate method or by methods using various transfection reagents (for example, oligofectamine, lipofectamine, lipofection, etc.).

As a substance that inhibits the expression of ZBTB16 by RNAi, shRNA or an expression vector containing the above DNA may be used, or cells containing the above expression vector may be used. The type of the expression vector or cell is not particularly limited, but expression vectors or cells that are already used as medicine are preferred.

The vector refers to a means for expressing a target gene in a host cell. The vector contains elements for expression of the target gene, and may include a replication origin, a promoter, an operator, a transcription termination sequence, etc., and may be inserted into the genome of the host cell. Appropriate enzymatic sites (e.g., restriction enzyme sites) for introduction and/or ribosome binding site (RBS) for translation into proteins and/or selectable markers to confirm successful introduction into host cells, IRES (Internal Ribosome Entry Site) may additionally be included. The vector may additionally include transcriptional control sequences (eg, enhancers, etc.) other than the promoter.

In addition, the vector may be plasmid DNA, recombinant vector, or other carrier known in the art, and specifically, linear DNA plasmid DNA, recombinant non-viral vector, recombinant viral vector, or inducible gene expression vector system. system), and the recombinant viral vector may include retrovirus, adenovirus, adeno associated virus, helper-dependent adenovirus, herpes simplex virus ( It may be a herpes simplex virus, lentivirus, or vaccinia virus vector, but is not limited thereto.

The method for introducing the expression vector into cells is not particularly limited as long as it is a known method, but is preferably liposome-mediated transfection, calcium phosphate method, DEAE-dextran-mediated transfection, positively charged lipid-mediated transfection, electroporation, or phage system. It may include one or more methods selected from transduction using or infection using a virus.

Therefore, the present invention may include a recombinant expression vector for expressing the shRNA. At this time, shRNA with the base sequence shown in SEQ ID NO: 2 as the target sequence can be used. The recombinant vector is not particularly limited as long as it is a recombinant DNA method known in the art.

The shRNA is used in any one carrier selected from the group consisting of recombinant adenovirus, adeno-associated viruses (AAV), retrovirus, lentivirus, herpes simplex virus, bassinia virus, liposome, and niosome. can be delivered by

The agent capable of inhibiting the activity of the ZBTB16 protein may include any one or more selected from the group consisting of compounds, peptides, aptamers, proteins, and antibodies that can specifically bind to the ZBTB16 protein.

In one embodiment of the present invention, the substance capable of inhibiting the expression or activity of the ZBTB16 protein may also include a degenerative brain disease treatment substance screened according to the degenerative brain disease treatment substance screening method described above.

By inhibiting the expression or activity of ZBTB16 according to the embodiments described herein, degenerative brain diseases or mental and behavioral disorders resulting therefrom can be prevented or treated.

The pharmaceutical composition may be used for preventing or treating degenerative brain diseases. Additionally, the pharmaceutical composition may be provided in any formulation suitable for topical application. For example, it may be any route selected from the group consisting of oral administration, transdermal administration, intravenous administration, intramuscular administration, subcutaneous injection, and intrabrain administration.

The pharmaceutical composition according to the present invention can be formulated in a suitable form with a commonly used pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, water, suitable oils, saline solutions, carriers for parenteral administration such as aqueous glucose and glycol, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. In addition, the pharmaceutical composition according to the present invention may be used as a suspending agent, solubilizing agent, stabilizer, isotonic agent, preservative, anti-adsorption agent, surfactant, diluent, excipient, pH adjuster, analgesic agent, and buffer, if necessary depending on the administration method or dosage form. , antioxidants, etc. may be appropriately included. Pharmaceutically acceptable carriers and formulations suitable for the present invention, including those exemplified above, are described in detail in Remington's Pharmaceutical Sciences, current edition.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art to which the present invention pertains. Alternatively, it can be manufactured by placing it in a multi-capacity container.

Additionally, the pharmaceutical composition may be administered by any device capable of moving the active ingredient to target cells. Specifically, an administration method using a non-invasive catheter may be used. The pharmaceutical composition of the present invention may be contained in a therapeutically effective amount for the treatment of diseases. In the present invention, the term 'treatment', unless otherwise stated, means reversing, alleviating, suppressing the progression of, or preventing one or more symptoms of the disease or disease to which this term applies. In addition, the term 'therapeutically effective amount' refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in tissue systems, animals, or humans as considered by researchers, veterinarians, doctors, or other clinicians, which means treatment. Includes an amount that induces relief of symptoms of the disease or disorder. It is obvious to those skilled in the art that the active ingredients included in the pharmaceutical composition of the present invention will vary depending on the effect.

Therefore, the optimal pharmaceutical composition content can be easily determined by a person skilled in the art, depending on the type of disease, the severity of the disease, the content of other ingredients contained in the composition, the type of dosage form, and the patient's age, weight, general health, gender, and diet. , can be adjusted according to various factors, including administration time, administration route and secretion rate of the composition, treatment period, and concurrently used drugs.

Regarding gene delivery, such as shRNA expression vectors that suppress ZBTB16 expression, the method is not particularly limited as long as shRNA or shRNA expression vectors that suppress ZBTB16 expression are expressed in the cells to be applied. For example, viral vectors, liposomes, etc. It is possible to use gene introduction using . Examples of viral vectors include animal viruses such as retrovirus, vaccinia virus, adenovirus, and Shinlinsemliki virus. Substances that inhibit ZBTB16 expression by RNAi may be injected directly into cells.

It is important to consider all of the above factors and include an amount that can achieve the maximum effect with the minimum amount without side effects. For example, the dosage of the composition of the present invention is about 1x10 ⁴ particles to 1x10 ¹² particles per kg of an adult as an active ingredient. However, the dosage may be prescribed in various ways depending on factors such as formulation method, administration method, patient's age, weight, gender, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity, and those skilled in the art will Taking these factors into consideration, the dosage can be adjusted appropriately. The number of administrations can be once or twice or more within the range of clinically acceptable side effects, and the administration site can be administered to one or two or more sites. For animals other than humans, the dosage per kg is the same as that for humans, or the above dosage is determined based on the volume ratio (e.g., average value) of the ischemic organ (e.g., heart, etc.) between the target animal and the human. The converted amount can be administered. Examples of animals subject to treatment according to the present invention include humans and other mammals, specifically humans, monkeys, mice, rats, rabbits, sheep, cows, dogs, goats, horses, pigs, etc. This is included.

Since the shRNA of the present invention inhibits ZBTB16 expression, the pharmaceutical composition of the present invention can be used to treat various diseases or disorders related to degenerative brain diseases, such as Alzheimer-type dementia, Lewy body dementia, and frontotemporal dementia ( frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, Down's syndrome, Huntington's disease, amyotrophic lateral sclerosis, spinocerebellar Spinocerebellar Atrophy, Tourette's Syndrome, Friedrich's Ataxia, Machado-Joseph's disease, Lewy Body Dementia, Muscle Dystrophy It can be used to treat dystonia and progressive supranuclear palsy. In this specification, the term “treatment” refers to (i) relieving or suppressing symptoms of degenerative brain disease; (ii) Alleviating or alleviating mental and behavioral disorders caused by degenerative brain diseases; and (iii) inhibition of degenerative brain disease by promoting autophagy of disease proteins related to degenerative brain disease. Accordingly, the term “therapeutically effective amount” as used herein refers to an amount sufficient to achieve the above-mentioned pharmacological effect.

Hereinafter, the present invention will be described in more detail through examples, etc., but the scope and content of the present invention should not be construed as being reduced or limited by the examples below. In addition, based on the disclosure of the present invention, including the following examples, it is clear that a person skilled in the art can easily implement the present invention for which no specific experimental results are presented, and the patent to which such variations and modifications are attached It is natural that it falls within the scope of the claims.

In addition, the experimental results presented below describe only the representative experimental results of the examples and comparative examples, and the effects of each embodiment of the present invention that are not explicitly presented below will be described in detail in the corresponding section.

Experimental Example 1. Dementia animal model (APPPS1)

In this experiment, 5-month-old APP/PS1 mice were prepared to be used as experimental animals. The APP/PS1 mouse is a representative animal model of Alzheimer's dementia that has been genetically mutated to overproduce beta amyloid (Aβ). This is APPswe/PSEN1dE9(line 85)(The Jackson Lab; available through the JAX MMRRC Stock# 034829(formerly Jackson Lab Stock # 004462))(https://www.alzforum.org/research-models/appswepsen1de9-line-85 ) line, which was provided and used by the KIST Research Animal Resource Center, which maintains and sells it. During the experiment, animals were allowed to consume standard rodent diet and water as desired, and were handled in accordance with strict approval from the Animal Care and Use Committee of the Korea Institute of Science and Technology. The experimental animals were allowed to adapt for one week, and general behavioral abnormalities were observed. Animals found to have abnormalities were not used in this experiment. All experimental animals were allowed to freely consume water and feed under conditions of 12 hours of sunlight and 12 hours of light in a breeding facility with constant temperature and constant humidity during the experiment period.

The control group (WT+GFP) was used as a control group that was not genetically modified to overproduce beta amyloid (Aβ).

Experimental Example 2. Preparation of ZBTB16 protein knockdown dementia animal model (APPPS1+shZtbt16)

pGFP-C-shLenti-Zbtb16 shRNA vector (ORIGENE) expressing shRNA (SEQ ID NO: 7: 5'-TAGAGGTACGTCTTCTCTATCCTCCAGTC-3') for the Zbtb16 gene (SEQ ID NO: 2) from ORIGENE (USA) and a specific portion as a negative control pGFP-C-shLenti-untargeted shRNA control vector (TR30021), which expresses shRNA with a random sequence, was purchased.

Lentivirus expressing Zbtb16 shRNA or control shRNA was prepared using the vector, third-generation packaging system (pMDLg/pRRE, pRSV-Rev, pMD2.G), and HEK293 T cell line according to the manufacturer's manual. HEK293T cell culture containing lentivirus was concentrated by ultracentrifugation at 50,000 g for 90 minutes at 4°C. Thereafter, the titer of the lentivirus concentrate was determined using the Lenti-X™ p24 Rapid Titer Kit (clontech, USA).

2×10 ⁶ transduction units/ml of recombinant lentivirus were introduced into the corpus callosum of the dementia animal model (APPPS1) (5 months old) of Experimental Example 1 and the normal animal model (WT), respectively, and the control group (WT+ GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZtbt16) were prepared. At this time, a Nanofil 33G smooth needle, Nanofil syringe (World Precision Instrument), and micro syringe pump (Eicom) were used. A ZBTB16 protein knockdown dementia animal model (APPPS1+shZtbt16) was produced (6 months old) by rearing for 1 month, and a control group (WT+GFP) and dementia animal model (APPPS1+GFP) for comparative experiments were also reared for 1 month under the same conditions. Manufactured (6 months old).

During the experimental period, the animal model was allowed to drink water and feed freely under conditions of 12 hours of sunlight and 12 hours of light in a breeding facility with constant temperature and constant humidity.

Experimental Example 3. Verification of degenerative brain disease biomarkers

In the present invention, a control group (WT+GFP) and a dementia animal model (APPPS1+GFP) were prepared as in Experimental Example 1, and they were reared for 1 month like the ZBTB16 protein knockdown dementia animal model, and the experiment was performed at 6 months of age. These were randomly assigned to 8 individuals each. Immunohistochemical staining was performed to evaluate ZBTB16 protein expression in the animal model. The control group (WT) and the dementia animal model (APPPS1) were each anesthetized and perfused, and then the brains were extracted and the brain tissues were fixed with 4% PFA. Tissues of the striatum and nucleus accumbens were obtained from the brain tissue, and mouse anti-ZBTB16 antibody (D-9; sc-28319, Santa Cruz Biotechnology, Santa Cruz, CA) was attached to the tissues of the striatum and nucleus accumbens, respectively ( 4℃, overnight). Next, the tissue was treated with biotinylated anti-mouse secondary antibody, and then dyed for color development. At this time, cell nuclei were stained with DAPI.

Figure 2 shows the level of ZBTB16 protein expression measured in the dorsal striatum and nucleus accumbens (NAc) in brain tissue (Brain) isolated from the control group (WT) and dementia animal model (APPPS1) using immunohistostaining. It is a result.

As shown in Figure 2, it can be seen that the expression of ZBTB16 protein was significantly increased in the dorsal striatum of the dementia animal model. After animal testing, ZBTB16 protein expression was examined in each animal through immunostaining. As a result, the expression level of ZBTB16 protein was significantly increased in the dementia animal model, providing information for diagnosis of degenerative brain diseases including dementia through ZBTB16 protein. You can see that it can be done.

Experimental Example 4. Investigation of the effect of ZBTB16 knockdown on memory and cognitive ability of dementia animal model

Two types of cognitive function tests (Y-maze test and novel object recognition test) were performed on the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) in Experimental Example 2. It was carried out.

4-1. Y-maze test (YMT)

The experimental animals were placed at the end of a three-branched Y-maze (42 was observed. After designating each branch as A, B, and C, all four feet must enter one branch completely to count as one entry. The case of entering three different branches one after another was defined as spontaneous alternation behavior. Alternation score (%) was calculated using the following formula.

Alternation(%)=[(Number of alternations)/(Total number of entries-2)] × 100

4-2. novel object recognition test (NOR)

The novel object recognition test is a modification of the existing method and consists of an adaptor, explorer, and novel object recognizer. After the mice were placed in an open field for 10 minutes each for two days and allowed to adapt, two identical objects were placed at regular intervals. The experimental animals were allowed to explore freely for 3 minutes, and the time they spent on each object was measured using Ethovision, and then returned to the cage for 30 minutes. Then, one of the installed objects was replaced with a new material, and the movements of the experimental animals were measured for 3 minutes. The object preference (recognition index (%)) was calculated by converting the time spent on each object into a percentage out of the total exploration time.

For statistical analysis of the experiment, paired t-test was used to confirm the significant difference in mean values between groups. If the p value was lower than 0.05, *, if the p value was lower than 0.01, **, if the p value is lower than 0.001, the significant difference is indicated by ***, and if there is no significant difference, the significant difference is indicated by N.S. Error bars represent S.E.M.

Figure 3 is a graph showing the results of the Y-maze test (YMT) for the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16).

As a result of examining the spontaneous behavioral changes in Figure 3, it was confirmed that the control group (WT+GFP) and the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) were at similar levels. In the dementia animal model (APPPS1+GFP), it increased to over 80%, but showed no significant difference compared to the control group.

In general, cognitive decline due to dementia appears from the age of 12 months, so most dementia-related experiments use the age of 12 months. However, the purpose of the present invention is to examine whether early diagnosis of dementia can be made in a dementia risk group without cognitive symptoms and the effect of improving, preventing or treating prodromal symptoms (mental symptoms) that occur in the early stages of dementia, so the animal of the present invention In the experiment, 6-month-old mice, which are 6 months younger than 12-month-old mice, were used. Therefore, although dementia was clearly induced, the results of the YMT experiment showed no significant differences between the control group, the dementia animal model, and the ZBTB16 knockdown dementia animal model. This is a result consistent with what the present inventor expected.

Figure 4 is a graph showing the results of a novel object recognition test (NOR) for the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16). In the drawing, N refers to a new material (Novel), and F refers to an existing object (familiar).

As a result of the new material search evaluation shown in Figure 4, it was confirmed that the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) were at similar levels.

In general, cognitive decline due to dementia appears from the age of 12 months, so most dementia-related experiments use the age of 12 months. However, the purpose of the present invention is to examine whether early diagnosis of dementia can be made in a dementia risk group without cognitive symptoms and the effect of improving, preventing or treating prodromal symptoms (mental symptoms) that occur in the early stages of dementia, so the animal of the present invention In the experiment, 6-month-old mice, which are 6 months younger than 12-month-old mice, were used. Therefore, even though early dementia was induced by the accumulation of beta-amyloid, the results of the YMT experiment showed that there was no significant difference between the control group, the dementia animal model, and the ZBTB16 knockdown dementia animal model, which is consistent with what the present inventors expected. It is a result.

Experimental Example 5. Investigation of the effect of ZBTB16 knockdown on social skills in animal models of dementia

5-1. 3CT (3-chamber test) behavioral experiment

During a behavioral experiment to check the sociability of mice to determine whether the dementia animal model (APPPS1+GFP) and the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared by the method of Experimental Example 2 above show negative symptoms due to early dementia. The most widely used 3-chamber test (3CT) behavioral experiment was performed.

Specifically, a measuring mouse (6 months old, male) was placed in an EthoVision XT 11.5 (manufactured by Noldus, Netherlands) in the middle room of three consecutive rooms separated by a transparent wall, and a live mouse (S1) was placed in one of the two rooms. ), an inanimate object (O) was placed in the opposite room, or a familiar mouse (S1) and a new mouse (S2) were placed. The longer you stay in either room, the longer it is marked in red. The test was performed for 10 minutes, and a normal animal model (WT+GFP) was used as a control group.

For statistical analysis of the experiment, paired t-test was used to confirm the significant difference in mean values between groups. If the p value was lower than 0.05, *, if the p value was lower than 0.01, **, if the p value is lower than 0.001, the significant difference is indicated by ***, and if there is no significant difference, the significant difference is indicated by N.S. Error bars represent S.E.M.

Figure 5 is a diagram showing the results of the 3-chamber test (3CT) of the dementia animal model (APPPS1+GFP), the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP) prepared according to the present invention. 5a shows interest in inanimate objects (0) and living mice (S1) of the dementia animal model (APPPS1+GFP) prepared according to the present invention, the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP). It is a diagram showing the degree, and Figure 2b is a familiar mouse (S1) and a new mouse of the dementia animal model (APPPS1+GFP), ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and control group (WT+GFP) prepared according to the present invention. This is a diagram showing the level of interest in the mouse (S2).

As shown in Figure 5, the phenomenon of showing higher interest in a living mouse (S1) than in an inanimate object (0) was confirmed to occur normally in the dementia animal model (APPPS1+GFP).

However, in Figure 5b, the control group (WT+GFP) spends more time and interacts with the new mouse (S2) than with the familiar mouse (S1), whereas the dementia animal model (APPPS1+GFP) spends more time interacting with the familiar mouse (S1). It was confirmed that the level of interest in the new mouse (S2) was similar (decreased sociability). On the other hand, the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) was found to spend more time and interact with new mice (S2) than with familiar mice (S1), similar to the control group.

Through the above-mentioned results, it was found that the dementia animal model (APPPS1+GFP), which was genetically mutated to overproduce beta amyloid (Aβ), showed symptoms of decreased curiosity and intimacy with new mice and lack of social sensitivity. You can.

It was confirmed that when the expression of ZBTB16 protein was specifically suppressed in the brain of the dementia animal model, curiosity and intimacy with new mice increased and symptoms of lack of social sensitivity were restored to normal levels.

Experimental Example 6. Investigation of the effect of ZBTB16 knockdown on anxiety in dementia animal models

The level of anxiety of each experimental animal was confirmed through the following experiment.

6-1. Elevated plus maze test (EPM)

The elevated cross maze experiment is conducted based on the premise that mice naturally dislike bright, open spaces and engage in voluntary exploration activities in new environments. The elevated cross maze apparatus consists of two open arms (30x5 cm) and two closed arms (5x30 cm, walls 15 cm high) extending from a common central platform (5x5 cm). It has been done. The structure was formed in the shape of a plus-sign with corresponding branches arranged to face each other. The device is raised 50 cm above floor level.

Mice belonging to the three groups were placed in the elevated cross maze apparatus and observed for 7 minutes each. Each experimental animal was individually placed in the center of the open range, and the time it stayed on each open branch was measured. Behavioral observation videos were captured using a video camera connected to software (Smart Junior, Panlab SL, Barcelona, Spain). Afterwards, the time the mouse stayed was measured every second through video file analysis using video tracking software, and the results are shown in Figure 6.

6-2. Light-dark box test (LDB)

The light/dark movement test is conducted based on the premise that mice naturally dislike bright light and engage in voluntary exploration activities in new environments. In the light/dark movement test, experimental animals belonging to the above three groups are placed in a mouse cage in which a light box and a dark box are connected by a connecting passage, and observed for 10 minutes. The lag time until the first time they leave the light room is measured. , the time spent in the light room, and the frequency of movement between each dark room and light room were measured. The frequency is an index that measures anti-anxiety function.

In the light-dark shift test, the results of the dementia animal model (APPPS1+GFP), the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP) were compared, and the results are shown in Figure 7.

6-3. statistics

For statistical analysis of the experiment, a one-way ANOVA test was used to confirm the significant difference in mean values between groups. If the p value was lower than 0.05, *, if the p value was lower than 0.01, * *, if the p value is lower than 0.001, *** is indicated, and if there is no significant difference, significant difference is indicated as N.S. Error bars represent S.E.M.

6-4. Analysis

Figure 6 is a diagram showing the results of the elevated cross maze test (EMP) of the dementia animal model (APPPS1+GFP), the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and the control group (WT+GFP) prepared according to the present invention.

As shown in Figure 6, it was confirmed that the time spent in the open branches was significantly reduced in the dementia animal model (APPPS1+GFP). It can be seen that the time spent in open branches increased in the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) to a similar level as the control group (WT+GFP). In other words, it was confirmed that when early dementia developed due to beta-amyloid accumulation, the time spent in bright, open spaces was significantly shortened. In other words, it can be seen that anxiety symptoms increase among mental and behavioral disorders despite early dementia in which memory and cognitive function are not significantly reduced due to beta-amyloid accumulation. At this time, it can be seen that when ZBTB16 protein expression is suppressed, anxiety symptoms, a mental and behavioral disorder of early dementia, are significantly improved to a level similar to normal levels.

Figure 7 is a diagram showing the results of the light-dark locomotion test (LDB) of a dementia animal model (APPPS1+GFP), a ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and a control group (WT+GFP).

As shown in Figure 7, the time spent in the light room in the dementia animal model (APPPS1+GFP) was significantly reduced compared to the control group (WT+GFP). In contrast, the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) stayed in the light room for a long time at a similar level to the control group (WT+GFP), and the frequency of movement between the dark room and the light room was significantly increased.

In other words, it can be seen that anxiety symptoms increase among mental and behavioral disorders despite early dementia in which memory and cognitive function are not significantly reduced due to beta-amyloid accumulation. At this time, it can be seen that when ZBTB16 protein expression is suppressed, anxiety symptoms, a mental and behavioral disorder of early dementia, are significantly improved to a level similar to normal levels.

Experimental Example 7. Analysis of autophagy phenomenon due to ZBTB16 protein inhibition

7-1. Immunohistochemical staining

In order to determine the extent of p62 protein activity and autophagy phenomenon due to ZBTB16 protein inhibition according to the present invention, immunohistostaining was performed using p62 and LC3 as markers.

A dementia animal model (APPPS1+GFP) prepared according to Experimental Example 2 and a ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) were prepared, and brain tissue frozen sections were prepared from them according to Experimental Example 3.

The sections were treated with primary antibodies (anti-LC3; Novus Biologicals; NB100-2220, anti-p62; Abcam; ab91526), and secondary antibodies (Goat anti-Rabbit IgG; Alexa Fluor 488, Goat anti-Mouse IgG; Alexa Fluor 594) was used. After washing with PBS three times and staining with DAPI for intracellular nuclear staining, the expression levels of p62 and LC3 were observed through confocal microscopy. The results are shown in Figures 8 and 9. The immunohistostaining method was schematically representative from at least three independent experiments.

Figure 8 shows the results of measuring the expression levels of LC3 and p62 in the dorsal striatum of brain tissue isolated from the dementia animal model (APPPS1+GFP) prepared according to the present invention by immunohistostaining, and Figure 9 shows the results of the present invention. This is the result of measuring the expression levels of LC3 and p62 in the dorsal striatum of brain tissue isolated from the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to this method using immunohistostaining.

As shown in Figures 8 and 9, it was confirmed that LC3 increased and p62 decreased in the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) compared to the dementia animal model (APPPS1+GFP). In other words, it was confirmed that autophagy phenomenon increased when the expression of ZBTB16 was suppressed in a dementia animal model.

In other words, it can be inferred that when dementia develops due to beta-amyloid accumulation, autophagy is reduced within brain tissue and disease proteins are not removed and accumulate, so the symptoms of the disease gradually become more severe. Inhibiting the expression of the ZBTB16 protein by treating it with shRNA increases and restores autophagy in brain tissue to remove disease proteins, thereby significantly improving, preventing, or treating mental and behavioral disorders in degenerative brain diseases.

Experimental Example 8. Analysis of autophagy phenomenon due to ZBTB16 protein inhibition - 12 months of age

8-1. 12 month old (12mo) animal testing

Experimental example except that the control group (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared from Experimental Example 1 were prepared and reared for 7 months instead of 1 month. In the same manner as in 2, a 12-month-old (12mo) control group (WT+GFP), a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) were prepared.

8-2. Immunohistochemical staining

In order to confirm the autophagy phenomenon that accompanies the process of dementia onset, we sought to identify LC3, an autophagy marker protein, and p62, an autophagy matrix protein.

Prepare 12-month-old (12mo) control (WT+GFP), dementia animal model (APPPS1+GFP), and ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to 8-1, anesthetize and perfuse each, and then brain. The brain tissue was extracted and fixed with 4% PFA. Tissues from the striatum and nucleus accumbens were obtained from the brain tissue, freeze-dried, and frozen sections of brain tissue were prepared.

Primary antibody (anti-LC3; Novus Biologicals; NB100-2220, anti-p62; Abcam; ab91526) or mouse anti-ZBTB16 antibody (D-9; sc-28319, Santa Cruz Biotechnology, Santa Cruz, CA) was applied to the sections. was treated with secondary antibodies (Goat anti-Rabbit IgG; Alexa Fluor 488, Goat anti-Mouse IgG; Alexa Fluor 594) or biotinylated anti-mouse secondary antibodies. The cells were again washed three times with PBS, stained with DAPI to stain the intracellular nuclei, and the expression level of p62 was observed through a confocal microscope. The results are shown in Figures 11 and 13. The immunohistostaining method was schematically representative from at least three independent experiments.

Figure 11 shows the results of measuring the expression levels of ZBTB16 and p62 from the dorsal striatum in brain tissue isolated from a 12-month-old control group (WT+GFP (12mo)) using immunohistostaining, and Figure 12 shows the results of measuring the expression levels of ZBTB16 and p62 in a 12-month-old dementia animal model. (APP/PS1+GFP(12mo)) shows the results of measuring the expression levels of ZBTB16 and p62 from the dorsal striatum using immunohistostaining in brain tissue isolated from the brain tissue, and Figure 13 shows the results of a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1). This is the result of measuring the expression levels of ZBTB16 and p62 in the dorsal striatum of brain tissue isolated from +shZbtb16) using immunohistostaining.

As shown in Figures 11 and 12, compared to the 12-month-old control group (WT+GFP(12mo)), the expression of ZBTB16 was increased in the 12-month-old dementia animal model (APP/PS1+GFP(12mo)), and the autophagy matrix protein, It was confirmed that the expression level of p62 also increased. In other words, when dementia develops, the expression level of ZBTB16 increases and the autophagy phenomenon decreases.

Next, as shown in Figure 13, the expression level of ZBTB16 was reduced in the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) compared to the dementia animal model (APPPS1+GFP), and p62 was confirmed to be restored to the normal level. In other words, it was confirmed that autophagy phenomenon increased when the expression of ZBTB16 was suppressed in a dementia animal model.

In other words, it can be inferred that when dementia develops due to beta-amyloid accumulation, autophagy is reduced within brain tissue and disease proteins are not removed and accumulate, so the symptoms of the disease gradually become more severe. Inhibiting the expression of the ZBTB16 protein by treating it with shRNA increases and restores autophagy in brain tissue to remove disease proteins, thereby significantly improving, preventing, or treating mental and behavioral disorders in degenerative brain diseases.

Experimental Example 9. Investigation of the effect of ZBTB16 knockdown on social skills in animal models of dementia - 12 months of age

9-1. 3CT (3-chamber test) behavioral experiment

A 12-month-old normal animal model (control group (WT+GFP)), a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared by the method of Experimental Example 8-1 above showed dementia. In order to check whether negative symptoms were displayed according to the 3CT (3-chamber test) behavioral experiment, which is the most widely used behavioral experiment to check the sociality of mice, was performed.

Specifically, a measuring animal model (12 months old, male) was placed in EthoVision XT 11.5 (manufactured by Noldus, Netherlands) in the middle room of three consecutive rooms separated by a transparent wall, and a live mouse (manufactured by Noldus, Netherlands) was placed in one of the two rooms. S1), an inanimate object (O) was placed in the opposite room, or a familiar mouse (S1) and a new mouse (S2) were placed. The longer you stay in either room, the longer it is marked in red. The test was performed for 10 minutes, and the 12-month-old control group (WT+GFP) prepared in Experimental Example 8-1 was used as the control group.

For statistical analysis of the experiment, paired t-test was used to confirm the significant difference in mean values between groups. If the p value was lower than 0.05, *, if the p value was lower than 0.01, **, if the p value is lower than 0.001, the significant difference is indicated by ***, and if there is no significant difference, the significant difference is indicated by N.S. Error bars represent S.E.M.

Figure 14 shows the 3-chamber test (3CT) results of a 12-month-old dementia animal model (APPPS1+GFP), a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and a 12-month-old control group (WT+GFP) prepared according to the present invention. 14A is a diagram showing inanimate objects of a 12-month-old dementia animal model (APPPS1+GFP), a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), and a 12-month-old control group (WT+GFP) prepared according to the present invention. (0) and a diagram showing the degree of interest (3CT: sociability) for a living mouse (S1), and Figure 14b shows a 12-month-old dementia animal model (APPPS1+GFP) prepared according to the present invention, and a 12-month-old ZBTB16 knockdown dementia animal model. This figure shows the degree of interest (3CT: novelty) in familiar mice (S1) and new mice (S2) in (APPPS1+shZbtb16) and the 12-month-old control group (WT+GFP).

As shown in Figure 14a, the phenomenon of showing higher interest in a living mouse (S1) than an inanimate object (0) was confirmed to occur normally in a 12-month-old dementia animal model (APPPS1+GFP).

However, in Figure 14b, the control group (WT+GFP) spends more time and interacts with the new mouse (S2) than with the familiar mouse (S1), whereas the dementia animal model (APPPS1+GFP) spends more time interacting with the familiar mouse (S1). It was confirmed that the level of interest in the new mouse (S2) was similar (decreased social skills; G③). On the other hand, the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) was found to spend more time and interact with new mice (S2) than with familiar mice (S1), similar to the control group. In other words, it was confirmed that symptoms of social decline caused by dementia could be restored to normal levels by suppressing ZBTB16 expression.

Through the above-mentioned results, it was found that the dementia animal model (APPPS1+GFP), which was genetically mutated to overproduce beta amyloid (Aβ), showed symptoms of decreased curiosity and intimacy with new mice and lack of social sensitivity. You can.

It was confirmed that when ZBTB16 protein expression was specifically suppressed in the brain of the dementia animal model, curiosity and intimacy with new mice increased and symptoms of lack of social sensitivity were restored to normal levels. In other words, it can be seen that ZBTB16 shows dementia prevention, treatment, and recovery effects not only in the dementia risk group without cognitive symptoms (6-month-old mice) but also in the dementia group with cognitive symptoms (12-month-old mice).

Experimental Example 10. Investigation of the effect of ZBTB16 knockdown on memory and cognitive ability in dementia animal model - 12 months old

Two types of cognitive function tests (Y -maze test and novel object recognition test) were conducted.

10-1. Y-maze test (YMT)

The Y maze experiment was conducted as a method to evaluate short-term memory and sequential action ability. The experimental animals were placed at the end of a three-branched Y-maze (42 was observed. After designating each branch as A, B, and C, all four feet must enter one branch completely to count as one entry. The case of entering three different branches one after another was defined as spontaneous alternation behavior. Alternation score (%) was calculated using the following formula. The experimental animals included a 12-month-old normal animal model (control group (WT+GFP)) prepared by the method in Experimental Example 8-1, a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16). ) was used, and the results were compared.

Alternation(%)=[(Number of alternations)/(Total number of entries-2)] × 100

10-2. novel object recognition test (NOR)

The new substance search test is a modification of the existing method and consists of an adaptor, explorer, and new substance recognizer. After the mice were placed in an open field for 10 minutes each for two days and allowed to adapt, two identical objects were placed at regular intervals. The experimental animals were allowed to explore freely for 3 minutes, and the time they spent on each object was measured using Ethovision, and then returned to the cage for 30 minutes. Then, one of the installed objects was replaced with a new material, and the movements of the experimental animals were measured for 3 minutes. Object preference was converted into a percentage of the time spent on each object out of the total exploration time.

The experimental animals included a 12-month-old normal animal model (control group (WT+GFP)) prepared by the method in Experimental Example 8-1, a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16). ) was used, and the results were compared.

For statistical analysis of the experiment, paired t-test was used to confirm the significant difference in mean values between groups. If the p value was lower than 0.05, *, if the p value was lower than 0.01, **, if the p value is lower than 0.001, the significant difference is indicated by ***, and if there is no significant difference, the significant difference is indicated by N.S. Error bars represent S.E.M.

Figure 15 is a Y-maze of a 12-month-old normal animal model (control group (WT+GFP)), a 12-month-old dementia animal model (APPPS1+GFP), and a 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16) prepared according to the present invention. A graph showing the results of the test (YMT) (left) and a graph showing the results of the novel object recognition test (NOR) (right).

As shown in Figure 15, it was confirmed that the altered behavioral ability of the 12-month-old dementia animal model (APPPS1+GFP) was significantly reduced compared to the normal animal model (control group (WT+GFP)). In other words, it can be seen that memory and attention concentration are significantly reduced due to dementia.

On the other hand, in the case of the 12-month-old ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), in which the expression of ZBTB16 was suppressed, the altered behavioral ability was confirmed to be significantly increased compared to the dementia animal model (APPPS1+GFP). In other words, if ZBTB16 protein expression is suppressed, memory and attention concentration deteriorated by dementia are restored to normal levels.

The new substance search test can evaluate cognitive ability and memory. In the normal animal model (WT+GFP), the time spent on the new substance was significantly longer than the time spent on the familiar substance, while in the dementia animal model (APPPS1+GFP), there was no significant difference in the time spent on the two substances.

On the other hand, in the ZBTB16 knockdown dementia animal model (APPPS1+shZbtb16), it was confirmed that the time spent on new substances significantly increased compared to the time spent on familiar substances, at a similar level to the control group (WT+GFP).

In other words, in a state of dementia in which memory and cognitive functions are greatly reduced due to beta-amyloid accumulation, suppressing the expression of ZBTB16 protein significantly restores cognitive ability, memory, and attention due to dementia to a level similar to normal levels.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Use of ZBTB16 in Neurodegenerative Disorders <130>HPC9928 <150> KR 10/2021/0010583 <151> 2021-01-26 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 673 <212> PRT <213> Artificial Sequence <220> <223> ZBTB16 protein <400> 1 Met Asp Leu Thr Lys Met Gly Met Ile Gln Leu Gln Asn Pro Ser His 1 5 10 15 Pro Thr Gly Leu Leu Cys Lys Ala Asn Gln Met Arg Leu Ala Gly Thr 20 25 30 Leu Cys Asp Val Val Ile Met Val Asp Ser Gln Glu Phe His Ala His 35 40 45 Arg Thr Val Leu Ala Cys Thr Ser Lys Met Phe Glu Ile Leu Phe His 50 55 60 Arg Asn Ser Gln His Tyr Thr Leu Asp Phe Leu Ser Pro Lys Thr Phe 65 70 75 80 Gln Gln Ile Leu Glu Tyr Ala Tyr Thr Ala Thr Leu Gln Ala Lys Ala 85 90 95 Glu Asp Leu Asp Asp Leu Leu Tyr Ala Ala Glu Ile Leu Glu Ile Glu 100 105 110 Tyr Leu Glu Glu Gln Cys Leu Lys Ile Leu Glu Thr Ile Gln Ala Ser 115 120 125 Asp Asp Asn Asp Thr Glu Ala Thr Met Ala Asp Gly Gly Gly Glu Glu 130 135 140 Glu Glu Asp Arg Lys Ala Arg Tyr Leu Lys Asn Ile Phe Ile Ser Lys 145 150 155 160 His Ser Ser Glu Glu Ser Gly Tyr Ala Ser Val Ala Gly Gln Ser Leu 165 170 175 Pro Gly Pro Met Val Asp Gln Ser Pro Ser Val Ser Thr Ser Phe Gly 180 185 190 Leu Ser Ala Met Ser Pro Thr Lys Ala Ala Val Asp Ser Leu Met Ser 195 200 205 Ile Gly Gln Ser Leu Leu Gln Gly Thr Leu Gln Pro Pro Ala Gly Pro 210 215 220 Glu Glu Pro Thr Leu Ala Gly Gly Gly Arg His Pro Gly Val Ala Glu 225 230 235 240 Val Lys Met Glu Met Met Gln Val Asp Glu Ala Pro Gly Gln Asp Ser 245 250 255 Pro Gly Ala Ala Glu Ser Ser Ile Ser Gly Gly Met Gly Asp Lys Leu 260 265 270 Glu Glu Arg Ser Lys Glu Gly Pro Gly Thr Pro Thr Arg Gly Ser Val 275 280 285 Ile Thr Ser Ala Arg Glu Leu His Tyr Gly Arg Glu Glu Ser Gly Glu 290 295 300 Gln Leu Ser Pro Pro Val Glu Ala Gly Gln Gly Pro Pro Gly Arg Gln 305 310 315 320 Glu Pro Leu Ala Pro Pro Val Glu Lys His Leu Gly Ile Tyr Ser Val 325 330 335 Leu Pro Asn His Lys Ala Asp Ala Val Leu Ser Met Pro Ser Ser Val 340 345 350 Thr Ser Gly Leu His Val Gln Pro Ala Leu Ala Val Ser Met Asp Phe 355 360 365 Ser Thr Tyr Gly Gly Leu Leu Pro Gln Gly Phe Ile Gln Arg Glu Leu 370 375 380 Phe Ser Lys Leu Gly Glu Leu Ala Val Gly Met Lys Ala Glu Ser Arg 385 390 395 400 Pro Leu Gly Glu Gln Cys Ser Val Cys Gly Val Glu Leu Pro Asp Asn 405 410 415 Glu Ala Val Glu Gln His Arg Lys Leu His Ser Gly Met Lys Thr Tyr 420 425 430 Gly Cys Glu Leu Cys Gly Lys Arg Phe Leu Asp Ser Leu Arg Leu Arg 435 440 445 Met His Leu Leu Ala His Ser Ala Gly Ala Lys Ala Phe Val Cys Asp 450 455 460 Gln Cys Gly Ala Gln Phe Ser Lys Glu Asp Ala Leu Glu Thr His Arg 465 470 475 480 Gln Thr His Thr Gly Thr Asp Met Ala Val Phe Cys Leu Leu Cys Gly 485 490 495 Lys Arg Phe Gln Ala Gln Ser Ala Leu Gln Gln His Met Glu Val His 500 505 510 Ala Gly Val Arg Ser Tyr Ile Cys Ser Glu Cys Asn Arg Thr Phe Pro 515 520 525 Ser His Thr Ala Leu Lys Arg His Leu Arg Ser His Thr Gly Asp His 530 535 540 Pro Tyr Glu Cys Glu Phe Cys Gly Ser Cys Phe Arg Asp Glu Ser Thr 545 550 555 560 Leu Lys Ser His Lys Arg Ile His Thr Gly Glu Lys Pro Tyr Glu Cys 565 570 575 Asn Gly Cys Gly Lys Lys Phe Ser Leu Lys His Gln Leu Glu Thr His 580 585 590 Tyr Arg Val His Thr Gly Glu Lys Pro Phe Glu Cys Lys Leu Cys His 595 600 605 Gln Arg Ser Arg Asp Tyr Ser Ala Met Ile Lys His Leu Arg Thr His 610 615 620 Asn Gly Ala Ser Pro Tyr Gln Cys Thr Ile Cys Thr Glu Tyr Cys Pro 625 630 635 640 Ser Leu Ser Ser Met Gln Lys His Met Lys Gly His Lys Pro Glu Glu 645 650 655 Ile Pro Pro Asp Trp Arg Ile Glu Lys Thr Tyr Leu Tyr Leu Cys Tyr 660 665 670 Val <210> 2 <211> 2022 <212> DNA <213> Artificial Sequence <220> <223> ZBTB16 gene <400> 2 atggatctga caaagatggg gatgatccag ctgcagaacc ctagccaccc cacggggctg 60 ctgtgcaagg ccaatcagat gcgactggct gggactttgt gcgatgtggt catcatggtg 120 gacagccagg agttccatgc ccaccggacg gtgctagcct gcaccagcaa gatgtttgag 180 atcctcttcc accgaaacag ccagcactat actctagact tcctctcgcc aaaaaccttc 240 cagcagatcc tggagtacgc ctacacggcc acactgcaag ccaaggcgga ggacctggat 300 gacctgctgt atgcagctga gattttagag atcgaatacc tggaggagca gtgcctgaag 360 atcctggaga ccatccaggc atctgatgac aatgacacag aggccaccat ggctgacggt 420 gggggcgaag aagaagagga ccgtaaggct cgatacctca agaacatctt tatctcgaag 480 cattccagcg aggagagtgg ctacgccagt gtggctggac agagcctccc tgggcccatg 540 gtggaccaga gcccctcagt ctccacctct ttcggtctct cagccatgag tcctaccaag 600 gcagccgtgg acagcttgat gagtatagga cagtcactcc tgcaaggaac tcttcagcca 660 cctgcagggc ctgaggagcc cacactggca gggggtgggc gacaccctgg ggtggctgag 720 gtgaagatgg aaatgatgca ggtagatgaa gcccctggcc aggacagccc tggggcagct 780 gagtctagca tctcaggagg gatgggggac aagcttgaag agaggagcaa agaggggcct 840 gggaccccga ctcgaggcag tgtcatcact agtgccagag agctgcatta tgggagagag 900 gagagtggtg agcagctctc gcctcctgtt gaagctggcc agggaccccc tgggcggcag 960 gagcccctgg cacccccagt ggagaagcat ttgggtatct actcggtgct gcccaaccac 1020 aaggccgatg ctgtgttgag catgccgtct tcagtgacgt ccggtctcca tgtgcaacct 1080 gccctggcag tctccatgga cttcagcacc tacgggggtc tgctgcctca gggcttcatc 1140 cagagggagc tgttcagcaa gctgggggag ctggctgtgg gcatgaaggc tgagagccgc 1200 cctctggggg agcagtgcag cgtgtgtggg gtcgagcttc cggacaacga ggcagtggag 1260 cagcacagga aactgcacag tgggatgaaa acatacgggt gtgaactctg cggaaaacgg 1320 ttcctggaca gtttgcgact gagaatgcat ttactggctc attcagcggg tgccaaagcc 1380 tttgtgtgtg atcaatgcgg tgcccagttc tcaaaggagg atgccctgga gacacacaga 1440 cagacccata ctggcacgga catggctgtc ttctgtctgc tgtgtgggaa acgctttcag 1500 gcacaaagcg cactccagca gcacatggag gtccacgcag gcgtgcgcag ctatatttgc 1560 agtgagtgca accgcacctt ccccagccac acggctctca agcgccacct tcgctcacat 1620 acaggtgacc acccatatga gtgtgagttc tgcggcagct gcttccggga tgagagcaca 1680 ctcaagagcc acaagcgcat ccacacaggg gagaagccct atgagtgtaa tggctgtggc 1740 aagaagttca gcctcaagca ccagttggag acgcactaca gggttcacac aggtgagaag 1800 ccctttgagt gcaaactctg ccaccagcgc tcccgagact actcggccat gatcaagcac 1860 ctgagaacac acaacggtgc ctcgccatac cagtgtacca tctgcacgga atactgcccc 1920 agcctctcct ccatgcagaa acacatgaag ggccacaagc cggagggagat cccacctgac 1980 tggaggatag agaagacgta cctctacctg tgttatgtgt ga 2022 <210> 3 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> a common nucleotide sequence in ZBTB16 mRNA of mouse and human <400> 3 gactggagga tagagaagac gtacctcta 29 <210> 4 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> a common nucleotide sequence in ZBTB16 mRNA of mouse and human <400> 4 aatggctgtg gcaagaagtt cagcctcaa 29 <210> 5 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> a common nucleotide sequence in ZBTB16 mRNA of mouse and human <400> 5 gcaagccaag gcggaggacc tggatgacc 29 <210> 6 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> a common nucleotide sequence in ZBTB16 mRNA of mouse and human <400> 6 atctcgaagc attccagcga ggagagtgg 29 <210> 7 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> shZBTB16 targeting SEQ ID NO: 3 <400> 7 tagaggtacg tcttctctat cctccagtc 29 <210> 8 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> shZBTB16 targeting SEQ ID NO: 4 <400> 8 ttgaggctga acttcttgcc acagccatt 29 <210> 9 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> shZBTB16 targeting SEQ ID NO: 5 <400> 9 ggtcatccag gtcctccgcc ttggcttgc 29 <210> 10 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> shZBTB16 targeting SEQ ID NO: 6 <400> 10 ccactctcct cgctgggaatg cttcgagat 29

Claims (21)

delete delete delete delete delete delete delete delete delete delete delete delete delete A pharmaceutical composition for preventing or treating degenerative brain diseases comprising shRNA represented by SEQ ID NO: 7, which can inhibit the expression or activity of ZBTB16 (Zinc finger and BTB domain-containing protein 16) protein. delete delete delete delete According to clause 14,
The degenerative brain diseases include Alzheimer-type dementia, Lewy body dementia, frontotemporal dementia, cerebrovascular dementia, Parkinson's disease, mild cognitive impairment, A pharmaceutical composition for preventing or treating degenerative brain diseases, characterized in that it has at least one selected from the group consisting of Down's syndrome and Huntington's disease. According to clause 14,
The composition is a pharmaceutical composition for preventing or treating degenerative brain diseases, characterized in that it improves, prevents, or treats mental and behavioral disorders (Behavioral and Psychological Symptoms of Dementia, BPSD) caused by degenerative brain diseases. According to clause 20,
The mental and behavioral disorders (Behavioral and Psychological Symptoms of Dementia (BPSD)) include delusions, hallucinations, agitation, aggression, activity disturbances, depression, and anxiety. (anxiety), diurnal rhythm disturbances, mood swings, irritability, lability, affective lability, defective self-regulation, abnormal repetitive behavior ( A pharmaceutical composition for preventing or treating degenerative brain diseases, characterized in that it has at least one selected from the group consisting of aberrant motor behavior, anxiety and phobias, and sleep disorders.