KR102569068B1 - Anti-PD-L1 antibody - Google Patents

Abstract

Provided is an anti-PD-L1 antibody that can be administered multiple times to animals other than rats. (a) an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and an animal antibody other than rat L chain having an L chain constant region of (b) CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41) An anti-PD-L1 antibody comprising an H chain having an H chain variable region containing CDR3 and an H chain constant region of an animal antibody other than rat. A pharmaceutical composition comprising the anti-PD-L1 antibody as an active ingredient. A method for preparing the anti-PD-L1 antibody is also provided.

Description

Anti-PD-L1 antibody

The present invention relates to an anti-PD-L1 antibody, and more particularly, to a variable region comprising a complementary chain determining region (CDR) of a rat anti-bovine PD-L1 antibody and a constant region of an antibody of an animal other than rat It relates to an anti-PD-L1 antibody having.

The immunosuppressive receptor Programmed death 1 (PD-1) and its ligand Programmed death ligand 1 (PD-L1) suppress excessive immune responses and are deeply involved in immune tolerance, Kyoto University, Honjo Tasuku and others (Non-Patent Document 1: Ishida Y, Agata Y, Shibahara K, Honjo T The EMBO Journal. 1992 Nov; 11 (11): 3887-3895.). It has recently been found to be involved in immunosuppression in tumors, and in human medicine, an antibody drug that inhibits the function of PD-1 has been developed and put into practical use (Ono Pharmaceutical Industry Co., Ltd. "Opdivo (registered trademark)").

Until now, the inventors of the present invention have developed an immunotherapy targeting PD-1 or PD-L1 for intractable animal diseases, and have clarified that this novel immunotherapy can be applied cross-disease and cross-animal. (Non-Patent Document 2: Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology. 2014 Aug; 142 (4): 551-61., Non-Patent Document 3 ：Maekawa N, Konnai S, Ikebuchi R, Okagawa T, Adachi M, Takagi S, Kagawa Y, Nakajima C, Suzuki Y, Murata S, Ohashi K. PLoS One. 2014 Jun 10;9(6)：e98415., B Patent Document 4: Mingala CN, Konnai S, Ikebuchi R, Ohashi K. Comp. Immunol. Microbiol. Infect. Dis. 2011 Jan; 34 (1): 55-63).

However, since the antibodies produced so far by the present inventors are rat antibodies, they cannot be administered multiple times to animals other than rats.

Ishida Y, Agata Y, Shibahara K, Honjo T The EMBO Journal. 1992 Nov; 11 (11): 3887-3895. Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology. 2014 Aug; 142 (4): 551-61. Maekawa N, Konnai S, Ikebuchi R, Okagawa T, Adachi M, Takagi S, Kagawa Y, Nakajima C, Suzuki Y, Murata S, Ohashi K. PLoS One. 2014 Jun 10 ; 9 (6): e98415. Mingala CN, Konnai S, Ikebuchi R, Ohashi K. Comp. Immunol. Microbiol. Infect. Dis. 2011 Jan; 34 (1): 55-63.

An object of the present invention is to provide an anti-PD-L1 antibody that can be administered multiple times to animals other than rats.

The present inventors determined the variable region of a rat antigen PD-L1 monoclonal antibody (4G12) capable of inhibiting the binding of dog PD-1 and PD-L1, and determined the variable region gene and canine immunoglobulin (corresponding to human IgG4). Successfully produced a rat-dog chimeric anti-PD-L1 antibody by culturing and propagating Chinese hamster ovary cells (CHO cells) into which a chimeric antibody gene combining the constant region genes of IgG-D) was introduced. did In addition, the CDRs of the variable regions of the rat antigen PD-L1 monoclonal antibody (4G12) were determined.

In addition, the present inventors determined the variable region of a rat antigen PD-L1 monoclonal antibody (4G12) capable of inhibiting the binding of bovine PD-1 and PD-L1, and the variable region gene and bovine immunoglobulin (bovine IgG1 However, in order to inhibit ADCC activity, mutations were added to the expected Fcγ receptor binding site of the CH2 domain (see Figure 19. Amino acid numbers and mutations: 250 E→P, 251 L→V, 252 P→A, 253 G →Deleted, 347 A→S, 348 P→S ;Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology 2014 Aug ;142 (4):551-561. ).) by culturing and propagating Chinese hamster ovary cells (CHO cells) into which a chimeric antibody gene in which the constant region genes were combined was introduced. The present invention was completed based on these findings.

The gist of the present invention is as follows.

(1) (a) an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38); L chain having the L chain constant region of the animal antibody of (b) CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and ASEEAVISLVY (SEQ ID NO: 41) An anti-PD-L1 antibody comprising an H chain having an H chain variable region comprising CDR3 having an amino acid sequence and an H chain constant region of an animal antibody other than rat.

(2) The antibody according to (1), wherein the L chain variable region and the H chain variable region are derived from rats.

(3) The antibody according to (2), wherein the L chain variable region is the L chain variable region of a rat antigen PD-L1 antibody, and the H chain variable region is the H chain variable region of a rat antigen PD-L1 antibody.

(4) The antibody described in (3), wherein the L chain variable region has the amino acid sequence of SEQ ID NO: 1 and the H chain variable region has the amino acid sequence of SEQ ID NO: 2.

(5) The antibody according to any one of (1) to (4), wherein the L chain constant region of the antibody other than rat has the amino acid sequence of the Lambda chain or Kappa chain constant region.

(6) The antibody according to any one of (1) to (5), wherein the H chain constant region of the antibody of an animal other than rat has an amino acid sequence of an immunoglobulin constant region corresponding to human IgG4.

(7) The antibody according to any one of (1) to (5), wherein the animal other than a rat is a cow, and a mutation that decreases ADCC activity and/or CDC activity is introduced into the H chain constant region of the bovine antibody.

(8) The animal other than the rat is a dog, the L chain constant region of the dog antibody has the amino acid sequence of the Lambda chain constant region, and the H chain constant region of the dog antibody is immunoglobulin equivalent to human IgG4. The antibody of (6) which has the amino acid sequence of a constant region.

(9) The L chain constant region of the bovine antibody has the amino acid sequence of the Lambda chain constant region, and the H chain constant region of the bovine antibody has introduced a mutation that reduces ADCC activity and/or CDC activity. (7) The antibody of description.

(10) The antibody according to (8), wherein the L chain constant region of the canine antibody has the amino acid sequence of SEQ ID NO: 3, and the H chain constant region of the canine antibody has the amino acid sequence of SEQ ID NO: 4.

(11) The antibody according to (9), wherein the L chain constant region of the bovine antibody has the amino acid sequence of SEQ ID NO: 100, and the H chain constant region of the bovine antibody has the amino acid sequence of SEQ ID NO: 102.

(12) The antibody according to any one of (1) to (11), which has a four-chain structure of two L chains and two H chains.

(13) A pharmaceutical composition comprising the antibody according to any one of (1) to (12) as an active ingredient.

(14) The pharmaceutical composition according to (13) for preventing and/or treating cancer and/or infectious disease.

(15) cancer and/or infection, neoplastic disease, leukemia, Johne's disease, anaplasma disease, bacterial mastitis, fungal mastitis, mycoplasma infection (eg, mycoplasma mastitis, mycoplasma pneumonia, etc.); The pharmaceutical composition according to (14) selected from the group consisting of tuberculosis, small pyroplasma disease, cryptosporidiosis, coccidiosis, trypanosoma disease, and leishmaniasis.

(16) (a') an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38); DNA encoding the L chain having the L chain constant region of other animal antibodies, (b') CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and ASEEAVISLVY (SEQ ID NO: 41) artificial gene DNA comprising a DNA encoding an H chain having an H chain variable region containing CDR3 having the amino acid sequence and an H chain constant region of an animal antibody other than rat.

(17) A vector containing the artificial gene DNA described in (16).

(18) A host cell transformed with the vector described in (17).

(19) A method for producing an antibody comprising culturing the host cells described in (18) and collecting an anti-PD-L1 antibody from the culture.

(20) an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and an animal antibody other than rat DNA encoding the L chain having an L chain constant region of .

(21) an H chain variable region comprising CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and CDR3 having the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41); DNA encoding the H chain having the H chain constant region of an animal antibody other than rat.

This specification is described in the specifications and / or drawings of Japanese Patent Application, Japanese Patent Application No. 2016-159088, Japanese Patent Application No. 2016-159089, Japanese Patent Application No. 2017-110723 and Japanese Patent Application No. 2017-61454, which are the basis of priority of the present application. contains the content

According to the present invention, a novel anti-PD-L1 antibody was obtained. This antibody can also be used for animals other than rats.

1 shows inhibition of binding of recombinant canine PD-L1 to recombinant canine PD-1. Binding of canine PD-L1-Ig to canine PD-1-Ig was detected on ELISA plates. The absorbance (OD) at the time of no antibody addition was taken as 100%, and the OD at each antibody concentration was expressed as a relative value. rat antigen PD-L1 monoclonal antibody 4G12, which cross-reacted with canine PD-L1; Rat IgG2a (κ), 5A2; Rat IgG1 (κ), and 6G7; Among the rat IgM (κ) clones, both 4G12 and 6G7 clones showed high binding inhibition ability.
Fig. 2 is a schematic diagram of a pDC6 vector and a rat-dog chimeric anti-PD-L1 antibody.
Figure 3: Expression and purification of rat-dog chimeric anti-PD-L1 antibodies c4G12 and c6G7. SDS-PAGE was performed under non-reducing conditions, and bands were visualized by CBB staining. a: Protein A purification only, b: + gel filtration chromatography purification.
Figure 4 shows the PD-1/PD-L1 binding inhibitory activity of rat-dog chimeric anti-PD-L1 antibodies c4G12 and c6G7.
Figure 5: Establishment of rat-dog chimeric anti-PD-L1 antibody c4G12 high-expressing cells.
Fig. 6 is an SDS-PAGE image of the rat-dog chimeric anti-PD-L1 antibody c4G12. The rat antigen PD-L1 antibody 4G12 and the rat-dog chimeric anti-PD-L1 antibody c4G12 were electrophoresed under reducing and non-reducing conditions and visualized by CBB staining. Under the reducing condition, a band of the antibody heavy chain around 50 kDa and the antibody light chain around 25 kDa were observed. No band other than the target was detected.
Fig. 7 shows the canine PD-1/PD-L1 binding and CD80/PD-L1 binding inhibitory activities of the rat antigen PD-L1 antibody 4G12 and the rat-dog chimeric anti-PD-L1 antibody c4G12. The rat antigen PD-L1 monoclonal antibody 4G12 and the rat-dog chimeric anti-PD-L1 antibody c4G12 decrease the amount of PD-L1-Ig binding to dog PD-1-Ig and CD80-Ig, No change in binding inhibitory activity was identified.
Fig. 8 shows the effect of activating canine immune-competent cells by the rat-dog chimeric anti-PD-L1 antibody c4G12. Canine PBMCs were stimulated and cultured for 3 days, and the concentrations of IL-2 and IFN-γ in the supernatant were quantified by the ELISA method. Further, on the second day of the stimulation culture, the nucleic acid analog EdU was added to the culture medium, and the amount taken up was quantified by flow cytometry. The rat-dog chimeric anti-PD-L1 antibody c4G12 increased IL-2 and IFN-γ production from canine PBMCs and promoted the proliferation of CD4+ and CD8+ lymphocytes.
Fig. 9 shows PD-L1 expression in oral melanoma (A) and undifferentiated sarcoma (B).
Fig. 10 is a CT image and appearance of a tumor in a treatment test of rat-dog chimeric anti-PD-L1 antibody c4G12 administered to dogs suffering from intraoral melanoma. (a, d) before initiation of treatment, (b, e) at 10 weeks of treatment, and (c, f) at 34 weeks of treatment. Significant antitumor effects were observed after 5 administrations of the antibody (10 weeks after the start of treatment), and further tumor reduction was observed at 34 weeks.
Fig. 11 is the transition of tumor long diameter in the oral melanoma-affected dog shown in Fig. 10 . Reduction of 30% or more compared to the baseline long diameter was regarded as partial success (PR).
Fig. 12 is a CT image of a rat-dog chimeric anti-PD-L1 antibody c4G12 administration treatment test conducted on dogs suffering from undifferentiated sarcoma. (a, c) before initiation of treatment and (b, d) at 3 weeks of treatment. Significant tumor shrinkage was confirmed with the two administrations of the antibody.
Fig. 13 is a CT image in a treatment test of rat-dog chimeric anti-PD-L1 antibody c4G12 administered to dogs suffering from oral melanoma (case of lung metastasis). (a, d, g) before initiation of treatment, (b, e, h) at 6 weeks of treatment, (c, f, i) at 18 weeks of treatment. Multiple lung metastases were eliminated by 9 antibody administrations.
Fig. 14 shows the transition of the survival rate after the occurrence of lung metastases in dogs with melanoma in the oral cavity. In the antibody-administered group, there is a possibility that the survival period is extended compared to the control group.
Fig. 15 shows CDR1, CDR2 and CDR3 regions in the L chain variable region and H chain variable region of rat antigen PD-L1 antibody 4G12.
16 : Cross-reactivity of the rat antigen PD-L1 antibody 4G12. It was confirmed that the rat antigen PD-L1 antibody 4G12 binds to sheep and pig PD-L1.
Fig. 17 shows the reactivity of the rat antigen PD-L1 antibody 4G12 to water buffalo leukocytes. The rat antigen PD-L1 antibody 4G12 strongly bound to water buffalo blood macrophages (CD14+CD11b+ cells). Further, the rat antigen PD-L1 antibody 4G12 weakly bound to water buffalo lymphocytes (CD14-CD11b-cells). This difference in binding properties is thought to reflect the expression level of PD-L1 in macrophages and lymphocytes.
Fig. 18 is a test of inhibition of ovine or swine PD-1/PD-L1 binding by rat antigen PD-L1 antibody 4G12. It was shown that the rat antigen PD-L1 antibody 4G12 can inhibit the binding of sheep and pig PD-1/PD-L1 in a concentration-dependent manner.
Fig. 19 shows the amino acid sequence of rat-bovine chimeric antigen PD-L1 antibody ch4G12. In the L chain variable region and H chain variable region of the rat antigen PD-L1 antibody 4G12, the CDR1, CDR2 and CDR3 regions are shown, and further amino acids mutated to bovine IgG1 (CH2 domain) (amino acid number and mutation: 250 E→P, 251 L→V, 252 P→A, 253 G→Delete, 347 A→S, 348 P→S) are also shown.
Fig. 20 is a schematic diagram of the pDC6 vector and the rat-bovine chimeric antigen PD-L1 antibody ch4G12.
Fig. 21 confirms the purification purity of the rat-bovine chimeric antigen PD-L1 antibody ch4G12.
Figure 22 shows the binding specificity of the rat-bovine chimeric antigen PD-L1 antibody ch4G12.
Fig. 23 shows the bovine PD-1/PD-L1 binding inhibitory activity of the rat-bovine chimeric antigen PD-L1 antibody ch4G12 (result of a test for inhibiting the binding between bovine PD-L1 expressing cells and soluble bovine PD-1).
Fig. 24 shows the bovine PD-1/PD-L1 binding inhibitory activity of the rat-bovine chimeric antigen PD-L1 antibody ch4G12 (result of a test for inhibiting the binding between bovine PD-1 expressing cells and soluble bovine PD-L1).
Fig. 25 shows the activation effect (cell proliferation) of the rat-bovine chimeric antigen PD-L1 antibody ch4G12 on bovine lymphocyte response.
Fig. 26 shows the activation effect of the rat-bovine chimeric antigen PD-L1 antibody ch4G12 on bovine lymphocyte responses to the BLV antigen (IFN-γ production amount).
Fig. 27 shows cell proliferation responses of T cells to BLV antigens in BLV experimentally infected cows administered with the rat-bovine chimeric antigen PD-L1 antibody ch4G12.
Fig. 28 shows changes in the amount of BLV provirus in BLV experimentally infected cows administered with the rat-bovine chimera antigen PD-L1 antibody ch4G12.

Hereinafter, the present invention will be described in detail.

The present invention provides (a) an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38); L chain having an L chain constant region of an animal antibody other than that of an animal antibody, (b) CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and ASEEAVISLVY (SEQ ID NO: 41) An anti-PD-L1 antibody comprising an H chain having an H chain variable region comprising CDR3 having an amino acid sequence of and an H chain constant region of an animal antibody other than rat.

CDRs 1 to 3 in the L chain variable region of the rat antigen PD-L1 antibody 4G12 are, respectively, a region consisting of the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), a region consisting of the amino acid sequence of WAT, and GQYLVYPFT (SEQ ID NO: 38) It is a region composed of an amino acid sequence (see Fig. 15).

In addition, CDRs 1 to 3 in the H chain variable region of the rat antigen PD-L1 antibody 4G12 are a region consisting of the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), a region consisting of the amino acid sequence of IYPEYGNT (SEQ ID NO: 40), and ASEEAVISLVY ( It is a region consisting of the amino acid sequence of SEQ ID NO: 41) (see FIG. 15).

The amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), the amino acid sequence of WAT and the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and ASEEAVISLVY (SEQ ID NO: 40) In the amino acid sequence of No. 41), 1, 2, 3, 4 or 5 amino acids may be deleted, substituted or added.

In the present specification, antibodies include, in addition to full-length antibodies, Fab, F(ab)' ₂ , ScFv, Diabody, V _H , V _L , Sc(Fv) ₂ , Bispecific sc(Fv) ₂ , Minibody, ScFv-Fc It is a concept that includes low molecular weight products such as monomer and ScFv-Fc dimer.

In the anti-PD-L1 antibody of the present invention, the L chain variable region and the H chain variable region may be derived from rats. For example, the L chain variable region may be the L chain variable region of a rat antigen PD-L1 antibody, and the H chain variable region may be the H chain variable region of a rat antigen PD-L1 antibody.

The amino acid sequence of the L chain variable region and the amino acid sequence of the H chain variable region of the rat antigen PD-L1 antibody are shown in SEQ ID NOs: 1 and 2, respectively. In the amino acid sequences of SEQ ID NOs: 1 and 2, one or more amino acids (For example, 5 or less, at most about 10) amino acids may be deleted, substituted, or added, and even when these mutations are introduced, they can function as the L chain variable region or H chain variable region of the PD-L1 antibody. there is.

The L chain constant region and H chain constant region of the antibody of an animal other than rat may be derived from an animal that produces PD-L1 that cross-reacts with the rat antigen PD-L1 antibody 4G12.

The L chain of the antibody includes Kappa chain (kappa chain) and Lambda chain (lambda chain), and in the anti-PD-L1 antibody of the present invention, the L chain constant region of the antibody of an animal other than rat is Kappa chain or Lambda chain It may have the amino acid sequence of the constant region of either chain, but the abundance ratio is higher for lamb, cat, dog, horse, and cow, and higher for Kappa chain in mouse, rat, human, and pig. Since a chain with a high abundance ratio is considered to be preferable, it is preferable to have the amino acid sequence of the constant region of the Lambda chain in sheep, cats, dogs, horses, and cows, and in mice, rats, humans, and pigs, the Kappa chain constant region It is preferred to have an amino acid sequence.

The H chain constant region of an antibody of an animal other than rat should have an amino acid sequence of an immunoglobulin constant region corresponding to human IgG4. The H chain is divided into γ chain, μ chain, α chain, δ chain, and ε chain by differences in the constant region, and each of these differences leads to five classes of IgG, IgM, IgA, IgD, and IgE (iso type) of immunoglobulin is formed.

Immunoglobulin G (IgG) accounts for 70 to 75% of human immunoglobulin, and is the most monomeric antibody in plasma. It has a four-chain structure of two light chains and two heavy chains. Human IgG1, IgG2, and IgG4 have a molecular weight of about 146,000, but human IgG3 has a long hinge portion connecting the Fab region and the Fc region, and has a molecular weight of 170,000. Human IgG1 accounts for about 65% of human IgG, human IgG2 about 25%, human IgG3 about 7%, and human IgG4 about 3%. Distributed averagely inside and outside blood vessels. Since human IgG1 has strong affinity for Fc receptors and complement factors on the surface of effector cells, it induces antibody-dependent cytotoxic activity (ADCC), and activates complement to induce complement-dependent cytotoxic activity (CDC). . Since human IgG2 and human IgG4 have low affinity for Fc receptors and complement factors, ADCC activity and CDC activity are low.

Immunoglobulin M (IgM) is a pentameric antibody in which five of the basic four-chain structures are linked, accounting for about 10% of human immunoglobulin. Molecular weight is 970,000. It is an immunoglobulin that is usually present only in the blood, is produced first against infectious microorganisms, and is responsible for initial immunity.

Immunoglobulin A (IgA) accounts for 10-15% of human immunoglobulins. Molecular weight is 160,000. Secreted IgA is a dimeric antibody in which two IgAs are bound. IgA1 is present in serum, nasal mucus, saliva, and breast milk, and IgA2 is present in large amounts in intestinal fluid.

Immunoglobulin D (IgD) is an antibody of less than 1% monomer of human immunoglobulin. It exists on the surface of B cells and is involved in the induction of antibody production.

Immunoglobulin E (IgE) is a monomeric antibody that exists only in a very small amount of 0.001% or less of human immunoglobulin. It is thought to be involved in the immune response to parasites, but in developed countries where parasites are rare, it is greatly involved in bronchial asthma and allergies in particular.

In dogs, as the H chain of IgG, IgG-A (corresponding to human IgG2), IgG-B (corresponding to human IgG1), IgG-C (corresponding to human IgG3), IgG-D (corresponding to human IgG4) sequences This is sympathetic. In the antibody of the present invention, an IgG H chain constant region having neither ADCC activity nor CDC activity is preferred (IgG4 in humans). In the case where an immunoglobulin constant region corresponding to human IgG4 has not been identified, an immunoglobulin equivalent to human IgG1 that has neither ADCC activity nor CDC activity may be used by mutating the region.

In cattle, as the H chain of IgG, the sequences of IgG1, IgG2, and IgG3 have been identified. In the antibody of the present invention, an IgG H chain constant region having neither ADCC activity nor CDC activity is preferred (IgG4 in humans). The constant region of human IgG1 has ADCC activity and CDC activity in the wild type, but it is known that their activities are reduced by adding amino acid substitutions or deletions to specific sites. In cattle, since the immunoglobulin constant region equivalent to human IgG4 has not been identified, this immunoglobulin equivalent region to human IgG1 can be mutated and used. As an example thereof, SEQ ID NOs: 102 and 103 respectively show the amino acid sequence and nucleotide sequence (with optimized codons) mutated in the CH2 domain of the H chain constant region (IgG1 chain, GenBank: X62916) of a bovine antibody.

When an animal other than a rat is an individual, the L chain constant region of the dog antibody has the amino acid sequence of the Lambda chain constant region, and the H chain constant region of the dog antibody is an immunoglobulin constant region corresponding to human IgG4. An anti-PD-L1 antibody having an amino acid sequence of is more preferred.

When an animal other than a rat is a cow, the L chain constant region of the bovine antibody has the amino acid sequence of the Lambda chain constant region, and the H chain constant region of the bovine antibody has a mutation that reduces ADCC activity and/or CDC activity An anti-PD-L1 antibody into which is introduced is more preferred.

The anti-PD-L1 antibodies of the present invention include rat-dog chimeric antibodies, caninized antibodies, completely canine antibodies, rat-bovine chimeric antibodies, bovine antibodies, and completely miniaturized antibodies, but animals are not limited to dogs and cattle; Humans, pigs, monkeys, mice, cats, horses, goats, sheep, water buffalo, rabbits, hamsters, guinea pigs and the like can be exemplified.

For example, the anti-PD-L1 antibody of the present invention has an amino acid sequence of SEQ ID NO: 3 in the L chain constant region of the canine antibody and an amino acid sequence of SEQ ID NO: 4 in the H chain constant region of the canine antibody. It may be an L1 antibody.

Further, for example, the anti-PD-L1 antibody of the present invention is an antibody wherein the L chain constant region of the bovine antibody has the amino acid sequence of SEQ ID NO: 100 and the H chain constant region of the bovine antibody has the amino acid sequence of SEQ ID NO: 102. It may be a PD-L1 antibody.

In the amino acid sequences of SEQ ID NOs: 3 and 4 and SEQ ID NOs: 100 and 102, one or more (eg, 5 or less, at most about 10) amino acids may be deleted, substituted or added, and these mutations are introduced Even if it is, it may have a function as an L chain constant region or H chain constant region of an antibody.

The anti-PD-L1 antibody of the present invention should have a four-chain structure of two L chains and two H chains.

The anti-PD-L1 antibody of the present invention can be produced as follows. The variable region sequence of the identified rat antigen PD-L1 antibody and an antibody of an animal other than rat (eg, dog, cow, etc.) (preferably, human IgG4 antibody, antibody equivalent to human IgG4 antibody, or equivalent to human IgG1) A mutation is added to the corresponding region of an immunoglobulin to synthesize an artificial gene including a constant region sequence of ADCC activity and/or CDC activity is reduced, and the artificial gene is inserted into a vector (e.g., a plasmid) After that, antibodies are collected from the culture by introducing into host cells (for example, mammalian cells such as CHO cells) and culturing the host cells.

The amino acid sequence and nucleotide sequence of the L chain variable region of the rat antigen PD-L1 antibody identified by the present inventors are shown in SEQ ID NOs: 1 and 5, respectively. In addition, SEQ ID NO: 15 shows the nucleotide sequence after codon optimization.

The amino acid sequence and nucleotide sequence of the H chain variable region of the rat antigen PD-L1 antibody identified by the present inventors are shown in SEQ ID NOs: 2 and 6, respectively. In addition, the nucleotide sequence after codon optimization is shown in SEQ ID NO: 16.

The amino acid sequence and nucleotide sequence of the L chain constant region of the canine antibody (Lambda chain, GenBank: E02824.1) are shown in SEQ ID NOs: 3 and 7, respectively. In addition, SEQ ID NO: 17 shows the nucleotide sequence after codon optimization.

The amino acid sequence and nucleotide sequence of the L chain constant region of bovine antibody (Lambda chain, GenBank: X62917) are shown in SEQ ID NOs: 100 and 101, respectively. Also, the nucleotide sequence after codon optimization is shown in SEQ ID NO: 104.

The amino acid sequence and nucleotide sequence of the canine antibody H chain constant region (IgG-D chain, GenBank: AF354267.1) are shown in SEQ ID NOs: 4 and 8, respectively. In addition, the nucleotide sequence after codon optimization is shown in SEQ ID NO: 18.

The amino acid sequence and nucleotide sequence (after codon optimization) of the H chain constant region (IgG1 chain, GenBank: X62916 modified) of the bovine antibody are shown in SEQ ID NOs: 102 and 103, respectively.

SEQ ID NO: 9 shows the amino acid sequence of the chimeric L chain composed of the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the canine antibody (Lambda chain, GenBank: E02824.1). SEQ ID NO: 19 shows the nucleotide sequence of the chimeric L chain comprising the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the canine antibody (Lambda chain, GenBank: E02824.1) (after codon optimization).

SEQ ID NO: 105 shows the amino acid sequence of a chimeric L chain composed of the L chain variable region of a rat antigen PD-L1 antibody and the L chain constant region of a bovine antibody (Lambda chain, GenBank: X62917). SEQ ID NO: 107 shows the nucleotide sequence of the chimeric L chain comprising the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the bovine antibody (Lambda chain, GenBank: X62917) (after codon optimization).

SEQ ID NO: 10 shows the amino acid sequence of the chimeric H chain composed of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the canine antibody (IgG-D chain, GenBank: AF354267.1). SEQ ID NO: 20 shows the nucleotide sequence of the chimeric H chain consisting of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the canine antibody (IgG-D chain, GenBank: AF354267.1) (after codon optimization). .

SEQ ID NO: 106 shows the amino acid sequence of the chimeric H chain composed of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the bovine antibody (IgG1 chain, GenBank: X62916 modified). SEQ ID NO: 108 shows the nucleotide sequence of the chimeric H chain consisting of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the bovine antibody (IgG1 chain, GenBank: X62916 modified) (after codon optimization).

In addition, amino acid sequences and nucleotide sequences of L chain constant regions and H chain constant regions of various animals can be obtained from known databases, and these sequences can be used.

The amino acid sequences and nucleotide sequences of L chain constant (normal) regions and H chain constant (normal) regions of dogs, sheep, pigs, water buffalo, humans, and cows are summarized in the table below.

(graph)

(pig continues)

SEQ ID NOs: 4, 3, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 12, 80, 82, In the amino acid sequences of 84 to 91, 100, 102 and 11, one or more (eg, 5 or less, at most about 10) amino acids may be deleted, substituted or added, even if these mutations are introduced, It can have a function as a constant region of the Ig heavy chain or light chain.

The constant region of human IgG1 has ADCC activity and CDC activity in the wild type, but it is known that their activities are reduced by adding amino acid substitutions or deletions to specific sites. In non-human animals, when the immunoglobulin constant region equivalent to human IgG4 has not been identified, those in which ADCC activity and CDC activity are reduced by mutating the immunoglobulin equivalent region to human IgG1 can be used. there is.

The present invention provides (a') an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), DNA encoding the L chain having the L chain constant region of an animal antibody other than rat, (b') CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40), and An artificial gene DNA containing an H chain variable region containing CDR3 having the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41) and a DNA encoding an H chain having an H chain constant region of an animal antibody other than rat is provided. Moreover, the present invention provides an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and DNA encoding the L chain having the L chain constant region of the animal antibody of (DNA of (a')) is also provided. In addition, the present invention is an H chain variable comprising CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40), and CDR3 having the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41) region, and DNA encoding the H chain having the H chain constant region of an animal antibody other than rat (DNA in (b')) is also provided.

(a) an L chain variable region comprising CDR1 having the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 having the amino acid sequence of WAT, and CDR3 having the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and an animal antibody other than rat L chain having an L chain constant region of (b) CDR1 having the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 having the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and having the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41) The H chain having the CDR3-containing H chain variable region and the H chain constant region of an animal antibody other than rat has been described above. The DNA of (a') is DNA (gene) encoding the L chain of (a), the DNA of (b') is the DNA (gene) encoding the H chain of (b), and the DNA of (a') and (b') can be synthesized using a commercially available synthesizer. A restriction enzyme recognition site, a KOZAK sequence, a poly A addition signal sequence, a promoter sequence, an intron sequence, and the like may be added to the artificial gene DNA.

In addition, the present invention also provides a vector containing the artificial gene DNA.

Examples of vectors include Escherichia coli-derived plasmids (eg, pBR322, pBR325, pUC12, pUC13), Bacillus subtilis-derived plasmids (eg, pUB110, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), and bacteriophages such as lambda phages. , animal viruses such as retroviruses and vaccinia viruses, entomopathogenic viruses such as baculoviruses, and the like can be used. In the examples described later, pDC6 (Japanese Patent No. 5704753, US Patent 9096878, EU Patent 2385115, Hong Kong (China) patent HK1163739, Australia Patent 2009331326) was used.

A promoter, enhancer, splicing signal, poly A addition signal, intronic sequence, selection marker, SV40 origin of replication and the like may be added to the vector.

In addition, the present invention also provides a host cell transformed with the vector. An anti-PD-L1 antibody can be produced by culturing this host cell and collecting an antibody from the culture. Accordingly, the present invention also provides a method for producing an antibody comprising culturing the host cell and collecting an anti-PD-L1 antibody from the culture. In the antibody production method of the present invention, a host cell may be transfected with a vector containing an artificial gene DNA containing DNA encoding the L chain and DNA encoding the H chain, and the DNA encoding the L chain The host cell may be co-transfected with the vector into which the vector and the vector into which DNA encoding the H chain is incorporated.

Host cells include bacterial cells (eg, Escherichia, Bacillus, Bacillus subtilis, etc.), fungal cells (eg, yeast, Aspergillus, etc.), insect cells (eg, S2 cells) , Sf cells, etc.), animal cells (eg, CHO cells, COS cells, HeLa cells, C127 cells, 3T3 cells, BHK cells, HEK293 cells, etc.), plant cells and the like. Among these, CHO-DG44 cells (CHO-DG44 (dhfr-/-)), which are dihydrofolate reductase-deficient cells, are preferred.

For introduction of the recombinant vector into the host, Molecular Cloning 2nd Edition, J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989 (e.g. calcium phosphate method, DEAE-dextran method, transfection method, microinjection method, lipofection method, electroporation method, transduction method, scrape loading method, shot gun method, etc.) or by infection.

Transformants can be cultured in a medium, and the anti-PD-L1 antibody of the present invention can be collected from the culture. When the antibody is secreted into the medium, the medium may be recovered, and the antibody may be separated and purified from the medium. When the antibody is produced in transformed cells, the cells may be lysed, and the antibody may be isolated and purified from the lysate.

Examples of the medium include OptiCHO medium, Dynamis medium, CD CHO medium, ActiCHO medium, FortiCHO medium, Ex-Cell CD CHO medium, BalanCD CHO medium, ProCHO 5 medium, and Cellvento CHO-100 medium, but are limited to these. it is not going to be

The pH of the medium varies depending on the cells to be cultured, but in general, pH 6.8 to 7.6, and in many cases, pH 7.0 to 7.4 is appropriate.

When the cells to be cultured are CHO cells, the CHO cells can be cultured using methods known to those skilled in the art. For example, it is usually possible to culture at 30 to 39°C, preferably about 37°C, in an atmosphere with a CO ₂ concentration in the gas phase of 0 to 40%, preferably 2 to 10%.

A suitable culture period is usually 1 day to 3 months, preferably 1 day to 3 weeks.

Isolation and purification of antibodies can be performed by known methods. Known separation and purification methods include methods using differences in solubility such as salting out and solvent precipitation, methods using differences in molecular weight such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, A method using a difference in charge such as ion exchange chromatography, a method using a specific affinity such as affinity chromatography, a method using a difference in hydrophobicity such as reverse phase high performance liquid chromatography, and a difference in isoelectric point such as isoelectric point electrophoresis How to use, etc.

The anti-PD-L1 antibody of the present invention can be used as an antibody drug for animals or humans. Therefore, the present invention provides a pharmaceutical composition comprising the above anti-PD-L1 antibody as an active ingredient.

The pharmaceutical composition of the present invention can be used for preventing and/or treating cancer and/or infectious disease. Cancers and/or infections include neoplastic diseases (e.g., malignant melanoma, lung cancer, stomach cancer, kidney cancer, breast cancer, bladder cancer, esophageal cancer, ovarian cancer, etc.), leukemia, Johne's disease, anaplasma disease, bacterial mastitis, Fungal mastitis, mycoplasma infection (eg, mycoplasma mastitis, mycoplasma pneumonia, etc.), tuberculosis, minipyroplasma disease, cryptosporidiosis, coccidiosis, trypanosoma disease and leishmaniasis can be exemplified, but , but is not limited thereto.

The anti-PD-L1 antibody of the present invention may be dissolved in a buffer such as PBS, physiological saline, or sterile water, and, if necessary, sterilized by filtration through a filter or the like, and then administered to a test animal (including humans) by injection. In addition, additives (eg, colorants, emulsifiers, suspending agents, surfactants, solubilizers, stabilizers, preservatives, antioxidants, buffers, tonicity agents, pH adjusters, etc.) may be added to this solution. As the route of administration, intravenous, intramuscular, intraperitoneal, subcutaneous, intradermal administration, etc. are possible, and intranasal or oral administration may also be used.

The dose, number and frequency of administration of the anti-PD-L1 antibody of the present invention vary depending on the condition, age, body weight, administration method, administration form, etc. of the test animal, but, for example, usually, What is necessary is just to administer 0.1-100 mg/kg body weight per animal, Preferably, 1-10 mg/kg body weight, at least once, at the frequency which obtains the desired effect.

The pharmaceutical composition of the present invention may be used alone, or may be used in combination with other immunotherapies or molecular target therapeutics such as surgery, radiation therapy, and cancer vaccine. Accordingly, a synergistic effect can be expected.

Example

Hereinafter, the present invention will be described in detail based on examples, but the present invention is not limited to these examples.

[Example 1] Rat-dog chimeric anti-PD-L1 antibody

1. Introduction

The immunosuppressive receptor Programmed death 1 (PD-1) and its ligand Programmed death ligand 1 (PD-L1) suppress excessive immune responses and are deeply involved in immune tolerance, Kyoto University, Honjo Tasuku and others It is a molecule identified by It has also recently been found to be involved in immunosuppression in tumors. In this Example, for the purpose of establishing a novel therapy for canine tumor disease, the variable region gene of the rat antigen PD-L1 monoclonal antibody (4G12) capable of inhibiting the binding of canine PD-1 and PD-L1, and canine immunity A rat-dog chimeric anti-PD-L1 antibody c4G12 obtained by culturing Chinese hamster ovary cells (CHO cells) into which a chimeric antibody gene combining globulin (IgG4) constant region genes was introduced was prepared, and in In vitro and in vivo effects were confirmed.

2. Materials and Methods

2.1 Bovine PD-L1 Monoclonal Antibody Producing Cells

The bovine PD-L1 gene sequence was identified (Ikebuchi R, Konnai S, Shirai T, Sunden Y, Murata S, Onuma M, Ohashi K. Vet Res. 2011 Sep 26; 42:103.), and recombinant cattle were identified from the genetic information. PD-L1 was prepared. Rats were immunized with the same recombinant protein to obtain a rat antigen PD-L1 antibody (Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology. 2014 Aug; 142 (4): 551-61. Clone 4G12, which later became the variable region of a canine chimeric antibody, is published in this paper).

2.2 Identification of the full-length canine PD-1 and PD-L1 genes

In order to determine the full length of canine PD-1 and PD-L1 cDNA, first, the predicted base sequences of canine PD-1 and PD-L1 already registered in The National Center for Biotechnology Information (NCBI) (GenBank accession numbers; XM_543338 and XM_541302), primers (cPD-1 inner F and R, cPD-L1 inner F and R) were designed to amplify the inside of the open reading frame (ORF) of the gene, and a PCR method was performed. For the obtained amplification product, the base sequence was determined by a capillary sequencer according to a conventional method. In addition, in order to determine the nucleotide sequences of the full-length PD-1 and PD-L1 cDNAs, primers (cPD-1 5'GSP and 3'GSP, cPD-1 5'GSP and 3'GSP, cPD- L1 5′GSP and 3′GSP) were designed, and the 5′ and 3′RACE methods were analyzed using the 5′ RACE System for Rapid Amplification of cDNA Ends and 3′ RACE System for Rapid Amplification of cDNA Ends (Invitrogen), respectively. conducted. The target gene fragments obtained by the 5' and 3'RACE methods were sequenced according to the above method (Maekawa N, Konnai S, Ikebuchi R, Okagawa T, Adachi M, Takagi S, Kagawa Y, Nakajima C , Suzuki Y, Murata S, Ohashi K. PLoS One. 2014 Jun 10;9 (6): e98415.).

Primer (cPD-1 inner F): AGGATGGCTCCTAGACTCCC (SEQ ID NO: 21)

Primer (cPD-1 inner R): AGACGATGGTGGCATACTCG (SEQ ID NO: 22)

Primer (cPD-L1 inner F): ATGAGAATGTTTAGTGTCTT (SEQ ID NO: 23)

Primer (cPD-L1 inner R): TTATGTCTCTTCAAATTGTATATC (SEQ ID NO: 24)

Primer (cPD-1 5'GSP): GTTGATCTGTGTGTTG (SEQ ID NO: 25)

Primer (cPD-1 3'GSP): CGGGACTTCCACATGAGCAT (SEQ ID NO: 26)

Primer (cPD-L1 5'GSP): TTTTAGACAGAAAGTGA (SEQ ID NO: 27)

Primer (cPD-L1 3'GSP): GACCAGCTCTTCTTGGGGAA (SEQ ID NO: 28)

2.3 Construction of PD-1 and PD-L1 Expressing COS-7 Cells

To prepare canine PD-1-EGFP and PD-L1-EGFP expression plasmids, the synthesized beagle PBMC-derived cDNA was used as a template and restriction enzymes XhoI and BamHI (PD-1), BglII and EcoRI (PD-1) were added to the 5' end. -L1) PCR was performed using primers (cPD-1-EGFP F and R, cPD-L1-EGFP F and R) designed by adding a recognition site. The obtained PCR products were treated with XhoI (Takara) and BamHI (Takara) (PD-1), BglII (New England Biolabs) and EcoRI (Takara) (PD-L1), followed by FastGene Gel/PCR Extraction Kit (NIPPON Genetics Co.), and cloning was performed using the pEGFP-N2 vector (Clontech Co.) subjected to the same restriction enzyme treatment. The resulting expression plasmid of interest was extracted using the QIAGEN Plasmid Midi kit (Qiagen) and stored at -30°C until used for experiments. Thereafter, the prepared expression plasmid was labeled as pEGFP-N2-cPD-1 or pEGFP-N2-cPD-L1.

Primer (cPD-1-EGFP F): CCGCTCGAGATGGGGAGCCGGCGGGGGCC (SEQ ID NO: 29)

Primer (cPD-1-EGFP R): CGCGGATCCTGAGGGGCCACAGGCCGGGTC (SEQ ID NO: 30)

Primer (cPD-L1-EGFP F): GAAGATCTATGAGAATGTTTAGTGTC (SEQ ID NO: 31)

Primer (cPD-L1-EGFP R): GGAATTCTGTCTCTTCAAATTGTATATC (SEQ ID NO: 32)

COS-7 cells at 5 × 10 ⁴ /cm ² were passaged in a 6-well plate and cultured in RPMI 1640 medium containing 10% non-assimilated fetal bovine serum and 0.01% L-glutamine at 37°C in 5% CO2. Incubated overnight in the presence of pEGFP-N2-cPD-1, pEGFP-N2-cPD-L1, or 0.4 μg/cm2 of pEGFP-N2 as a negative control were respectively introduced into COS-7 cells using Lipofectamine 2000 reagent (Invitrogen) and cultured for 48 hours (cPD-1-EGFP expressing cells and cPD-L1-EGFP expressing cells). In order to confirm the expression of canine PD-1 and PD-L1 in the prepared expressing cells, enhanced green fluorescent protein (EGFP) intracellular analysis was performed using an inverted confocal laser microscope LSM700 (ZEISS). Localization was visualized (Maekawa N, Konnai S, Ikebuchi R, Okagawa T, Adachi M, Takagi S, Kagawa Y, Nakajima C, Suzuki Y, Murata S, Ohashi K. PLoS One. 2014 Jun 10 ; 9 (6): e98415.).

2.4 Construction of Recombinant Canine PD-1, PD-L1 and CD80

Primers (cPD-L1) to which NheI or EcoRV (PD-1 and PD-L1) recognition sequences were added to the 5' end to amplify the extracellular region estimated from the predicted amino acid sequences of canine PD-1, PD-L1 and CD80 1-Ig F and R, cPD-L1-Ig F and R), or primers with EcoRV or KpnI (CD80) recognition sequences added to the 5' end (cCD80-Ig F and R) were designed. PCR was performed using the synthesized beagle PBMC-derived cDNA as a template, and the PCR product was treated with NheI (Takara) and EcoRV (Takara), or EcoRV (Takara) and KpnI (New England Biolabs), followed by FastGene pCXN2.1-Rabbit IgG Fc vector (Niwa et al., 1991; Zettlmeissl et al., 1990; Juntendo University Graduate School of Medicine) purified using Gel/PCR Extraction Kit (NIPPON Genetics) and subjected to the same restriction enzyme treatment Cloning was carried out using a strain derived from Professor Takehiko Yokomizo of the Graduate School and modified in this laboratory). Expression plasmids were purified using the QIAGEN Plasmid Midi kit (Qiagen) and stored at -30°C until being used in experiments. Thereafter, the prepared expression plasmids were labeled as pCXN2.1-cPD-1-Ig, pCXN2.1-cPD-L1-Ig or pCXN2.1-cCD80-Ig, respectively.

Primer (cPD-1-Ig F): CGCGGCTAGCATGGGGAGCCGGCGGGGGCC (SEQ ID NO: 33)

Primer (cPD-1-Ig R): CGCGGATATCCAGCCCCCTGCAACTGGCCGC (SEQ ID NO: 34)

Primer (cPD-L1-Ig F): CGCGGCTAGCATGAGAATGTTTAGTGTCTT (SEQ ID NO: 35)

Primer (cPD-L1-Ig R): CGCGGATATCAGTCCTCTCACTTGCTGGAA (SEQ ID NO: 36)

Primer (cCD80-Ig F): CGCGGATATCATGGATTACACAGCGAAGTG (SEQ ID NO: 129)

Primer (cCD80-Ig R): CGGGGTACCCCAGAGCTGTTGCTGGTTAT (SEQ ID NO: 130)

Expi293F cells (Life Technologies) were transfected with these expression vectors, and culture supernatants containing recombinant Ig fusion proteins were obtained. The produced recombinant protein was purified from the supernatant using Ab Capcher Extra (Protein A variant, ProteNova), and PD-MidiTrap G-25 (GE Healthcare) was used to purify the buffer with phosphate buffered saline (PBS; pH). 7.4) and stored at −30° C. until used for experiments (cPD-1-I, cPD-L1-Ig and cCD80-Ig). The protein concentration was quantified by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) and used in subsequent experiments.

Identification of rat antigen PD-L1 monoclonal antibodies that cross-react with 2.5 PD-L1

In order to identify a rat antigen PD-L1 monoclonal antibody that cross-reacts with dog PD-L1, flow cytometry was performed using the antigen PD-L1 antibody prepared in 2.1. 2 × 10 ⁵ -1 × 10 ⁶ cells were reacted with 10 μg/ml of an anti-PD-L1 antibody at room temperature for 30 minutes, washed, and then treated with Allophycocyanine-labeled anti-rat Ig goat antibody (Beckman Coulter). Detection of the antigenic PD-L1 antibody was performed. FACS Verse (Becton, Dickinson and Company) was used for analysis. As negative control antibodies, rat IgG2a (κ) isotype control (BD Biosciences), rat IgG1 (κ) isotype control (BD Biosciences), and rat IgM (κ) isotype control (BD Biosciences) were used. In addition, PBS with 10% non-assimilated goat serum was used for all washing operations and antibody dilution (Maekawa N, Konnai S, Ikebuchi R, Okagawa T, Adachi M, Takagi S, Kagawa Y, Nakajima C, Suzuki Y, Murata S, Ohashi K. PLoS One. Papers using IgM (κ)).

2.6 Selection test of variable region for establishment of rat-dog chimeric anti-PD-L1 antibody

Hereinafter, 4G12 among 10 clones of rat antigen PD-L1 monoclonal antibody that cross-reacted with dog PD-L1; Rat IgG2a (κ), 5A2; Rat IgG1 (κ), and 6G7; Rat IgM (κ) was selected, and whether these antibodies inhibit canine PD-1/PD-L1 binding was examined. That is, canine PD-1-Ig (prepared in 2.4) was layered on a flat-bottomed 96-hole plate, and a blocking operation was performed with PBS containing 1% BSA and 0.05% Tween20. Canine PD-L1-Ig (prepared in 2.4) biotinylated using Lightning-Link Biotin Conjugation Kit (Innova Biosciences) was mixed with rat antigen PD-L1 at each concentration (0, 2.5, 5, 10 μg/ml). After reacting with antibodies 4G12, 5A2 and 6G7 at 37 ° C for 30 minutes, they were added to the plate, and the binding of cPD-L1-Ig to cPD-1-Ig was measured by Neutravidin-HRP (Thermo Fisher Scientific) and TMB one component substrate (Bethyl Laboratories) was quantified by a color development reaction. Rat antigen PD-L1 monoclonal antibodies 4G12 and 6G7 showed good canine PD-1/PD-L1 binding inhibitory activity, whereas 5A2 had no binding inhibitory activity. (Fig. 1)

2.7 Preparation of Rat-Dog Chimeric Anti-PD-L1 Antibody Expression Vector (FIG. 2)

Hereinafter, rat antigen PD-L1 monoclonal antibodies: 4G12 and 6G7, which showed good inhibitory activity against canine PD-1/PD-L1 binding by the selection test of 2.6 (Fig. 1), rat-dog chimeric anti-PD-L1 Two types of rat-dog chimeric anti-PD-L1 antibodies were established using the variable region of the antibody.

Variable region (heavy chain and light chain) genes were identified from hybridomas producing rat antigen PD-L1 antibodies 4G12 and 6G7. In addition, a gene sequence was prepared by combining the rat antibody heavy chain and light chain variable region sequences with the known heavy chain IgG4 constant region and light chain lambda chain constant region of a dog antibody, and codon optimization was performed (SEQ ID NO: 9 and 10 (amino acid sequence), SEQ ID NOs: 19 and 20 (nucleotide sequence after codon optimization)), NotI restriction enzyme recognition sequence, KOZAK sequence, chimeric antibody light chain sequence, poly A addition signal sequence (PABGH), promoter sequence (PCMV ), SacI restriction enzyme recognition sequence, intron sequence (INRBG), KOZAK sequence, chimeric antibody heavy chain sequence, and XbaI restriction enzyme recognition sequence were arranged in the above order. The synthesized gene chain was cloned into the expression vector pDC6 (prof. Yasuhiko Suzuki, Hokkaido University Human Common Infectious Disease Research Center) cloning site (NotI and XbaI restriction enzyme recognition sequences downstream of PCMV, located between INRBG and PABGH) Restriction enzyme recognition sequences were used to arrange them in the above order (FIG. 2), and a rat-dog chimeric anti-PD-L1 antibody expression vector was constructed. This expression vector was transfected into Expi293F cells (Life Technologies) to obtain a culture supernatant containing the chimeric antibody. Purification was performed from the supernatant using Ab Capcher Extra (Protein A variant, ProteNova), and further purification was performed by gel filtration chromatography. SDS-PAGE was performed under non-reducing conditions using a 10% acrylamide gel, followed by staining with a Quick-CBB kit (Wako Pure Chemical Industries, Ltd.), followed by decolorization in distilled water. Although a contaminant protein was confirmed only by Protein A purification, a purified antibody with high purity was obtained by gel filtration chromatography purification (FIG. 3). It was confirmed that the obtained purified antibody specifically binds to canine PD-L1 expressing cells using flow cytometry (data not shown). As a result of examining the canine PD-1/PD-L1 binding inhibitory activity of the two chimeric antibodies by the method shown in 2.6, the rat-dog chimeric anti-PD-L1 antibody c4G12 was the rat antigen PD-L1 monoclonal Although the same binding inhibitory activity as that of antibody 4G12 was exhibited, the rat-dog chimeric anti-PD-L1 antibody c6G7 showed clearly attenuated binding inhibitory activity (Fig. 4). Therefore, a rat-dog chimera incorporating the variable region sequences (SEQ ID NOs: 2 and 1 (amino acid sequences), SEQ ID NOs: 16 and 15 (nucleotide sequences after codon optimization)) of the rat antigen PD-L1 monoclonal antibody 4G12 as a therapeutic antibody Anti-PD-L1 antibody c4G12 was selected. The amino acid sequence and nucleotide sequence of c4G12 L chain (after codon optimization) are shown in SEQ ID NOs: 9 and 19, and the amino acid sequence and nucleotide sequence (after codon optimization) of H chain are shown in SEQ ID NOs: 10 and 20.

2.8 Expression of rat-dog chimeric anti-PD-L1 antibody c4G12

The rat-dog chimeric anti-PD-L1 antibody c4G12-expressing pDC6 vector used in 2.7 was transfected into dihydrofolate reductase-deficient CHO-DG44 cells (CHO-DG44 (dfhr-/-)), and high expression clones were obtained. Selection was made by the dot blot method. In addition, gene amplification treatment was performed by adding a load in a medium containing 60 nM methotrexate (Mtx). Rat-dog chimeric anti-PD-L1 antibody c4G12 stable expression cells (clone name: 4.3F1) after completion of gene amplification were transferred to Mtx-free Opti-CHO medium and cultured with shaking for 14 days (125 rpm, 37 °C, 5% CO2). Cell viability was calculated by trypan blue staining (FIG. 5). The amount of chimeric antibody produced in the culture supernatant was quantified by ELISA method (FIG. 5). The culture supernatant on day 14 was centrifuged at 10,000 g for 10 minutes to remove cells, and then passed through a 0.22 μm filter to proceed to the antibody purification step.

In addition, by changing the medium to Dynamis medium and carrying out an appropriate feed, the amount of antibody production was improved to approximately twice the conventional level (data not shown).

2.9. Purification of rat-dog chimeric anti-PD-L1 antibody c4G12

The culture supernatant prepared by the above method was purified using Ab Capcher Extra (ProteNova). The binding to the resin was performed using an open column method, and PBS pH 7.4 was used as an equilibration buffer and washing buffer. IgG Elution Buffer (Thermo Scientific) was used as the elution buffer, and 1M Tris was used as the neutralization buffer. The purified antibody was concentrated by ultrafiltration using Amicon Ultra-15 (50 kDa, Millipore) and buffer replaced with PBS. It was passed through a filter of 0.22 μm and used for each experiment.

2.10. Confirmation of purification of rat-dog chimeric anti-PD-L1 antibody c4G12 (FIG. 6)

In order to confirm the purity of the purified antibody, antibody protein was detected by SDS-PAGE and CBB staining. A SuperSep Ace 5-20% (Wako) gradient gel was used and electrophoresed under reducing and non-reducing conditions for rat anti-PD-L1 monoclonal antibody 4G12 and rat-dog chimeric anti-PD-L1 antibody c4G12. . After dyeing with Quick-CBB kit (Wako Pure Chemical Industries, Ltd.), decolorization was performed in distilled water. A band was seen at the position of the molecular weight corresponding to the antibody, and the band of the impostor protein was not recognized.

2.11. Determination of binding affinity of rat antigen PD-L1 monoclonal antibody 4G12 and rat-dog chimeric anti-PD-L1 antibody c4G12 to cPD-L1-His

A primer (cPD-L1-His F) to which a NheI recognition sequence was added to the 5' end to amplify an extracellular region estimated from the predicted amino acid sequence of canine PD-L1, an EcoRV recognition sequence and a 6xHis tag to the 5' end A primer (cPD-L1-His R) to which the sequence was added was designed. PCR was performed using the synthesized beagle PBMC-derived cDNA as a template, and the PCR product was treated with NheI (Takara) and EcoRV (Takara), and then purified using FastGene Gel/PCR Extraction Kit (NIPPON Genetics) , Cloning was performed using the pCXN2.1 vector (Niwa et al., 1991; provided by Professor Takehiko Yokomizo, Graduate School of Medicine, Juntendo University) subjected to the same restriction enzyme treatment. Expression plasmids were purified using the QIAGEN Plasmid Midi kit (Qiagen) and stored at −30° C. until used in experiments. Thereafter, the prepared expression plasmid was labeled as pCXN2.1-cPD-L1-His.

Primer (cPD-L1-His F): CGCGGCTAGCATGAGAATGTTTAGTGTCTT (SEQ ID NO: 131)

Primer (cPD-L1-His R):

CGCGGATATCTTAATGGTGATGGTGATGGTGAGTCCTCTCACTTGCTGG (SEQ ID NO: 132)

The expression vector was transfected into Expi293F cells (Life Technologies), and a culture supernatant containing the recombinant protein was obtained. The produced recombinant protein is purified from the supernatant using TALON Metal Affinity Resin (Clontech), buffer is replaced with PBS using Amicon Ultra-4 Ultracel-3 (Merck Millipore), and used for experiments and stored at 4°C until (cPD-L1-His). The protein concentration was quantified by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) and used in subsequent experiments.

Evaluation of the binding affinity (Avidity) of the rat antigen PD-L1 monoclonal antibody 4G12 and the rat-dog chimeric anti-PD-L1 antibody c4G12 to cPD-L1-His using a biomolecular interaction analyzer (Biacore X100) did That is, specific binding was observed by immobilizing an anti-histidine antibody on a CM5 sensor chip, capturing cPD-L1-His, and then adding a monoclonal antibody as an analyte. Both antibodies showed specific binding, and Avidity was almost equivalent (Table 1). Also, similarly, when the avidity of canine PD-1-Ig and CD80-Ig to cPD-L1-His was measured, the binding affinity was clearly lower than that of the rat-dog chimeric anti-PD-L1 antibody c4G12 (Table 1). ).

Table 1. Binding affinity of each antibody and recombinant protein to canine PD-L1-His.

2.12. Canine PD-1/PD-L1 binding and CD80/PD-L1 binding inhibitory activity of rat-dog chimeric anti-PD-L1 antibody c4G12 (FIG. 7)

Canine PD-1/PD-L1 binding and CD80/PD-L1 binding inhibition tests with anti-PD-L1 antibodies were conducted using canine PD-1-Ig, PD-L1-Ig and CD80-Ig (as described above). did Canine PD-1-Ig or CD80-Ig was stratified on a flat-bottomed 96 well plate, and each concentration (0, 2.5, 5, 10 μg/ml) of the rat antigen PD-L1 antibody 4G12 or rats was added according to the procedure in 2.6. - The binding amount of canine PD-L1-Ig reacted with the canine chimeric anti-PD-L1 antibody c4G12 was evaluated. Changes in the binding inhibitory activity due to chimeric antibody formation were not confirmed.

2.13. Effect of rat-dog chimeric anti-PD-L1 antibody c4G12 on activating canine immune-competent cells (FIG. 8)

Canine PBMCs were cultured for 3 days by stimulation with Staphylococcal Enterotoxin B (SEB), a super antigen, and the change in cytokine production by addition of the rat-dog chimeric anti-PD-L1 antibody c4G12 was measured by Duoset ELISA canine IL-2 or IFN-γ. (R & D systems) was used and quantified by the ELISA method. The rat-dog chimeric anti-PD-L1 antibody c4G12 increased the production of IL-2 and IFN-γ from canine PBMCs. Similarly, EdU, a nucleic acid analog, was added to the culture medium on the second day of SEB stimulation, and after culturing for 2 hours, the uptake was quantified by flow cytometry using a Click-iT Plus EdU flow cytometry assay kit (Life Technologies). , EdU uptake in canine CD4+ or CD8+ lymphocytes was enhanced by the addition of the rat-dog chimeric anti-PD-L1 antibody c4G12, and an increase in cell proliferation ability was confirmed.

2.14. Selection of dogs with tumors used for inoculation tests for dogs

Since this treatment is expected to be more effective when PD-L1 is expressed in the tumor, PD-L1 expression analysis was performed in the tumor part of the dog by immunohistochemical staining. Formaldehyde-fixed, paraffin-embedded tumor tissue was cut into thin slices with a microtome to a thickness of 4 µm, attached to silane-coated glass slides (Matsunami Glass Industrial Co., Ltd.), dried, and then deparaffinized with xylene/alcohol. was carried out. While immersing in citric acid buffer {0.37 g of citric acid (Wako Pure Chemical Industries, Ltd.), 2.4 g of trisodium citrate dihydrate (Kishida Chemical Co., Ltd., 1000 ml of distilled water}), antigen activation treatment was performed with a microwave for 10 minutes, and Nichirei auto-immunization was performed. Dyeing was performed by a dyeing apparatus. As a pretreatment, it was immersed in a methanol solution containing 0.3% hydrogen peroxide at room temperature for 15 minutes, washed with PBS, and an anti-PD-L1 monoclonal antibody was added and reacted at room temperature for 30 minutes. After washing with PBS, histopine simple stain MAX-PO (Rat) (Nichirei Biosciences) was added and reacted at room temperature for 30 minutes, followed by 3,3'-diaminobenzidine tetrahydrochloride (3,3' -diaminobenzidine tetrahydrocholide) and observed using an optical microscope. Dogs with oral melanoma and undifferentiated sarcoma in which tumor cells were positive for PD-L1 were used for the following inoculation test (clinical test). The antigen PD-L1 monoclonal antibody is a hybridoma producing a rat antigen PD-L1 monoclonal antibody (Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology. 2014 Aug; 142 (4): 551-61.).

2.15. Inoculation test for dogs

For the rat-dog chimeric anti-PD-L1 antibody c4G12 to be inoculated in dogs in clinical trials, MabSelect SuRe LX (GE Healthcare) was prepared from the culture supernatant obtained by the procedure shown in 2.8 for the purpose of removing contaminants and polymer proteins. After affinity chromatography purification was performed, hydroxy apatite chromatography purification was performed using a BioScale CHT20-I prepacked column (Bio-Rad). The fraction containing the aggregate was further purified by anion exchange chromatography using a HiScreen Q-Sepharose HP prepacked column (GE Healthcare).

(1) Safety test: Dogs (beagles, contraceptive females, 13 years old, body weight approximately 10 kg) were instilled with 2 mg/kg of the established rat-dog chimeric anti-PD-L1 antibody c4G12 three times at 2-week intervals (點滴靜注) was done. Other than anaphylaxis, no clinically problematic side effects were observed.

(2) Clinical trial 1: rat-dog chimeric anti-PD-L1 antibody c4G12 2 established in PD-L1-positive intraoral melanoma (Fig. 9A) recurrent dog (miniature dachshund, male, 11 years old, approximately 7.5 kg body weight) MG/kg or 5 mg/kg was intravenously dripped 22 times at 2-week intervals. Significant tumor shrinkage was confirmed at 10 weeks after initiation of treatment, and further shrinkage was confirmed at 34 weeks after initiation of treatment (FIG. 10). During the 44-week observation period, no metastases to lymph nodes or lungs were identified. If PR (partial success) was defined as a reduction in tumor long diameter of 30% or more compared to the baseline, PR criteria were met at 16 to 20 weeks and after 34 weeks (FIG. 11).

(3) Clinical trial 2: Dog with undifferentiated sarcoma disease (West Highland White Terrier, castrated male, 12 years old, weighing about 8 kg ) was instilled with 5 mg/kg of the rat-dog chimeric anti-PD-L1 antibody c4G12 twice at intervals of 2 weeks. Clear tumor regression was confirmed at 3 weeks after the start of treatment (FIG. 12).

(4) Clinical trial 3: For a dog with intraoral melanoma from which the primary site was surgically removed (beagle, contraceptive female, 11 years old, weight approximately 10 kg), rat-dog chimera anti-PD-L1 antibody c4G12 2 mg /kg or 5 mg/kg was intravenously dripped 9 times at 2-week intervals. At 18 weeks of initiation of treatment, multiple lung metastases had disappeared (FIG. 13).

(5) Clinical trial 4: 2 mg/kg or 5 mg/kg of the rat-dog chimeric anti-PD-L1 antibody c4G12 was intravenously administered intravenously to four dogs suffering from oral melanoma with lung metastases. Although there was no obvious tumor shrinkage during the observation period, the survival period after lung metastasis was confirmed tended to be longer than that of the control group (no antibody administration, historical control group: n = 15) (FIG. 14). Administration may prolong survival.

2.16. CDR analysis of anti-PD-L1 antibody

NCBI IGBLAST (http://www.ncbi.nlm.nih.gov/igblast/) was used to determine the complementarity determining regions (CDRs) of the rat antigen PD-L1 antibody 4G12. The results are shown in FIG. 15 .

[Example 2] Application of anti-PD-L1 antibody to other animal species

1.1. Identification of the PD-L1 gene for sheep, pigs and water buffalo

To determine the full length of the ovine, porcine, and water buffalo PD-L1 cDNA coding region (CDS), first, the entire CDS of the gene was obtained from the nucleotide sequences (GenBank accession numbers: XM_004004362, NM_001025221 and XM_613366) of the ovine, porcine, and bovine PD-L1 genes. Primers (ovPD-L1 CDS F and R, poPD-L1 CDS F and R, buPD-L1 CDS F1, R1, F2, and R2) to amplify the length were designed and PCR methods were performed. For the obtained amplification product, the base sequence was determined by a capillary sequencer according to a conventional method (Mingala CN, Konnai S, Ikebuchi R, Ohashi K. Comp. Immunol. Microbiol. Infect. Dis. 2011 Jan; 34 ( 1): 55-63. Thesis identifying the water buffalo PD-L1 gene).

Primer (ovPD-L1 CDS F): ATGAGGATATATAGTGTCTTAACAT (SEQ ID NO: 109)

Primer (ovPD-L1 CDS R): TTACGTCTCCTCAAAATGTG (SEQ ID NO: 110)

Primer (poPD-L1 CDS F): ATGAGGATATGTAGTATCTTTACAT (SEQ ID NO: 111)

Primer (poPD-L1 CDS R): TTACGTCTCCTCAAATTGTGT (SEQ ID NO: 112)

Primer (buPD-L1 CDS F1): ATGAGGATATATAGTGTCTT (SEQ ID NO: 113)

Primer (buPD-L1 CDS R1): GCCACTCAGGACTTGGTGAT (SEQ ID NO: 114)

Primer (buPD-L1 CDS F2): GGGGGTTTACTGTTGCTTGA (SEQ ID NO: 115)

Primer (buPD-L1 CDS R2): TTACGTCTCCTCAAATTGT (SEQ ID NO: 116)

1.2. Construction of Ovine PD-1, Ovine PD-L1, Porcine PD-1 and Porcine PD-L1 Expressing COS-7 Cells

To prepare ovine PD-1, ovine PD-L1, porcine PD-1 and porcine PD-L1 expression plasmids, the synthesized ovine or porcine PBMC-derived cDNA was used as a template, and restriction enzymes BglII and SmaI (sheep) were added to the 5' end. PD-1), HindIII and SmaI (porcine PD-1), or XhoI and SmaI (sheep and pig PD-L1) recognition sites were added to design primers (ovPD-1-EGFP F and R, ovPD-L1-EGFP PCR was performed using F and R, poPD-1-EGFP F and R, or poPD-L1-EGFP F and R). The obtained PCR products were BglII (Takara) and SmaI (Takara) (sheep PD-1), HindIII (Takara) and SmaI (Takara) (pig PD-1), XhoI (Takara) and SmaI (Takara) ) (sheep and pig PD-L1), purified using FastGene Gel/PCR Extraction Kit (NIPPON Genetics), introduced into pEGFP-N2 vector (Clontech) subjected to the same restriction enzyme treatment, Cloning was performed. Expression plasmids were extracted using FastGene Xpress Plasmid PLUS Kit (NIPPON Genetics) and stored at −30° C. until used for experiments. Thereafter, the prepared expression plasmids were designated as pEGFP-N2-ovPD-1, pEGFP-N2-ovPD-L1, pEGFP-N2-poPD-1 or pEGFP-N2-poPD-L1.

Primer (ovPD-1-EGFP F): GAAGATCTATGGGGACCCCGCGGGCGCCG (SEQ ID NO: 117)

Primer (ovPD-1-EGFP R): GACCCGGGGAGGGGCCAGGAGCAGTGTCC (SEQ ID NO: 118)

Primer (ovPD-L1-EGFP F): CCGCTCGAGATGAGGATATATAGTGTCT (SEQ ID NO: 119)

Primer (ovPD-L1-EGFP R): ATCCCGGGCGTCTCCTCAAAATGTGTAG (SEQ ID NO: 120)

Primer (poPD-1-EGFP F): ACTAAGCTTATGGGGACCCCGCGGG (SEQ ID NO: 121)

Primer (poPD-1-EGFP R): ACTCCCGGGGAGGGGCCAAGAGCAGT (SEQ ID NO: 122)

Primer (poPD-L1-EGFP F): CCGCTCGAGATGAGGATATGTAGTATCTT (SEQ ID NO: 123)

Primer (poPD-L1-EGFP R): ATCCCGGGCGTCTCCTCAAATTGTGTATC (SEQ ID NO: 124)

COS-7 cells at 5 × 10 ⁴ /cm 2 were passaged in a 6-hole plate and cultured overnight at 37° C. in 5% CO 2 in RPMI 1640 medium containing 10% non-assimilated fetal bovine serum and 0.01% L-glutamine. . 0.4 μg/cm of pEGFP-N2-ovPD-1, pEGFP-N2-ovPD-L1, pEGFP-N2-poPD-1, pEGFP-N2-poPD-L1, or pEGFP-N2 as a negative control was added to Lipofectamine 2000 reagent (Invitrogen). ) were introduced into COS-7 cells, respectively, and cultured for 48 hours (ovPD-1-EGFP expressing cells, ovPD-L1-EGFP expressing cells, poPD-1-EGFP expressing cells and poPD-L1-EGFP expressing cells ). To confirm the expression of ovine PD-1, ovine PD-L1, porcine PD-1 and porcine PD-L1 in the prepared expression cells, an inverted confocal laser microscope LSM700 (ZEISS) or an all-in-one fluorescence microscope BZ- The intracellular localization of EGFP was visualized by 9000 (KEYENCE).

1.3. Construction of Recombinant Ovine PD-L1 and Porcine PD-L1

Primers (ovPD-L1-Ig F and R, or poPD- L1-Ig F and R) were designed. PCR was performed using the synthesized sheep or porcine PBMC-derived cDNA as a template, and the PCR product was treated with NheI (Takara) and EcoRV (Takara), and then FastGene Gel/PCR Extraction Kit (NIPPON Genetics) was used pCXN2.1-Rabbit IgG Fc vector (Niwa et al., 1991; Zettlmeissl et al., 1990; It is obvious that it was diverted from Professor Takehiko Yokomizo, Graduate School of Medicine, Juntendo University modified in), and cloning was performed. Expression plasmids were purified by FastGene Xpress Plasmid PLUS Kit (NIPPON Genetics) and stored at −30° C. until used for experiments. Thereafter, the prepared expression plasmid was labeled as pCXN2.1-ovPD-L1-Ig or pCXN2.1-poPD-L1-Ig.

Primer (ovPD-L1-Ig F): GACGCTAGCATGAGGATATATAGTGTCT (SEQ ID NO: 125)

Primer (ovPD-L1-Ig R): GCTCTGATATCCCTCGTTTTTGCTGGAT (SEQ ID NO: 126)

Primer (poPD-L1-Ig F): GACGCTAGCATGAGGATATGTAGTATCTT (SEQ ID NO: 127)

Primer (poPD-L1-Ig R): AGCTGATATCCCTCTTTCTTGCTGGATC (SEQ ID NO: 128)

30 μg of pCXN2.1-ovPD-L1-Ig or pCXN2.1-poPD-L1-Ig was introduced into 7.5 × 10 ⁷ Expi293F cells (Life Technologies) using Expifectamin (Life technologies), and 6 Culture supernatant was recovered by carrying out daily shaking culture. In the culture supernatant containing the Fc fusion recombinant protein, the Fc fusion reconstituted protein was purified using Ab-Capcher Extra (ProteNova). After purification, the buffer was replaced with PBS (pH 7.4) using a PD-10 Desalting Column (GE Healthcare), and stored at -30°C until used for experiments (ovine PD-L1-Ig). After purification, the concentrations of ovine PD-L1-Ig and porcine PD-L1-Ig were measured using Rabbit IgG ELISA Quantitation Set (BETHYL). Auto Palte Washer BIO WASHER 50 (DS Pharma Biomedical) was used for each washing operation of ELISA, and Microplate Reader MTP-650FA (Corona Electric Co., Ltd.) was used for absorbance measurement.

1.4. Reactivity of the rat antigen PD-L1 antibody 4G12 against ovine and porcine PD-L1

Cross-reactivity of the rat antigen PD-L1 monoclonal antibody to sheep and pig PD-L1 was confirmed by flow cytometry. Sheep and porcine PD-L1-EGFP expressing COS-7 cells were blocked with 10% non-assimilated goat serum in PBS at room temperature for 15 minutes, and 10 μg/ml of rat antigen PD-L1 antibody 4G12 was reacted at room temperature for 30 minutes After washing, allophycocyanine-labeled anti-rat Ig goat antibody (Beckman Coulter) was reacted at room temperature for 30 minutes. FACS Verse (BD Biosciences) was used for analysis. As a negative control antibody, a rat IgG2a (κ) isotype control (BD Biosciences) was used. In addition, PBS with 1% bovine serum albumin was used for all washing operations and antibody dilution.

Experimental results are shown in FIG. 16 . It was confirmed that the rat antigen PD-L1 antibody 4G12 binds to sheep and pig PD-L1.

1.5. Reactivity of the rat antigen PD-L1 antibody 4G12 on water buffalo leukocytes

Peripheral blood of water buffalo (Bubalus bubalis; Asiatic water buffalo) was hemolyzed with ACK buffer, and leukocytes were isolated. 10% non-assimilated goat serum was blocked at room temperature for 15 minutes using PBS, and rat antigen PD-L1 antibody 4G12/Peridinin-chlorophyll-protein complex/cyanin 5.5-labeled antigen CD14 antibody (mouse IgG1, CAM36A, manufactured by VMRD)/appell CD11b Antibodies (mouse IgG2b, CC126, AbD Serotec) were reacted at room temperature for 30 minutes. After washing, allophycocyanine-labeled anti-rat Ig goat antibody (Beckman Coulter) and Fluorescein isothiocyanate-labeled anti-mouse IgG2b goat antibody (Beckman Coulter) were reacted at room temperature for 30 minutes. FACS Calibur (BD Biosciences) was used for analysis. As a negative control antibody, a rat IgG2a (κ) isotype control (BD Biosciences) was used. In addition, PBS with 10% non-assimilated goat serum was used for all washing operations and antibody dilution.

Experimental results are shown in FIG. 17 . The rat antigen PD-L1 antibody 4G12 strongly bound to water buffalo blood macrophages (CD14+CD11b+ cells). Further, the rat antigen PD-L1 antibody 4G12 weakly bound to water buffalo lymphocytes (CD14-CD11b-cells). This difference in binding properties is thought to reflect the expression level of PD-L1 in macrophages and lymphocytes.

1.6. Ovine or Porcine PD-1/PD-L1 Binding Inhibition Test by Rat Antigen PD-L1 Antibody 4G12

Using ovine PD-1-EGFP expressing COS-7 cells and ovine PD-L1-Ig recombinant protein, or porcine PD-1-EGFP expressing COS-7 cells and porcine PD-L1-Ig recombinant protein, the rat appeals PD-L1-Ig recombinant protein. A sheep or pig PD-1/PD-L1 binding inhibition test by the L1 antibody (4G12) was conducted. Each concentration (0, 1, 5, 10, 20, 50 μg/ml) of the rat antigen PD-L1 antibody 4G12 was previously added to sheep PD-L1-Ig (final concentration: 1 μg/ml) or pig PD-L1-Ig ( final concentration of 5 µg/ml) at 37°C for 30 minutes, and then 2 × 10 ⁵ sheep PD-1-EGFP expressing COS-7 cells or pig PD-1-EGFP expressing COS-7 cells, respectively. It was made to react for 30 minutes at degreeC. After washing, sheep PD-L1-Ig or pig PD-L1-Ig bound to the cell surface was detected by Alexa Fluor 647-labeled anti-rabbit IgG (H+L) goat F(ab')2 (Life Technologies). FACS Verse (BD Biosciences) was used for analysis. As a negative control antibody, a rat IgG2a (κ) isotype control (BD Biosciences) was used. The ratio of PD-L1-Ig binding cells when no antibody was added was taken as 100%, and the ratio of PD-L1-Ig binding cells at each concentration was expressed as a relative value.

As a result, it was shown that the rat antigen PD-L1 antibody 4G12 can inhibit the binding between sheep PD-1/PD-L1 and pig PD-1/PD-L1 in a concentration-dependent manner ( Fig. 18 ).

[Example 3]

1. Introduction

The immunosuppressive receptor Programmed death 1 (PD-1) and its ligand Programmed death ligand 1 (PD-L1) suppress excessive immune responses and are deeply involved in immune tolerance, Kyoto University, Honjo Tasuku and others It is a molecule identified by It has also recently been found to be involved in immunosuppression in tumors. In this Example, for the purpose of establishing a novel treatment for bovine infections, the variable region gene of bovine PD-1 and rat antigen PD-L1 monoclonal antibody (4G12) capable of inhibiting the binding of PD-L1, and bovine immune globulin (IgG1, however, in order to suppress ADCC activity, mutations were added to the expected Fcγ receptor binding site in the CH2 domain. See Figure 19. Amino acid numbers and mutations: 250 E→P, 251 L→V, 252 P→A, 253 G→Deleted, 347 A→S, 348 P→S ;Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology 2014 Aug ;142(4)：551- 561.), rat-bovine chimeric anti-PD-L1 antibody ch4G12 obtained by culturing and propagating Chinese hamster ovary cells (CHO cells) into which a chimeric antibody gene combining the constant region genes was introduced, and in vitro and in vivo effects were confirmed.

2. Materials and Methods

Construction of Bovine PD-1 and PD-L1 Expressing Cells

bovine PD-1 gene (GenBank accession number AB510901 ; Ikebuchi R, Konnai S, Sunden Y, Onuma M, Ohashi K. Microbiol. Immunol. 2010 May ; 54 (5): 291-298.), bovine PD-L1 gene ( GenBank accession number AB510902; Ikebuchi R, Konnai S, Shirai T, Sunden Y, Murata S, Onuma M, Ohashi K. Vet. Res. 2011 Sep. 26; 42:103.) to determine the full-length cDNA base sequence. and produced bovine PD-1 or PD-L1 membrane-expressing cells from the genetic information. First, in order to prepare a bovine PD-1 or PD-L1 expression plasmid, using the synthesized bovine PBMC-derived cDNA as a template, restriction enzymes NotI and HindIII (bovine PD-1), NheI and XhoI (bovine PD-1) were added to the 5' end. PCR was performed using primers (boPD-1-myc F and R, boPD-L1-EGFP F and R) to which PD-L1) recognition sites were added. The obtained PCR products were treated with NotI (Takara) and HindIII (Takara; bovine PD-1), NheI (Takara) and XhoI (Takara; bovine PD-L1), followed by FastGene Gel/PCR Extraction Kit ( NIPPON Genetics), introduced into pCMV-Tag1 vector (Agilent Technologies; bovine PD-1) or pEGFP-N2 vector (Clontech; bovine PD-L1) subjected to the same restriction enzyme treatment, and cloning was performed. conducted. The resulting expression plasmid of interest was extracted using the QIAGEN Plasmid Midi kit (Qiagen) and stored at -30°C until used for experiments. Thereafter, the prepared expression plasmid is designated as pCMV-Tag1-boPD-1.

Primer (boPD-1-myc F): ATATGCGGCCGCATGGGGACCCCGCGGGCGCT (SEQ ID NO: 133)

Primer (boPD-1-myc R): GCGCAAGCTTTCAGAGGGGCCAGGAGCAGT (SEQ ID NO: 134)

Primer (boPD-L1-EGFP F): CTAGCTAGCACCATGAGGATATATAGTGTCTTAAC (SEQ ID NO: 135)

Primer (boPD-L1-EGFP R): CAATCTCGAGTTACAGACAGAAGATGACTGC (SEQ ID NO: 136)

Bovine PD-1 membrane-expressing cells were prepared according to the following procedure. First, 2.5 μg of pCMV-Tag1-boPD-1 was introduced into 4 × 10 ⁶ CHO-DG44 cells using Lipofectamine LTX (Invitrogen). After 48 hours, CD DG44 medium containing 800 μg/ml G418 (Enzo Life Science), 20 ml/ℓ GlutaMAX supplement (Life technologies), 18 ml/ℓ 10% Pluronic F-68 (Life technologies) ( The medium was exchanged with Life technologies Co., Ltd., and selection was performed. The obtained expressing cells were reacted with rat antigen PD-1 antibody 5D2 at room temperature, and after washing, further reacted with anti-rat IgG microbeads labeled antibody (Miltenyi Biotec) at room temperature. Cells highly expressing bovine PD-1 were isolated using Auto MACS (Miltenyi Biotec), and re-isolation was performed in the same procedure to increase the purity. Cloning was performed on the prepared expressing cells by the limiting dilution method to obtain bovine PD-1 highly expressing CHO DG44 cells (bovine PD-1 expressing cells).

Bovine PD-L1 membrane-expressing cells were prepared according to the following procedure. First, 2.5 μg of pEGFP-N2-boPD-L1 or pEGFP-N2 as a negative control was introduced into 4 × 10 ⁶ CHO-DG44 cells using Lipofectamine LTX (Invitrogen). After 48 hours, CD DG44 medium containing 800 μg/ml G418 (Enzo Life Science), 20 ml/ℓ GlutaMAX supplement (Life technologies), 18 ml/ℓ 10% Pluronic F-68 (Life technologies) ( Life technologies Co., Ltd.), and at the same time as performing selection, cloning was performed by the limiting dilution method (bovine PD-L1 expressing cells). In order to confirm expression of bovine PD-L1 in the prepared expressing cells, intracellular localization of EGFP was visualized using an inverted confocal laser microscope LSM700 (ZEISS).

Construction of Soluble Bovine PD-1 and PD-L1

A bovine PD-1-Ig expression plasmid was constructed according to the following procedure. A gene sequence was prepared by combining the signal peptide and extracellular region of bovine PD-1 (GenBank accession number AB510901) with the known constant region Fc portion of bovine IgG1 (GenBank accession number X62916), and codon optimization was performed in CHO cells. After that, the restriction enzyme (NotI) recognition sequence, KOZAK sequence, bovine PD-1 signal peptide sequence, bovine PD-1 gene extracellular region sequence, bovine IgG1 Fc region sequence, and restriction enzyme (XbaI) recognition sequence are arranged in the above order. Gene synthesis was performed to In addition, bovine IgG1 was mutated at the expected Fcγ receptor binding site in the CH2 domain in order to suppress ADCC activity (mutation insertion point: 185 E→P, 186 L→V, 187 P→A, 189 G→deletion, 281 A→S, 282 P→S;Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology 2014 Aug;142(4):551-561. Figure 2 shows the amino acid sequence of PD-1-Ig and the site of mutation insertion). The synthesized gene chain was treated with NotI (Takara) and XbaI (Takara), then purified using FastGene Gel/PCR Extraction Kit (NIPPON Genetics), and the expression vector pDN11 subjected to the same restriction enzyme treatment ( A bovine PD-1-Ig expression vector was constructed by incorporating into the cloning site (NotI and XbaI restriction enzyme recognition sequences located downstream of PCMV, between INRBG and PABGH) of Hokkaido University Zoological Infectious Disease Research Center, provided by Professor Yasuhiko Suzuki. . Expression plasmids were purified using the QIAGEN Plasmid Midi kit (Qiagen) and stored at −30° C. until used in experiments. Thereafter, the prepared expression plasmid is labeled as pDN11-boPD-1-Ig.

A bovine PD-L1-Ig expression plasmid was constructed according to the following procedure. To amplify the signal peptide and extracellular region of bovine PD-L1 (GenBank accession number AB510902), primers (boPD-L1-Ig F and R) to which restriction enzymes NheI and EcoRV recognition sites were added to the 5' end were designed. . PCR was performed using the synthesized bovine PBMC-derived cDNA as a template, and the PCR product was treated with NheI (Takara) and EcoRV (Takara), and then purified using FastGene Gel/PCR Extraction Kit (NIPPON Genetics) , introduced into the pCXN2.1-Rabbit IgG1 Fc vector (Niwa et al., 1991; Zettlmeissl et al., 1990; modified from Professor Takehiko Yokomizo, Professor, Graduate School of Medicine, Juntendo University) subjected to the same restriction enzyme treatment, , cloning was performed. Expression plasmids were purified by QIAGEN Plasmid Midi kit (Qiagen) or FastGene Xpress Plasmid PLUS Kit (NIPPON Genetics) and stored at -30°C until used for experiments. Thereafter, the prepared expression plasmid is labeled as pCXN2.1-boPD-L1-Ig.

Primer (boPD-L1-Ig F): GCTAGCATGAGGATATATAGTGTCTTAAC (SEQ ID NO: 137)

Primer (boPD-L1-Ig R): GATATCATTCCTCTTTTTTGCTGGAT (SEQ ID NO: 138)

Soluble bovine PD-1-Ig expressing cells were prepared according to the following procedure. 2.5 μg of pDN11-boPD-1-Ig was introduced into 4 × 10 ⁶ CHO-DG44 cells using Lipofectamine LTX (Invitrogen). After 48 hours, the medium was replaced with OptiCHO AGT medium (Life technologies) containing 800 μg/ml of G418 (Enzo Life Science) and 20 ml/ℓ of GlutaMAX supplement (Life technologies), cultured for 3 weeks, and selection was performed. did The concentration of the Fc fusion recombinant protein in the culture supernatant of the resulting cell line was measured using an ELISA method using an antigen IgG F(c) rabbit polyclonal antibody (Rockland), and a cell line highly expressing the Fc fusion recombinant protein was selected. conducted. The resulting high-expressing cell line was transferred to a G418-free medium, shaken culture was performed for 14 days, and the culture supernatant was recovered. The culture supernatant containing the Fc fusion recombinant protein was ultrafiltered using Centricon Plus-70 (Millipore), and then the Fc fusion recombinant protein was purified using Ab-Capcher Extra (ProteNova). After purification, the buffer was replaced with phosphate-buffered saline (PBS; pH 7.4) using a PD-10 Desalting Column (GE Healthcare), and stored at -30°C until used for experiments (bovine PD-1-Ig ). The concentration of bovine PD-1-Ig after purification was measured by an ELISA method using an anti-IgG F(c) rabbit polyclonal antibody (Rockland). Auto Plate Washer BIO WASHER 50 (DS Pharma Biomedical) was used for each washing operation of ELISA, and Microplate Reader MTP-650FA (Corona Electric Co., Ltd.) was used for absorbance measurement.

Soluble bovine PD-L1-Ig expressing cells were prepared according to the following procedure. 30 μg of pCXN2.1-boPD-L1-Ig was introduced into 7.5 × 10 ⁷ Expi293F cells (Life Technologies) using Expifectamine (Life Technologies), shaking culture was performed for 7 days, and the culture supernatant was recovered. . The recombinant protein was purified from the culture supernatant using Ab-Capcher Extra (ProteNova; bovine PD-L1-Ig). After purification, the buffer was replaced with PBS (pH 7.4) using PD MiniTrap G-25 (GE Healthcare), and stored at -30°C until used for experiments (bovine PD-L1-Ig). The concentration of bovine PD-L1-Ig after purification was measured using Rabbit IgG ELISA Quantitation Set (Bethyl Co.). Auto Plate Washer BIO WASHER 50 (DS Pharma Biomedical) was used for each washing operation of ELISA, and Microplate Reader MTP-650FA (Corona Electric Co., Ltd.) was used for absorbance measurement.

Preparation of Rat Antigen PD-L1 Monoclonal Antibody Producing Cells

Bovine PD-L1-Ig (Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology 2014 Aug.; 142 (4): 551-561. Described in this paper bovine PD-L1-Ig was prepared by the method and used for immunization) in the foot of a rat, and a hybridoma was established using the iliac lymph node method, and the rat antigen PD-L1 monoclonal Antibody-producing hybridoma strain 4G12 was obtained. The method for establishing a rat antigen PD-L1 monoclonal antibody is described in detail in the following non-patent literature (Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Vet. Res. 2013 Jul. 22;44:59;Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology 2014 Aug.;142 (4): 551-561).

Construction of Rat-Bovine Chimeric Antibody PD-L1 Antibody Expression Vector

A rat-bovine chimeric PD-L1 antibody ch4G12 was established by fusing the antibody constant regions of bovine IgG1 and bovine Igλ using rat antigen PD-L1 antibody 4G12 as an antibody variable region.

First, genes in the variable regions (heavy chain and light chain) were respectively identified from hybridomas producing the rat antigen PD-L1 antibody 4G12. Next, the heavy chain and light chain variable region sequences of each of the rat antibodies were linked to the known constant regions of bovine IgG1 (heavy chain; GenBank Accession number X62916 modified) and bovine Igλ (light chain; GenBank Accession number X62917). A gene sequence was prepared and codon optimization was performed (rat-bovine chimera antigen PD-L1 antibody ch4G12: SEQ ID NOs: 105 and 106 (amino acid sequences), SEQ ID NOs: 107 and 108 (nucleotide sequences after codon optimization)). In addition, in order to suppress ADCC activity in bovine IgG1, mutations were added to the Fcγ receptor expected binding site in the CH2 domain (see Fig. 19. Amino acid numbers and mutations: 250 E→P, 251 L→V, 252 P→A, 253 G→Deleted, 347 A→S, 348 P→S ;Ikebuchi R, Konnai S, Okagawa T, Yokoyama K, Nakajima C, Suzuki Y, Murata S, Ohashi K. Immunology 2014 Aug ;142(4)：551- 561.). In addition, NotI restriction enzyme recognition sequence, KOZAK sequence, chimeric antibody light chain sequence, poly A addition signal sequence (PABGH), promoter sequence (PCMV), SacI restriction enzyme recognition sequence, intron sequence (INRBG), KOZAK sequence, chimeric antibody intermediate Genes were artificially synthesized so that the sequence sequence and the XbaI restriction enzyme recognition sequence were arranged in the above order. Expression plasmid pDC6 (Hokkaido It was introduced into the cloning site (notI and XbaI restriction enzyme recognition sequences located downstream of PCMV, between INRBG and PABGH) of the University's Infectious Disease Research Center, provided by Professor Yasuhiko Suzuki, and cloned (FIG. 20). The resulting expression plasmid of interest was extracted using the QIAGEN Plasmid Midi kit (Qiagen) and stored at -30°C until used for experiments. Thereafter, the prepared expression plasmid is labeled as pDC6-boPD-L1ch4G12.

Expression of the rat-bovine chimeric anti-PD-L1 antibody

pDC6-boPD-L1ch4G12 was introduced into CHO-DG44 cells (CHO-DG44 (dfhr ^−/− )), which are dihydrofolate reductase deficient cells. After 48 hours, the medium was replaced with OptiCHO AGT medium (Life technologies) containing 20 ml/L of GlutaMAX supplement (Life technologies), cultured for 3 weeks, and expression cells were selected and cloned by the limiting dilution method. Next, the concentration of the chimeric antibody contained in the culture supernatant was measured by a dot blot method using an antigen IgG F(c) rabbit polyclonal antibody (Rockland) and an ELISA method, and clones with high expression were selected. In addition, gene amplification was performed on the selected rat-bovine chimera antigen PD-L1 antibody high-expressing clones by loading them in a medium containing 60 nM methotrexate (Mtx). The rat-bovine chimeric antigen PD-L1 antibody stably expressing cells established as described above were transferred to Mtx-free Opti-CHO AGT medium, and cultured with shaking for 14 days (125 rpm, 37°C, 5% CO ₂ ). The amount of chimeric antibody produced in the culture supernatant was quantified using an ELISA method using an antigen IgG F(c) rabbit polyclonal antibody (Rockland). Auto Plate Washer BIO WASHER 50 (DS Pharma Biomedical) was used for each washing operation of ELISA, and Microplate Reader MTP-650FA (Corona Electric Co., Ltd.) was used for absorbance measurement. The culture supernatant on day 14 was centrifuged at 10,000 g for 10 minutes to remove cells, and then the centrifuged supernatant was sterilized by passing through a Steritop-GP 0.22 μm filter (Millipore), and stored at 4° C. until used for purification.

Purification of Rat-Bovine Chimeric Antibody PD-L1 Antibodies

From the culture supernatant prepared by the above method, each chimeric antibody was purified using Ab Capcher Extra (ProteNova). The binding to the resin was performed using an open column method, and PBS (pH 7.4) was used as an equilibration buffer and washing buffer. IgG Elution Buffer (Thermo Fisher Scientific) was used as the elution buffer, and 1 M Tris (pH 9.0) was used as the neutralization buffer. The purified antibody was buffer replaced with PBS (pH 7.4) and concentrated using a PD-10 Desalting Column (GE Healthcare) and Amicon Ultra-15 (50 kDa, Millipore). The purified chimeric antibody was sterilized by passing through a 0.22 μm syringe filter (Millipore), and stored at 4°C until used for experiments.

Confirmation of Purification Purity of Rat-Bovine Chimeric Antibody PD-L1 Antibody (FIG. 21)

In order to confirm the purity of the purified rat-bovine chimeric antigen PD-L1 antibody, antibody protein was detected by SDS-PAGE and CBB staining. Using a 10% acrylamide gel, the purified rat-bovine chimeric antibody was subjected to electrophoresis under reducing conditions (reduction with 2-mercaptoethanol (Sigma-Aldrich)) and non-reducing conditions. After staining with Quick-CBB kit (Wako Pure Chemical Industries, Ltd.), discoloration was performed in distilled water. The result is shown in FIG. 21. Bands were confirmed at the expected positions of 25 kDa and 50 kDa under reducing conditions and 150 kDa under non-reducing conditions.

Binding Specificity of the Rat-Bovine Chimeric Antibody PD-L1 Antibody (FIG. 22)

It was confirmed by flow cytometry that the rat-bovine chimeric antigen PD-L1 antibody specifically binds to bovine PD-L1-expressing cells (described above). First, the rat antigen PD-L1 antibody 4G12 or the rat-bovine chimeric PD-L1 antibody ch4G12 was reacted with bovine PD-L1 expressing cells at room temperature for 30 minutes. After washing, APC-labeled anti-rat Ig goat antibody (Southern Biotech) or Alexa Fluor 647-labeled antigen IgG (H+L) goat F(ab')2 (Jackson ImmunoResearch) was reacted at room temperature for 30 minutes. As a negative control antibody, a rat IgG2a (κ) isotype control (BD Biosciences) or a bovine IgG1 antibody (Bethyl) was used. After washing, each rat antibody or rat-bovine chimeric antibody bound to the cell surface was detected by FACS Verse (BD Biosciences). In addition, PBS to which 1% bovine serum albumin (Sigma-Aldrich) was added was used for all washing operations and antibody dilution.

The experimental results are shown in FIG. 22 . Rat-bovine chimeric PD-L1 antibody ch4G12 was shown to bind to bovine PD-L1-expressing cells similarly to rat antigen PD-L1 antibody 4G12.

Bovine PD-1/PD-L1 binding inhibitory activity of rat-bovine chimeric anti-PD-L1 antibody

(1) Binding inhibition test between bovine PD-L1 expressing cells and soluble bovine PD-1 (FIG. 23)

A bovine PD-1/PD-L1 binding inhibition test with an appeal PD-L1 antibody was conducted using bovine PD-L1 expressing cells (above) and bovine PD-1-Ig (above). First, 2 × 10 ⁵ bovine PD-L1 expressing cells were injected with each concentration (0, 0.32, 0.63, 1.25, 2.5, 5, 10 μg/ml) of rat antigen PD-L1 antibody 4G12 or rat-bovine chimeric antigen PD-L1 antibody. It was reacted with the L1 antibody ch4G12 at room temperature for 30 minutes. As a negative control antibody, a rat IgG2a (κ) isotype control (BD Biosciences) or a bovine IgG1 antibody (Bethyl) was used. After washing, bovine PD-1-Ig labeled with biotin using Lightning-Link Type A Biotin Labeling Kit (Innova Biosciences) was added at a final concentration of 2 µg/ml, and reacted at room temperature for another 30 minutes. After washing, bovine PD-1-Ig bound to the cell surface was detected by APC-labeled streptavidin (BioLegend). FACS Verse (BD Biosciences) was used for analysis. In addition, PBS to which 1% bovine serum albumin (Sigma-Aldrich) was added was used for all washing operations and antibody dilution. The ratio of bovine PD-1-Ig binding cells when no antibody was added was taken as 100%, and the ratio of bovine PD-1-Ig binding cells at each antibody concentration was expressed as a relative value.

The experimental results are shown in FIG. 23 . It was shown that the rat-bovine chimeric PD-L1 antibody ch4G12 can inhibit the bovine PD-1/PD-L1 binding in a concentration-dependent manner, similarly to the rat antigen PD-L1 antibody 4G12.

(2) Binding inhibition test between bovine PD-1 expressing cells and soluble bovine PD-L1 (FIG. 24)

Bovine PD-1/PD-L1 binding inhibition test by an appeal PD-L1 antibody was conducted using bovine PD-1 expressing cells (above) and bovine PD-L1-Ig (above). First, rat antigen PD-L1 antibody 4G12 or rat-bovine chimeric PD-L1 antibody ch4G12 at final concentrations (0, 0.32, 0.63, 1.25, 2.5, 5, 10 μg/ml) was plated in a 96-well plate, and final concentration 1 [mu]g/ml of bovine PD-L1-Ig was added and reacted at room temperature for 30 minutes. This mixture was reacted with 2 × 10 ⁵ bovine PD-1 expressing cells at room temperature for 30 minutes. As a negative control antibody, a rat IgG2a (κ) isotype control (BD Biosciences) or a bovine IgG1 antibody (Bethyl) was used. After washing, Alexa Fluor 647-labeled anti-rabbit IgG (H+L) goat F(ab')2 (Life Technologies) was reacted at room temperature for 30 minutes, and bovine PD-L1-Ig bound to the cell surface was detected. FACS Verse (BD Biosciences) was used for analysis. In addition, PBS to which 1% bovine serum albumin (Sigma-Aldrich) was added was used for all washing operations and antibody dilution. The ratio of bovine PD-L1-Ig binding cells when no antibody was added was taken as 100%, and the ratio of bovine PD-L1-Ig binding cells at each antibody concentration was expressed as a relative value.

The experimental results are shown in FIG. 24 . It was shown that the rat-bovine chimeric PD-L1 antibody ch4G12 can inhibit the bovine PD-1/PD-L1 binding in a concentration-dependent manner, similarly to the rat antigen PD-L1 antibody 4G12.

Bioactivity test using rat-bovine chimeric anti-PD-L1 antibody

(1) Effect on cell proliferation (FIG. 25)

In order to confirm that inhibition of the bovine PD-1/PD-L1 binding by the rat-bovine chimeric anti-PD-L1 antibody activates lymphocytes, a biological activity test was conducted using cell proliferation as an indicator. Bovine PBMCs isolated from normal bovine peripheral blood were suspended in PBS at a concentration of 10 × 10 ⁶ cells/ml, and reacted at room temperature for 20 minutes using Carboxyfluorescein succinimidyl ester (CFSE). RPMI containing 10% non-assimilated fetal bovine serum (Cell Culture Technologies), antibiotics (Streptomycin 200 μg/ml, penicillin 200 U/ml) (Life Technologies), 0.01% L-glutamine (Life Technologies) After washing twice with 1640 medium (Sigma-Aldrich), it was reacted with an anti-CD3 mouse antibody (WSU Monoclonal Antibody Center) at 4°C for 30 minutes. After washing, it was reacted with anti-mouse IgG1 microbeads (Miltenyi Biotec) at 4°C for 15 minutes, and CD3 positive T cells were isolated using autoMACS (registered trademark) Pro (Miltenyi Biotec). To the isolated CD3-positive T cells, an anti-CD3 mouse antibody (WSU Monoclonal Antibody Center) and an anti-CD28 mouse antibody (Bio-Rad) were added, and 10 μg/ml of the rat-bovine chimeric anti-PD-L1 antibody ch4G12 was present. It was co-cultured with bovine PD-L1-expressing cells under the presence or absence (CD3-positive T cells: bovine PD-L1-expressing cells = 10:1). Serum-derived bovine IgG (Sigma-Aldrich) was used for antibody control, and EGFP-expressing cells into which pEGFP-N2 was introduced were used for control of PD-L1-expressing cells. After 6 days, the cells were collected and reacted with an anti-CD4 mouse antibody and an anti-CD8 mouse antibody (Bio-Rad) at room temperature for 30 minutes. For antibody labeling, Zenon Mouse IgG1 Labeling Kits (Life Technologies) or Lightning-Link Kit (Innova Biosciences) were used. FACS Verse (BD Biosciences) was used for analysis. PBS to which 1% bovine serum albumin (Sigma-Aldrich) was added was used for the washing operation and antibody dilution after culturing.

The experimental results are shown in FIG. 25 . Proliferation of CD4-positive and CD8-positive T cells was significantly suppressed by co-culture with bovine PD-L1 expressing cells. It was shown that the rat-bovine chimeric antigen PD-L1 antibody ch4G12 inhibits this suppression in CD4-positive T cells.

(2) Effect on IFN-γ production (FIG. 26)

In order to confirm that inhibition of bovine PD-1/PD-L1 binding by the rat-bovine chimeric anti-PD-L1 antibody activates lymphocytes, a biological activity test was performed using the amount of IFN-γ production as an index. Bovine PBMCs isolated from peripheral blood of BLV-infected cows were added with 10% non-assimilated fetal bovine serum (Cell Culture Technologies), antibiotics (streptomycin 200 μg/ml, penicillin 200 U/ml) to a concentration of 4×10 ⁶ cells/ml. (Life Technologies) and RPMI 1640 medium (Sigma-Aldrich) containing 0.01% L-glutamine (Life Technologies). 10 μg/ml of rat antigen PD-L1 antibody 4G12 or rat-bovine chimeric PD-L1 antibody ch4G12, 2% BLV-infected fetal renal cell (FLK-BLV) culture supernatant was added to PBMC, and 37°C, 5% It was cultured for 6 days under CO ₂ conditions. As the control antibody, serum-derived rat IgG (Sigma-Aldrich) and serum-derived bovine IgG (Sigma-Aldrich) were used. After 6 days, the culture supernatant was collected, and the amount of IFN-γ production was quantified using the Bovine IFN-γ ELISA Kit (BETYL). Auto Plate Washer BIO WASHER 50 (DS Pharma Biomedical) was used for each washing operation of ELISA, and Microplate Reader MTP-650FA (Corona Electric Co., Ltd.) was used for absorbance measurement.

The experimental results are shown in FIG. 26 . It was shown that the rat-bovine chimeric PD-L1 antibody ch4G12, like the rat antigen PD-L1 antibody 4G12, increased the IFN-γ response of bovine PBMCs to the BLV antigen (n = 10).

CDR Interpretation of Rat Antigen PD-L1 Antibodies

NCBI IGBLAST (http://www.ncbi.nlm.nih.gov/igblast/) was used to determine the complementarity determining regions (CDRs) of the rat antigen PD-L1 antibody 4G12. The results are shown in FIG. 19 .

Inoculation test on cattle

About 260 mg (1 mg/kg) of the established rat-bovine chimera PD-L1 antibody ch4G12 was intravenously administered to BLV experimentally infected cows (Holstein, male, 7 months old, body weight 267 kg). Blood was collected over time from the infected cow, and PBMC were isolated by a density gradient centrifugation method.

(1) Cell proliferation response of T cells to BLV antigen (FIG. 27)

Bovine PBMC were suspended in PBS and reacted with CFSE at room temperature for 20 minutes. RPMI containing 10% non-assimilated fetal bovine serum (Cell Culture Technologies), antibiotics (Streptomycin 200 μg/ml, penicillin 200 U/ml) (Life Technologies), 0.01% L-glutamine (Life Technologies) After washing twice with 1640 medium (Sigma-Aldrich), it was adjusted to 4 × 10 ⁶ cells/ml with the same medium. A 2% BLV-infected fetal renal cell (FLK-BLV) culture supernatant was added to the PBMCs, and cultured for 6 days at 37°C under 5% CO2 conditions. As a control, a 2% BLV-uninfected fetal renal cell (FLK) culture supernatant was used. After 6 days, PBMC were collected and reacted with an antigenic CD4 mouse antibody, an antigenic CD8 mouse antibody, and an antigenic IgM mouse antibody (Bio-Rad) at 4°C for 20 minutes. For antibody labeling, Zenon Mouse IgG1 Labeling Kits (Life Technologies) or Lightning-Link Kit (Innova Biosciences) were used. FACS Verse (BD Biosciences) was used for analysis. In addition, PBS to which 1% bovine serum albumin (Sigma-Aldrich) was added was used for all washing operations and antibody dilution.

The experimental results are shown in FIG. 27 . Antibody administration increased the BLV-specific cell proliferation response of CD4-positive T cells compared to before administration.

(2) Changes in the amount of BLV provirus (FIG. 28)

DNA was extracted from the isolated bovine PBMC using Wizard DNA Purification kit (Promega). The concentration of the extracted DNA was quantified based on absorbance (260 nm) measured using a Nanodrop 8000 Spectrophotometer (Thermo Fisher Scientific). To measure the amount of BLV provirus in PBMC, real-time PCR was performed using Cycleave PCR Reaction Mix SP (Takara) and Probe/Primer/Positive control for detecting bovine leukemia virus (Takara). LightCycler480 System II (Roche Diagnosis Co.) was used for the measurement.

The experimental results are shown in FIG. 28 . The amount of BLV provirus decreased significantly compared to before administration until the end of the test period.

All publications, patents, and patent applications cited in this specification are hereby incorporated herein by reference.

The anti-PD-L1 antibody of the present invention can be used for preventing and/or treating cancer or infectious disease in animals.

sequence table free text

<SEQ ID NO: 1>

SEQ ID NO: 1 shows the amino acid sequence of the L chain variable region of the rat antigen PD-L1 antibody.

<SEQ ID NO: 2>

SEQ ID NO: 2 shows the amino acid sequence of the H chain variable region of the rat antigen PD-L1 antibody.

<SEQ ID NO: 3>

SEQ ID NO: 3 shows the amino acid sequence of the L chain constant region of the canine antibody.

<SEQ ID NO: 4>

SEQ ID NO: 4 shows the amino acid sequence of the H chain constant region of the canine antibody.

<SEQ ID NO: 5>

SEQ ID NO: 5 shows the nucleotide sequence of the L chain variable region of the rat antigen PD-L1 antibody.

The nucleotide sequence after codon optimization of the nucleotide sequence of SEQ ID NO: 5 is shown in <SEQ ID NO: 15>.

<SEQ ID NO: 6>

SEQ ID NO: 6 shows the nucleotide sequence of the H chain variable region of the rat antigen PD-L1 antibody.

The nucleotide sequence after codon optimization of the nucleotide sequence of SEQ ID NO: 6 is shown in <SEQ ID NO: 16>.

<SEQ ID NO: 7>

SEQ ID NO: 7 shows the nucleotide sequence of the L chain constant region of the canine antibody.

The nucleotide sequence after codon optimization of the nucleotide sequence of SEQ ID NO: 7 is shown in <SEQ ID NO: 17>.

<SEQ ID NO: 8>

SEQ ID NO: 8 shows the nucleotide sequence of the H chain constant region of the canine antibody.

The nucleotide sequence after codon optimization of the nucleotide sequence of SEQ ID NO: 8 is shown in <SEQ ID NO: 18>.

<SEQ ID NO: 9>

SEQ ID NO: 9 shows the amino acid sequence of the chimeric L chain composed of the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the canine antibody.

<SEQ ID NO: 10>

SEQ ID NO: 10 shows the amino acid sequence of the chimeric H chain composed of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the canine antibody.

<SEQ ID NO: 19>

The nucleotide sequence (nucleotide sequence after codon optimization) of the chimeric L chain consisting of the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the dog antibody is shown.

<SEQ ID NO: 20>

SEQ ID NO: 20 shows the nucleotide sequence (nucleotide sequence after codon optimization) of the chimeric H chain composed of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the canine antibody.

<SEQ ID NO: 11>

SEQ ID NO: 11 shows the amino acid sequence of the L chain constant region of a human antibody.

<SEQ ID NO: 12>

SEQ ID NO: 12 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the human antibody (IgG4 variant 1).

<SEQ ID NO: 13>

SEQ ID NO: 13 shows the nucleotide sequence of the L chain constant region of a human antibody.

<SEQ ID NO: 14>

SEQ ID NO: 14 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the human antibody (IgG4 variant 1).

<SEQ ID NOs: 21 to 36>

SEQ ID NOs: 21 to 36, in order, primers cPD-1 inner F, cPD-1 inner R, cPD-L1 inner F, cPD-L1 inner R, cPD-1 5'GSP, cPD-1 3'GSP, cPD -L1 5′GSP, cPD-L1 3′GSP, cPD-1-EGFP F, cPD-1-EGFP R, cPD-L1-EGFP F, cPD-L1-EGFP R, cPD-1-Ig, cPD-1 - Nucleotide sequences of Ig R, cPD-L1-Ig F and cPD-L1-Ig R are shown.

<SEQ ID NO: 37>

SEQ ID NO: 37 shows the amino acid sequence (QSLLYSENQKDY) of CDR1 of the L chain variable region of the rat antigen PD-L1 antibody 4G12.

<SEQ ID NO: 38>

SEQ ID NO: 38 shows the amino acid sequence (GQYLVYPFT) of CDR3 of the L chain variable region of the rat antigen PD-L1 antibody 4G12.

<SEQ ID NO: 39>

SEQ ID NO: 39 shows the amino acid sequence (GYTFTSNF) of CDR1 of the H chain variable region of the rat antigen PD-L1 antibody 4G12.

<SEQ ID NO: 40>

SEQ ID NO: 40 shows the amino acid sequence (IYPEYGNT) of CDR2 of the H chain variable region of the rat antigen PD-L1 antibody 4G12.

<SEQ ID NO: 41>

SEQ ID NO: 41 shows the amino acid sequence of CDR3 of the H chain variable region of the rat antigen PD-L1 antibody 4G12 (ASEEAVISLVY).

<SEQ ID NO: 42>

SEQ ID NO: 42 shows the amino acid sequence of the H chain constant regions (CH1 to CH3) of both antibodies (IgG1).

<SEQ ID NO: 43>

SEQ ID NO: 43 shows the nucleotide sequences of the H chain constant regions (CH1 to CH3) of both antibodies (IgG1).

<SEQ ID NO: 44>

SEQ ID NO: 44 shows the amino acid sequence of the H chain constant regions (CH1 to CH3) of both antibodies (IgG2).

<SEQ ID NO: 45>

SEQ ID NO: 45 shows the nucleotide sequences of the H chain constant regions (CH1 to CH3) of both antibodies (IgG2).

<SEQ ID NO: 46>

SEQ ID NO: 46 shows the amino acid sequence of the L chain (Ig kappa (CK)) constant region of both antibodies.

<SEQ ID NO: 47>

SEQ ID NO: 47 shows the nucleotide sequence of the L chain (Ig kappa (CK)) constant region of both antibodies.

<SEQ ID NO: 48>

SEQ ID NO: 48 shows the amino acid sequence of the L chain (Ig lambda (CL)) constant region of both antibodies.

<SEQ ID NO: 49>

SEQ ID NO: 49 shows the nucleotide sequence of the L chain (Ig lambda (CL)) constant region of both antibodies.

<SEQ ID NO: 50>

SEQ ID NO: 50 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG1a ).

<SEQ ID NO: 51>

SEQ ID NO: 51 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG1a ).

<SEQ ID NO: 52>

SEQ ID NO: 52 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG1 ^b ).

<SEQ ID NO: 53>

SEQ ID NO: 53 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG1 ^b ).

<SEQ ID NO: 54>

SEQ ID NO: 54 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG2a ).

<SEQ ID NO: 55>

SEQ ID NO: 55 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG2a ).

<SEQ ID NO: 56>

SEQ ID NO: 56 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG2 ^b ).

<SEQ ID NO: 57>

SEQ ID NO: 57 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG2 ^b ).

<SEQ ID NO: 58>

SEQ ID NO: 58 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG3).

<SEQ ID NO: 59>

SEQ ID NO: 59 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG3).

<SEQ ID NO: 60>

SEQ ID NO: 60 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG4a ).

<SEQ ID NO: 61>

SEQ ID NO: 61 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG4a ).

<SEQ ID NO: 62>

SEQ ID NO: 62 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG4 ^b ).

<SEQ ID NO: 63>

SEQ ID NO: 63 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG4 ^b ).

<SEQ ID NO: 64>

SEQ ID NO: 64 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG5a ).

<SEQ ID NO: 65>

SEQ ID NO: 65 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG5 ^a ).

<SEQ ID NO: 66>

SEQ ID NO: 66 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG5 ^b ).

<SEQ ID NO: 67>

SEQ ID NO: 67 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG5 ^b ).

<SEQ ID NO: 68>

SEQ ID NO: 68 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG6a ).

<SEQ ID NO: 69>

SEQ ID NO: 69 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody ( ^IgG6a ).

<SEQ ID NO: 70>

SEQ ID NO: 70 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG6 ^b ).

<SEQ ID NO: 71>

SEQ ID NO: 71 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the porcine antibody (IgG6 ^b ).

<SEQ ID NO: 72>

SEQ ID NO: 72 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the water buffalo antibody (presumed to be IgG1).

<SEQ ID NO: 73>

SEQ ID NO: 73 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the water buffalo antibody (presumed to be IgG1).

<SEQ ID NO: 74>

SEQ ID NO: 74 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the water buffalo antibody (presumed to be IgG2).

<SEQ ID NO: 75>

SEQ ID NO: 75 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the water buffalo antibody (presumed to be IgG2).

<SEQ ID NO: 76>

SEQ ID NO: 76 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the water buffalo antibody (presumed to be IgG3).

<SEQ ID NO: 77>

SEQ ID NO: 77 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the water buffalo antibody (presumed to be IgG3).

<SEQ ID NO: 78>

SEQ ID NO: 78 shows the amino acid sequence of the constant region (CL) of the L chain (presumed to be Ig lambda) of the water buffalo antibody.

<SEQ ID NO: 79>

SEQ ID NO: 79 shows the nucleotide sequence of the constant region (CL) of the L chain (presumed to be Ig lambda) of the water buffalo antibody.

<SEQ ID NO: 80>

SEQ ID NO: 80 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the human antibody (IgG4 variant 2).

<SEQ ID NO: 81>

SEQ ID NO: 81 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the human antibody (IgG4 variant 2).

<SEQ ID NO: 82>

SEQ ID NO: 82 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the human antibody (IgG4 variant 3).

<SEQ ID NO: 83>

SEQ ID NO: 83 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the human antibody (IgG4 variant 3).

<SEQ ID NO: 84>

SEQ ID NO: 84 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG1 variant 1).

<SEQ ID NO: 85>

SEQ ID NO: 85 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG1 variant 2).

<SEQ ID NO: 86>

SEQ ID NO: 86 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG1 variant 3).

<SEQ ID NO: 87>

SEQ ID NO: 87 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG2 variant 1).

<SEQ ID NO: 88>

SEQ ID NO: 88 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG2 variant 2).

<SEQ ID NO: 89>

SEQ ID NO: 89 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG2 variant 3).

<SEQ ID NO: 90>

SEQ ID NO: 90 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG3 variant 1).

<SEQ ID NO: 91>

SEQ ID NO: 91 shows the amino acid sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG3 variant 2).

<SEQ ID NO: 92>

SEQ ID NO: 92 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG1 variant 1).

<SEQ ID NO: 93>

SEQ ID NO: 93 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG1 variant 2).

<SEQ ID NO: 94>

SEQ ID NO: 94 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG1 variant 3).

<SEQ ID NO: 95>

SEQ ID NO: 95 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG2 variant 1).

<SEQ ID NO: 96>

SEQ ID NO: 96 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG2 variant 2).

<SEQ ID NO: 97>

SEQ ID NO: 97 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG2 variant 3).

<SEQ ID NO: 98>

SEQ ID NO: 98 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG3 variant 1).

<SEQ ID NO: 99>

SEQ ID NO: 99 shows the nucleotide sequence of the H chain constant region (CH1 to CH3) of the bovine antibody (IgG3 variant 2).

<SEQ ID NO: 100>

SEQ ID NO: 100 shows the amino acid sequence of the L chain constant region of a bovine antibody (bovine Ig lambda, GenBank: X62917).

<SEQ ID NO: 101>

SEQ ID NO: 101 shows the nucleotide sequence of the L chain constant region of a bovine antibody (bovine Ig lambda, GenBank: X62917).

The nucleotide sequence after codon optimization of the nucleotide sequence of SEQ ID NO: 101 is shown in <SEQ ID NO: 104>.

<SEQ ID NO: 102>

SEQ ID NO: 102 shows the amino acid sequence of the H chain constant region of bovine antibody (bovine IgG1, GenBank: X62916 modified). The transition points are underlined. Amino acid number and mutation: 113E→P, 114L→V, 115P→A, 116G→deletion, 209A→S, 210P→S

<SEQ ID NO: 103>

SEQ ID NO: 103 shows the nucleotide sequence (after codon optimization) of the H chain constant region (bovine IgG1, GenBank: X62916 modified) of the bovine antibody.

<SEQ ID NO: 105>

SEQ ID NO: 105 shows the amino acid sequence of the chimeric L chain composed of the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the bovine antibody.

<SEQ ID NO: 106>

SEQ ID NO: 106 shows the amino acid sequence of the chimeric H chain composed of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the bovine antibody (bovine IgG1, GenBank: X62916 modified).

<SEQ ID NO: 107>

The nucleotide sequence of the chimeric L chain consisting of the L chain variable region of the rat antigen PD-L1 antibody and the L chain constant region of the bovine antibody (nucleotide sequence after codon optimization) is shown.

<SEQ ID NO: 108>

The nucleotide sequence (nucleotide sequence after codon optimization) of the chimeric H chain consisting of the H chain variable region of the rat antigen PD-L1 antibody and the H chain constant region of the bovine antibody (bovine IgG1, GenBank: X62916 modified) is shown.

<SEQ ID NOs: 109 to 132>

SEQ ID NOs: 109 to 132 are, in order, primers ovPD-L1 CDS F, ovPD-L1 CDS R, poPD-L1 CDS F, poPD-L1 CDS R, buPD-L1 CDS F1, buPD-L1 CDS R1, buPD-L1 CDS F2, buPD-L1 CDS R2, ovPD-1-EGFP F, ovPD-1-EGFP R, ovPD-L1-EGFP F, ovPD-L1-EGFP R, poPD-1-EGFP F, poPD-1-EGFP R , poPD-L1-EGFP F, poPD-L1-EGFP R, ovPD-L1-Ig F, ovPD-L1-Ig R, poPD-L1-Ig F, poPD-L1-Ig R, cCD80-Ig F, cCD80- Nucleotide sequences of Ig R, cPD-L1-His F and cPD-L1-His R are shown.

<SEQ ID NOs: 133 to 138>

SEQ ID NOs: 133 to 138 are, in order, primers boPD-1-myc F, boPD-1-myc R, boPD-L1-EGFP F, boPD-L1-EGFP R, boPD-L1-Ig F, boPD-L1- The nucleotide sequence of Ig R is shown.

SEQUENCE LISTING <110> NATIONAL UNIVERSITY CORPORATION HOKKAIDO UNIVERSITY <120> Anti-PD-L1 antibodies <130> FP-221PCT <150> JP P2016-159088 <151> 2016-08-15 <150> JP P2016-159089 <151> 2016-08-15 <150> JP P2017-110723 <151> 2017-06-05 <150> JP P2017-61454 <151> 2017-03-27 <160> 138 <170> PatentIn version 3.5 <210> 1 <211> 133 <212> PRT <213> rattus norvegicus <400> 1 Met Glu Ser Gln Thr His Val Leu Ile Ser Leu Leu Leu Ser Val Ser 1 5 10 15 Gly Thr Tyr Gly Asp Ile Ala Ile Thr Gln Ser Pro Ser Ser Val Ala 20 25 30 Val Ser Val Gly Glu Thr Val Thr Leu Ser Cys Lys Ser Ser Gln Ser 35 40 45 Leu Leu Tyr Ser Glu Asn Gln Lys Asp Tyr Leu Gly Trp Tyr Gln Gln 50 55 60 Lys Pro Gly Gln Thr Pro Lys Pro Leu Ile Tyr Trp Ala Thr Asn Arg 65 70 75 80 His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp 85 90 95 Phe Thr Leu Ile Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Asp Tyr 100 105 110 Tyr Cys Gly Gln Tyr Leu Val Tyr Pro Phe Thr Phe Gly Pro Gly Thr 115 120 125 Lys Leu Glu Leu Lys 130 <210> 2 <211> 137 <212> PRT <213> rattus norvegicus <400> 2 Met Gly Trp Ser Gln Ile Ile Leu Phe Leu Val Ala Ala Ala Thr Cys 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys 20 25 30 Pro Gly Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Asn Phe Met His Trp Val Lys Gln Gln Pro Gly Asn Gly Leu 50 55 60 Glu Trp Ile Gly Trp Ile Tyr Pro Glu Tyr Gly Asn Thr Lys Tyr Asn 65 70 75 80 Gln Lys Phe Asp Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Phe Cys Ala Ser Glu Glu Ala Val Ile Ser Leu Val Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser 130 135 <210> 3 <211> 105 <212> PRT 213 <Canis lupus> <400> 3 Gln Pro Lys Ala Ser Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu 1 5 10 15 Glu Leu Gly Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe 20 25 30 Tyr Pro Ser Gly Val Thr Val Ala Trp Lys Ala Ser Gly Ser Pro Val 35 40 45 Thr Gln Gly Val Glu Thr Thr Lys Pro Ser Lys Gln Ser Asn Asn Lys 50 55 60 Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Asp Lys Trp Lys Ser 65 70 75 80 His Ser Ser Phe Ser Cys Leu Val Thr His Glu Gly Ser Thr Val Glu 85 90 95 Lys Lys Val Ala Pro Ala Glu Cys Ser 100 105 <210> 4 <211> 331 <212> PRT 213 <Canis lupus> <400> 4 Ala Ser Thr Thr Ala Pro Ser Val Phe Pro Leu Ala Pro Ser Cys Gly 1 5 10 15 Ser Thr Ser Gly Ser Thr Val Ala Leu Ala Cys Leu Val Ser Gly Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ser Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Thr Val Thr Val Pro Ser Ser Arg Trp Pro Ser Glu Thr 65 70 75 80 Phe Thr Cys Asn Val Val His Pro Ala Ser Asn Thr Lys Val Asp Lys 85 90 95 Pro Val Pro Lys Glu Ser Thr Cys Lys Cys Ile Ser Pro Cys Pro Val 100 105 110 Pro Glu Ser Leu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro 115 120 125 Lys Asp Ile Leu Arg Ile Thr Arg Thr Pro Glu Ile Thr Cys Val Val 130 135 140 Leu Asp Leu Gly Arg Glu Asp Pro Glu Val Gln Ile Ser Trp Phe Val 145 150 155 160 Asp Gly Lys Glu Val His Thr Ala Lys Thr Gln Pro Arg Glu Gln Gln 165 170 175 Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Glu His Gln 180 185 190 Asp Trp Leu Thr Gly Lys Glu Phe Lys Cys Arg Val Asn His Ile Gly 195 200 205 Leu Pro Ser Pro Ile Glu Arg Thr Ile Ser Lys Ala Arg Gly Gln Ala 210 215 220 His Gln Pro Ser Val Tyr Val Leu Pro Pro Ser Pro Lys Glu Leu Ser 225 230 235 240 Ser Ser Asp Thr Val Thr Leu Thr Cys Leu Ile Lys Asp Phe Phe Pro 245 250 255 Pro Glu Ile Asp Val Glu Trp Gln Ser Asn Gly Gln Pro Glu Pro Glu 260 265 270 Ser Lys Tyr His Thr Thr Ala Pro Gln Leu Asp Glu Asp Gly Ser Tyr 275 280 285 Phe Leu Tyr Ser Lys Leu Ser Val Asp Lys Ser Arg Trp Gln Gln Gly 290 295 300 Asp Thr Phe Thr Cys Ala Val Met His Glu Ala Leu Gln Asn His Tyr 305 310 315 320 Thr Asp Leu Ser Leu Ser His Ser Pro Gly Lys 325 330 <210> 5 <211> 399 <212> DNA <213> rattus norvegicus <400> 5 atggaatcac agacgcatgt cctcatttcc cttctgctct cggtatctgg tacctatggg 60 gacattgcga taacccagtc tccatcctct gtggctgtgt cagtaggaga gacggtcact 120 ctgagctgca agtccagtca gagtctttta tacagtgaaa accaaaagga ctatttgggc 180 tggtaccagc agaaaccagg gcagactcct aaacccctta tctactgggc aaccaaccgg 240 cacactgggg tccctgatcg cttcacaggt agtggatccg ggacagactt cactctgatc 300 atcagcagtg tgcaggctga agacctggct gattattact gtgggcagta ccttgtctat 360 ccgttcacgt ttggacctgg gaccaagctg gaactgaaa 399 <210> 6 <211> 411 <212> DNA <213> rattus norvegicus <400> 6 atgggatgga gccagatcat cctctttctg gtggcagcag ctacatgtgt tcactcccag 60 gtacagctgc agcaatctgg ggctgaatta gtgaagcctg ggtcctcagt gaaaatttcc 120 tgcaaggctt ctggctacac cttcaccagt aactttatgc actgggtaaa gcagcagcct 180 ggaaatggcc ttgagtggat tgggtggatt tatcctgaat atggtaatac taagtacaat 240 caaaagttcg atgggaaggc aacactcact gcagacaaat cctccagcac agcctatatg 300 cagctcagca gcctgacatc tgaggactct gcagtctatt tctgtgcaag tgaggaggca 360 gttatatccc ttgtttactg gggccaaggc actctggtca ctgtctcttc a 411 <210> 7 <211> 318 <212> DNA 213 <Canis lupus> <400> 7 cagcccaagg cctccccctc ggtcacactc ttcccgccct cctctgagga gctcggcgcc 60 aacaaggcca ccctggtgtg cctcatcagc gacttctacc ccagcggcgt gacggtggcc 120 tggaaggcaa gcggcagccc cgtcacccag ggcgtggaga ccaccaagcc ctccaagcag 180 agcaacaaca agtacgcggc cagcagctac ctgagcctga cgcctgacaa gtggaaatct 240 cacagcagct tcagctgcct ggtcacgcac gaggggagca ccgtggagaa gaaggtggcc 300 cccgcagagt gctcttag 318 <210> 8 <211> 996 <212> DNA 213 <Canis lupus> <400> 8 gcctccacca cggccccctc ggttttccca ctggccccca gctgcgggtc cacttccggc 60 tccacggtgg ccctggcctg cctggtgtca ggctacttcc ccgagcctgt aactgtgtcc 120 tggaattccg gctccttgac cagcggtgtg cacaccttcc cgtccgtcct gcagtcctca 180 gggctctact ccctcagcag cacggtgaca gtgccctcca gcaggtggcc cagcgagacc 240 ttcacctgca acgtggtcca cccggccagc aacactaaag tagacaagcc agtgcccaaa 300 gagtccacct gcaagtgtat atccccatgc ccagtccctg aatcactggg agggccttcg 360 gtcttcatct ttcccccgaa acccaaggac atcctcagga ttccccgaac acccgagatc 420 acctgtgtgg tgttagatct gggccgtgag gaccctgagg tgcagatcag ctggttcgtg 480 gatggtaagg aggtgcacac agccaagacg cagcctcgtg agcagcagtt caacagcacc 540 taccgtgtgg tcagcgtcct ccccattgag caccaggact ggctcaccgg aaaggagttc 600 aagtgcagag tcaaccacat aggcctcccg tcccccatcg agaggactat ctccaaagcc 660 agagggcaag cccatcagcc cagtgtgtat gtcctgccac catccccaaa ggaggttgtca 720 tccagtgaca cggtcaccct gacctgcctg atcaaagact tcttcccacc tgagattgat 780 gtggagtggc agagcaatgg acagccggag cccgagagca agtaccacac gactgcgccc 840 cagctggacg aggacgggtc ctacttcctg tacagcaagc tctctgtgga caagagccgc 900 tggcagcagg gagacacctt cacatgtgcg gtgatgcatg aagctctaca gaaccactac 960 acagatctat ccctctccca ttctccgggt aaatga 996 <210> 9 <211> 238 <212> PRT <213> artificial sequence <220> <223> chimeric L chain <400> 9 Met Glu Ser Gln Thr His Val Leu Ile Ser Leu Leu Leu Ser Val Ser 1 5 10 15 Gly Thr Tyr Gly Asp Ile Ala Ile Thr Gln Ser Pro Ser Ser Val Ala 20 25 30 Val Ser Val Gly Glu Thr Val Thr Leu Ser Cys Lys Ser Ser Gln Ser 35 40 45 Leu Leu Tyr Ser Glu Asn Gln Lys Asp Tyr Leu Gly Trp Tyr Gln Gln 50 55 60 Lys Pro Gly Gln Thr Pro Lys Pro Leu Ile Tyr Trp Ala Thr Asn Arg 65 70 75 80 His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp 85 90 95 Phe Thr Leu Ile Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Asp Tyr 100 105 110 Tyr Cys Gly Gln Tyr Leu Val Tyr Pro Phe Thr Phe Gly Pro Gly Thr 115 120 125 Lys Leu Glu Leu Lys Gln Pro Lys Ala Ser Pro Ser Val Thr Leu Phe 130 135 140 Pro Pro Ser Ser Glu Glu Leu Gly Ala Asn Lys Ala Thr Leu Val Cys 145 150 155 160 Leu Ile Ser Asp Phe Tyr Pro Ser Gly Val Thr Val Ala Trp Lys Ala 165 170 175 Ser Gly Ser Pro Val Thr Gln Gly Val Glu Thr Thr Lys Pro Ser Lys 180 185 190 Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro 195 200 205 Asp Lys Trp Lys Ser His Ser Ser Phe Ser Cys Leu Val Thr His Glu 210 215 220 Gly Ser Thr Val Glu Lys Lys Val Ala Pro Ala Glu Cys Ser 225 230 235 <210> 10 <211> 468 <212> PRT <213> artificial sequence <220> <223> chimeric H chain <400> 10 Met Gly Trp Ser Gln Ile Ile Leu Phe Leu Val Ala Ala Ala Thr Cys 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys 20 25 30 Pro Gly Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Asn Phe Met His Trp Val Lys Gln Gln Pro Gly Asn Gly Leu 50 55 60 Glu Trp Ile Gly Trp Ile Tyr Pro Glu Tyr Gly Asn Thr Lys Tyr Asn 65 70 75 80 Gln Lys Phe Asp Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Phe Cys Ala Ser Glu Glu Ala Val Ile Ser Leu Val Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Thr Ala Pro Ser 130 135 140 Val Phe Pro Leu Ala Pro Ser Cys Gly Ser Thr Ser Gly Ser Thr Val 145 150 155 160 Ala Leu Ala Cys Leu Val Ser Gly Tyr Phe Pro Glu Pro Val Thr Val 165 170 175 Ser Trp Asn Ser Gly Ser Leu Thr Ser Gly Val His Thr Phe Pro Ser 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Thr Val Thr Val 195 200 205 Pro Ser Ser Arg Trp Pro Ser Glu Thr Phe Thr Cys Asn Val Val His 210 215 220 Pro Ala Ser Asn Thr Lys Val Asp Lys Pro Val Pro Lys Glu Ser Thr 225 230 235 240 Cys Lys Cys Ile Ser Pro Cys Pro Val Pro Glu Ser Leu Gly Gly Pro 245 250 255 Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Ile Leu Arg Ile Thr 260 265 270 Arg Thr Pro Glu Ile Thr Cys Val Val Leu Asp Leu Gly Arg Glu Asp 275 280 285 Pro Glu Val Gln Ile Ser Trp Phe Val Asp Gly Lys Glu Val His Thr 290 295 300 Ala Lys Thr Gln Pro Arg Glu Gln Gln Phe Asn Ser Thr Tyr Arg Val 305 310 315 320 Val Ser Val Leu Pro Ile Glu His Gln Asp Trp Leu Thr Gly Lys Glu 325 330 335 Phe Lys Cys Arg Val Asn His Ile Gly Leu Pro Ser Pro Ile Glu Arg 340 345 350 Thr Ile Ser Lys Ala Arg Gly Gln Ala His Gln Pro Ser Val Tyr Val 355 360 365 Leu Pro Pro Ser Pro Lys Glu Leu Ser Ser Ser Asp Thr Val Thr Leu 370 375 380 Thr Cys Leu Ile Lys Asp Phe Phe Pro Pro Glu Ile Asp Val Glu Trp 385 390 395 400 Gln Ser Asn Gly Gln Pro Glu Pro Glu Ser Lys Tyr His Thr Thr Ala 405 410 415 Pro Gln Leu Asp Glu Asp Gly Ser Tyr Phe Leu Tyr Ser Lys Leu Ser 420 425 430 Val Asp Lys Ser Arg Trp Gln Gln Gly Asp Thr Phe Thr Cys Ala Val 435 440 445 Met His Glu Ala Leu Gln Asn His Tyr Thr Asp Leu Ser Leu Ser His 450 455 460 Ser Pro Gly Lys 465 <210> 11 <211> 106 <212> PRT <213> Homo sapiens <400> 11 Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 1 5 10 15 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 20 25 30 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 35 40 45 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 50 55 60 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 65 70 75 80 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 85 90 95 Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 100 105 <210> 12 <211> 326 <212> PRT <213> Homo sapiens <400> 12 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser 1 5 10 15 Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe 20 25 30 Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly 35 40 45 Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu 50 55 60 Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr 65 70 75 80 Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg 85 90 95 Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu 100 105 110 Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly 145 150 155 160 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp 180 185 190 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro 195 200 205 Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu 210 215 220 Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn 225 230 235 240 Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 245 250 255 Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr 260 265 270 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg 275 280 285 Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys 290 295 300 Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 305 310 315 320 Ser Leu Ser Leu Gly Lys 325 <210> 13 <211> 321 <212> DNA <213> Homo sapiens <400> 13 actgtggctg caccatctgt cttcatcttc ccgccatctg atgagcagtt gaaatctgga 60 actgcctctg ttgtgtgcct gctgaataac ttctatccca gagaggccaa agtacagtgg 120 aaggtggata acgccctcca atcgggtaac tcccaggaga gtgtcacaga gcaggacagc 180 aaggacagca cctacagcct cagcagcacc ctgacgctga gcaaagcaga ctacgagaaa 240 cacaaagtct acgcctgcga agtcacccat cagggcctga gctcgcccgt cacaaagagc 300 ttcaacaggg gagagtgtta g 321 <210> 14 <211> 981 <212> DNA <213> Homo sapiens <400> 14 tccaccaagg gcccatccgt cttccccctg gcgccctgct ccaggagcac ctccgagagc 60 acagccgccc tgggctgcct ggtcaaggac tacttccccg aaccggtgac ggtgtcgtgg 120 aactcaggcg ccctgaccag cggcgtgcac accttcccgg ctgtcctaca gtcctcagga 180 ctctactccc tcagcagcgt ggtgaccgtg ccctccagca gcttgggcac gaagacctac 240 acctgcaacg tagatcacaa gcccagcaac accaaggtgg acaagagagt tgagtccaaa 300 tatggtcccc catgcccatc atgcccagca cctgagttcc tgggggggacc atcagtcttc 360 ctgttccccc caaaacccaa ggacactctc atgatctccc ggacccctga ggtcacgtgc 420 gtggtggtgg acgtgagcca ggaagacccc gaggtccagt tcaactggta cgtggatggc 480 gtggaggtgc ataatgccaa gacaaagccg cgggaggagc agttcaacag cacgtaccgt 540 gtggtcagcg tcctcaccgt cctgcaccag gactggctga acggcaagga gtacaagtgc 600 aaggtctcca acaaaggcct cccgtcctcc atcgagaaaa ccatctccaa agccaaaggg 660 cagccccgag agccacaggt gtacaccctg cccccatccc aggagggagat gaccaagaac 720 caggtcagcc tgacctgcct ggtcaaaggc ttctacccca gcgacatcgc cgtggagtgg 780 gagagcaatg ggcagccgga gaacaactac aagaccacgc ctcccgtgct ggactccgac 840 ggctccttct tcctctacag caggctaacc gtggacaaga gcaggtggca ggaggggaat 900 gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacacaca gaagagcctc 960 tccctgtctc tgggtaaatg a 981 <210> 15 <211> 399 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 15 atggaatctc aaactcatgt tttgatttca ttacttctga gtgtttccgg aacctacggt 60 gatatcgcta tcactcaatc tccctcctct gttgctgtgt ctgtgggcga aaccgttacc 120 ctgtcctgca agtccagtca gtctcttctc tactccgaga atcaaaagga ctacctgggc 180 tggtaccaac agaagcccgg ccagacccca aagccactga tatactgggc aaccaacagg 240 cacaccggag tgcccgacag gttcacaggc agtggatctg gcaccgactt taccttgatc 300 atttcaagcg tgcaggctga agatctggcc gactactact gtggtcagta tctggtgtat 360 cctttcactt tcgggccagg gacaaaattg gaattgaag 399 <210> 16 <211> 411 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 16 atgggttggt ctcaaattat cttgtttttg gttgctgcag ccacttgtgt tcattctcag 60 gtgcagctgc aacaaagcgg cgcagaactg gtgaaacctg gcagcagcgt gaaaatatct 120 tgtaaggcca gcggatatac tttcacctcc aatttcatgc attgggtcaa acagcagccc 180 ggcaacggac tcgagtggat cggctggatc taccccgagt atggcaacac aaaatataac 240 caaaaatttg atggaaaggc taccctgact gccgataagt cctccagcac cgcatacatg 300 caactctcct ccctgacctc cgaggatagc gctgtctact tctgtgcttc cgaagaggct 360 gtcatatcct tggtctattg ggggccaagga actctggtga ccgtctcatc t 411 <210> 17 <211> 318 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 17 cagcccaaag cctctcccag cgtcaccctc ttcccacctt ccagtgagga gctgggggca 60 aacaaagcca ctttggtgtg tctcatctcc gatttttacc cctccggggt cacagtcgca 120 tggaaggcct ccggatcccc tgtgacacag ggagtggaga caacaaaacc tagcaagcag 180 agtaacaata agtatgccgc ctcaagctat ctcagcctta ctcctgataa gtggaagtca 240 catagcagtt ttagttgcct cgtaacacat gagggttcaa ctgtggagaa aaaagtagct 300 ccagctgagt gctcatga 318 <210> 18 <211> 996 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 18 gctagcacaa ccgctccctc cgtttttccc ctcgccccat cctgcgggtc aaccagcgga 60 tccaccgtcg ctctggcttg tctggtgtca ggatacttcc ccgagcctgt caccgtttct 120 tggaatagcg gcagccttac ttccggcgtg cataccttcc ctagcgtgct tcagtcctcc 180 ggtctgtatt ccctcagctc caccgtaact gtcccaagct caaggtggcc ctctgagaca 240 tttacctgca atgtggtcca tcctgcttca aataccaaag tggacaagcc cgtcccaaaa 300 gagtctacct gcaaatgtat cagtccttgt cccgtgcccg agtctctggg cggaccctca 360 gtctttatct tcccacccaa gccaaaggac atattgcgca ttacacggac acccgaaatc 420 acctgtgttg tgttggatct cggccgggaa gatcctgagg tgcagattag ttggtttgtt 480 gatggcaagg aggtgcacac agcaaaaaca cagcccagag aacagcagtt caacagtact 540 tatagagtag tgagtgtgtt gcctatagag catcaggact ggctgacagg caaagaattc 600 aaatgtaggg ttaaccacat tggcctccct agtccaatcg agaggacaat ctctaaagcc 660 cgaggccagg ctcatcagcc ttctgtgtac gttctgcctc ctagtcctaa ggaactgtct 720 tcttcagaca cagtaacact cacttgcctg attaaggact tttttcctcc agagattgat 780 gtggaatggc agtctaacgg gcagccagag ccagaatcta agtaccacac tactgcacca 840 cagctggatg aggatgggtc ttacttcctg tacagtaagc tgagtgtgga caagtctcga 900 tggcagcagg gggatacttt tacttgcgca gtaatgcacg aagcattgca gaaccactac 960 actgacctgt cacttagtca ctcaccaggg aagtaa 996 <210> 19 <211> 717 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 19 atggaatctc aaactcatgt tttgatttca ttacttctga gtgtttccgg aacctacggt 60 gatatcgcta tcactcaatc tccctcctct gttgctgtgt ctgtgggcga aaccgttacc 120 ctgtcctgca agtccagtca gtctcttctc tactccgaga atcaaaagga ctacctgggc 180 tggtaccaac agaagcccgg ccagacccca aagccactga tatactgggc aaccaacagg 240 cacaccggag tgcccgacag gttcacaggc agtggatctg gcaccgactt taccttgatc 300 atttcaagcg tgcaggctga agatctggcc gactactact gtggtcagta tctggtgtat 360 cctttcactt tcgggccagg gacaaaattg gaattgaagc agcccaaagc ctctcccagc 420 gtcaccctct tcccaccttc cagtgaggag ctgggggcaa acaaagccac tttggtgtgt 480 ctcatctccg atttttaccc ctccggggtc acagtcgcat ggaaggcctc cggatcccct 540 gtgacacagg gagtggagac aacaaaacct agcaagcaga gtaacaataa gtatgccgcc 600 tcaagctatc tcagccttac tcctgataag tggaagtcac atagcagttt tagttgcctc 660 gtaacacatg agggttcaac tgtggagaaa aaagtagctc cagctgagtg ctcatga 717 <210> 20 <211> 1407 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 20 atgggttggt ctcaaattat cttgtttttg gttgctgcag ccacttgtgt tcattctcag 60 gtgcagctgc aacaaagcgg cgcagaactg gtgaaacctg gcagcagcgt gaaaatatct 120 tgtaaggcca gcggatatac tttcacctcc aatttcatgc attgggtcaa acagcagccc 180 ggcaacggac tcgagtggat cggctggatc taccccgagt atggcaacac aaaatataac 240 caaaaatttg atggaaaggc taccctgact gccgataagt cctccagcac cgcatacatg 300 caactctcct ccctgacctc cgaggatagc gctgtctact tctgtgcttc cgaagaggct 360 gtcatatcct tggtctattg gggccaagga actctggtga ccgtctcatc tgctagcaca 420 accgctccct ccgtttttcc cctcgcccca tcctgcgggt caaccagcgg atccaccgtc 480 gctctggctt gtctggtgtc aggatacttc cccgagcctg tcaccgtttc ttggaatagc 540 ggcagcctta cttccggcgt gcataccttc cctagcgtgc ttcagtcctc cggtctgtat 600 tccctcagct ccaccgtaac tgtcccaagc tcaaggtggc cctctgagac atttacctgc 660 aatgtggtcc atcctgcttc aaataccaaa gtggacaagc ccgtcccaaa agagtctacc 720 tgcaaatgta tcagtccttg tcccgtgccc gagtctctgg gcggaccctc agtctttatc 780 ttcccaccca agccaaagga catattgcgc attacacgga cacccgaaat cacctgtgtt 840 gtgttggatc tcggccggga agatcctgag gtgcagatta gttggtttgt tgatggcaag 900 gaggtgcaca cagcaaaaac acagcccaga gaacagcagt tcaacagtac ttatagagta 960 gtgagtgtgt tgcctataga gcatcaggac tggctgacag gcaaagaatt caaatgtagg 1020 gttaaccaca ttggcctccc tagtccaatc gagaggacaa tctctaaagc ccgaggccag 1080 gctcatcagc cttctgtgta cgttctgcct cctagtccta aggaactgtc ttcttcagac 1140 acagtaacac tcacttgcct gattaaggac ttttttcctc cagagattga tgtggaatgg 1200 cagtctaacg ggcagccaga gccagaatct aagtaccaca ctactgcacc acagctggat 1260 gaggatgggt cttacttcct gtacagtaag ctgagtgtgg acaagtctcg atggcagcag 1320 ggggatactt ttacttgcgc agtaatgcac gaagcattgc agaaccacta cactgacctg 1380 tcacttagtc actcaccagg gaagtaa 1407 <210> 21 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 21 aggatggctc ctagactccc 20 <210> 22 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 22 agacgatggt ggcatactcg 20 <210> 23 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 23 atgagaatgt ttagtgtctt 20 <210> 24 <211> 24 <212> DNA <213> artificial sequence <220> <223> primer <400> 24 ttatgtctct tcaaattgta tatc 24 <210> 25 <211> 16 <212> DNA <213> artificial sequence <220> <223> primer <400> 25 gttgatctgt gtgttg 16 <210> 26 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 26 cgggacttcc acatgagcat 20 <210> 27 <211> 17 <212> DNA <213> artificial sequence <220> <223> primer <400> 27 ttttagacag aaagtga 17 <210> 28 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 28 gaccagctct tcttgggggaa 20 <210> 29 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 29 ccgctcgaga tggggagccg gcgggggcc 29 <210> 30 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 30 cgcggatcct gaggggccac aggccgggtc 30 <210> 31 <211> 26 <212> DNA <213> artificial sequence <220> <223> primer <400> 31 gaagatctat gagaatgttt agtgtc 26 <210> 32 <211> 28 <212> DNA <213> artificial sequence <220> <223> primer <400> 32 ggaattctgt ctcttcaaat tgtatatc 28 <210> 33 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 33 cgcggctagc atggggagcc ggcgggggcc 30 <210> 34 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 34 cgcggatatc cagcccctgc aactggccgc 30 <210> 35 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 35 cgcggctagc atgagaatgt ttagtgtctt 30 <210> 36 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 36 cgcggatatc agtcctctca cttgctggaa 30 <210> 37 <211> 12 <212> PRT <213> rattus norvegicus <400> 37 Gln Ser Leu Leu Tyr Ser Glu Asn Gln Lys Asp Tyr 1 5 10 <210> 38 <211> 9 <212> PRT <213> rattus norvegicus <400> 38 Gly Gln Tyr Leu Val Tyr Pro Phe Thr 1 5 <210> 39 <211> 8 <212> PRT <213> rattus norvegicus <400> 39 Gly Tyr Thr Phe Thr Ser Asn Phe 1 5 <210> 40 <211> 8 <212> PRT <213> rattus norvegicus <400> 40 Ile Tyr Pro Glu Tyr Gly Asn Thr 1 5 <210> 41 <211> 11 <212> PRT <213> rattus norvegicus <400> 41 Ala Ser Glu Glu Ala Val Ile Ser Leu Val Tyr 1 5 10 <210> 42 <211> 331 <212> PRT <213> <400> 42 Ala Ser Thr Thr Pro Pro Lys Val Tyr Pro Leu Thr Ser Cys Cys Gly 1 5 10 15 Asp Thr Ser Ser Ser Ile Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ala Ile Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Val Val Thr Val Pro Ala Ser Thr Ser Gly Ala Gln Thr 65 70 75 80 Phe Ile Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys 85 90 95 Arg Val Glu Pro Gly Cys Pro Asp Pro Cys Lys His Cys Arg Cys Pro 100 105 110 Pro Pro Glu Leu Pro Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys 115 120 125 Pro Lys Asp Thr Leu Thr Ile Ser Gly Thr Pro Glu Val Thr Cys Val 130 135 140 Val Val Asp Val Gly Gln Asp Asp Pro Glu Val Gln Phe Ser Trp Phe 145 150 155 160 Val Asp Asn Val Glu Val Arg Thr Ala Arg Thr Lys Pro Arg Glu Glu 165 170 175 Gln Phe Asn Ser Thr Phe Arg Val Val Ser Ala Leu Pro Ile Gln His 180 185 190 Gln Asp Trp Thr Gly Gly Lys Glu Phe Lys Cys Lys Val His Asn Glu 195 200 205 Ala Leu Pro Ala Pro Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Gln 210 215 220 Ala Arg Glu Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Glu Leu 225 230 235 240 Ser Lys Ser Thr Leu Ser Val Thr Cys Leu Val Thr Gly Phe Tyr Pro 245 250 255 Asp Tyr Ile Ala Val Glu Trp Gln Lys Asn Gly Gln Pro Glu Ser Glu 260 265 270 Asp Lys Tyr Gly Thr Thr Thr Ser Gln Leu Asp Ala Asp Gly Ser Tyr 275 280 285 Phe Leu Tyr Ser Arg Leu Arg Val Asp Lys Asn Ser Trp Gln Glu Gly 290 295 300 Asp Thr Tyr Ala Cys Val Val Met His Glu Ala Leu His Asn His Tyr 305 310 315 320 Thr Gln Lys Ser Ile Ser Lys Pro Pro Gly Lys 325 330 <210> 43 <211> 996 <212> DNA <213> <400> 43 gcctcaacaa cacccccgaa agtctaccct ctgacttctt gctgcgggga cacgtccagc 60 tccatcgtga ccctgggctg cctggtctcc agctatatgc ccgagccggt gaccgtgacc 120 tggaactctg gtgccctgac cagcggcgtg cacaccttcc cggccatcct gcagtcctcc 180 gggctctact ctctcagcag cgtggtgacc gtgccggcca gcacctcagg agccccagacc 240 ttcatctgca acgtagccca cccggccagc agcaccaagg tggacaagcg tgttgagccc 300 ggatgcccgg acccatgcaa acattgccga tgcccacccc ctgagctccc cggaggaccg 360 tctgtcttca tcttcccacc gaaacccaag gacaccctta caatctctgg aacgcccgag 420 gtcacgtgtg tggtggtgga cgtgggccag gatgaccccg aggtgcagtt ctcctggttc 480 gtggacaacg tggaggtgcg cacggccagg acaaagccga gagaggagca gttcaacagc 540 accttccgcg tggtcagcgc cctgcccatc cagcaccaag actggactgg aggaaaggag 600 ttcaagtgca aggtccacaa cgaagccctc ccggccccca tcgtgaggac catctccagg 660 accaaagggc aggcccggga gccgcaggtg tacgtcctgg ccccacccca ggaagagctc 720 agcaaaagca cgctcagcgt cacctgcctg gtcaccggct tctacccaga ctacatcgcc 780 gtggagtggc agaaaaatgg gcagcctgag tcggaggaca agtacggcac gaccacatcc 840 cagctggacg ccgacggctc ctacttcctg tacagcaggc tcagggtgga caagaacagc 900 tggcaagaag gagacaccta cgcgtgtgtg gtgatgcacg aggctctgca caaccactac 960 acacagaagt cgatctctaa gcctccgggt aaatga 996 <210> 44 <211> 329 <212> PRT <213> <400> 44 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Thr Ser Cys Cys Gly 1 5 10 15 Asp Thr Ser Ser Ser Ser Ser Ile Val Thr Leu Gly Cys Leu Val Ser 20 25 30 Ser Tyr Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu 35 40 45 Thr Ser Gly Val His Thr Phe Pro Ala Ile Leu Gln Ser Ser Gly Leu 50 55 60 Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ala Ser Thr Ser Gly Ala 65 70 75 80 Gln Thr Phe Ile Cys Asn Val Ala His Pro Ala Ser Ser Ala Lys Val 85 90 95 Asp Lys Arg Val Gly Ile Ser Ser Asp Tyr Ser Lys Cys Ser Lys Pro 100 105 110 Pro Cys Val Ser Arg Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys 115 120 125 Asp Ser Leu Met Ile Thr Gly Thr Pro Glu Val Thr Cys Val Val Val 130 135 140 Asp Val Gly Gln Gly Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp 145 150 155 160 Asn Val Glu Val Arg Thr Ala Arg Thr Lys Pro Arg Glu Glu Gln Phe 165 170 175 Asn Ser Thr Phe Arg Val Val Ser Ala Leu Pro Ile Gln His Asp His 180 185 190 Trp Thr Gly Gly Lys Glu Phe Lys Cys Lys Val His Ser Lys Gly Leu 195 200 205 Pro Ala Pro Ile Val Arg Thr Ile Ser Arg Ala Lys Gly Gln Ala Arg 210 215 220 Glu Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Leu Ser Lys 225 230 235 240 Ser Thr Leu Ser Val Thr Cys Leu Val Thr Gly Phe Tyr Pro Asp Tyr 245 250 255 Ile Ala Val Glu Trp Gln Arg Ala Arg Gln Pro Glu Ser Glu Asp Lys 260 265 270 Tyr Gly Thr Thr Thr Ser Gln Leu Asp Ala Asp Gly Ser Tyr Phe Leu 275 280 285 Tyr Ser Arg Leu Arg Val Asp Lys Ser Ser Trp Gln Arg Gly Asp Thr 290 295 300 Tyr Ala Cys Val Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 305 310 315 320 Lys Ser Ile Ser Lys Pro Pro Gly Lys 325 <210> 45 <211> 990 <212> DNA <213> <400> 45 gcctccacca cagccccgaa agtctaccct ctgacttctt gctgcgggga cacgtccagc 60 tccagctcca tcgtgaccct gggctgcctg gtctccagct atatgcccga gccggtgacc 120 gtgacctgga actctggtgc cctgaccagc ggcgtgcaca ccttcccggc catcctgcag 180 tcctccgggc tctactctct cagcagcgtg gtgaccgtgc cggccagcac ctcaggagcc 240 cagaccttca tctgcaacgt agcccacccg gccagcagcg ccaaggtgga caagcgtgtt 300 gggatctcca gtgactactc caagtgttct aaaccgcctt gcgtgagccg accgtctgtc 360 ttcatcttcc ccccgaaacc caaggacagc ctcatgatca caggaacgcc cgaggtcacg 420 tgtgtggtgg tggacgtggg ccagggtgac cccgaggtgc agttctcctg gttcgtggac 480 aacgtggagg tgcgcacggc caggacaaag ccgagagagg agcagttcaa cagcaccttc 540 cgcgtggtca gcgccctgcc catccagcac gaccactgga ctggaggaaa ggagttcaag 600 tgcaaggtcc acagcaaagg cctcccggcc cccatcgtga ggaccatctc cagggccaaa 660 gggcaggccc gggagccgca ggtgtacgtc ctggccccac cccaggaaga gctcagcaaa 720 agcacgctca gcgtcacctg cctggtcacc ggcttctacc cagactacat cgccgtggag 780 tggcagagag cgcggcagcc tgagtcggag gacaagtacg gcacgaccac atcccagctg 840 gacgccgacg gctcctactt cctgtacagc aggctcaggg tggacaagag cagctggcaa 900 agaggagaca cctacgcgtg tgtggtgatg cacgaggctc tgcacaacca ctacacacag 960 aagtcgatct ctaagcctcc gggtaaatga 990 <210> 46 <211> 102 <212> PRT <213> <400> 46 Pro Ser Val Phe Leu Phe Lys Pro Ser Glu Glu Gln Leu Arg Thr Gly 1 5 10 15 Thr Val Ser Val Val Cys Leu Val Asn Asp Phe Tyr Pro Lys Asp Ile 20 25 30 Asn Val Lys Val Lys Val Asp Gly Val Thr Gln Asn Ser Asn Phe Gln 35 40 45 Asn Ser Phe Thr Asp Gln Asp Ser Lys Lys Ser Thr Tyr Ser Leu Ser 50 55 60 Ser Thr Leu Thr Leu Ser Ser Ser Glu Tyr Gln Ser His Asn Ala Tyr 65 70 75 80 Ala Cys Glu Val Ser His Lys Ser Leu Pro Thr Ala Leu Val Lys Ser 85 90 95 Phe Asn Lys Asn Glu Cys 100 <210> 47 <211> 309 <212> DNA <213> <400> 47 ccatccgtct tcctcttcaa accatctgag gaacagctga ggaccggaac tgtctctgtc 60 gtgtgcttgg tgaatgattt ctaccccaaa gatatcaatg tcaaggtgaa agtggatggg 120 gttaccaga acagcaactt ccagaacagc ttcacagacc aggacagcaa gaaaagcacc 180 tacagcctca gcagcaccct gacactgtcc agctcagagt accagagcca taacgcctat 240 gcgtgtgagg tcagccacaa gagcctgccc accgccctcg tcaagagctt caataagaat 300 gaatgttag 309 <210> 48 <211> 106 <212> PRT <213> <400> 48 Gly Gln Pro Lys Ser Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Thr 1 5 10 15 Glu Glu Leu Ser Thr Asn Lys Ala Thr Val Val Cys Leu Ile Asn Asp 20 25 30 Phe Tyr Pro Gly Ser Val Asn Val Val Trp Lys Ala Asp Gly Ser Thr 35 40 45 Ile Asn Gln Asn Val Lys Thr Thr Gln Ala Ser Lys Gln Ser Asn Ser 50 55 60 Lys Tyr Ala Ala Ser Ser Tyr Leu Thr Leu Thr Gly Ser Glu Trp Lys 65 70 75 80 Ser Lys Ser Ser Tyr Thr Cys Glu Val Thr His Glu Gly Ser Thr Val 85 90 95 Thr Lys Thr Val Lys Pro Ser Glu Cys Ser 100 105 <210> 49 <211> 321 <212> DNA <213> <400> 49 ggtcagccca agtccgcacc ctcggtcacc ctgttcccgc cttccacgga ggagctcagt 60 accaacaagg ccaccgtggt gtgtctcatc aacgacttct acccgggtag cgtgaacgtg 120 gtctggaagg cagatggcag caccatcaat cagaacgtga agaccaccca ggcctccaaa 180 cagagcaaca gcaagtacgc ggccagcagc tacctgaccc tgacgggcag cgagtggaag 240 tctaagagca gttacacctg cgaggtcacg cacgagggga gcaccgtgac gaagacagtg 300 aagccctcag agtgttctta g 321 <210> 50 <211> 328 <212> PRT <213> Sus scrofa <400> 50 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Met Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Lys 85 90 95 Arg Val Gly Thr Lys Thr Lys Pro Pro Cys Pro Ile Cys Pro Gly Cys 100 105 110 Glu Val Ala Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Met Ile Ser Gln Thr Pro Glu Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Lys Glu His Ala Glu Val Gln Phe Ser Trp Tyr Val Asp Gly 145 150 155 160 Val Glu Val His Thr Ala Glu Thr Arg Pro Lys Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln Asp Trp 180 185 190 Leu Lys Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Val Asp Leu Pro 195 200 205 Ala Pro Ile Thr Arg Thr Ile Ser Lys Ala Ile Gly Gln Ser Arg Glu 210 215 220 Pro Gln Val Tyr Thr Leu Pro Pro Pro Ala Glu Glu Leu Ser Arg Ser 225 230 235 240 Lys Val Thr Val Thr Cys Leu Val Ile Gly Phe Tyr Pro Pro Asp Ile 245 250 255 His Val Glu Trp Lys Ser Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr 260 265 270 Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly Thr Phe Phe Leu Tyr 275 280 285 Ser Lys Leu Ala Val Asp Lys Ala Arg Trp Asp His Gly Glu Thr Phe 290 295 300 Glu Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 305 310 315 320 Ser Ile Ser Lys Thr Gln Gly Lys 325 <210> 51 <211> 987 <212> DNA <213> Sus scrofa <400> 51 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcggcaggga cacgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccatgacc 120 tggaactcgg gcgccctgac cagtggcgtg cataccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggcca gcagcctgtc cagcaagagc 240 tacacctgca atgtcaacca cccggccacc accaccaagg tggacaagcg tgttggaaca 300 aagaccaaac caccatgtcc catatgccca ggctgtgaag tggccgggcc ctcggtcttc 360 atcttccctc caaaacccaa ggacaccctc atgatctccc agacccccga ggtcacgtgc 420 gtggtggtgg acgtcagcaa ggagcacgcc gaggtccagt tctcctggta cgtggacggc 480 gtagaggtgc acacggccga gacgagacca aaggaggagc agttcaacag cacctaccgt 540 gtggtcagcg tcctgcccat ccagcaccag gactggctga aggggaagga gttcaagtgc 600 aaggtcaaca acgtagacct cccagccccc atcacgagga ccatctccaa ggctataggg 660 cagagccggg agccgcaggt gtacaccctg cccccacccg ccgaggagct gtccaggagc 720 aaagtcaccg taacctgcct ggtcattggc ttctacccac ctgacatcca tgttgagtgg 780 aagagcaacg gacagccgga gccagagggc aattacgca ccaccccgcc ccagcaggac 840 gtggacggga ccttcttcct gtacagcaag ctcgcggtgg acaaggcaag atgggaccat 900 ggagaaacat ttgagtgtgc ggtgatgcac gaggctctgc acaaccacta cacccagaag 960 tccatctcca agactcaggg taaatga 987 <210> 52 <211> 328 <212> PRT <213> Sus scrofa <400> 52 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Val Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Lys 85 90 95 Arg Val Gly Ile His Gln Pro Gln Thr Cys Pro Ile Cys Pro Gly Cys 100 105 110 Glu Val Ala Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Met Ile Ser Gln Thr Pro Glu Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Lys Glu His Ala Glu Val Gln Phe Ser Trp Tyr Val Asp Gly 145 150 155 160 Val Glu Val His Thr Ala Glu Thr Arg Pro Lys Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln Asp Trp 180 185 190 Leu Lys Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Val Asp Leu Pro 195 200 205 Ala Pro Ile Thr Arg Thr Ile Ser Lys Ala Ile Gly Gln Ser Arg Glu 210 215 220 Pro Gln Val Tyr Thr Leu Pro Pro Pro Ala Glu Glu Leu Ser Arg Ser 225 230 235 240 Lys Val Thr Leu Thr Cys Leu Val Ile Gly Phe Tyr Pro Pro Asp Ile 245 250 255 His Val Glu Trp Lys Ser Asn Gly Gln Pro Glu Pro Glu Asn Thr Tyr 260 265 270 Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly Thr Phe Phe Leu Tyr 275 280 285 Ser Lys Leu Ala Val Asp Lys Ala Arg Trp Asp His Gly Asp Lys Phe 290 295 300 Glu Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 305 310 315 320 Ser Ile Ser Lys Thr Gln Gly Lys 325 <210> 53 <211> 987 <212> DNA <213> Sus scrofa <400> 53 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcggcaggga cgtgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gcgccctgac cagtggcgtg cacaccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggcca gcagcctgtc cagcaagagc 240 tacacctgca atgtcaacca cccggccacc accaccaagg tggacaagcg tgttggaata 300 caccagccgc aaacatgtcc catatgccca ggctgtgaag tggccgggcc ctcggtcttc 360 atcttccctc caaaacccaa ggacaccctc atgatctccc agacccccga ggtcacgtgc 420 gtggtggtgg acgtcagcaa ggagcacgcc gaggtccagt tctcctggta cgtggacggc 480 gtagaggtgc acacggccga gacgagacca aaggaggagc agttcaacag cacctaccgt 540 gtggtcagcg tcctgcccat ccagcaccag gactggctga aggggaagga gttcaagtgc 600 aaggtcaaca acgtagacct cccagccccc atcacgagga ccatctccaa ggctataggg 660 cagagccggg agccgcaggt gtacaccctg cccccacccg ccgaggagct gtccaggagc 720 aaagtcacgc taacctgcct ggtcattggc ttctacccac ctgacatcca tgttgagtgg 780 aagagcaacg gacagccgga gccagagaac acataccgca ccaccccgcc ccagcaggac 840 gtggacggga ccttcttcct gtacagcaaa ctcgcggtgg acaaggcaag atgggaccat 900 ggagacaaat ttgagtgtgc ggtgatgcac gaggctctgc acaaccacta cacccagaag 960 tccatctcca agactcaggg taaatga 987 <210> 54 <211> 328 <212> PRT <213> Sus scrofa <400> 54 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Ser Arg 1 5 10 15 Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Ser Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Lys 85 90 95 Arg Val Gly Thr Lys Thr Lys Pro Pro Cys Pro Ile Cys Pro Ala Cys 100 105 110 Glu Ser Pro Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Met Ile Ser Arg Thr Pro Gln Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Gln Glu Asn Pro Glu Val Gln Phe Ser Trp Tyr Val Asp Gly 145 150 155 160 Val Glu Val His Thr Ala Gln Thr Arg Pro Lys Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln Asp Trp 180 185 190 Leu Asn Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro 195 200 205 Ala Pro Ile Thr Arg Ile Ile Ser Lys Ala Lys Gly Gln Thr Arg Glu 210 215 220 Pro Gln Val Tyr Thr Leu Pro Pro His Ala Glu Glu Leu Ser Arg Ser 225 230 235 240 Lys Val Ser Ile Thr Cys Leu Val Ile Gly Phe Tyr Pro Pro Asp Ile 245 250 255 Asp Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr 260 265 270 Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly Thr Tyr Phe Leu Tyr 275 280 285 Ser Lys Phe Ser Val Asp Lys Ala Ser Trp Gln Gly Gly Gly Ile Phe 290 295 300 Gln Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 305 310 315 320 Ser Ile Ser Lys Thr Pro Gly Lys 325 <210> 55 <211> 987 <212> DNA <213> Sus scrofa <400> 55 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcagcaggga cacgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gcgccctgtc cagtggcgtg cataccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggcca gcagcctgtc cagcaagagc 240 tacacctgca atgtcaacca cccggccacc accaccaagg tggacaagcg tgttggaaca 300 aagaccaaac caccatgtcc catatgccca gcctgtgaat caccagggcc ctcggtcttc 360 atcttccctc caaaacccaa ggacaccctc atgatctccc ggacacccca ggtcacgtgc 420 gtggtggttg atgtgagcca ggagaacccg gaggtccagt tctcctggta cgtggacggc 480 gtagaggtgc acacggccca gacgaggcca aaggaggagc agttcaacag cacctaccgc 540 gtggtcagcg tcctacccat ccagcaccag gactggctga acgggaagga gttcaagtgc 600 aaggtcaaca acaaagacct cccagccccc atcacaagga tcatctccaa ggccaaaggg 660 cagacccggg agccgcaggt gtacaccctg cccccacacg ccgaggagct gtccaggagc 720 aaagtcagca taacctgcct ggtcattggc ttctacccac ctgacatcga tgtcgagtgg 780 caaagaaacg gacagccgga gccagagggc aattacgca ccaccccgcc ccagcaggac 840 gtggacggga cctacttcct gtacagcaag ttctcggtgg acaaggccag ctggcagggt 900 ggaggcatat tccagtgtgc ggtgatgcac gaggctctgc acaaccacta cacccagaag 960 tctatctcca agactccggg taaatga 987 <210> 56 <211> 328 <212> PRT <213> Sus scrofa <400> 56 Ala Pro Lys Thr Ala Pro Leu Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Lys 85 90 95 Arg Val Gly Thr Lys Thr Lys Pro Pro Cys Pro Ile Cys Pro Ala Cys 100 105 110 Glu Ser Pro Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Met Ile Ser Arg Thr Pro Gln Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Gln Glu Asn Pro Glu Val Gln Phe Ser Trp Tyr Val Asp Gly 145 150 155 160 Val Glu Val His Thr Ala Gln Thr Arg Pro Lys Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Gln Asp Trp 180 185 190 Leu Asn Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro 195 200 205 Ala Pro Ile Thr Arg Ile Ile Ser Lys Ala Lys Gly Gln Thr Arg Glu 210 215 220 Pro Gln Val Tyr Thr Leu Pro Pro His Ala Glu Glu Leu Ser Arg Ser 225 230 235 240 Lys Val Ser Ile Thr Cys Leu Val Ile Gly Phe Tyr Pro Pro Asp Ile 245 250 255 Asp Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr 260 265 270 Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly Thr Tyr Phe Leu Tyr 275 280 285 Ser Lys Phe Ser Val Asp Lys Ala Ser Trp Gln Gly Gly Gly Ile Phe 290 295 300 Gln Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 305 310 315 320 Ser Ile Ser Lys Thr Pro Gly Lys 325 <210> 57 <211> 987 <212> DNA <213> Sus scrofa <400> 57 gcccccaaga cggccccatt ggtctaccct ctggccccct gcggcaggga cacgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gcgccctgac cagtggcgtg cataccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggcca gcagcctgtc cagcaagagc 240 tacacctgca atgtcaacca cccggccacc accaccaagg tggacaagcg tgttggaaca 300 aagaccaaac caccatgtcc catatgccca gcctgtgaat cgccagggcc ctcggtcttc 360 atcttccctc caaaacccaa ggacaccctc atgatctccc ggacacccca ggtcacgtgc 420 gtggtagttg atgtgagcca ggagaacccg gaggtccagt tctcctggta cgtggacggc 480 gtagaggtgc acacggccca gacgaggcca aaggaggagc agttcaacag cacctaccgc 540 gtggtcagcg tcctgcccat ccagcaccag gactggctga acgggaagga gttcaagtgc 600 aaggtcaaca acaaagacct cccagccccc atcacaagga tcatctccaa ggccaaaggg 660 cagacccggg agccgcaggt gtacaccctg cccccacacg ccgaggagct gtccaggagc 720 aaagtcagca taacctgcct ggtcattggc ttctacccac ctgacatcga tgtcgagtgg 780 caaagaaacg gacagccgga gccagagggc aattacgca ccaccccgcc ccagcaggac 840 gtggacggga cctacttcct gtacagcaag ttctcggtgg acaaggccag ctggcagggt 900 ggaggcatat tccagtgtgc ggtgatgcac gaggctctgc acaaccacta cacccagaag 960 tctatctcca agactccggg taaatga 987 <210> 58 <211> 333 <212> PRT <213> Sus scrofa <400> 58 Ala Tyr Asn Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Val Ser Asp His Asn Val Ala Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Ser Arg 35 40 45 Val Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Ile Val Ala Ala Ser Ser Leu Ser Thr Leu Ser 65 70 75 80 Tyr Thr Cys Asn Val Tyr His Pro Ala Thr Asn Thr Lys Val Asp Lys 85 90 95 Arg Val Asp Ile Glu Pro Pro Thr Pro Ile Cys Pro Glu Ile Cys Ser 100 105 110 Cys Pro Ala Ala Glu Val Leu Gly Ala Pro Ser Val Phe Leu Phe Pro 115 120 125 Pro Lys Pro Lys Asp Ile Leu Met Ile Ser Arg Thr Pro Lys Val Thr 130 135 140 Cys Val Val Val Asp Val Ser Gln Glu Glu Ala Glu Val Gln Phe Ser 145 150 155 160 Trp Tyr Val Asp Gly Val Gln Leu Tyr Thr Ala Gln Thr Arg Pro Met 165 170 175 Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile 180 185 190 Gln His Gln Asp Trp Leu Lys Gly Lys Glu Phe Lys Cys Lys Val Asn 195 200 205 Asn Lys Asp Leu Leu Ser Pro Ile Thr Arg Thr Ile Ser Lys Ala Thr 210 215 220 Gly Pro Ser Arg Val Pro Gln Val Tyr Thr Leu Pro Pro Ala Trp Glu 225 230 235 240 Glu Leu Ser Lys Ser Lys Val Ser Ile Thr Cys Leu Val Thr Gly Phe 245 250 255 Tyr Pro Pro Asp Ile Asp Val Glu Trp Gln Ser Asn Gly Gln Gln Glu 260 265 270 Pro Glu Gly Asn Tyr Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly 275 280 285 Thr Tyr Phe Leu Tyr Ser Lys Leu Ala Val Asp Lys Val Arg Trp Gln 290 295 300 Arg Gly Asp Leu Phe Gln Cys Ala Val Met His Glu Ala Leu His Asn 305 310 315 320 His Tyr Thr Gln Lys Ser Ile Ser Lys Thr Gln Gly Lys 325 330 <210> 59 <211> 1002 <212> DNA <213> Sus scrofa <400> 59 gcctacaaca cagctccatc ggtctaccct ctggccccct gtggcaggga cgtgtctgat 60 cataacgtgg ccttgggctg ccttgtctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gtgccctgtc cagagtcgtg cataccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgatc gtggcggcca gcagcctgtc caccctgagc 240 tacacgtgca acgtctacca cccggccacc aacaccaagg tggacaagcg tgttgacatc 300 gaacccccca cacccatctg tcccgaaatt tgctcatgcc cagctgcaga ggtcctggga 360 gcaccgtcgg tcttcctctt ccctccaaaa cccaaggaca tcctcatgat ctcccggaca 420 cccaaggtca cgtgcgtggt ggtggacgtg agccaggagg aggctgaagt ccagttctcc 480 tggtacgtgg acggcgtaca gttgtacacg gcccagacga ggccaatgga ggagcagttc 540 aacagcacct accgcgtggt cagcgtcctg cccatccagc accaggactg gctgaagggg 600 aaggagttca agtgcaaggt caacaacaaa gacctccttt cccccatcac gaggaccatc 660 tccaaggcta cagggccgag ccgggtgccg caggtgtaca ccctgccccc agcctgggaa 720 gagctgtcca agagcaaagt cagcataacc tgcctggtca ctggcttcta cccacctgac 780 atcgatgtcg agtggcagag caacggacaa caagagccag agggcaatta ccgcaccacc 840 ccgccccagc aggacgtgga tgggacctac ttcctgtaca gcaagctcgc ggtggacaag 900 gtcaggtggc agcgtggaga cctattccag tgtgcggtga tgcacgaggc tctgcacaac 960 cactacaccc agaagtccat ctccaagact cagggtaaat ga 1002 <210> 60 <211> 277 <212> PRT <213> Sus scrofa <400> 60 Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser Leu Ser Ser 1 5 10 15 Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser Tyr Thr Cys 20 25 30 Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Lys Arg Val Gly 35 40 45 Thr Lys Thr Lys Pro Pro Cys Pro Ile Cys Pro Ala Cys Glu Gly Pro 50 55 60 Gly Pro Ser Ala Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 65 70 75 80 Ile Ser Arg Thr Pro Lys Val Thr Cys Val Val Val Asp Val Ser Gln 85 90 95 Glu Asn Pro Glu Val Gln Phe Ser Trp Tyr Val Asp Gly Val Glu Val 100 105 110 His Thr Ala Gln Thr Arg Pro Lys Glu Glu Gln Phe Asn Ser Thr Tyr 115 120 125 Arg Val Val Ser Val Leu Pro Ile Gln His Gln Asp Trp Leu Asn Gly 130 135 140 Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro Ile 145 150 155 160 Thr Arg Ile Ile Ser Lys Ala Lys Gly Gln Thr Arg Glu Pro Gln Val 165 170 175 Tyr Thr Leu Pro Pro Pro Thr Glu Glu Leu Ser Arg Ser Lys Val Thr 180 185 190 Leu Thr Cys Leu Val Thr Gly Phe Tyr Pro Pro Asp Ile Asp Val Glu 195 200 205 Trp Gln Arg Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr Arg Thr Thr 210 215 220 Pro Pro Gln Gln Asp Val Asp Gly Thr Tyr Phe Leu Tyr Ser Lys Leu 225 230 235 240 Ala Val Asp Lys Ala Ser Trp Gln Arg Gly Asp Thr Phe Gln Cys Ala 245 250 255 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Ile Phe 260 265 270 Lys Thr Pro Gly Lys 275 <210> 61 <211> 834 <212> DNA <213> Sus scrofa <400> 61 accttcccat ccgtcctgca gccgtcaggg ctctactccc tcagcagcat ggtgaccgtg 60 ccggccagca gcctgtccag caagagctac acctgcaatg tcaaccaccc ggccaccacc 120 accaaggtgg acaagcgtgt tggaacaaag accaaaccac catgtcccat atgcccagcc 180 tgtgaagggc ccgggccctc ggccttcatc ttccctccaa aacccaagga caccctcatg 240 atctcccgga cccccaaggt cacgtgcgtg gtggtagatg tgagccagga gaacccggag 300 gtccagttct cctggtacgt ggacggcgta gaggtgcaca cggcccagac gaggccaaag 360 gaggagcagt tcaacagcac ctaccgcgtg gtcagcgtcc tgcccatcca gcaccaggac 420 tggctgaacg ggaaggagtt caagtgcaag gtcaacaaca aagacctccc agcccccatc 480 acaaggatca tctccaaggc caaagggcag acccgggagc cgcaggtgta caccctgccc 540 ccacccaccg aggagctgtc caggagcaaa gtcacgctaa cctgcctggt cactggcttc 600 tacccacctg acatcgatgt cgagtggcaa agaaacggac agccggagcc agagggcaat 660 taccgcacca ccccgcccca gcaggacgtg gacgggacct acttcctgta cagcaagctc 720 gcggtggaca aggccagctg gcagcgtgga gacacatcc agtgtgcggt gatgcacgag 780 gctctgcaca accactacac ccagaagtcc atcttcaaga ctccgggtaa atga 834 <210> 62 <211> 318 <212> PRT <213> Sus scrofa <400> 62 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Val Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Lys 85 90 95 Arg Val Gly Ile His Gln Pro Gln Thr Cys Pro Ile Cys Pro Ala Cys 100 105 110 Glu Gly Pro Gly Pro Ser Ala Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Met Ile Ser Arg Thr Pro Lys Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Gln Glu Asn Pro Glu Val Gln Phe Ser Trp Tyr Val Asp Gly 145 150 155 160 Val Glu Val His Thr Ala Gln Thr Arg Pro Lys Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Leu Ile Gln His Gln Asp Trp 180 185 190 Leu Asn Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro 195 200 205 Ala Pro Ile Thr Arg Ile Ile Ser Lys Ala Lys Gly Gln Thr Arg Glu 210 215 220 Pro Gln Val Tyr Thr Leu Pro Pro Pro Thr Glu Glu Leu Ser Arg Ser 225 230 235 240 Lys Val Thr Leu Thr Cys Leu Val Thr Gly Phe Tyr Pro Pro Asp Ile 245 250 255 Asp Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr 260 265 270 Arg Thr Thr Pro Pro Gln Gln Asp Val Asp Gly Thr Tyr Phe Leu Tyr 275 280 285 Ser Lys Leu Ala Val Asp Lys Ala Ser Trp Gln Arg Gly Asp Thr Phe 290 295 300 Gln Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr 305 310 315 <210> 63 <211> 955 <212> DNA <213> Sus scrofa <400> 63 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcggcaggga cgtgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gcgccctgac cagtggcgtg cacaccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggcca gcagcctgtc cagcaagagc 240 tacacctgca atgtcaacca cccggccacc accaccaagg tggacaagcg tgttggaata 300 caccagccgc aaacatgtcc catatgccca gcctgtgaag ggcccgggcc ctcggccttc 360 atcttccctc caaaacccaa ggacaccctc atgatctccc ggaccccccaa ggtcacgtgc 420 gtggtggttg atgtgagcca ggagaacccg gaggtccagt tctcctggta cgtggacggc 480 gtagaggtgc acacggccca gacgaggcca aaggaggagc agttcaacag cacctaccgc 540 gtggtcagcg tcctgctcat ccagcaccag gactggctga acgggaagga gttcaagtgc 600 aaggtcaaca acaaagacct cccagccccc atcacaagga tcatctccaa ggccaaaggg 660 cagacccggg agccgcaggt gtacaccctg cccccaccca ccgaggagct gtccaggagc 720 aaagtcacgc taacctgcct ggtcactggc ttctacccac ctgacatcga tgtcgagtgg 780 caaagaaacg gacagccgga gccagagggc aattacgca ccaccccgcc ccagcaggac 840 gtggacggga cctacttcct gtacagcaag ctcgcggtgg acaaggccag ctggcagcgt 900 ggagacacat tccagtgtgc ggtgatgcac gaggctctgc acaaccacta caccc 955 <210> 64 <211> 323 <212> PRT <213> Sus scrofa <400> 64 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Ser Arg 1 5 10 15 Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala His Ser Leu Ser Ser Lys Arg 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Lys Thr Lys Val Asp Leu 85 90 95 Cys Val Gly Arg Pro Cys Pro Ile Cys Pro Gly Cys Glu Val Ala Gly 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Ile Leu Met Ile 115 120 125 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Lys Glu 130 135 140 His Ala Glu Val Gln Phe Ser Trp Tyr Val Asp Gly Glu Glu Val His 145 150 155 160 Thr Ala Glu Thr Arg Pro Lys Glu Glu Gln Phe Asn Ser Thr Tyr Arg 165 170 175 Val Val Ser Val Leu Pro Ile Gln His Glu Asp Trp Leu Lys Gly Lys 180 185 190 Glu Phe Glu Cys Lys Val Asn Asn Glu Asp Leu Pro Gly Pro Ile Thr 195 200 205 Arg Thr Ile Ser Lys Ala Lys Gly Val Val Arg Ser Pro Glu Val Tyr 210 215 220 Thr Leu Pro Pro Pro Ala Glu Glu Leu Ser Lys Ser Ile Val Thr Leu 225 230 235 240 Thr Cys Leu Val Lys Ser Ile Phe Pro Phe Ile His Val Glu Trp Lys 245 250 255 Ile Asn Gly Lys Pro Glu Pro Glu Asn Ala Tyr Arg Thr Thr Pro Pro 260 265 270 Gln Glu Asp Glu Asp Arg Thr Tyr Phe Leu Tyr Ser Lys Leu Ala Val 275 280 285 Asp Lys Ala Arg Trp Asp His Gly Glu Thr Phe Glu Cys Ala Val Met 290 295 300 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Ile Ser Lys Thr 305 310 315 320 Gln Gly Lys <210> 65 <211> 975 <212> DNA <213> Sus scrofa <220> <221> misc_feature <222> (748)..(748) <223> n is a, c, g, or t <400> 65 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcagcaggga cacgtctggc 60 cctaacgtgg ccttgggctg cctggtctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gcgccctgac cagtggcgtg cacaccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggccc acagcttgtc cagcaagcgc 240 tatacgtgca atgtcaacca cccagccacc aaaaccaagg tggacctgtg tgttggacga 300 ccatgtccca tatgcccagg ctgtgaagtg gccgggccct cggtcttcat cttccctcca 360 aaacccaagg acatcctcat gatctcccgg acccccgagg tcacgtgcgt ggtggtggac 420 gtcagcaagg agcacgccga ggtccagttc tcctggtacg tggacggcga agaggtgcac 480 acggccgaga cgaggccaaa ggaggagcag ttcaacagca cctaccgcgt ggtcagcgtc 540 ctgcccatcc agcacgagga ctggctgaag gggaaggagt tcgagtgcaa ggtcaacaac 600 gaagacctcc caggccccat cacgaggacc atctccaagg ccaaaggggt ggtacggagc 660 ccggaggtgt acaccctgcc cccacccgcc gaggagctgt ccaagagcat agtcacgcta 720 acctgcctgg tcaaaagcat cttcccgnct ttcatccatg ttgagtgggaa aatcaacgga 780 aaaccagagc cagagaacgc atatcgcacc accccgcctc aggaggacga ggacaggacc 840 tacttcctgt acagcaagct cgcggtggac aaggcaagat gggaccatgg agaaacattt 900 gagtgtgcgg tgatgcacga ggctctgcac aaccactaca cccagaagtc catctccaag 960 actcagggta aatga 975 <210> 66 <211> 317 <212> PRT <213> Sus scrofa <400> 66 Ala Tyr Asn Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Val Ser Asp His Asn Val Ala Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Trp Gly Ala Gln Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Thr Val Thr Val Pro Ala His Ser Leu Ser Ser Lys Cys 65 70 75 80 Phe Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Leu 85 90 95 Cys Val Gly Lys Lys Thr Lys Pro Arg Cys Pro Ile Cys Pro Gly Cys 100 105 110 Glu Val Ala Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Ile Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 130 135 140 Val Ser Lys Glu His Ala Glu Val Gln Phe Ser Trp Tyr Val Asp Gly 145 150 155 160 Glu Glu Val His Thr Ala Glu Thr Arg Pro Lys Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Val Leu Pro Ile Gln His Glu Asp Trp 180 185 190 Leu Lys Gly Lys Glu Phe Glu Cys Lys Val Asn Asn Glu Asp Leu Pro 195 200 205 Gly Pro Ile Thr Arg Thr Ile Ser Lys Ala Lys Gly Val Val Arg Ser 210 215 220 Pro Glu Val Tyr Thr Leu Pro Pro Pro Ala Glu Glu Leu Ser Lys Ser 225 230 235 240 Ile Val Thr Leu Thr Cys Leu Val Lys Ser Phe Phe Pro Pro Phe Ile 245 250 255 His Val Glu Trp Lys Ile Asn Gly Lys Pro Glu Pro Glu Asn Ala Tyr 260 265 270 Arg Thr Thr Pro Pro Gln Glu Asp Glu Asp Gly Thr Tyr Phe Leu Tyr 275 280 285 Ser Lys Phe Ser Val Glu Lys Phe Arg Trp His Ser Gly Gly Ile His 290 295 300 Cys Ala Val Met His Glu Ala Leu His Asn His Tyr Thr 305 310 315 <210> 67 <211> 952 <212> DNA <213> Sus scrofa <400> 67 gcctacaaca cagctccatc ggtctaccct ctggccccct gtggcaggga cgtgtctgat 60 cataacgtgg ccttgggctg cctggtctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactggg gcgcccagac cagtggcgtg cacaccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag cacggtgacc gtgccggccc acagcttgtc cagcaagtgc 240 ttcacgtgca atgtcaacca cccggccacc accaccaagg tggacctgtg tgttggaaaa 300 aagaccaagc ctcgatgtcc catatgccca ggctgtgaag tggccgggcc ctcggtcttc 360 atcttccctc caaaacccaa ggacatcctc atgatctccc ggacccccga ggtcacgtgc 420 gtggtggtgg acgtcagcaa ggagcacgcc gaggtccagt tctcctggta cgtggacggc 480 gaagaggtgc acacggccga gacgagacca aaggaggagc agttcaacag cacttaccgc 540 gtggtcagcg tcctgcccat ccagcacgag gactggctga aggggaagga gttcgagtgc 600 aaggtcaaca acgaagacct cccaggcccc atcacgagga ccatctccaa ggccaaaggg 660 gtggtacgga gcccggaggt gtacaccctg cccccacccg ccgaggagct gtccaagagc 720 atagtcacgc taacctgcct ggtcaaaagc ttcttcccgc ctttcatcca tgttgagtgg 780 aaaatcaacg gaaaaccaga gccagagaac gcataccgca ccaccccgcc ccaggaggac 840 gaggacggga cctacttcct gtacagcaag ttctcggtgg aaaagttcag gtggcacagt 900 ggaggcatcc actgtgcggt gatgcacgag gctctgcaca accactacac cc 952 <210> 68 <211> 314 <212> PRT <213> Sus scrofa <400> 68 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Leu Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Leu Ser Ser Lys Ser 65 70 75 80 Tyr Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Leu 85 90 95 Cys Val Gly Arg Pro Cys Pro Ile Cys Pro Ala Cys Glu Gly Pro Gly 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 115 120 125 Ser Arg Thr Pro Gln Val Thr Cys Val Val Val Asp Val Ser Gln Glu 130 135 140 Asn Pro Glu Val Gln Phe Ser Trp Tyr Val Asp Gly Val Glu Val His 145 150 155 160 Thr Ala Gln Thr Arg Pro Lys Glu Ala Gln Phe Asn Ser Thr Tyr Arg 165 170 175 Val Val Ser Val Leu Pro Ile Gln His Glu Asp Trp Leu Lys Gly Lys 180 185 190 Glu Phe Glu Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro Ile Thr 195 200 205 Arg Ile Ile Ser Lys Ala Lys Gly Pro Ser Arg Glu Pro Gln Val Tyr 210 215 220 Thr Leu Ser Pro Ser Ala Glu Glu Leu Ser Arg Ser Lys Val Ser Ile 225 230 235 240 Thr Cys Leu Val Thr Gly Phe Tyr Pro Pro Asp Ile Asp Val Glu Trp 245 250 255 Lys Ser Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr Arg Thr Thr Pro 260 265 270 Pro Gln Gln Asp Val Asp Gly Thr Tyr Phe Leu Tyr Ser Lys Leu Ala 275 280 285 Val Asp Lys Ala Ser Trp Gln Arg Gly Asp Pro Phe Gln Cys Ala Val 290 295 300 Met His Glu Ala Leu His Asn His Tyr Thr 305 310 <210> 69 <211> 943 <212> DNA <213> Sus scrofa <400> 69 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcggcaggga cacgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccctgacc 120 tggaactcgg gcgccctgac cagtggcgtg cataccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag catggtgacc gtgccggcca gcagcctgtc cagcaagagc 240 tacacctgca atgtcaacca cccggccacc accaccaagg tggacctgtg tgttggacga 300 ccatgtccca tatgcccagc ctgtgaaggg cccgggccct cggtcttcat cttccctcca 360 aaacccaagg acaccctcat gatctcccgg acaccccagg tcacgtgcgt ggtggtagat 420 gtgagccagg aaaacccgga ggtccagttc tcctggtatg tggacggtgt agaggtgcac 480 acggcccaga cgaggccaaa ggaggcgcag ttcaacagca cctaccgtgt ggtcagcgtc 540 ctgcccatcc agcacgagga ctggctgaag gggaaggagt tcgagtgcaa ggtcaacaac 600 aaagacctcc cagcccccat cacaaggatc atctccaagg ccaaagggcc gagccggggag 660 ccgcaggtgt acaccctgtc cccatccgcc gaggagctgt ccaggagcaa agtcagcata 720 acctgcctgg tcactggctt ctacccacct gacatcgatg tcgagtggaa gagcaacgga 780 cagccggagc cagagggcaa ttaccgcacc accccgcccc agcaggacgt ggacgggacc 840 tacttcctgt acagcaagct cgcggtggac aaggccagct ggcagcgtgg agacccattc 900 cagtgtgcgg tgatgcacga ggctctgcac aaccactaca ccc 943 <210> 70 <211> 320 <212> PRT <213> Sus scrofa <400> 70 Ala Pro Lys Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro Cys Gly Arg 1 5 10 15 Asp Thr Ser Gly Pro Asn Val Ala Leu Gly Cys Leu Ala Ser Ser Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ser Val Leu Gln Pro Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Thr Val Thr Val Pro Ala Arg Ser Ser Ser Arg Lys Cys 65 70 75 80 Phe Thr Cys Asn Val Asn His Pro Ala Thr Thr Thr Lys Val Asp Leu 85 90 95 Cys Val Gly Arg Pro Cys Pro Ile Cys Pro Ala Cys Glu Gly Asn Gly 100 105 110 Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 115 120 125 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu 130 135 140 Asn Pro Glu Val Gln Phe Ser Trp Tyr Val Asp Gly Glu Glu Val His 145 150 155 160 Thr Ala Glu Thr Arg Pro Lys Glu Glu Gln Phe Asn Ser Thr Tyr Arg 165 170 175 Val Val Ser Val Leu Pro Ile Gln His Gln Asp Trp Leu Lys Gly Lys 180 185 190 Glu Phe Glu Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro Ile Thr 195 200 205 Arg Ile Ile Ser Lys Ala Lys Gly Pro Ser Arg Glu Pro Gln Val Tyr 210 215 220 Thr Leu Ser Pro Ser Ala Glu Glu Leu Ser Arg Ser Lys Val Ser Ile 225 230 235 240 Thr Cys Leu Val Thr Gly Phe Tyr Pro Pro Asp Ile Asp Val Glu Trp 245 250 255 Lys Ser Asn Gly Gln Pro Glu Pro Glu Gly Asn Tyr Arg Ser Thr Pro 260 265 270 Pro Gln Glu Asp Glu Asp Gly Thr Tyr Phe Leu Tyr Ser Lys Leu Ala 275 280 285 Val Asp Lys Ala Arg Leu Gln Ser Gly Gly Ile His Cys Ala Val Met 290 295 300 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Ile Ser Lys Thr 305 310 315 320 <210> 71 <211> 960 <212> DNA <213> Sus scrofa <400> 71 gcccccaaga cggcccccatc ggtctaccct ctggccccct gcggcaggga cacgtctggc 60 cctaacgtgg ccttgggctg cctggcctca agctacttcc ccgagccagt gaccgtgacc 120 tggaactcgg gcgccctgac cagtggcgtg cacaccttcc catccgtcct gcagccgtca 180 gggctctact ccctcagcag cacggtgacc gtgccggcca ggagctcgtc cagaaagtgc 240 ttcacgtgca atgtcaacca cccggccacc accaccaagg tggacctgtg tgttggacga 300 ccatgtccca tatgcccagc ctgtgaaggg aacgggccct cggtcttcat cttccctcca 360 aaacccaagg acaccctcat gatctcccgg acccccgagg tcacgtgcgt ggtggtagat 420 gtgagccagg aaaacccgga ggtccagttc tcctggtacg tggacggcga agaggtgcac 480 acggccgaga cgaggccaaa ggaggagcag ttcaacagca cctaccgtgt ggtcagcgtc 540 ctgcccatcc agcaccagga ctggctgaag ggaaaggagt tcgagtgcaa ggtcaacaac 600 aaagacctcc cagcccccat cacaaggatc atctccaagg ccaaagggcc gagccggggag 660 ccgcaggtgt acaccctgtc cccatccgcc gaggagctgt ccaggagcaa agtcagcata 720 acctgcctgg tcactggctt ctacccacct gacatcgatg tcgagtggaa gagcaacgga 780 cagccggagc cagagggcaa ttaccgctcc accccgcccc aggaggacga ggacgggacc 840 tacttcctgt acagcaaact cgcggtggac aaggcgaggt tgcagagtgg aggcatccac 900 tgtgcggtga tgcacgaggc tctgcacaac cactacaccc agaagtccat ctccaagact 960 <210> 72 <211> 266 <212> PRT 213 <213> <400> 72 Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr 1 5 10 15 Ser Leu Ser Ser Thr Val Thr Ala Pro Ala Ser Ala Thr Lys Ser Gln 20 25 30 Thr Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp 35 40 45 Lys Ala Val Val Pro Pro Cys Arg Pro Lys Pro Cys Asp Cys Cys Pro 50 55 60 Pro Pro Glu Leu Pro Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys 65 70 75 80 Pro Lys Asp Thr Leu Thr Ile Ser Gly Thr Pro Glu Val Thr Cys Val 85 90 95 Val Val Asp Val Gly His Asp Asp Pro Glu Val Lys Phe Ser Trp Phe 100 105 110 Val Asp Asp Val Glu Val Asn Thr Ala Arg Thr Lys Pro Arg Glu Glu 115 120 125 Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Ala Leu Pro Ile Gln His 130 135 140 Asn Asp Trp Thr Gly Gly Lys Glu Phe Lys Cys Lys Val Tyr Asn Glu 145 150 155 160 Gly Leu Pro Ala Pro Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Gln 165 170 175 Ala Arg Glu Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Asp Glu Leu 180 185 190 Ser Lys Ser Thr Val Ser Ile Thr Cys Met Val Thr Gly Phe Tyr Pro 195 200 205 Asp Tyr Ile Ala Val Glu Trp Gln Lys Asp Gly Gln Pro Glu Ser Glu 210 215 220 Asp Lys Tyr Gly Thr Thr Pro Pro Gln Leu Asp Ser Asp Gly Ser Tyr 225 230 235 240 Phe Leu Tyr Ser Arg Leu Arg Val Asn Lys Asn Ser Trp Gln Glu Gly 245 250 255 Gly Ala Tyr Thr Cys Val Val Met His Glu 260 265 <210> 73 <211> 801 <212> DNA 213 <213> <400> 73 gagcggcgtg cacaccttcc cggccgtcct tcagtcctcc gggctctact ctctcagcag 60 cacggtgacc gcgcccgcca gcgccacaaa aagccagacc ttcacctgca acgtagccca 120 cccggccagc agcaccaagg tggacaaggc tgttgttccc ccatgcagac cgaaaccctg 180 tgattgctgc ccaccccctg agctccccgg aggaccctct gtcttcatct tcccaccaaa 240 acccaaggac accctcacaa tctctggaac tcctgaggtc acgtgtgtgg tggtggacgt 300 gggccacgat gaccccgagg tgaagttctc ctggttcgtg gacgatgtgg aggtaaacac 360 agccaggacg aagccaagag aggagcagtt caacagcacc taccgcgtgg tcagcgccct 420 gcccatccag cacaacgact ggactggagg aaaggagttc aagtgcaagg tctacaatga 480 aggcctccca gcccccatcg tgaggaccat ctccaggacc aaagggcagg cccgggagcc 540 gcaggtgtac gtcctggccc caccccagga cgagctcagc aaaagcacgg tcagcatcac 600 ttgcatggtc actggcttct acccagacta catcgccgta gagtggcaga aagatgggca 660 gcctgagtca gaggacaaat atggcacgac cccgccccag ctggacagcg atggctccta 720 cttcctgtac agcaggctca gggtgaacaa gaacagctgg caagaaggag gcgcctacac 780 gtggtgtagtg atgcatgagg c 801 <210> 74 <211> 309 <212> PRT 213 <br> <400> 74 Ala Ser Ile Thr Ala Pro Lys Val Tyr Pro Leu Thr Ser Cys Arg Gly 1 5 10 15 Glu Thr Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Thr Val Thr Ala Pro Ala Ser Ala Thr Lys Ser Gln Thr 65 70 75 80 Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Thr 85 90 95 Ala Val Gly Phe Ser Ser Asp Cys Cys Lys Phe Pro Lys Pro Cys Val 100 105 110 Arg Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu 115 120 125 Met Ile Thr Gly Asn Pro Glu Val Thr Cys Val Val Val Asp Val Gly 130 135 140 Arg Asp Asn Pro Glu Val Gln Phe Ser Trp Phe Val Gly Asp Val Glu 145 150 155 160 Val His Thr Gly Arg Ser Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr 165 170 175 Tyr Arg Val Val Ser Thr Leu Pro Ile Gln His Asn Asp Trp Thr Gly 180 185 190 Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Gly Leu Pro Ala Pro 195 200 205 Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Gln Ala Arg Glu Pro Gln 210 215 220 Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Leu Ser Lys Ser Thr Val 225 230 235 240 Ser Val Thr Cys Met Val Thr Gly Phe Tyr Pro Asp Tyr Ile Ala Val 245 250 255 Glu Trp His Arg Asp Arg Gln Ala Glu Ser Glu Asp Lys Tyr Arg Thr 260 265 270 Thr Pro Pro Gln Leu Asp Ser Asp Gly Ser Tyr Phe Leu Tyr Ser Arg 275 280 285 Leu Lys Val Asn Lys Asn Ser Trp Gln Glu Gly Gly Ala Tyr Thr Cys 290 295 300 Val Val Met His Glu 305 <210> 75 <211> 929 <212> DNA 213 <213> <400> 75 gcctccatca cagccccgaa agtctaccct ctgacttctt gccgcgggga aacgtccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggccgtcct tcagtcctct 180 gggctctact ctctcagcag cacggtgacc gcgcccgcca gcgccacaaa aagccagacc 240 ttcacctgca acgtagccca cccggccagc agcaccaagg tggacacggc tgttgggttc 300 tccagtgact gctgcaagtt tcctaagcct tgtgtgaggg gaccatctgt cttcatcttc 360 ccgccgaaac ccaaagacac cctgatgatc acaggaaatc ccgaggtcac atgtgtggtg 420 gtggacgtgg gccgggataa ccccgaggtg cagttctcct ggttcgtggg tgatgtggag 480 gtgcacacgg gcaggtcgaa gccgagagag gagcagttca acagcaccta ccgcgtggtc 540 agcaccctgc ccatccagca caatgactgg actggaggaa aggagttcaa gtgcaaggtc 600 aacaacaaag gcctcccagc ccccatcgtg aggaccatct ccaggaccaa agggcaggcc 660 cgggagccgc aggtgtacgt cctggcccca ccccaggaag agctcagcaa aagcacggtc 720 agcgtcactt gcatggtcac tggcttctac ccagactaca tcgccgtaga gtggcataga 780 gaccggcagg ctgagtcgga ggacaagtac cgcacgaccc cgccccagct ggacagcgat 840 ggctcctact tcctgtacag caggctcaag gtgaacaaga acagctggca agaaggaggc 900 gcctacacgt gtgtagtgat gcatgaggc 929 <210> 76 <211> 352 <212> PRT 213 <213> <400> 76 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ala Ser Ser Cys Gly 1 5 10 15 Asp Thr Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Asn 35 40 45 Gly Val His Thr Phe Pro Ala Val Arg Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Met Pro Thr Ser Thr Ala Gly Thr Gln Thr 65 70 75 80 Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Thr 85 90 95 Ala Val Thr Ala Arg His Pro Val Pro Lys Thr Pro Glu Thr Pro Ile 100 105 110 His Pro Val Lys Pro Pro Thr Gln Glu Pro Arg Asp Glu Lys Thr Pro 115 120 125 Cys Gln Cys Pro Lys Cys Pro Glu Pro Leu Gly Gly Leu Ser Val Phe 130 135 140 Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Thr Ile Ser Gly Thr Pro 145 150 155 160 Glu Val Thr Cys Val Val Val Asp Val Gly Gln Asp Asp Pro Glu Val 165 170 175 Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Arg Met 180 185 190 Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Ala 195 200 205 Leu Pro Ile Gln His Gln Asp Trp Leu Arg Glu Lys Glu Phe Lys Cys 210 215 220 Lys Val Asn Asn Lys Gly Leu Pro Ala Pro Ile Val Arg Thr Ile Ser 225 230 235 240 Arg Thr Lys Gly Gln Ala Arg Glu Pro Gln Val Tyr Val Leu Ala Pro 245 250 255 Pro Arg Glu Glu Leu Ser Lys Ser Thr Leu Ser Leu Thr Cys Leu Ile 260 265 270 Thr Gly Phe Tyr Pro Glu Glu Val Asp Val Glu Trp Gln Arg Asn Gly 275 280 285 Gln Pro Glu Ser Glu Asp Lys Tyr His Thr Thr Pro Pro Gln Leu Asp 290 295 300 Ala Asp Gly Ser Tyr Phe Leu Tyr Ser Arg Leu Arg Val Asn Arg Ser 305 310 315 320 Ser Trp Gln Glu Gly Asp His Tyr Thr Cys Ala Val Met His Glu Ala 325 330 335 Leu Arg Asn His Tyr Lys Glu Lys Pro Ile Ser Arg Ser Pro Gly Lys 340 345 350 <210> 77 <211> 1059 <212> DNA 213 <213> <400> 77 gcctccacca cagccccgaa agtctaccct ctggcatcca gctgcgggga cacgtccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gaacggcgtg cacaccttcc cggccgtccg gcagtcctcc 180 gggctctact ctctcagcag catggtgacc atgcccacca gcaccgcagg aacccagacc 240 ttcacctgca acgtagccca cccggccagc agcaccaagg tggacacggc tgtcactgca 300 aggcatccgg tcccgaagac accagagaca cctatccatc ctgtaaaacc cccaacccag 360 gagcccagag atgaaaagac accctgccag tgtcccaaat gcccagaacc tctggggagga 420 ctgtctgtct tcatcttccc accgaaaccc aaggacaccc tcacaatctc tggaacgccc 480 gaggtcacgt gtgtggtggt ggacgtgggc caggatgacc ccgaagtgca gttctcctgg 540 ttcgtggatg acgtggaggt gcacacagcc aggatgaagc caagagagga gcagttcaac 600 agcacctacc gcgtggtcag cgccctgccc atccagcacc aggactggct gcgggaaaag 660 gagttcaagt gcaaggtcaa caacaaaggc ctcccggccc ccatcgtgag gaccatctcc 720 aggaccaaag ggcaggcccg ggagccacag gtgtatgtcc tggccccacc ccgggaagag 780 ctcagcaaaa gcacgctcag cctcacctgc ctaatcaccg gcttctaccc agaagaggta 840 gacgtggagt ggcagagaaa tgggcagcct gagtcagagg acaagtacca cacgacccca 900 ccccagctgg acgctgacgg ctcctacttc ctgtacagca ggctcagggt gaacaggagc 960 agctggcagg aaggagacca ctacacgtgt gcagtgatgc atgaagcttt acggaatcac 1020 tacaaagaga agcccatctc gaggtctccg ggtaaatga 1059 <210> 78 <211> 105 <212> PRT 213 <213> <400> 78 Gln Pro Lys Ser Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Thr Glu 1 5 10 15 Glu Leu Ser Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe 20 25 30 Tyr Pro Gly Ser Met Thr Val Ala Arg Lys Ala Asp Gly Ser Thr Ile 35 40 45 Thr Arg Asn Val Glu Thr Thr Arg Ala Ser Lys Gln Ser Asn Ser Lys 50 55 60 Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Gly Ser Glu Trp Lys Ser 65 70 75 80 Lys Gly Ser Tyr Ser Cys Glu Val Thr His Glu Gly Ser Thr Val Thr 85 90 95 Lys Thr Val Lys Pro Ser Glu Cys Ser 100 105 <210> 79 <211> 318 <212> DNA 213 <br><br><br> <400> 79 cagcccaagt ccgcaccctc agtcaccctg ttcccaccct ccacggagga gctcagcgcc 60 aacaaggcca ccctggtgtg tctcatcagc gacttctacc cgggtagcat gaccgtggcc 120 aggaaggcag acggcagcac catcacccgg aacgtggaga ccacccgggc ctccaaacag 180 agcaacagca agtacgcggc cagcagctac ctgagcctga cgggcagcga gtggaaatcg 240 aaaggcagtt acagctgcga ggtcacgcac gaggggagca ccgtgacaaa gacagtgaag 300 ccctcagagt gttcttag 318 <210> 80 <211> 229 <212> PRT <213> Homo sapiens <400> 80 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe 1 5 10 15 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Val His Gln Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly Lys 225 <210> 81 <211> 690 <212> DNA <213> Homo sapiens <400> 81 gagtccaaat atggtccccc gtgcccatca tgcccagcac ctgagttcct ggggggacca 60 tcagtcttcc tgttcccccc aaaacccaag gacactctca tgatctcccg gacccctgag 120 gtcacgtgcg tggtggtgga cgtgagccag gaagaccccg aggtccagtt caactggtac 180 gtggatggcg tggaggtgca taatgccaag acaaagccgc gggaggagca gttcaacagc 240 acgtaccgtg tggtcagcgt cctcaccgtc gtgcaccagg actggctgaa cggcaaggag 300 tacaagtgca aggtctccaa caaaggcctc ccgtcctcca tcgagaaaac catctccaaa 360 gccaaagggc agccccgaga gccacaggtg tacaccctgc ccccatccca ggaggagatg 420 accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctaccccag cgacatcgcc 480 gtggagtggg agagcaatgg gcagccggag aacaactaca agaccacgcc tcccgtgctg 540 gactccgacg gctccttctt cctctacagc aggctaaccg tggacaagag caggtggcag 600 gaggggaatg tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacgcag 660 aagagcctct ccctgtctct gggtaaatga 690 <210> 82 <211> 217 <212> PRT <213> Homo sapiens <400> 82 Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 1 5 10 15 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 20 25 30 Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr 35 40 45 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 50 55 60 Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 65 70 75 80 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 85 90 95 Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 100 105 110 Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met 115 120 125 Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 130 135 140 Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 145 150 155 160 Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 165 170 175 Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val 180 185 190 Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 195 200 205 Lys Ser Leu Ser Leu Ser Leu Gly Lys 210 215 <210> 83 <211> 654 <212> DNA <213> Homo sapiens <400> 83 gcacctgagt tcctgggggg accatcagtc ttcctgttcc ccccaaaacc caaggacact 60 ctcatgatct cccggacccc tgaggtcacg tgcgtggtgg tggacgtgag ccaggaagac 120 cccgaggtcc agttcaactg gtacgtggat ggcgtggagg tgcataatgc caagacaaag 180 ccgcgggagg agcagttcaa cagcacgtac cgtgtggtca gcgtcctcac cgtcctgcac 240 caggactggc tgaacggcaa ggagtacaag tgcaaggtct ccaacaaagg cctcccgtcc 300 tccatcgaga aaaccatctc caaagccaaa gggcagcccc gagagccaca ggtgtacacc 360 ctgcccccat cccaggagga gatgaccaag aaccaggtca gcctgacctg cctggtcaaa 420 ggcttctacc ccagcgacat cgccgtggag tgggagca atgggcagcc ggagaacaac 480 tacaagacca cgcctcccgt gctggactcc gacggctcct tcttcctcta cagcaagctc 540 accgtggaca agagcaggtg gcaggagggg aacgtcttct catgctccgt gatgcatgag 600 gctctgcaca accactacac gcagaagagc ctctccctgt ctctgggtaa atga 654 <210> 84 <211> 329 <212> PRT <213> <400> 84 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ser Ser Cys Cys Gly 1 5 10 15 Asp Lys Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Gly Ser Thr Ser Gly Gln Thr Phe 65 70 75 80 Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Ala 85 90 95 Val Asp Pro Thr Cys Lys Pro Ser Pro Cys Asp Cys Cys Pro Pro Pro 100 105 110 Glu Leu Pro Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys 115 120 125 Asp Thr Leu Thr Ile Ser Gly Thr Pro Glu Val Thr Cys Val Val Val 130 135 140 Asp Val Gly His Asp Asp Pro Glu Val Lys Phe Ser Trp Phe Val Asp 145 150 155 160 Asp Val Glu Val Asn Thr Ala Thr Thr Lys Pro Arg Glu Glu Gln Phe 165 170 175 Asn Ser Thr Tyr Arg Val Val Ser Ala Leu Arg Ile Gln His Gln Asp 180 185 190 Trp Thr Gly Gly Lys Glu Phe Lys Cys Lys Val His Asn Glu Gly Leu 195 200 205 Pro Ala Pro Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Pro Ala Arg 210 215 220 Glu Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Leu Ser Lys 225 230 235 240 Ser Thr Val Ser Leu Thr Cys Met Val Thr Ser Phe Tyr Pro Asp Tyr 245 250 255 Ile Ala Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Asp Lys 260 265 270 Tyr Gly Thr Thr Pro Pro Gln Leu Asp Ala Asp Ser Ser Tyr Phe Leu 275 280 285 Tyr Ser Lys Leu Arg Val Asp Arg Asn Ser Trp Gln Glu Gly Asp Thr 290 295 300 Tyr Thr Cys Val Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 305 310 315 320 Lys Ser Thr Ser Lys Ser Ala Gly Lys 325 <210> 85 <211> 329 <212> PRT <213> <400> 85 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ser Ser Cys Cys Gly 1 5 10 15 Asp Lys Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Gly Ser Thr Ser Gly Gln Thr Phe 65 70 75 80 Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Ala 85 90 95 Val Asp Pro Thr Cys Lys Pro Ser Pro Cys Asp Cys Cys Pro Pro Pro 100 105 110 Glu Leu Pro Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys 115 120 125 Asp Thr Leu Thr Ile Ser Gly Thr Pro Glu Val Thr Cys Val Val Val 130 135 140 Asp Val Gly His Asp Asp Pro Glu Val Lys Phe Ser Trp Phe Val Asp 145 150 155 160 Asp Val Glu Val Asn Thr Ala Thr Thr Lys Pro Arg Glu Glu Gln Phe 165 170 175 Asn Ser Thr Tyr Arg Val Val Ser Ala Leu Arg Ile Gln His Gln Asp 180 185 190 Trp Thr Gly Gly Lys Glu Phe Lys Cys Lys Val His Asn Glu Gly Leu 195 200 205 Pro Ala Pro Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Pro Ala Arg 210 215 220 Glu Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Leu Ser Lys 225 230 235 240 Ser Thr Val Ser Leu Thr Cys Met Val Thr Ser Phe Tyr Pro Asp Tyr 245 250 255 Ile Ala Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Asp Lys 260 265 270 Tyr Gly Thr Thr Pro Pro Gln Leu Asp Ala Asp Ser Ser Tyr Phe Leu 275 280 285 Tyr Ser Lys Leu Arg Val Asp Arg Asn Ser Trp Gln Glu Gly Asp Thr 290 295 300 Tyr Thr Cys Val Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 305 310 315 320 Lys Ser Thr Ser Lys Ser Ala Gly Lys 325 <210> 86 <211> 329 <212> PRT <213> <400> 86 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ser Ser Cys Cys Gly 1 5 10 15 Asp Lys Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Gly Ser Thr Ser Gly Thr Gln Thr 65 70 75 80 Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys 85 90 95 Ala Val Asp Pro Arg Cys Lys Thr Thr Cys Asp Cys Cys Pro Pro Pro 100 105 110 Glu Leu Pro Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys 115 120 125 Asp Thr Leu Thr Ile Ser Gly Thr Pro Glu Val Thr Cys Val Val Val 130 135 140 Asp Val Gly His Asp Asp Pro Glu Val Lys Phe Ser Trp Phe Val Asp 145 150 155 160 Asp Val Glu Val Asn Thr Ala Thr Thr Lys Pro Arg Glu Glu Gln Phe 165 170 175 Asn Ser Thr Tyr Arg Val Val Ser Ala Leu Arg Ile Gln His Gln Asp 180 185 190 Trp Thr Gly Gly Lys Glu Phe Lys Cys Lys Val His Asn Glu Gly Leu 195 200 205 Pro Ala Pro Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Pro Ala Arg 210 215 220 Glu Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Leu Ser Lys 225 230 235 240 Ser Thr Val Ser Leu Thr Cys Met Val Thr Ser Phe Tyr Pro Asp Tyr 245 250 255 Ile Ala Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Asp Lys 260 265 270 Tyr Gly Thr Thr Pro Pro Gln Leu Asp Ala Asp Gly Ser Tyr Phe Leu 275 280 285 Tyr Ser Arg Leu Arg Val Asp Arg Asn Ser Trp Gln Glu Gly Asp Thr 290 295 300 Tyr Thr Cys Val Val Met His Glu Ala Leu His Asn His Tyr Thr Gln 305 310 315 320 Lys Ser Thr Ser Lys Ser Ala Gly Lys 325 <210> 87 <211> 326 <212> PRT <213> <400> 87 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ala Ser Ser Cys Gly 1 5 10 15 Asp Thr Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Ser Gly Gln Thr Phe 65 70 75 80 Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Ala 85 90 95 Val Gly Val Ser Ile Asp Cys Ser Lys Cys His Asn Gln Pro Cys Val 100 105 110 Arg Glu Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu 115 120 125 Met Ile Thr Gly Thr Pro Glu Val Thr Cys Val Val Val Asn Val Gly 130 135 140 His Asp Asn Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu 145 150 155 160 Val His Thr Ala Arg Ser Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr 165 170 175 Tyr Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Thr Gly 180 185 190 Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Gly Leu Ser Ala Pro 195 200 205 Ile Val Arg Ile Ile Ser Arg Ser Lys Gly Pro Ala Arg Glu Pro Gln 210 215 220 Val Tyr Val Leu Asp Pro Pro Lys Glu Glu Leu Ser Lys Ser Thr Leu 225 230 235 240 Ser Val Thr Cys Met Val Thr Gly Phe Tyr Pro Glu Asp Val Ala Val 245 250 255 Glu Trp Gln Arg Asn Arg Gln Thr Glu Ser Glu Asp Lys Tyr Arg Thr 260 265 270 Thr Pro Pro Gln Leu Asp Thr Asp Arg Ser Tyr Phe Leu Tyr Ser Lys 275 280 285 Leu Arg Val Asp Arg Asn Ser Trp Gln Glu Gly Asp Ala Tyr Thr Cys 290 295 300 Val Val Met His Glu Ala Leu His Asn His Tyr Met Gln Lys Ser Thr 305 310 315 320 Ser Lys Ser Ala Gly Lys 325 <210> 88 <211> 326 <212> PRT <213> <400> 88 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ser Ser Cys Cys Gly 1 5 10 15 Asp Lys Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Gly Ser Thr Ser Gly Gln Thr Phe 65 70 75 80 Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Ala 85 90 95 Val Gly Val Ser Ser Asp Cys Ser Lys Pro Asn Asn Gln His Cys Val 100 105 110 Arg Glu Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu 115 120 125 Met Ile Thr Gly Thr Pro Glu Val Thr Cys Val Val Val Asn Val Gly 130 135 140 His Asp Asn Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu 145 150 155 160 Val His Thr Ala Arg Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr 165 170 175 Tyr Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Thr Gly 180 185 190 Gly Lys Glu Phe Lys Cys Lys Val Asn Ile Lys Gly Leu Ser Ala Ser 195 200 205 Ile Val Arg Ile Ile Ser Arg Ser Lys Gly Pro Ala Arg Glu Pro Gln 210 215 220 Val Tyr Val Leu Asp Pro Pro Lys Glu Glu Leu Ser Lys Ser Thr Val 225 230 235 240 Ser Val Thr Cys Met Val Ile Gly Phe Tyr Pro Glu Asp Val Asp Val 245 250 255 Glu Trp Gln Arg Asp Arg Gln Thr Glu Ser Glu Asp Lys Tyr Arg Thr 260 265 270 Thr Pro Pro Gln Leu Asp Ala Asp Arg Ser Tyr Phe Leu Tyr Ser Lys 275 280 285 Leu Arg Val Asp Arg Asn Ser Trp Gln Arg Gly Asp Thr Tyr Thr Cys 290 295 300 Val Val Met His Glu Ala Leu His Asn His Tyr Met Gln Lys Ser Thr 305 310 315 320 Ser Lys Ser Ala Gly Lys 325 <210> 89 <211> 327 <212> PRT <213> <400> 89 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ser Ser Cys Cys Gly 1 5 10 15 Asp Lys Ser Ser Ser Gly Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Ser Gly Thr Gln Thr 65 70 75 80 Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys 85 90 95 Ala Val Gly Val Ser Ser Asp Cys Ser Lys Pro Asn Asn Gln His Cys 100 105 110 Val Arg Glu Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr 115 120 125 Leu Met Ile Thr Gly Thr Pro Glu Val Thr Cys Val Val Val Asn Val 130 135 140 Gly His Asp Asn Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val 145 150 155 160 Glu Val His Thr Ala Arg Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 165 170 175 Thr Tyr Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Thr 180 185 190 Gly Gly Lys Glu Phe Lys Cys Lys Val Asn Ile Lys Gly Leu Ser Ala 195 200 205 Ser Ile Val Arg Ile Ile Ser Arg Ser Lys Gly Pro Ala Arg Glu Pro 210 215 220 Gln Val Tyr Val Leu Asp Pro Pro Lys Glu Glu Leu Ser Lys Ser Thr 225 230 235 240 Val Ser Leu Thr Cys Met Val Ile Gly Phe Tyr Pro Glu Asp Val Asp 245 250 255 Val Glu Trp Gln Arg Asp Arg Gln Thr Glu Ser Glu Asp Lys Tyr Arg 260 265 270 Thr Thr Pro Pro Gln Leu Asp Ala Asp Arg Ser Tyr Phe Leu Tyr Ser 275 280 285 Lys Leu Arg Val Asp Arg Asn Ser Trp Gln Arg Gly Asp Thr Tyr Thr 290 295 300 Cys Val Val Met His Glu Ala Leu His Asn His Tyr Met Gln Lys Ser 305 310 315 320 Thr Ser Lys Ser Ala Gly Lys 325 <210> 90 <211> 352 <212> PRT <213> <400> 90 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ala Ser Ser Cys Gly 1 5 10 15 Asp Thr Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Arg Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Ser Ser Glu Thr Gln Thr 65 70 75 80 Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys 85 90 95 Ala Val Thr Ala Arg Arg Pro Val Pro Thr Thr Pro Lys Thr Thr Ile 100 105 110 Pro Pro Gly Lys Pro Thr Thr Pro Lys Ser Glu Val Glu Lys Thr Pro 115 120 125 Cys Gln Cys Ser Lys Cys Pro Glu Pro Leu Gly Gly Leu Ser Val Phe 130 135 140 Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Thr Ile Ser Gly Thr Pro 145 150 155 160 Glu Val Thr Cys Val Val Val Asp Val Gly Gln Asp Asp Pro Glu Val 165 170 175 Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Arg Thr 180 185 190 Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Ala 195 200 205 Leu Arg Ile Gln His Gln Asp Trp Leu Gln Gly Lys Glu Phe Lys Cys 210 215 220 Lys Val Asn Asn Lys Gly Leu Pro Ala Pro Ile Val Arg Thr Ile Ser 225 230 235 240 Arg Thr Lys Gly Gln Ala Arg Glu Pro Gln Val Tyr Val Leu Ala Pro 245 250 255 Pro Arg Glu Glu Leu Ser Lys Ser Thr Leu Ser Leu Thr Cys Leu Ile 260 265 270 Thr Gly Phe Tyr Pro Glu Glu Ile Asp Val Glu Trp Gln Arg Asn Gly 275 280 285 Gln Pro Glu Ser Glu Asp Lys Tyr His Thr Thr Ala Pro Gln Leu Asp 290 295 300 Ala Asp Gly Ser Tyr Phe Leu Tyr Ser Lys Leu Arg Val Asn Lys Ser 305 310 315 320 Ser Trp Gln Glu Gly Asp His Tyr Thr Cys Ala Val Met His Glu Ala 325 330 335 Leu Arg Asn His Tyr Lys Glu Lys Ser Ile Ser Arg Ser Pro Gly Lys 340 345 350 <210> 91 <211> 352 <212> PRT <213> <400> 91 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ala Ser Arg Cys Gly 1 5 10 15 Asp Thr Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Ala Ser Thr Ser Glu Thr Gln Thr 65 70 75 80 Phe Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys 85 90 95 Ala Val Thr Ala Arg Arg Pro Val Pro Thr Thr Pro Lys Thr Thr Ile 100 105 110 Pro Pro Gly Lys Pro Thr Thr Gln Glu Ser Glu Val Glu Lys Thr Pro 115 120 125 Cys Gln Cys Ser Lys Cys Pro Glu Pro Leu Gly Gly Leu Ser Val Phe 130 135 140 Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Thr Ile Ser Gly Thr Pro 145 150 155 160 Glu Val Thr Cys Val Val Val Asp Val Gly Gln Asp Asp Pro Glu Val 165 170 175 Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val His Thr Ala Arg Thr 180 185 190 Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Ala 195 200 205 Leu Arg Ile Gln His Gln Asp Trp Leu Gln Gly Lys Glu Phe Lys Cys 210 215 220 Lys Val Asn Asn Lys Gly Leu Pro Ala Pro Ile Val Arg Thr Ile Ser 225 230 235 240 Arg Thr Lys Gly Gln Ala Arg Glu Pro Gln Val Tyr Val Leu Ala Pro 245 250 255 Pro Arg Glu Glu Leu Ser Lys Ser Thr Leu Ser Leu Thr Cys Leu Ile 260 265 270 Thr Gly Phe Tyr Pro Glu Glu Ile Asp Val Glu Trp Gln Arg Asn Gly 275 280 285 Gln Pro Glu Ser Glu Asp Lys Tyr His Thr Thr Ala Pro Gln Leu Asp 290 295 300 Ala Asp Gly Ser Tyr Phe Leu Tyr Ser Arg Leu Arg Val Asn Lys Ser 305 310 315 320 Ser Trp Gln Glu Gly Asp His Tyr Thr Cys Ala Val Met His Glu Ala 325 330 335 Leu Arg Asn His Tyr Lys Glu Lys Ser Ile Ser Arg Ser Pro Gly Lys 340 345 350 <210> 92 <211> 990 <212> DNA <213> <400> 92 gcctccacca cagccccgaa agtctaccct ctgagttctt gctgcgggga caagtccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggctgtcct tcagtcctcc 180 gggctgtact ctctcagcag catggtgacc gtgcccggca gcacctcagg acagaccttc 240 acctgcaacg tagcccaccc ggccagcagc accaaggtgg acaaggctgt tgatccccaca 300 tgcaaaccat caccctgtga ctgttgccca ccccctgagc tccccggagg accctctgtc 360 ttcatcttcc caccgaaacc caaggacacc ctcacaatct cgggaacgcc cgaggtcacg 420 tgtgtggtgg tggacgtggg ccacgatgac cccgaggtga agttctcctg gttcgtggac 480 gacgtggagg taaacacagc cacgacgaag ccgagagagg agcagttcaa cagcacctac 540 cgcgtggtca gcgccctgcg catccagcac caggactgga ctggaggaaa ggaggttcaag 600 tgcaaggtcc acaacgaagg ccctcccggcc cccatcgtga ggaccatctc caggaccaaa 660 gggccggccc gggagccgca ggtgtatgtc ctggccccac cccaggaaga gctcagcaaa 720 agcacggtca gcctcacctg catggtcacc agcttctacc cagactacat cgccgtggag 780 tggcagagaa acgggcagcc tgagtcggag gacaagtacg gcacgacccc gccccagctg 840 gacgccgaca gctcctactt cctgtacagc aagctcaggg tggacaggaa cagctggcag 900 gaaggagaca cctacacgtg tgtggtgatg cacgaggccc tgcacaatca ctacacgcag 960 aagtccacct ctaagtctgc gggtaaatga 990 <210> 93 <211> 990 <212> DNA <213> <400> 93 gcctccacca cagccccgaa agtctaccct ctgagttctt gctgcgggga caagtccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggccgtcct tcagtcctcc 180 gggctgtact ctctcagcag catggtgacc gtgcccggca gcacctcagg acagaccttc 240 acctgcaacg tagcccaccc ggccagcagc accaaggtgg acaaggctgt tgatccccaca 300 tgcaaaccat caccctgtga ctgttgccca ccccctgagc tccccggagg accctctgtc 360 ttcatcttcc caccgaaacc caaggacacc ctcacaatct cgggaacgcc cgaggtcacg 420 tgtgtggtgg tggacgtggg ccacgatgac cccgaggtga agttctcctg gttcgtggac 480 gacgtggagg taaacacagc cacgacgaag ccgagagagg agcagttcaa cagcacctac 540 cgcgtggtca gcgccctgcg catccagcac caggactgga ctggaggaaa ggaggttcaag 600 tgcaaggtcc acaacgaagg ccctcccggcc cccatcgtga ggaccatctc caggaccaaa 660 gggccggccc gggagccgca ggtgtatgtc ctggccccac cccaggaaga gctcagcaaa 720 agcacggtca gcctcacctg catggtcacc agcttctacc cagactacat cgccgtggag 780 tggcagagaa acgggcagcc tgagtcggag gacaagtacg gcacgacccc gccccagctg 840 gacgccgaca gctcctactt cctgtacagc aagctcaggg tggacaggaa cagctggcag 900 gaaggagaca cctacacgtg tgtggtgatg cacgaggccc tgcacaatca ctacacgcag 960 aagtccacct ctaagtctgc gggtaaatga 990 <210> 94 <211> 990 <212> DNA <213> <400> 94 gcctccacca cagccccgaa agtctaccct ctgagttctt gctgcgggga caagtccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggccgtcct tcagtcctcc 180 gggctctact ctctcagcag catggtgacc gtgcccggca gcacctcagg aacccagacc 240 ttcacctgca acgtagccca cccggccagc agcaccaagg tggacaaggc tgttgatccc 300 agatgcaaaa caacctgtga ctgttgccca ccgcctgagc tccctggagg accctctgtc 360 ttcatcttcc caccgaaacc caaggacacc ctcacaatct cgggaacgcc cgaggtcacg 420 tgtgtggtgg tggacgtggg ccacgatgac cccgaggtga agttctcctg gttcgtggac 480 gacgtggagg taaacacagc cacgacgaag ccgagagagg agcagttcaa cagcacctac 540 cgcgtggtca gcgccctgcg catccagcac caggactgga ctggaggaaa ggaggttcaag 600 tgcaaggtcc acaacgaagg cctcccagcc cccatcgtga ggaccatctc caggaccaaa 660 gggccggccc gggagccgca ggtgtatgtc ctggccccac cccaggaaga gctcagcaaa 720 agcacggtca gcctcacctg catggtcacc agcttctacc cagactacat cgccgtggag 780 tggcagagaa atgggcagcc tgagtcagag gacaagtacg gcacgacccc tccccagctg 840 gacgccgacg gctcctactt cctgtacagc aggctcaggg tggacaggaa cagctggcag 900 gaaggagaca cctacacgtg tgtggtgatg cacgaggccc tgcacaatca ctacacgcag 960 aagtccacct ctaagtctgc gggtaaatga 990 <210> 95 <211> 981 <212> DNA <213> <400> 95 gcctccacca cagccccgaa agtctaccct ctggcatcca gctgcggaga cacatccagc 60 tccaccgtga ccctgggctg cctggtgtcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggctgtcct tcagtcctcc 180 gggctctact ctctcagcag catggtgacc gtgcccgcca gcagctcagg acagaccttc 240 acctgcaacg tagcccaccc ggccagcagc accaaggtgg acaaggctgt tggggtctcc 300 attgactgct ccaagtgtca taaccagcct tgcgtgaggg aaccatctgt cttcatcttc 360 ccaccgaaac ccaaagacac cctgatgatc acaggaacgc ccgaggtcac gtgtgtggtg 420 gtgaacgtgg gccacgataa ccccgaggtg cagttctcct ggttcgtgga tgacgtggag 480 gtgcacacgg ccaggtcgaa gccaagagag gagcagttca acagcacgta ccgcgtggtc 540 agcgccctgc ccatccagca ccaggactgg actggaggaa aggagttcaa gtgcaaggtc 600 aacaacaaag gcctctcggc ccccatcgtg aggatcatct ccaggagcaa agggccggcc 660 cgggagccgc aggtgtatgt cctggaccca cccaaggaag agctcagcaa aagcacgctc 720 agcgtcacct gcatggtcac cggcttctac ccagaagatg tagccgtgga gtggcagaga 780 aaccggcaga ctgagtcgga ggacaagtac cgcacgaccc cgccccagct ggacaccgac 840 cgctcctact tcctgtacag caagctcagg gtggacagga acagctggca ggaaggagac 900 gcctacacgt gtgtggtgat gcacgaggcc ctgcacaatc actacatgca gaagtccacc 960 tctaagtctg cgggtaaatg a 981 <210> 96 <211> 981 <212> DNA <213> <400> 96 gcctccacca cagccccgaa agtctaccct ctgagttctt gctgcgggga caagtccagc 60 tccaccgtga ccctgggctg cctggtgtcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggccgtcct tcagtcctcc 180 gggctctact ctctcagcag catggtgacc gtgcccggca gcacctcagg acagaccttc 240 acctgcaacg tagcccaccc ggccagcagc accaaggtgg acaaggctgt tggggtctcc 300 agtgactgct ccaagcctaa taaccagcat tgcgtgaggg aaccatctgt cttcatcttc 360 ccaccgaaac ccaaagacac cctgatgatc acaggaacgc ccgaggtcac gtgtgtggtg 420 gtgaacgtgg gccacgataa ccccgaggtg cagttctcct ggttcgtgga cgacgtggag 480 gtgcacacgg ccaggacgaa gccgagagag gagcagttca acagcacgta ccgcgtggtc 540 agcgccctgc ccatccagca ccaggactgg actggaggaa aggagttcaa gtgcaaggtc 600 aacatcaaag gcctctcggc ctccatcgtg aggatcatct ccaggagcaa agggccggcc 660 cgggagccgc aggtgtatgt cctggaccca cccaaggaag agctcagcaa aagcacggtc 720 agcgtcacct gcatggtcat cggcttctac ccagaagatg tagacgtgga gtggcagaga 780 gaccggcaga ctgagtcgga ggacaagtac cgcacgaccc cgccccagct ggacgccgac 840 cgctcctact tcctgtacag caagctcagg gtggacagga acagctggca gagaggagac 900 acctacacgt gtgtggtgat gcacgaggcc ctgcacaatc actacatgca gaagtccacc 960 tctaagtctg cgggtaaatg a 981 <210> 97 <211> 984 <212> DNA <213> <400> 97 gcctccacca cagccccgaa agtctaccct ctgagttctt gctgcgggga caagtccagc 60 tcgggggtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggccgtcct tcagtcctcc 180 gggctctact ctctcagcag catggtgacc gtgcccgcca gcagctcagg aacccagacc 240 ttcacctgca acgtagccca cccggccagc agcaccaagg tggacaaggc tgttggggtc 300 tccagtgact gctccaagcc taataaccag cattgcgtga gggaaccatc tgtcttcatc 360 ttcccaccga aacccaaaga caccctgatg atcacaggaa cgcccgaggt cacgtgtgtg 420 gtggtgaacg tgggccacga taaccccgag gtgcagttct cctggttcgt ggacgacgtg 480 gaggtgcaca cggccaggac gaagccgaga gaggagcagt tcaacagcac gtaccgcgtg 540 gtcagcgccc tgcccatcca gcaccaggac tggactggag gaaaggagtt caagtgcaag 600 gtcaacatca aaggcctctc ggcctccatc gtgaggatca tctccaggag caaagggccg 660 gcccgggagc cgcaggtgta tgtcctggac ccacccaagg aagagctcag caaaagcacg 720 gtcagcctca cctgcatggt catcggcttc tacccagaag atgtagacgt ggagtggcag 780 agagaccggc agactgagtc ggaggacaag taccgcacga ccccgcccca gctggacgcc 840 gaccgctcct acttcctgta cagcaagctc agggtggaca ggaacagctg gcagagagga 900 gacactaca cgtgtgtggt gatgcacgag gccctgcaca atcactacat gcagaagtcc 960 acctctaagt ctgcgggtaa atga 984 <210> 98 <211> 1059 <212> DNA <213> <400> 98 gcctccacca cagccccgaa agtctaccct ctggcatcca gctgcggaga cacatccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagcggcgtg cacaccttcc cggccgtccg gcagtcctct 180 gggctgtact ctctcagcag catggtgact gtgcccgcca gcagctcaga aacccagacc 240 ttcacctgca acgtagccca cccggccagc agcaccaagg tggacaaggc tgtcactgca 300 aggcgtccag tcccgacgac gccaaagaca actatccctc ctggaaaacc cacaacccca 360 aagtctgaag ttgaaaagac accctgccag tgttccaaat gcccagaacc tctgggagga 420 ctgtctgtct tcatcttccc accgaaaccc aaggacaccc tcacaatctc gggaacgccc 480 gaggtcacgt gtgtggtggt ggacgtgggc caggatgacc ccgaggtgca gttctcctgg 540 ttcgtggacg acgtggaggt gcacacggcc aggacgaagc cgagagagga gcagttcaac 600 agcacctacc gcgtggtcag cgccctgcgc atccagcacc aggactggct gcagggaaag 660 gagttcaagt gcaaggtcaa caacaaaggc ctcccggccc ccattgtgag gaccatctcc 720 aggaccaaag ggcaggcccg ggagccgcag gtgtatgtcc tggccccacc ccgggaagag 780 ctcagcaaaa gcacgctcag cctcacctgc ctgatcaccg gtttctaccc agaagagata 840 gacgtggagt ggcagagaaa tgggcagcct gagtcggagg acaagtacca cacgaccgca 900 ccccagctgg atgctgacgg ctcctacttc ctgtacagca agctcagggt gaacaagagc 960 agctggcagg aaggagacca ctacacgtgt gcagtgatgc acgaagcttt acggaatcac 1020 tacaaagaga agtccatctc gaggtctccg ggtaaatga 1059 <210> 99 <211> 1059 <212> DNA <213> <400> 99 gcctccacca cagccccgaa agtctaccct ctggcatccc gctgcggaga cacatccagc 60 tccaccgtga ccctgggctg cctggtctcc agctacatgc ccgagccggt gaccgtgacc 120 tggaactcgg gtgccctgaa gagtggcgtg cacaccttcc cggccgtcct tcagtcctcc 180 gggctgtact ctctcagcag catggtgacc gtgcccgcca gcacctcaga aacccagacc 240 ttcacctgca acgtagccca cccggccagc agcaccaagg tggacaaggc tgtcactgca 300 aggcgtccag tcccgacgac gccaaagaca accatccctc ctggaaaacc cacaacccag 360 gagtctgaag ttgaaaagac accctgccag tgttccaaat gcccagaacc tctgggagga 420 ctgtctgtct tcatcttccc accgaaaccc aaggacaccc tcacaatctc gggaacgccc 480 gaggtcacgt gtgtggtggt ggacgtgggc caggatgacc ccgaggtgca gttctcctgg 540 ttcgtggacg acgtggaggt gcacacggcc aggacgaagc cgagagagga gcagttcaac 600 agcacctacc gcgtggtcag cgccctgcgc atccagcacc aggactggct gcagggaaag 660 gagttcaagt gcaaggtcaa caacaaaggc ctcccggccc ccattgtgag gaccatctcc 720 aggaccaaag ggcaggcccg ggagccgcag gtgtatgtcc tggccccacc ccgggaagag 780 ctcagcaaaa gcacgctcag cctcacctgc ctgatcaccg gtttctaccc agaagagata 840 gacgtggagt ggcagagaaa tgggcagcct gagtcggagg acaagtacca cacgaccgca 900 ccccagctgg atgctgacgg ctcctacttc ctgtacagca ggctcagggt gaacaagagc 960 agctggcagg aaggagacca ctacacgtgt gcagtgatgc atgaagcttt acggaatcac 1020 tacaaagaga agtccatctc gaggtctccg ggtaaatga 1059 <210> 100 <211> 105 <212> PRT <213> <400> 100 Gln Pro Lys Ser Pro Pro Ser Val Thr Leu Phe Pro Pro Ser Thr Glu 1 5 10 15 Glu Leu Asn Gly Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe 20 25 30 Tyr Pro Gly Ser Val Thr Val Val Val Trp Lys Ala Asp Gly Ser Thr Ile 35 40 45 Thr Arg Asn Val Glu Thr Thr Arg Ala Ser Lys Gln Ser Asn Ser Lys 50 55 60 Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Ser Ser Asp Trp Lys Ser 65 70 75 80 Lys Gly Ser Tyr Ser Cys Glu Val Thr His Glu Gly Ser Thr Val Thr 85 90 95 Lys Thr Val Lys Pro Ser Glu Cys Ser 100 105 <210> 101 <211> 318 <212> DNA <213> <400> 101 cagcccaagt ccccaccctc ggtcaccctg ttcccgccct ccacggagga gctcaacggc 60 aacaaggcca ccctggtgtg tctcatcagc gacttctacc cgggtagcgt gaccgtggtc 120 tggaaggcag acggcagcac catcacccgc aacgtggaga ccacccgggc ctccaaacag 180 agcaacagca agtacgcggc cagcagctac ctgagcctga cgagcagcga ctggaaatcg 240 aaaggcagtt acagctgcga ggtcacgcac gaggggagca ccgtgacgaa gacagtgaag 300 ccctcagagt gttcttag 318 <210> 102 <211> 328 <212> PRT <213> <400> 102 Ala Ser Thr Thr Ala Pro Lys Val Tyr Pro Leu Ser Ser Cys Cys Gly 1 5 10 15 Asp Lys Ser Ser Ser Thr Val Thr Leu Gly Cys Leu Val Ser Ser Tyr 20 25 30 Met Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ala Leu Lys Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Met Val Thr Val Pro Gly Ser Thr Ser Gly Gln Thr Phe 65 70 75 80 Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Ala 85 90 95 Val Asp Pro Thr Cys Lys Pro Ser Pro Cys Asp Cys Cys Pro Pro Pro 100 105 110 Pro Val Ala Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp 115 120 125 Thr Leu Thr Ile Ser Gly Thr Pro Glu Val Thr Cys Val Val Val Asp 130 135 140 Val Gly His Asp Asp Pro Glu Val Lys Phe Ser Trp Phe Val Asp Asp 145 150 155 160 Val Glu Val Asn Thr Ala Thr Thr Lys Pro Arg Glu Glu Gln Phe Asn 165 170 175 Ser Thr Tyr Arg Val Val Ser Ala Leu Arg Ile Gln His Gln Asp Trp 180 185 190 Thr Gly Gly Lys Glu Phe Lys Cys Lys Val His Asn Glu Gly Leu Pro 195 200 205 Ser Ser Ile Val Arg Thr Ile Ser Arg Thr Lys Gly Pro Ala Arg Glu 210 215 220 Pro Gln Val Tyr Val Leu Ala Pro Pro Gln Glu Glu Leu Ser Lys Ser 225 230 235 240 Thr Val Ser Leu Thr Cys Met Val Thr Ser Phe Tyr Pro Asp Tyr Ile 245 250 255 Ala Val Glu Trp Gln Arg Asn Gly Gln Pro Glu Ser Glu Asp Lys Tyr 260 265 270 Gly Thr Thr Pro Pro Gln Leu Asp Ala Asp Ser Ser Tyr Phe Leu Tyr 275 280 285 Ser Lys Leu Arg Val Asp Arg Asn Ser Trp Gln Glu Gly Asp Thr Tyr 290 295 300 Thr Cys Val Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 305 310 315 320 Ser Thr Ser Lys Ser Ala Gly Lys 325 <210> 103 <211> 987 <212> DNA <213> <400> 103 gctagcacaa ctgctcctaa ggtgtacccc ctgagctctt gctgcggcga caagtctagc 60 agcaccgtga ccctcggatg cctcgtcagc agctatatgc ctgagccagt tacagtgaca 120 tggaattctg gtgcccttaa gtccggcgtc cataccttcc ctgctgtgct gcagtcctct 180 ggcctgtaca gtttgtcctc tatggtgaca gtacccggtt ccacctccgg acagaccttt 240 acctgtaatg tggctcatcc cgcctcctcc acaaaggtgg ataaggctgt tgaccctacc 300 tgtaaaccca gtccatgcga ctgctgtccc ccccctccag ttgccggacc ctcagtcttt 360 attttcccac ccaaacccaa agacaccctg acaatctctg gaacaccaga agtcacctgc 420 gtcgtcgtgg atgtgggcca cgacgatcct gaggtaaaat tctcatggtt cgtcgacgat 480 gtgggaagtga atacagctac tacaaaacct cgcgaagagc agtttaactc tacctatcga 540 gtggtttctg ctttgcggat tcagcatcag gattggacag gcggcaaaga gtttaaatgt 600 aaagtccata acgagggact tccttctagt atcgtgcgca ctatcagtag aactaaaggg 660 cctgctcggg aacctcaggt gtacgtcctg gcacctccac aggaagagct gagtaagtct 720 acagtttctc tgacttgtat ggtaacatct ttttatccag attacatcgc agttgaatgg 780 cagaggaacg ggcagccaga gagtgaggat aagtacggga ctactccacc acagctggac 840 gcagactcaa gttacttcct gtactcaaag ctgagggttg acagaaactc atggcaggag 900 ggggacactt acacttgcgt agttatgcac gaggcacttc acaaccacta cactcagaag 960 agtacttcaa agagtgcagg gaagtaa 987 <210> 104 <211> 318 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 104 cagcctaaga gtcctccttc tgtaacactc tttcccccct ctaccgagga actcaacggc 60 aataaagcta ccttggtttg cctatttct gatttctacc ccgggtctgt gaccgtggtg 120 tggaaagctg atgggtccac cattactcgg aatgtggaaa ccacccgggc ttctaagcag 180 tccaactcta aatacgcagc atcctcctat ttgagtctta ctagtagtga ctggaagtca 240 aagggtagtt acagttgcga agtcacacat gaaggttcaa cagtgacaaa gacagtcaag 300 ccctcagagt gctcatag 318 <210> 105 <211> 238 <212> PRT <213> artificial sequence <220> <223> chimeric L chain <400> 105 Met Glu Ser Gln Thr His Val Leu Ile Ser Leu Leu Leu Ser Val Ser 1 5 10 15 Gly Thr Tyr Gly Asp Ile Ala Ile Thr Gln Ser Pro Ser Ser Val Ala 20 25 30 Val Ser Val Gly Glu Thr Val Thr Leu Ser Cys Lys Ser Ser Gln Ser 35 40 45 Leu Leu Tyr Ser Glu Asn Gln Lys Asp Tyr Leu Gly Trp Tyr Gln Gln 50 55 60 Lys Pro Gly Gln Thr Pro Lys Pro Leu Ile Tyr Trp Ala Thr Asn Arg 65 70 75 80 His Thr Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp 85 90 95 Phe Thr Leu Ile Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Asp Tyr 100 105 110 Tyr Cys Gly Gln Tyr Leu Val Tyr Pro Phe Thr Phe Gly Pro Gly Thr 115 120 125 Lys Leu Glu Leu Lys Gln Pro Lys Ser Pro Pro Ser Val Thr Leu Phe 130 135 140 Pro Pro Ser Thr Glu Glu Leu Asn Gly Asn Lys Ala Thr Leu Val Cys 145 150 155 160 Leu Ile Ser Asp Phe Tyr Pro Gly Ser Val Thr Val Val Val Trp Lys Ala 165 170 175 Asp Gly Ser Thr Ile Thr Arg Asn Val Glu Thr Thr Arg Ala Ser Lys 180 185 190 Gln Ser Asn Ser Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Ser 195 200 205 Ser Asp Trp Lys Ser Lys Gly Ser Tyr Ser Cys Glu Val Thr His Glu 210 215 220 Gly Ser Thr Val Thr Lys Thr Val Lys Pro Ser Glu Cys Ser 225 230 235 <210> 106 <211> 465 <212> PRT <213> artificial sequence <220> <223> chimeric H chain <400> 106 Met Gly Trp Ser Gln Ile Ile Leu Phe Leu Val Ala Ala Ala Thr Cys 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys 20 25 30 Pro Gly Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Asn Phe Met His Trp Val Lys Gln Gln Pro Gly Asn Gly Leu 50 55 60 Glu Trp Ile Gly Trp Ile Tyr Pro Glu Tyr Gly Asn Thr Lys Tyr Asn 65 70 75 80 Gln Lys Phe Asp Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Phe Cys Ala Ser Glu Glu Ala Val Ile Ser Leu Val Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Thr Ala Pro Lys 130 135 140 Val Tyr Pro Leu Ser Ser Cys Cys Gly Asp Lys Ser Ser Ser Thr Val 145 150 155 160 Thr Leu Gly Cys Leu Val Ser Ser Tyr Met Pro Glu Pro Val Thr Val 165 170 175 Thr Trp Asn Ser Gly Ala Leu Lys Ser Gly Val His Thr Phe Pro Ala 180 185 190 Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Met Val Thr Val 195 200 205 Pro Gly Ser Thr Ser Gly Gln Thr Phe Thr Cys Asn Val Ala His Pro 210 215 220 Ala Ser Ser Thr Lys Val Asp Lys Ala Val Asp Pro Thr Cys Lys Pro 225 230 235 240 Ser Pro Cys Asp Cys Cys Pro Pro Pro Val Ala Gly Pro Ser Val 245 250 255 Phe Ile Phe Pro Pro Lys Pro Lys Asp Thr Leu Thr Ile Ser Gly Thr 260 265 270 Pro Glu Val Thr Cys Val Val Val Asp Val Gly His Asp Asp Pro Glu 275 280 285 Val Lys Phe Ser Trp Phe Val Asp Asp Val Glu Val Asn Thr Ala Thr 290 295 300 Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser 305 310 315 320 Ala Leu Arg Ile Gln His Gln Asp Trp Thr Gly Gly Lys Glu Phe Lys 325 330 335 Cys Lys Val His Asn Glu Gly Leu Pro Ser Ser Ile Val Arg Thr Ile 340 345 350 Ser Arg Thr Lys Gly Pro Ala Arg Glu Pro Gln Val Tyr Val Leu Ala 355 360 365 Pro Pro Gln Glu Glu Leu Ser Lys Ser Thr Val Ser Leu Thr Cys Met 370 375 380 Val Thr Ser Phe Tyr Pro Asp Tyr Ile Ala Val Glu Trp Gln Arg Asn 385 390 395 400 Gly Gln Pro Glu Ser Glu Asp Lys Tyr Gly Thr Thr Pro Pro Gln Leu 405 410 415 Asp Ala Asp Ser Ser Tyr Phe Leu Tyr Ser Lys Leu Arg Val Asp Arg 420 425 430 Asn Ser Trp Gln Glu Gly Asp Thr Tyr Thr Cys Val Val Met His Glu 435 440 445 Ala Leu His Asn His Tyr Thr Gln Lys Ser Thr Ser Lys Ser Ala Gly 450 455 460 Lys 465 <210> 107 <211> 717 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 107 atggaatctc aaactcatgt tttgatttca ttacttctga gtgtttccgg aacctacggt 60 gatatcgcta tcactcaatc tccctcctct gttgctgtgt ctgtgggcga aaccgttacc 120 ctgtcctgca agtccagtca gtctcttctc tactccgaga atcaaaagga ctacctgggc 180 tggtaccaac agaagcccgg ccagacccca aagccactga tatactgggc aaccaacagg 240 cacaccggag tgcccgacag gttcacaggc agtggatctg gcaccgactt taccttgatc 300 atttcaagcg tgcaggctga agatctggcc gactactact gtggtcagta tctggtgtat 360 cctttcactt tcgggccagg gacaaaactc gagctcaaac agcctaagag tcctccttct 420 gtaacactct ttcccccctc taccgaggaa ctcaacggca ataaagctac cttggtttgc 480 cttatttctg atttctaccc cgggtctgg accgtggtgt ggaaagctga tgggtccacc 540 attactcgga atgtggaaac cacccgggct tctaagcagt ccaactctaa atacgcagca 600 tcctcctatt tgagtcttac tagtagtgac tggaagtcaa agggtagtta cagttgcgaa 660 gtcacacatg aaggttcaac agtgacaaag acagtcaagc cctcagagtg ctcatag 717 <210> 108 <211> 1398 <212> DNA <213> artificial sequence <220> <223> codon-optimized sequence <400> 108 atggggtggt cccagattat attgttcctc gtcgccgccg ccacttgcgt acacagccaa 60 gtgcaacttc aacaaagcgg tgcagaactg gtaaagcccg gtagctctgt gaaaatatcc 120 tgtaaagcca gtggctacac atttaccagc aactttatgc actgggtgaa gcaacagccc 180 ggaaatggct tggagtggat tggctggatc tatcccgaat atggtaacac caagtataat 240 cagaagttcg acggtaaggc caccctcacc gccgataagt catcctccac cgcctatatg 300 cagctcagca gcctgaccag cgaggattcc gctgtgtact tctgtgccag cgaagaggct 360 gtgatctcat tggtgtattg gggacagggc accctcgtca ccgtgtccag cgctagcaca 420 actgctccta aggtgtaccc cctgagctct tgctgcggcg acaagtctag cagcaccgtg 480 accctcggat gcctcgtcag cagctatatg cctgagccag ttacagtgac atggaattct 540 ggtgccctta agtccggcgt ccataccttc cctgctgtgc tgcagtcctc tggcctgtac 600 agtttgtcct ctatggtgac agtacccggt tccacctccg gacagacctt tacctgtaat 660 gtggctcatc ccgcctcctc cacaaaggtg gataaggctg ttgaccctac ctgtaaaccc 720 agtccatgcg actgctgtcc cccccctcca gttgccggac cctcagtctt tattttccca 780 cccaaaccca aagacaccct gacaatctct ggaacaccag aagtcacctg cgtcgtcgtg 840 gatgtgggcc acgacgatcc tgaggtaaaa ttctcatggt tcgtcgacga tgtggaagtg 900 aatacagcta ctacaaaacc tcgcgaagag cagtttaact ctacctatcg agtggtttct 960 gctttgcgga ttcagcatca ggattggaca ggcggcaaag agtttaaatg taaagtccat 1020 aacgagggac ttccttctag tatcgtgcgc actatcagta gaactaaagg gcctgctcgg 1080 gaacctcagg tgtacgtcct ggcacctcca caggaagagc tgagtaagtc tacagtttct 1140 ctgacttgta tggtaacatc tttttatcca gattacatcg cagttgaatg gcagaggaac 1200 gggcagccag agagtgagga taagtacggg actactccac cacagctgga cgcagactca 1260 agttacttcc tgtactcaaa gctgagggtt gacagaaact catggcagga gggggacact 1320 tacacttgcg tagttatgca cgaggcactt cacaaccact acactcagaa gagtacttca 1380 aagagtgcag ggaagtaa 1398 <210> 109 <211> 25 <212> DNA <213> artificial sequence <220> <223> primer <400> 109 atgaggatat atagtgtctt aacat 25 <210> 110 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 110 ttacgtctcc tcaaaatgtg 20 <210> 111 <211> 25 <212> DNA <213> artificial sequence <220> <223> primer <400> 111 atgaggatat gtagtatctt tacat 25 <210> 112 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 112 ttacgtctcc tcaaattgtg t 21 <210> 113 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 113 atgaggatat atagtgtctt 20 <210> 114 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 114 gccactcagg acttggtgat 20 <210> 115 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 115 gggggtttac tgttgcttga 20 <210> 116 <211> 19 <212> DNA <213> artificial sequence <220> <223> primer <400> 116 ttacgtctcc tcaaattgt 19 <210> 117 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 117 gaagatctat ggggaccccg cgggcgccg 29 <210> 118 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 118 gacccgggga ggggccagga gcagtgtcc 29 <210> 119 <211> 28 <212> DNA <213> artificial sequence <220> <223> primer <400> 119 ccgctcgaga tgaggatata tagtgtct 28 <210> 120 <211> 28 <212> DNA <213> artificial sequence <220> <223> primer <400> 120 atcccgggcg tctcctcaaa atgtgtag 28 <210> 121 <211> 25 <212> DNA <213> artificial sequence <220> <223> primer <400> 121 actaagctta tggggacccc gcggg 25 <210> 122 <211> 26 <212> DNA <213> artificial sequence <220> <223> primer <400> 122 actcccgggg aggggccaag agcagt 26 <210> 123 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 123 ccgctcgaga tgaggatatg tagtatctt 29 <210> 124 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 124 atcccgggcg tctcctcaaa ttgtgtatc 29 <210> 125 <211> 28 <212> DNA <213> artificial sequence <220> <223> primer <400> 125 gacgctagca tgaggatata tagtgtct 28 <210> 126 <211> 28 <212> DNA <213> artificial sequence <220> <223> primer <400> 126 gctctgatat ccctcgtttt tgctggat 28 <210> 127 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 127 gacgctagca tgaggatatg tagtatctt 29 <210> 128 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 128 agcttgatat ccctctttct tgctggatc 29 <210> 129 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 129 cgcggatatc atggattaca cagcgaagtg 30 <210> 130 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 130 cggggtaccc cagagctgtt gctggttat 29 <210> 131 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 131 cgcggctagc atgagaatgt ttagtgtctt 30 <210> 132 <211> 49 <212> DNA <213> artificial sequence <220> <223> primer <400> 132 cgcggatatc ttaatggtga tggtgatggt gagtcctctc acttgctgg 49 <210> 133 <211> 32 <212> DNA <213> artificial sequence <220> <223> primer <400> 133 atatgcggcc gcatggggac cccgcgggcg ct 32 <210> 134 <211> 30 <212> DNA <213> artificial sequence <220> <223> primer <400> 134 gcgcaagctt tcagaggggc caggagcagt 30 <210> 135 <211> 35 <212> DNA <213> artificial sequence <220> <223> primer <400> 135 ctagctagca ccatgaggat atatagtgtc ttaac 35 <210> 136 <211> 31 <212> DNA <213> artificial sequence <220> <223> primer <400> 136 caatctcgag ttacagacag aagatgactg c 31 <210> 137 <211> 29 <212> DNA <213> artificial sequence <220> <223> primer <400> 137 gctagcatga ggadatatag tgtcttaac 29 <210> 138 <211> 26 <212> DNA <213> artificial sequence <220> <223> primer <400> 138 gatatcattc ctcttttttg ctggat 26

Claims (23)

(a) an L chain variable region comprising CDR1 consisting of the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 consisting of the amino acid sequence of WAT, and CDR3 consisting of the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and an animal antibody other than rat L chain having an L chain constant region of (b) CDR1 consisting of the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 consisting of the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41) It comprises an H chain having an H chain variable region comprising a CDR3 comprising a CDR3 and an H chain constant region of an antibody of an animal other than a rat, wherein the L chain variable region and the H chain variable region are derived from a rat, and the animal other than a rat is a cow or Personal, anti-PD-L1 antibody. delete According to claim 1,
An anti-PD-L1 antibody, wherein the L chain variable region is the L chain variable region of a rat antigen PD-L1 antibody, and the H chain variable region is the H chain variable region of a rat antigen PD-L1 antibody. According to claim 3,
An anti-PD-L1 antibody wherein the L chain variable region has the amino acid sequence of SEQ ID NO: 1 and the H chain variable region has the amino acid sequence of SEQ ID NO: 2. According to claim 1,
An anti-PD-L1 antibody wherein the L chain constant region of an animal antibody other than rat has the amino acid sequence of a Lambda chain or Kappa chain constant region. According to claim 1,
An anti-PD-L1 antibody, wherein the animal other than a rat is a dog, and the H chain constant region of the dog antibody has the amino acid sequence of a dog IgG-D constant region. According to claim 1,
An anti-PD-L1 antibody wherein the animal other than a rat is a cow, and the H chain constant region of the bovine antibody has the amino acid sequence of SEQ ID NO: 102. According to claim 6,
An anti-PD-L1 antibody wherein the L chain constant region of the canine antibody has the amino acid sequence of a Lambda chain constant region. According to claim 7,
An anti-PD-L1 antibody wherein the L chain constant region of the bovine antibody has the amino acid sequence of the Lambda chain constant region. According to claim 8,
An anti-PD-L1 antibody wherein the L chain constant region of the canine antibody has the amino acid sequence of SEQ ID NO: 3, and the H chain constant region of the canine antibody has the amino acid sequence of SEQ ID NO: 4. According to claim 9,
An anti-PD-L1 antibody wherein the L chain constant region of the bovine antibody has the amino acid sequence of SEQ ID NO: 100. According to claim 1,
An anti-PD-L1 antibody having a four-chain structure of two L chains and two H chains. At least one preventive, therapeutic, or A pharmaceutical composition for prevention and treatment. delete delete (a') L chain variable region comprising CDR1 consisting of the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 consisting of the amino acid sequence of WAT, and CDR3 consisting of the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and animals other than rats DNA encoding the L chain having an L chain constant region of an antibody, (b') CDR1 consisting of the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 consisting of the amino acid sequence of IYPEYGNT (SEQ ID NO: 40) and ASEEAVISLVY (SEQ ID NO: 39) 41) comprising a DNA encoding an H chain having an H chain variable region comprising a CDR3 consisting of the amino acid sequence and an H chain constant region of an animal antibody other than a rat, wherein the L chain variable region and the H chain variable region are origin, and animals other than rats are cows or individuals, artificial genetic DNA. A vector comprising the artificial gene DNA according to claim 16. A host cell line transformed with the vector according to claim 17. A method for producing an antibody comprising culturing the host cell line according to claim 18 and collecting an anti-PD-L1 antibody from the culture. An L chain variable region comprising CDR1 composed of the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 composed of the amino acid sequence of WAT, and CDR3 composed of the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and the L chain of an animal antibody other than rat DNA encoding the L chain having a constant region, CDR1 consisting of the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 consisting of the amino acid sequence of IYPEYGNT (SEQ ID NO: 40), and CDR3 consisting of the amino acid sequence of ASEEAVISLVY (SEQ ID NO: 41) A composition for the production of an anti-PD-L1 antibody in vitro, comprising DNA encoding an H chain having an H chain variable region comprising an H chain constant region and an H chain constant region of an animal antibody other than rat, A composition in which the L chain variable region and the H chain variable region are derived from a rat, and the animal other than the rat is a cow or individual. An L chain variable region comprising CDR1 composed of the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 composed of the amino acid sequence of WAT, and CDR3 composed of the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and the L chain of an animal antibody other than rat A vector containing DNA encoding the L chain having a constant region, CDR1 consisting of the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 consisting of the amino acid sequence of IYPEYGNT (SEQ ID NO: 40), and amino acids of ASEEAVISLVY (SEQ ID NO: 41) Anti-PD-L1 in vitro containing a vector into which DNA encoding the H chain having an H chain variable region comprising CDR3 consisting of the sequence and an H chain constant region of an animal antibody other than rat was incorporated A composition for producing an antibody, wherein the L chain variable region and the H chain variable region are derived from a rat, and the animal other than the rat is a cow or an individual. An L chain variable region comprising CDR1 composed of the amino acid sequence of QSLLYSENQKDY (SEQ ID NO: 37), CDR2 composed of the amino acid sequence of WAT, and CDR3 composed of the amino acid sequence of GQYLVYPFT (SEQ ID NO: 38), and the L chain of an animal antibody other than rat A vector containing DNA encoding the L chain having a constant region, CDR1 consisting of the amino acid sequence of GYTFTSNF (SEQ ID NO: 39), CDR2 consisting of the amino acid sequence of IYPEYGNT (SEQ ID NO: 40), and amino acids of ASEEAVISLVY (SEQ ID NO: 41) A host cell line transformed with a vector incorporating a DNA encoding an H chain having an H chain variable region comprising CDR3 consisting of the sequence and an H chain constant region of an animal antibody other than rat, comprising: an L chain variable region and an H chain; A host cell line in which the variable region is derived from a rat and the non-rat animal is a bovine or individual. A method for producing an antibody comprising culturing the host cell line of claim 22 and collecting an anti-PD-L1 antibody from the culture.

Images