KR102554781B1 - Improved process for production of fucosylated oligosaccharides - Google Patents

Abstract

The present invention relates to methods for producing fucosylated oligosaccharides by using recombinant prokaryotic host cells cultured on gluconeogenic substrates, as well as host cells and uses thereof. The host cell is genetically modified so that the activity of fructose-6-phosphate converting enzyme is removed or reduced, and the transport of the fucosylated oligosaccharide produced through the cell membrane is facilitated by an exogenous transport protein.

Description

Improved process for production of fucosylated oligosaccharides

The present invention relates to a method for producing fucosylated oligosaccharides using genetically modified prokaryotic host cells, as well as the host cells used in the method and their use for producing fucosylated oligosaccharides at high titers.

Human milk represents a complex mixture of carbohydrates, fats, proteins, vitamins, minerals and trace elements. By far the most dominant fraction is represented by carbohydrates, which can be further divided into lactose and more complex oligosaccharides (human milk oligosaccharides, HMOs). While lactose is used as an energy source, complex oligosaccharides are not metabolized by infants. The fraction of complex oligosaccharides is the total carbohydrate fraction of It accounts for less than 20% and is composed of more than 200 different oligosaccharides. The generation and concentration of these complex oligosaccharides is specific to humans and thus cannot be found in large amounts in the milk of other mammals.

Approximately 200 structurally-diverse HMOs have been identified so far and many beneficial properties have been reported. Although HMOs are not digested by breastfed infants, they represent a useful source of carbon and energy for beneficial bacteria of the genera Bifidobacteria , Lactobacillus and Bacteroides in the intestine, Allowing them to dominate the digestive tract and allowing them to outrun pathogens, thereby preventing infection of the intestinal epithelium. However, HMOs also bind directly to pathogenic bacteria, protozoa and viruses, blocking pathogen-host interactions by mimicking glycan cell surface receptors, thereby protecting breastfed children from infectious diseases.

The most important oligosaccharide is 2'-fucosyllactose. Additional important HMOs present in human milk are 3-fucosyllactose , lacto - N -tetraose, lacto- N - neo tetraose and lacto- N -tetraose. It is lacto- N -fucopentaose. In addition to these neutral oligosaccharides, also acidic HMOs such as 3'-sialyllactose, 6-sialyllactose and sialyllacto-N-tetraose a, b, and c, or sialyllacto-N-fuke HMOs such as Pentaose II can be found in human milk. These structures are closely related to epitopes of epithelial cell surface glycoconjugates and Lewis histoblood group antigens , and the structural homology of HMOs to epithelial epitopes may have protective properties against bacterial pathogens. cause

Because of their beneficial properties, HMOs are favored for inclusion as ingredients in infant formula and other food products, necessitating the production of HMOs in large quantities, even on a multi-ton scale.

Due to the limited supply and difficulty in obtaining pure fractions of individual human milk oligosaccharides, chemical routes to some of these complex molecules have been developed. However, chemical and biocatalytic approaches have proven to be commercially unsustainable, as well as the chemical synthetic route, especially to human milk oligosaccharides, which entails several toxic chemicals, which can contaminate the final product. impose

Due to the challenges involved in the chemical synthesis of human milk oligosaccharides, several enzymatic methods and fermentative approaches have been developed. Today, mainly using genetically engineered bacterial strains, such as recombinant Escherichia coli, several HMOs, such as 2'-fucosyllactose, 3-fucosyllactose, lacto- N -tetraose, lactose - A fermentative approach has been developed for N -neotetraose, lacto- N -fucopentaose I, lacto- N -difucohexaose II, 3'-sialyllactose and 6'-sialyllactose.

However, even the most efficient processes available today, even based on bacterial fermentation, do not or rarely achieve HMO titers greater than 20 g/L in culture broth. Industrial-scale processes typically must exceed titers of 50 g/L, although 100 g/L is more preferred.

Accordingly, an object of the present invention is to provide an improved fermentation process, which enables the biosynthesis of fucosylated oligosaccharides, in particular 2'-fucosyllactose, at titers exceeding 100 g/L or more. is to provide

Summary of Invention

These and other objects are solved by a method for producing fucosylated oligosaccharides using a genetically modified prokaryotic host cell, the method comprising:

- at least (i) the activity of fructose-6-phosphate-converting enzyme at a constant level in the unmodified host cell is reduced or abolished; (ii) at least one gene encoding an enzyme required for de novo synthesis of GDP-fucose is overexpressed in the host cell; (iii) an exogenous gene encoding a fucosyltransferase, preferably an alpha-1,2-fucosyltransferase and/or an alpha-1,3-fucosyltransferase, is expressed in the host cell, preferably providing a host cell that has been genetically modified to overexpress;

- said genetically modified host cell in a culture medium containing a carbon and energy source selected from at least one of glucose, sucrose, glycerol, succinate, citrate, pyruvate, malate, lactate, or ethanol culturing; and

- providing lactose to the culture medium with lactose.

In the next step, the fucosylated oligosaccharide thus produced can be recovered or obtained from the medium in which the host cells are cultured.

The steps of growing and culturing the genetically modified host cell and adding lactose to the culture medium include first culturing the genetically modified host cell for a specified period of time and then, in a next step after this first incubation time, lactose is added to the culture medium. by adding it to the medium in which the host cells are cultured; Alternatively, lactose can be provided in a specific amount from the beginning of the culture time of the genetically modified host cell, and added continuously in a specific amount. Alternatively, lactose can be produced internally.

This object can be further addressed by genetically modified prokaryotic host cells and their use for the production of fucosylated oligosaccharides, wherein the host cells are at least (i) at a constant level of fructose-6 in unmodified host cells. - by reducing or eliminating the activity of phosphate-converting enzymes and/or increasing the activity of fructose-6-phosphate generating enzymes in the host cell; (ii) at least one gene encoding an enzyme required for de novo synthesis of GDP-fucose is overexpressed; (iii) an exogenous gene encoding a fucosyltransferase, preferably an alpha-1,2-fucosyltransferase and/or an alpha-1,3-fucosyltransferase, is expressed in the host cell, preferably It can be genetically modified to overexpress.

Optionally, the host cell is further genetically modified to (iv) express a gene encoding a protein that enables or facilitates transport of the desired fucosylated oligosaccharide into the medium in which the host cell is cultured; (v) expresses an exogenous gene encoding a bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase; (vi) has inactivated or deleted genes encoding L-fucose-isomerase and L-fuculose-kinase; (vii) has an inactivated or disrupted gene encoding colanic acid synthase; (viii) expresses lactose permease; (ix) has an inactivated or deleted endogenous beta-galactosidase gene; (x) has a regulatable exogenous beta-galactosidase gene; (xi) overexpresses an exogenous gene for metabolizing galactose; (xii) expresses an exogenous gene encoding an enzyme exhibiting fructose-1,6-bisphosphate phosphatase activity.

Also provided herein is a method for producing a fucosylated oligosaccharide using a genetically modified prokaryotic host cell, the method comprising:

- said genetically modified at least (i) by reducing or eliminating the activity of fructose-6-phosphate-converting enzyme at a constant level in the unmodified host cell, or by increasing the activity of fructose-6-phosphate generating enzyme increased fructose-6-phosphate pool in host cells; (ii) at least one gene encoding an enzyme required for de novo synthesis of GDP-fucose is overexpressed in the host cell; (iii) providing a genetically modified prokaryotic host cell such that an exogenous gene encoding alpha-1,2-fucosyltransferase and/or alpha-1,3-fucosyltransferase is expressed within the host cell; ;

- the genetically modified host cell in a culture medium containing a carbon and/or energy source selected from at least one of glucose, sucrose, glycerol, succinate, citrate, pyruvate, malate, lactate, or ethanol culturing; and

- providing lactose to the culture medium with lactose.

The fundamental objects of the present invention are completely solved by the above method.

The method according to the present invention, as well as the genetically modified host cells used in the method, produce fucosylated oligosaccharides at titers exceeding 50 g/L, even 100 g/L, and even more than 150 g/L. It is possible to do this, thus providing a successful tool for the large-scale, and therefore industrial scale, fermentative production of fucosylated oligosaccharides.

As is presently and generally understood in the state of the art, a "fucosylated oligosaccharide" is a fucosylated oligosaccharide found in human milk, ie, an oligosaccharide having fucose-residues. Preferably, the fucosylated oligosaccharide is selected from 2'-fucosyllactose, 3-fucosyllactose or difucosyllactose.

Also, "genetically modified prokaryotic host cell" currently refers to a prokaryotic cell whose genetic material has been altered using genetic manipulation techniques. for example, The host cell can be affected such that endogenous nuclear sequences naturally occurring within the host cell are deleted, blocked, or otherwise altered such that their expression is altered, i.e. eliminated, reduced, repressed, enhanced, or mimicked. and/or an exogenous nucleic acid, ie, a nucleic acid foreign to the host cell, has been introduced into the host cell and genetically modified to be expressed within the cell, eg, under the control of a regulatable promoter. In this regard, such genetically modified host cells are also referred to as “recombinant host cells”. For example, a subject prokaryotic host cell can be genetically modified by the introduction of a heterologous nucleic acid, eg, an exogenous nucleic acid foreign to the prokaryotic host cell, or a recombinant nucleic acid not normally found in the prokaryotic host cell, into an appropriate prokaryotic host cell. It is a modified prokaryotic host cell.

Thus, the term “recombinant,” as used herein with reference to a bacterial host cell, refers to the bacterial cell replicating a heterologous nucleic acid (i.e., a sequence “foreign to that cell”) or expressing a peptide or protein encoded by a heterologous nucleic acid. indicate A recombinant cell may contain genes not found in the native (non-recombinant) form of the cell. A recombinant cell may also contain a gene found in the cell in its native form, wherein the gene has been modified by artificial means and re-introduced into the cell. The term also encompasses a cell that contains a nucleic acid endogenous to the cell that has been modified without removing the nucleic acid from the cell; Such modifications include those obtained by gene replacement, site-specific mutagenesis, and related techniques. Thus, a "recombinant polypeptide" is one produced by recombinant cells. As used herein, "heterologous sequence" or "heterologous nucleic acid" is one that originates from a source foreign to a particular host cell (e.g., from a different species) or, if from the same source, is modified from its original form. It became. Accordingly, a heterologous nucleic acid operably linked to a promoter is from a source different from that from which the promoter was derived, or, if from the same source, modified from its original form. A heterologous sequence can be stably introduced into the genome of a host microbial cell, for example, by transfection, transformation, conjugation or transduction, wherein the techniques are used to identify the host cell and the sequence to be introduced. will be applied depending on A variety of techniques are known to those skilled in the art and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).

Thus, a "genetically modified prokaryotic host cell" is understood as a prokaryotic cell that is currently transformed or transfected, or a prokaryotic cell capable of transformation or transfection with an exogenous polynucleotide sequence.

Nucleic acid sequences used in the present invention can be included, for example, in vectors that will be stably transformed/transfected or otherwise introduced into host microbial cells.

A wide variety of expression systems can be used to express genes in the present invention. Such vectors include, among other things, chromosomal, episomal, and viral-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophages, from transposons, from yeast episomes, from insertional elements, from yeast chromosomal elements, Vectors derived from viruses, and vectors derived from combinations thereof, such as plasmids and those derived from bacteriophage genetic elements, such as cosmids and phagemids. Expression system constructs can contain regulatory sites that control as well as generate expression. In this regard, generally any system or vector suitable for maintaining, propagating or expressing a polynucleotide in a host and suitable for synthesizing a polypeptide may be used for expression. Appropriate DNA sequences can be inserted into the expression system by any of a variety of known and conventional techniques, such as, for example, those set forth in Sambrook et al., supra.

The art is replete with patents and literature publications relating to “recombinant DNA” methodologies for the isolation, synthesis, purification and amplification of genetic material for use in transformation of selected host organisms. Accordingly, it is common knowledge to transform a host organism with a "hybrid" viral or circular plasmid DNA containing selected exogenous (ie, heterologous or "heterologous") DNA sequences. One skilled in the art will know a variety of methods of obtaining a "hybrid" vector for use in transformation of a selected host organism.

The term "a nucleic acid sequence encoding a" generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA, and generally refers to a specific polypeptide or a gene encoding a protein. The terms include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions or single-, double- and triple-stranded regions, single- and double-stranded RNA, and single- and double-stranded regions. RNA that is a mixture of double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded, or more typically, double-stranded, or triple-stranded regions, or a mixture of single- and double-stranded regions. include The term also includes a single contiguous region or non-contiguous regions (e.g., integrated phage or insert sequences or blocked by editing) encoding the polypeptide, as well as coding and/or non-coding sequences. It encompasses polynucleotides that together contain additional sites capable of

As used herein, the term “culturing” means growing and/or incubating bacterial cells in a medium and under conditions that are permissive and appropriate to produce the desired oligosaccharide(s). A couple of suitable bacterial host cells, as well as media and conditions for their cultivation, will be readily available to those skilled in the art upon reading the detailed description of the present invention relative to the skill and professional background of those skilled in the art.

It is understood that with the invention as disclosed herein, the production of one or more oligosaccharides as defined herein is possible, as long as the respective nucleic acids encoding the appropriate proteins/enzymes, as disclosed herein, are contained within the cell. It will be.

As used herein, the term “recovering” means isolating, harvesting, purifying, collecting or otherwise separating oligosaccharides produced by a host microorganism according to the present invention from a host microorganism culture. .

According to one embodiment of the methods and uses of the present invention, the fucosylated oligosaccharide to be produced is selected from at least one of 2'-fucosyllactose, 3-fucosyllactose or difucosyllactose.

According to one embodiment of the method of the present invention, the prokaryotic host cell is selected from the group consisting of bacterial host cells, preferably Escherichia coli strain, Lactobacillus species or Corynebacter It is selected from Corynebacterium glutamicum strains.

Preferably, the host cell is Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Bacillus megaterium , Lactobacillus casei , Lactobacillus acido Lactobacillus acidophilus , Lactobacillus helveticus, Lactobacillus delbrueckii , Lactococcus lactis cells. Additional bacterial strains will be recognized by those skilled in the art upon reading this disclosure.

As currently and generally understood, the expression "fucosyltransferase" refers to the transfer of L-fucose sugar from a GDP-fucose (guanosine diphosphate-fucose) donor substrate to an acceptor substrate, resulting in fucosylation. It is understood as an enzyme that forms oligosaccharides. In the present invention, the acceptor substrate is an oligosaccharide. Fucosyltransferases can also catalyze fucosylation in the presence of glycan acceptors, as well as hydrolysis of GDP-L-fucose in the absence of an available acceptor substrate.

Thus, a nucleic acid/polynucleotide encoding the term "alpha-1,2-fucosyltransferase" or "fucosyltransferase" or "alpha-1,2-fucosyltransferase" or "fucosyltransferase" is Refers to a glycosyltransferase that catalyzes the transfer of a fucose moiety from a donor substrate, eg, GDP-fucose, to an acceptor molecule in an alpha-1-2-linkage. A nucleic acid/polynucleotide encoding the term "alpha-1,3-fucosyltransferase" or "fucosyltransferase" or "alpha-1,3-fucosyltransferase" or "fucosyltransferase" is a donor substrate , eg, a glycosyltransferase that catalyzes the transfer of a fucose moiety from GDP-fucose to an acceptor molecule in an alpha-1,3-linkage. Receptor molecules include, for example, lactose, 2'-fucosyllactose, 3-fucosyllactose, 3'-sialyllactose, 6'-sialyllactose, lacto-N-tetraose, lacto-N-neotetraose or derivatives thereof.

According to the present invention, the exogenous gene encoding fucosyltransferase expresses a protein expressing alpha-1,2-fucosyltransferase activity or a protein expressing alpha-1,3-fucosyltransferase activity. genes expressing alpha-1,2-fucosyltransferase as well as alpha-1,3-fucosyltransferase activity.

According to a preferred embodiment, for the synthesis of 2'-fucosyllactose, a suitable alpha-1,2-fucosyltransferase is expressed, and for the synthesis of 3-fucosyllactose, a suitable alpha-1,3-fucosyltransferase is expressed. Syltransferase is expressed, and for the synthesis of 2',3-difucosyllactose, both the appropriate alpha-1,2-fucosyltransferase and alpha-1,3-fucosyltransferase or alpha-1,3-fucosyltransferase At least one gene encoding a protein exhibiting 1,2- as well as alpha-1,3-fucosyltransferase activity is expressed.

Non-limiting examples of fucosyltransferases that may be used in accordance with the present invention and may be part of the present invention include, for example, bacterial fucosyltransferases, and preferably alpha-1,2-fucosyltransferases. , and more preferably E. E. coli: alpha-1,2-fucosyltransferase encoded by the wbgL gene of O126, or alpha-1,2-fucosyltransferase encoded by the fuc T gene of Helicobacter pylori , or alpha -1,3-fucosyltransferase, and more preferably Akkermansia muciniphila , Bacteroides fragilis , H. Pylori, or H. It is an alpha-1,3-fucosyltransferase from H. hepaticus . Preferably, the glycosyl-transferase is used or a variant thereof disclosed in EP 2 479 263 A1 or described from EP 2 439 264 A1 or described in WO 2010/142305, the content of which is expressly set out herein and is a part of the present invention. make up the subject

As used herein, the term "variant" is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, in particular an enzyme as referred to and used herein, respectively, but retains the essential (enzymatic) properties of the reference polynucleotide or polypeptide. Typical variants of polynucleotides differ in nucleotide sequence from the reference nucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of the polypeptide encoded by the reference nucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions or truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs from the reference polypeptide in amino acid sequence. In general, differences are limited so that the sequences of the reference polypeptide and variant are very similar throughout and, in many places, identical. Variant and reference polypeptides may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. Substituted or inserted amino acid residues may or may not be encoded by the genetic code. Variants of a polynucleotide or polypeptide may be naturally occurring, eg, allelic variants, or may be variants not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides can be prepared by mutagenesis techniques, direct synthesis, and other recombinant methods known to those skilled in the art.

Within the scope of the present invention, nucleic acid/polynucleotide and polypeptide polymorphic variants, alleles, mutations, and interspecies homologues may also be included within these terms, which may be used for polypeptides referred to herein, for example Fructose-6-phosphate-converting enzymes, especially phosphofructokinase A, glucose-6-phosphate isomerase, fructose-6-phosphate aldolase 6-phosphate aldolase), a transketolase such as tkt A, tkt B, or a transaldolase such as tal A, tal B, fructose-1,6-bisphosphate phosphatase , Used in the present invention, phosphomannomutase, preferably man B, mannose-1-phosphate guanosyltransferase, preferably man C, GDP-mannose-4 ,6-dehydratase (GDP-mannose-4,6-dehydratase), preferably gmd , and GDP-L-fucose synthase (GDP-L-fucose synthase), preferably wca G, Functional activity of fructose-1,6-bisphosphate phosphatase, preferably fructose-1,6-bisphosphate phosphatase ( fbpa e) from peas ( Pisum sativum ), relative to fucosyltransferase, as used herein. About 60% amino acid sequence identity to the sugar efflux transporters, e.g., yberc0001_9420 and SetA, and to the lactose permease, e.g., LacY, as used herein, 65 %, 70%, 75%, 80%, 85%, 90%, preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity. and preferably has an amino acid sequence/nucleic acid sequence spanning a region of at least about 25, 50, 100, 200, 500, 1000 or more amino acids.

Thus, a “functional fragment” of any gene/protein disclosed herein is meant to designate sequence variants of the gene/protein that still retain the same or to a lesser extent the activity of the gene or protein from which each fragment is derived. do.

As defined herein, the term “endogenous” herein and generally in the art means that the nucleic acid encoding the enzyme of interest originates from and has not been introduced into said host cell, whereas “exogenous " or "recombinant" nucleic acid means that has been introduced into said host cell and does not originate from said host cell.

According to another embodiment, the nucleic acid/gene is homologous or heterologous. As is currently and generally understood in the related art, the expression "allogous" refers to a nucleic acid sequence/gene encoding a particular product or products, which is derived from the same species into which the nucleic acid sequence has been inserted. Thus, the term "heterologous" refers to a nucleic acid/sequence gene that encodes a particular product or products and is derived from a species other than that into which the nucleic acid sequence/gene has been inserted.

According to another embodiment, the host cell of the present invention further comprises regulatory sequences allowing controlled overexpression of endogenous or exogenous/recombinant nucleic acid sequences/genes. As defined above, the term "regulatory sequence" used herein synonymously with the expression "nucleic acid/gene expression control sequence" includes an array of promoter sequences, signal sequences, or transcription factor binding sites; Sequences affect the transcription and/or translation of a nucleic acid sequence or gene operably linked to a regulatory sequence.

Currently, the term "operably linked" as used herein may refer to a functional linkage between a nucleic acid/gene expression control sequence (eg, promoter, signal sequence, alignment of transcription factor binding sites) and a second nucleic acid sequence or gene. , wherein the expression control sequence affects transcription and/or translation of the nucleic acid corresponding to the second sequence. Thus, the term "promoter" designates a DNA sequence that usually "precedes" a gene in a DNA polymer and provides a site for initiation of transcription into mRNA. "Regulatory" DNA sequences also bind proteins that are usually "upstream" (i.e., precede) a gene in a given DNA polymer and determine the frequency (or rate) of transcriptional initiation. Collectively, referred to as "promoter/regulator" or "regulatory" DNA sequences, these sequences that precede a selected gene (or series of genes) in a functional DNA polymer determine whether transcription (and eventual expression) of the gene will occur or not. work together to determine A DNA sequence that “follows” a gene in a DNA polymer and provides a signal to terminate transcription into mRNA is referred to as a transcription “terminator” sequence.

As already outlined further above, the nucleic acid sequences/genes used in accordance with the present invention may be comprised, for example, in vectors to be stably transformed/transfected into bacterial host cells. The definition of recombinant production, as outlined above, and details thereof will also apply in this section.

In some embodiments, the nucleic acid sequence/gene is placed under the control of an inducible promoter, wherein the promoter is such that the level of expression is dependent on environmental or developmental factors, such as, for example, temperature, pH, anaerobic or aerobic conditions, light, It directs the expression of genes that can be altered by transcription factors and chemicals. Such promoters are referred to herein as "inducible" promoters, which allow for controlling the timing of expression of the proteins used in the present invention. this. For E. coli and other bacterial host cells, inducible promoters are known to those skilled in the art.

Throughout the present invention, the expression "gene", when translated into protein, refers to a nucleotide (or nucleic acid sequence; above; Reference) is meant to represent the linear sequence of. A protein/peptide—as in the present invention—has a specific enzymatic function. “Nucleic acid” refers to deoxyribonucleotides or polymers of ribonucleotides in single- or double-stranded form and, unless otherwise limited, is a known natural nucleotide that hybridizes to a nucleic acid in a manner similar to naturally occurring nucleotides. embraces the analogues of Unless otherwise indicated, a particular nucleic acid sequence includes its complementary sequence.

The term "nucleic acid sequence encoding..." or "gene(s) encoding/encoding..." generally refers to any polyribonucleotide or polydeoxynucleotide, which is unmodified RNA or DNA. or modified RNA or DNA, and generally refers to a gene encoding a specific polypeptide or protein. The terms include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions or single-, double- and triple-stranded regions, single- and double-stranded RNA, and single- and double-stranded regions. -including hybrid molecules comprising RNA, which is a mixture of stranded regions, DNA and RNA which may be single-stranded, or more typically, double-stranded, or triple-stranded regions, or a mixture of single- and double-stranded regions. do. The term also refers to a single contiguous region or non-contiguous regions (e.g., integrated phage or insert sequences or blocked by editing) that encodes a polypeptide, which may also contain coding and/or non-coding sequences. It encompasses polynucleotides that together contain additional sites.

Accordingly, in the present invention, the terms "gene" or "nucleic acid sequence" are used interchangeably.

Additionally, as used herein, when the term "active" refers to an enzyme, any molecule, particularly a protein, that exhibits enzymatic activity, and a catalyst that produces a specific biochemical reaction while remaining unchanged by the reaction. It is meant to include any molecule that acts. In particular, proteins with enzymatic activity are meant to be encompassed by the term, which are capable of converting a substrate into a product.

In an enzymatic reaction, a molecule at the beginning of the process, called a substrate, is converted into a different molecule called a product. Almost all chemical reactions within biological cells require enzymes to occur at rates sufficient to survive. Since enzymes are selective for their substrates among many possibilities and speed up only a few reactions, the set of enzymes produced within a cell determines which metabolic pathways occur within that cell.

Thus, according to the present invention, when an enzyme's activity is "removed" or "reduced", if the enzyme or its expression is unmodified, the enzyme does not have the activity it has, i.e., in this case the activity is unmodified. is eliminated or reduced compared to the expressed enzyme/enzyme.

The inventors of the present invention were able to provide methods and genetically modified host cells capable of producing fucosylated oligosaccharides with product titers exceeding 100 g/L.

According to one embodiment of the present invention of the method or host cell of the present invention, the activity of fructo-6-phosphate-converting enzyme, which is at a constant level - when available - in unmodified cells is reduced or eliminated. this. When E. coli is used as a host cell, in the method and host cell according to the present invention, the fructose-6-phosphate converting enzyme is phosphofructokinase, preferably phosphofructokinase A (PfKA), glucose-6 - selected from the group consisting of phosphate isomerase, fructose-6-phosphate aldolase, transketolase, preferably tkt A, tkt B, or transaldolase, preferably tal A, tal B Preferred, otherwise unmodified teeth. The fructose-6-phosphate converting enzyme, which is present and active in E. coli host cells, has been modified to reduce or eliminate its activity.

PfkA efficiently phosphorylates fructose-6-phosphate to fructose-1,6-bisphosphate. Fructose-6-phosphate is converted to GDP-L- in the glycolytic pathway, and in the gluconeogenic pathway, and starting from ManA catalyzed isomerization of fructose-6-phosphate to mannose-6-phosphate. It is a branching point in the synthesis of fucose. this. When E. coli grows on gluconeogenic substrates such as glycerol, phosphorylation of fructose-6-phosphate by PfkA is a very ATP-consuming treadmill reaction and, moreover, competes with ManA for the substrate.

According to one embodiment of the method and host cell of the present invention, the fructose-6-phosphate generating enzyme is fructose-1,6-bisphosphate phosphatase, the activity of which is to generate a pool of fructose-6-phosphate. can be increased to increase

According to another embodiment of the present invention, at least one gene encoding an enzyme required for de novo synthesis of GDP-fucose is overexpressed in the host cell.

As mentioned above, GDP-fucose serves as an L-fucose-donor for the reaction of fucosyltransferase, which transfers L-fucose to an acceptor substrate to form fucosylated oligosaccharides.

To produce GDP-fucose internally using genetically modified prokaryotic host cells, external addition of L-fucose, which can be converted to GDP-fucose via the salvage pathway, is not required. , This is because the host cell effectively produces GDP-fucose required for the fucosylation-process of the desired oligosaccharide.

At least one gene that encodes an enzyme required for the de novo synthesis of GDP-fucose and is overexpressed in the host cell may be an endogenous gene or an exogenous gene, which may be integrated into the genome of the host cell.

In one embodiment of the present invention, the exogenous gene encoding an enzyme required for de novo synthesis of GDP-fucose is a gene encoding phosphomannomutase, preferably ManB , encoding an amannose-1-phosphate guanosyltransferase. gene, preferably manC , a gene encoding GDP-mannose-4,6-dehydratase, preferably gmd , and a gene encoding GDP-L-fucose synthase, preferably wcaG .

In one embodiment of the present invention, and further as mentioned above, at least one exogenous gene encoding a fucosyltransferase has alpha-1,2-fucosyltransferase activity and/or alpha-1,3- It is selected from genes expressing proteins exhibiting fucosyltransferase activity. In this regard, alpha-1,2-fucosyltransferase E. E. coli: when selected from the group consisting of wbg L of O126 or alpha-1,2-fucosyltransferase encoded by the fucT 2 gene of Helicobacter pylori; and the gene encoding alpha-1,3-fucosyltransferase is alpha-1,3- from the species Akkermansia musiniphila, Bacteroides fragilis, Helicobacter pylori or Helicobacter hepaticus. Particularly preferred are those selected from the group consisting of fucosyltransferases.

According to another embodiment of the invention, the host cell: (i) expresses a gene, preferably an exogenous gene, encoding a protein enabling or facilitating the export of the desired fucosylated oligosaccharide into the culture medium. and/or (ii) expresses an exogenous gene encoding a bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase; (iii) exhibits mutated or deleted genes fucI and fucK , leading to reduced or eliminated activity of L-fucose-isomerase (FucI) and L-fuculose-kinase (FucK); (iv) has an inactivated or disrupted gene encoding colanic acid synthase; (v) expresses, preferably overexpresses, an endogenous and/or exogenous permease for the import of lactose; (vi) has an inactivated or deleted endogenous beta-galactosidase gene; (vii) expresses a gene encoding a beta-galactosidase, preferably a regulatable exogenous beta-galactosidase; (viii) further genetically modified to overexpress an endogenous and/or exogenous gene encoding fructose-1,6-bisphosphate phosphatase.

With the additional genetic modifications indicated above, the method for producing fucosylated oligosaccharides could be further improved.

The catabolism of intracellular fucose is inhibited by deleting or inactivating the genes encoding L-fucose isomerase (eg, FucI) and L-fuculose-kinase (eg, FucK). can be avoided

By disrupting, deleting or inactivating the gene encoding the cholanic acid biosynthetic enzyme (eg, the wcaJ gene, which catalyzes the first step in cholanic acid synthesis in E. coli as a host cell), otherwise the substrate GDP-L- The production of intracellular cholanic acid, which can compete with the fucosyltransferase reaction to fucose, is prevented.

According to a preferred embodiment, the protein enabling or promoting export of the desired fucosylated oligosaccharide into the culture medium is preferably yberc0001_9420 and E. coli. It is a sugar efflux transporter selected from E. coli SetA.

According to a preferred embodiment, the gene encoding the bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase is fkp from Bacteroides fragilis.

According to a preferred embodiment, the fructose-1,6-bisphosphate phosphatase is encoded by a gene that is a functionally active variant of fructose-1,6-bisphosphate phosphatase ( fbpase ) from pea.

According to a preferred embodiment, the lactose permease is E. coli LacY.

By expressing a gene encoding a bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase that catalyzes the synthesis of GDP-L-fucose, for example, the Bacteroides fragilis fkp gene , to prevent the formation of free L-fucose, which can accumulate as a by-product after hydrolysis of GDP-L-fucose, and thereby rescue free L-fucose for the synthesis of desired fucosylated oligosaccharides. there is.

According to a preferred embodiment, the exogenous gene for metabolizing galactose is a gene comprising the galETKM operon and/or galP from E. coli.

According to one embodiment of the present invention, the gene that the host cell is modified internally or together is an endogenous or exogenous gene.

Throughout the present invention, and in applying each gene/nucleic acid exogenously introduced into the host cell, according to an embodiment of the method and host cell - at least one exogenous gene, preferably integrated into the host cell genome It is preferred that the exogenous gene is overexpressed, preferably under endogenous or exogenous induction, or in a constitutive manner.

Thus, (i) exogenous genes encoding enzymes required for de novo synthesis of GDP-fucose; (ii) an exogenous gene encoding a fucosyltransferase; (iii) an exogenous gene encoding a sugar efflux transporter; (iv) an exogenous gene encoding a bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase; (v) lactose permease; (vi) a regulatable exogenous gene encoding beta-galactosidase; and/or (vii) an exogenous gene for metabolizing galactose; (viii) an exogenous gene encoding fructose-1,6-bisphosphate phosphatase; It is preferred that at least one of the genes is/are overexpressed; Overexpression can be effected, for example, by a regulatable promoter that initiates transcription of the gene(s) either at specific time points or periods during culture or during the entire culture time.

Also, according to a preferred embodiment, the exogenous gene to be introduced into the host cell used in the method according to the present invention is integrated into the genome of the host cell.

Furthermore, according to one aspect of the present invention, and unless otherwise defined, genes that are modified in/with the host cell according to the present invention may also be endogenous genes, their expression being enhanced or increased, overexpressed or , or otherwise eliminated or reduced.

Degradation of exogenously added lactose can be prevented by inactivating or deleting the endogenous beta-galactosidase gene(s); however, it degrades lactose, which is not metabolized and would otherwise prevent purification of the desired fucosylated oligosaccharide. It is also preferred that a controllable exogenous gene encoding a beta-galactosidase or a mutant form of beta-galactosidase is expressed in the host cell. For example, the Lac ZΩ fragment of the lac Z gene can be expressed, and the expression can be regulated, eg, by a repressor, eg a concentration sensitive transcriptional repressor, eg c I857. In this case, synthesis of beta-galactosidase Ω-fragment can be initiated by increasing the temperature to 42°C.

As currently and generally understood in the art, a repressor is a DNA- or RNA-binding protein that inhibits the expression of one or more genes by binding to an operator or related silencer. DNA-binding inhibitors block the attachment of RNA polymerase to the promoter and thus prevent transcription of the gene into messenger RNA.

As a promoter of an exogenous beta-galactosidase alpha fragment, for example, E. The E. coli BL21(DE3) PgbA promoter can be used. Beta-galactosidase α- and Ω-fragments combine to result in activated beta-galactosidase in the cell.

In a preferred embodiment, lactose is added at a concentration of at least 5 mM, more preferably at a concentration of at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 mM, better than 300 mM lactose from the start of the culture. provided by addition at a concentration of 300 mM or greater, or 400 mM.

According to still another embodiment, lactose is added to the culture medium at a concentration such that a lactose concentration of at least 5 mM, more preferably at least 10, 20, or 30 mM is obtained throughout the production phase of the culture by adding lactose Provided.

Alternatively, lactose may be produced intracellularly by the host cell, as described in patent EP1927316 A1, the contents of which are hereby incorporated by reference and incorporated herein by reference.

In methods according to the present invention, it is preferred that the host cells are cultured for at least about 60, 80, 100 or about 120 hours or in a continuous manner.

Thus, according to one aspect of the present invention, ie in a continuous method, a carbon source is continuously added to the medium during the culturing phase of the host cells. By continuously adding a carbon source during the culturing phase, continuous and effective production of oligosaccharides is achieved.

According to another aspect, the method according to the present invention is a constant volume fed-batch culture in which the substrate is supplied without diluting the culture, or a variable volume in which the fermentation volume changes with fermentation time because of substrate supply. It is or includes any one of the volume fed-batch fermentation methods, fed-batch fermentation.

As mentioned above, the present invention also relates to a genetically modified prokaryotic host cell, wherein the host cell (i) has a constant level of fructose-6-phosphate-converting enzyme activity in the unmodified host cell. degraded or eliminated; (ii) at least one gene encoding an enzyme required for de novo synthesis of GDP-fucose is overexpressed; (iii) an exogenous gene encoding a fucosyltransferase, preferably a gene encoding alpha-1,2-fucosyltransferase and/or alpha-1,3-fucosyltransferase, is expressed in the cell; genetically modified.

As mentioned for the method above, the host cell is preferably selected from Escherichia coli strains, Lactobacillus strains or Corynebacterium strains.

According to one embodiment of the host cell according to the present invention, the intracellular pool of fructose-6-phosphate is (i) phosphofructokinase, glucose-6-phosphate isomerase, fructose-6-phosphate aldola by reducing or eliminating the activity of a transketolase, such as tkt A, tkt B, or a transaldolase, such as a fructose-6-phosphate converting enzyme selected from the group of tal A, tal B, or (ii) by increasing the activity of fructose-1,6-bisphosphate phosphatase.

In a preferred embodiment, genes encoding enzymes required for de novo synthesis of GDP-fucose are overexpressed.

In yet another preferred embodiment, the exogenous gene encoding at least one fucosyltransferase is a gene encoding alpha-1,2-fucosyltransferase and/or alpha-1,3-fucosyltransferase, Refers to alpha-1,2-fucosyltransferase, E. wbg L from E. coli O126 or fucT 2 from Helicobacter pylori, and alpha-1,3-fucosyltransferase, which refers to the species Ackermansia musiniphila, Bacteroides fragilis, Helicobacter pylori, or Helicobacter h. Selected from the genes of Paticus.

According to one embodiment, the host cell described above optionally (iv) expresses an exogenous gene encoding a sugar efflux transporter; (v) expresses an exogenous gene encoding a bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase; (vi) has inactivated or deleted genes encoding L-fucose-isomerase and L-puculose-kinase; (vii) has an inactivated or disrupted gene encoding a UDP-glucose:undecaprenyl phosphate glucose-1-phosphate transferase; (viii) expresses exogenous lactose permease; (ix) has an inactivated or deleted endogenous beta-galactosidase gene; (x) expresses a regulatable exogenous gene encoding beta-galactosidase; (xi) expresses an exogenous gene for metabolizing galactose; and further genetically modified to express an exogenous gene encoding fructose-1,6-bisphosphate phosphatase.

The invention also relates to the use of a genetically modified prokaryotic host cell according to the invention for the production of fucosylated oligosaccharides.

Additional advantages are obtained from the detailed description of an embodiment and the accompanying drawings.

It goes without saying that the features described above and those described further below may be used not only in the combinations specified individually but also in other combinations or alone without departing from the scope of the present invention.

Several embodiments of the invention are illustrated in the drawings and described in more detail in the detailed description that follows. In the drawing:
1 schematic, exemplary illustration of a genetically modified host cell to be used in a method according to the present invention;
Figure 2 E. producing 2'-fucosyllactose by HPLC. HPLC analysis of supernatants from glycerol-grown cultures of E. coli strains; and
Figure 3 SEQ ID NOs 1 to 7.

1 shows an exemplary host cell according to the present invention to be used in a method according to the present invention, in which an exemplary pathway for the fermentation of an exemplary fucosylated oligosaccharide 2-fucosyllactose is depicted. In Figure 1, an exemplary bacterial host cell, genetically modified according to the present invention, with respect to the production of 2'-fucosyllactose is shown.

As can be seen from Figure 1, glycerol is illustratively used as the carbon source, while lactose is added externally. Lactose is transported into the host cell via a permease (eg, LacY). Glycerol is taken up into the host cell via facilitated diffusion using GlpF. Within the prokaryotic host cell, glycerol is converted to glyceraldehyde-3-phosphate, which is converted to fructose-6-phosphate, which (i) favors overexpression of an exogenous gene encoding the Fbpase (ii) inhibition by inactivation of phosphofructokinase A (PfkA) with reverse reaction. Exogenous enzymes required for the de novo synthesis of GDP-fucose, namely phosphomannomutase ManB, mannose-1-phosphate guanosyltransferase ManC, GDP-mannose-4,6-dehydratase Gmd, and GDP-L - Through overexpression of the fucose synthase WcaG, GDP-L-fucose is produced.

In the next step, GDP-L-fucose reacts with absorbed lactose to produce 2-fucosyllactose, by the activity of an alpha-1,2-fucosyltransferase, such as WbgL, which is transported by efflux transport. Through a sieve, for example TPYb, the host cells are exported into the medium in which they are cultured.

In Figure 2, by HPLC, E. coli producing 2'-fucosyllactose. Results of HPLC analysis of supernatants from glycerol-grown cultures of E. coli strains are shown.

Depicted in Figure 2 is an HPLC profile (black) of a fermentation broth from a 2'-fucosyllactose producing strain harboring the gene encoding the heterologous transporter yberc0001_9420 and the gene encoding the heterologous transporter yberc0001_9420 . HPLC profile of fermentation broth of the same strain after deletion (gray). Fermentation of both strains was carried out at 28° C. for 111 h using glycerol as the carbon and energy source.

Example 1

This for the production of 2'-fucosyllactose. Engineering of the E. coli BL21(DE3) strain

this. Using E. coli BL21 (DE3) as a parental host, a strain for the production of 2'-fucosyllactose in a whole cell biosynthetic approach was constructed. Genome engineering of strains included gene disruption and deletion events and integration of heterologous genes.

Since 2'-fucosyllactose is synthesized from lactose, it was applied to bacterial culture, and from GDP-L-fucose produced from living cells, first a wild-type copy of the lac Z gene encoding endogenous β-galactosidase ( wild-type copy) was inactivated by mutagenesis using a mis-match oligonucleotide (see Ellis et al., "High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides). ", Proc. Natl. Acad. Sci. USA 98: 6742-6746 (2001)). Using the same method, the gene of arabinose-isomerase ara A was disrupted.

A lac ZΩ gene fragment was introduced under the control of the temperature sensitive transcriptional repressor cI857 . The lac Zα fragment gene represents the LacZ ⁺ strain, E. coli. It was expressed under the control of the PgbA promoter in E. coli BL21(DE3) strain.

Genomic deletion was performed by λ Red mediated recombination according to the method of Datsenko and Warner ("One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products", Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)). The genes fuc I and fuc K encoding L-fucose isomerase and L-fuculose kinase, respectively, were deleted to prevent degradation of L-fucose. Also, the gene wzxC-wcaJ was deleted. WcaJ encodes a UDP-glucose:undecaprenyl phosphate glucose-1-phosphate transferase that presumably catalyzes the first step in cholanic acid synthesis (Stevenson et al., "Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colonic acid", J. Bacteriol. 178:4885-4893; (1996)); The production of cholanic acid will compete with GDP-fucose with the fucosyltransferase reaction.

Genomic integration of heterologous genes was performed by transposition. A large gene cluster was integrated into the genome mediated by an overactive C9-mutation of the mariner transposase Himar 1 (Lampe et al ., "Hyperactive transposase mutants of the Himar1 mariner). transposon", Proc. Natl. Acad. Sci. USA 96:11428-11433 (1999)), and was inserted into the plasmid pEcomar under the transcriptional control of the _Para promoter. To enhance the de novo synthesis of GDP-fucose, phosphomannomutase ( manB ) from E. coli K12 DH5α, mannose-1-phosphate guanosyltransferase ( manC ), GDP-mannose-4,6-dihy The genes encoding dratase ( gmd ), and GDP-L-fucose synthase ( wcaG ) in E. coli. E. coli BL21(DE3) strain: operon manCB was set under the control of the constitutive promoter P _tet , and operons gmd , wcaG were transcribed from the constitutive P _T5 promoter. Contains the gene for dihydrofolate reductase for trimethoprim resistance, flanked by inverted terminal repeats that are specifically recognized by the Mariner-like element Himar1 transposase ( flanked), the transposon cassette <P _tet -manCB -P _T5 -gmd, wcaG- FRT -dhfr- FRT> (SEQ ID NO: 1) from pEcomar C9- man CB- gmd , wcaG-dhfr . into the E. coli genome.

For chromosomal integration of a single gene, EZ-Tn5 ^TM transposase (Epicentre, USA) was used. To produce the EZ-Tn5 transposome, the gene of interest and an antibiotic resistance cassette flanked by FRT-sites were combined with a 19-bp mosaic terminal recognition site for the EZ-Tn5 transposase (5'-CTGTCTCTTATACACATCT (SEQ ID NO: 8) )) was amplified with primers containing both sites. Using the EZ-Tn5™ transposase, E. The gene for the lactose importer LacY from E. coli K12 TG1 (accession number ABN72583), E. coli. E. coli: 2-fucosyltransferase gene wbg L (accession number ADN43847) from O126, and Yersinia bercovieri ) Encoding sugar efflux transporters of the major promoter superfamily from ATCC 43970 The gene yberc0001_9420 (accession number EEQ08298) was integrated using the respective integration cassettes: <P _tet - lacY -FRT- aadA- FRT> (SEQ ID NO: 2), <P _tet - wbg L co -FRT- neo- FRT> ( SEQ ID NO: 3), and <P _tet - yberc0001_9420co -FRT- cat- FRT> (SEQ ID NO: 4), the resulting strain. Genes w bgL and yberc0001_9420 were synthesized artificially and codons were optimized by GeneScript Corporation (USA). After successful integration of the lac Y gene, the resistance gene was removed from the streptomycin-resistant clone with the FLP recombinase encoded on the plasmid pCP20 (Datsenko and Warner, "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products", Proc. Natl. Acad. Sci. USA 97:6640-6645 (2000)]).

this. Since E. coli BL21(DE3) lacks a functional gal -operon, EZ-translocation using the integration cassette <P _gal - galE-galT-galK-galM > (SEQ ID NO: 5) E. A negatively regulated copy of the galETKM operon of E. coli K was integrated into the B strain. Integrand was selected from MacConkey-agar containing 1% galactose as red colonies. The resulting strain can metabolize the monosaccharides glucose and galactose derived from lactose hydrolysis.

Example 2

Evidence of enhanced 2'-fucosyllactose exportation by an efflux transporter per Yersinia bercobieri ATCC 43970

yberc0001_9420 Knock-out of

To confirm the functionality of the heterologous sugar transporter from Yersinia berkovieri ATCC 43970, the resulting strain Δyberc0001_9420 , into which the gene yberc0001_9420 was inserted, plasmid pBBR1MCS according to Datsenko and Wanner (2000; see above) Using the gentamicin resistance cassette aacC1 from (Kovach, Elzer et al. 1995, "Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes", Gene 166, 175-176 ]), manB , manC , gmd , wcaG , lacY , wbgL ; and strain E., which is a strain containing the genomic integration of yberc0001_9420 . coli BL21( ^DE3 ) lacZ- ^, araA- ^, fucI- ^, fucK- ^, wcaJ- The gene yberc0001_9420 was deleted by homologous recombination from .

Culture conditions for producing 2'-fucosyllactose

Those harboring the heterologous exoporter yberc0001_9420 . E. coli BL21(DE3) strain and Δyberc0001_9420 strain were treated with 7 g/L NH ₄ H ₂ PO ₄ , 7 g/L K ₂ HP0 ₄ , 2 g/L KOH, 0.3 g/L citric acid, 2 g/L L of MgS0 ₄ X 7H ₂ 0, and 0.015 g/L of CaCl ₂ X 6H ₂ 0, 1.5% glycerol as carbon source, 10 μg/ml of antibiotic trimethoprim, and 15 μg/ml of kanamycin 1 mL/L trace element solution (54.5 g/L ferric ammonium citrate, 9.8 g/L MnCl ₂ X 4H ₂ O, 1.6 g/L CoCl ₂ X 6H ₂ O, 1 g/L CuCl ₂ X 2H ₂ O, 1.9 g/L H ₃ BO ₃ , 9 g/L ZnSO ₄ X 7H ₂ O, 1.1 g/L Na ₂ MoO ₄ X 2H ₂ O, 1.5 g/L Na ₂ SeO ₃ , It was started with 800 ml of mineral salt medium supplemented with 1.5 g/L of NiSO ₄ X 6H ₂ O) and cultured at 28° C. in a 3 L fermenter (Edison, New Brunswick, USA). Cultures were started with 2.5% (v/v) inoculum from the pre-culture growth in the same glycerol containing medium. Lactose as an acceptor in the fucosyltransferase reaction, starting at an OD660 _nm of about 10, was added within 7 hours to obtain a concentration of 30 mM in the culture. Subsequently, lactose was manually modulated to maintain receptor molecule excess; Glycerol was added successively.

Analysis of culture supernatants by HPLC and detection of 2'-fucosyllactose

ReproSil Carbohydrate, 5 μm (250 mm X 4,6 mm) (Dr. My Analysis by high performance liquid chromatography (HPLC) was performed using a Shh GmBH). Elution was performed isocratically using acetonitrile:H ₂ O (68/32 (v/v)) as eluent at 35° C. and flow rate 1.4 ml/min. 20 μl of sample was applied to the column. The 2'-fucosyllactose concentration was calculated from a standard curve. Therefore, HPLC with 10% (v/v) 100 mM sucrose before filtering (0.22 μm pore size) and washing with solid phase extraction on an ion exchange matrix (Strata ABW, Phenomenex). It was added as an internal standard to the sample.

this. Detection of 2'-Foucaultsyllactose in Supernatants of E. coli BL21 (DE3) Cultures

After 111 hours of cultivation at 28° C. in inorganic salt medium containing glycerol as a carbon source, 73 mM ( 35,6 g/L) and 25 mM (12,2 g/L) of 2'-fucosyllactose were detected by HPLC (see Fig. 2). Depicted in Figure 2 is an HPLC profile (black) of fermentation broth from a strain producing 2'-fucosyllactose harboring the gene encoding the heterologous transporter yberc0001_9420 and deletion of the gene encoding the heterologous transporter yberc0001_9420 . HPLC profile (gray) of fermentation broth of the same strain after fermentation. Deletion of the heterologous export transporter yberc0001_9420 in the strain reduced the detected amount of 2'-fucosyllactose in the supernatant. This clearly provides evidence that, although the yberc0001_9420 gene is identical in both strains, because of the genetic background, the transporter protein enhances 2'-fucosyllactose production by faster transport of the trisaccharide out of the cell. . Additionally, lower cell densities were obtained in cells lacking the 2′-fucosyllactose exporter, probably due to osmotic stress caused by strong intracellular sugar accumulation. As shown in Figure 2, the amount of 2',3-difucosyllactose detected in the Δyberc0001_9420 culture was about twice as high as that in the broth of the original strain. The increased production of 2',3-difucosyllactose, in which L-fucose is transferred to 2'-fucosyllactose by a fucosyltransferase-catalyzed reaction, is also compared to the yberc0001_9420 overexpressing strain, yberc0001_9420 rust- suggesting a higher intracellular concentration of the receptor molecule 2'-fucosyllactose in the out strain.

2, the bright line, that is, the gray line, is Δyberc0001_9420 . Shows the supernatant of E. coli BL21(DE3) strain Δ yberc0001_9420 , the black line is E. coli. Supernatant of a culture of yberc0001_9420 containing E. coli BL21 (DE3) is shown. Samples were taken after 111 hours of incubation at 28° C. in mineral salts medium with glycerol as the carbon source.

Example 3

Production of 2'-fucosyllactose during the fermentation process

Fermentation was carried out in a 3L-fermenter at 30° C. and pH 7.0: the pH was adjusted by titrating with 25% ammonia. The strain described in Example 2 was cultured in the inorganic salt medium described in Example 2 using glycerol as a carbon and energy source. A fermenter with a starting volume of 1 L was inoculated with the pre-culture grown in the same medium. After 2% of the glycerol contained in the batch was consumed, glycerol (60% v/v) was fed continuously. When the OD _{600 nm} reached 6, 10 mL of 0.66 M lactose was added to each of the three portions (1 hour apart). Thereafter, lactose was fed by continuous flushing to maintain a lactose concentration of at least 10 mM in the fermentor. After 86 hours of culture, a final titer of 91.3 mM (44.6 g/L) 2'-fucosyllactose was reached. By shifting the temperature to 42° C., the β-galatosidase gene was expressed, and lactose and its decomposition products glucose and galactose were metabolized by the 2'-fucosyllactose producing strain.

Example 4

HPLC-analysis of culture supernatants

Analysis by HPLC was performed using a Waters X-Bridge Amide column 3.5 μm (250 X 4.6 mm) (Eschborn, Germany) connected to a refractive index detector (RID-10A) (Shimadzu, Germany) and an HPLC system (Shimadzu, Germany) did Elution was performed with 30% A: 50% (v/v) ACN in ddH ₂ O, 0.1% (v/v) NH ₄ OH and 70% B: in ddH ₂ O as eluent at 35° C. and flow rate 1.4 ml/min. It was performed isocratically using 80% (v/v) ACN, 0.1% (v/v) NH ₄ OH (v/v). 10 μl of the sample was applied to the column and the 2′-fucosyllactose concentration was calculated from the standard curve. Therefore, 100 mM of 10% (v/v) sucrose was added as an internal standard to HPLC samples prior to clearing using filtration (0.22 μm pore size) and solid phase extraction on an ion exchange matrix (Strata ABW, Phenomenex). added. Byproducts such as L-fucose, 3-fucosyllactose, 2',3-difucosyllactose and fucosylgalactose were also detected using the same assay conditions.

Example 5

Improvement of strains producing 2'-fucosyllactose by metabolic engineering

this. A further improvement in the synthesis of 2'-fucosyllactose by E. coli strains was achieved through deletion of the pfkA gene, which encodes phosphofructokinase A. this. When culturing E. coli on a gluconeogenic substrate such as glycerol, Phosphorylation of fructose-6-phosphate by PfkA is a highly ATP consuming treadmill reaction and, moreover, it competes with ManA as a substrate. The pfkA gene is a gentamicin resistance cassette ( aacC1 ) flanked by lox 71/66 sites (Lambert, Bongers et al . 2007 "Cre-lox- Based system for multiple gene deletions and selectable-marker removal in Lactobacillus plantarum ", Appl. Environ. Microbial. 73, 1126-113]) was used for deletion by homologous recombination. After successful deletion of the pfkA gene, a Cre recombinase cloned from the pKD46 chassis (see Datsenko and Wanner, 2000) under the control of the _Para promoter was used (Abremski, Hoess et al . 1983, " Studies on the properties of P1 site-specific recombination: evidence for topologically unlinked products following recombination", Cell 32, 1301-1311), antibiotic resistance gene. E. coli genome.

For the different fucosyltransferases, besides the transferase activity, GDP-L-fucose hydrolase activity was demonstrated. Also in the case of wbgL , the alpha-1,2-fucosyltransferase used in the synthesis of 2'-fucosyllactose herein, this hydrolytic activity was shown (see EP3050973 A1). Free L-fucose in the production of 2'-fucosyllactose To rescue and remove contaminating L-fucose from the culture broth, the fkp gene encoding the bifunctional L-fucokinase/L-fucose 1-phosphate guanylyltransferase of Bacteroides fragilis was , by transposition using the EZ-Tn5™ transposase, <Ptet-fkp-lox-aacC1-lox> (SEQ ID NO: 6), under the transcriptional control of the P _tet promoter together with the lox71/66 flanking aacC1 gene. It was genomically integrated into the strain described in 1. After successful integration, the gentamicin resistance gene was removed from the genome as described above.

Example 6

Optimized fermentation process for the production of 2'-fucosyllactose

1 mL/L trace element solution (54.5 m/L ferric ammonium citrate, 9.8 g/L MnCl ₂ X 4H ₂ O, 1.6 g/L CoCl ₂ X 6H ₂ O, 1 g/L CuCl ₂ X 2H ₂ O, 1.9 g/L H ₃ BO ₃ , 9 g/L ZnSO ₄ X 7H ₂ O, 1.1 g/L Na ₂ MoO ₄ X 2H ₂ O, 1.5 g/L Na ₂ SeO ₃ , 1.5 g/L of NiSO ₄ X 6H ₂ O), 3 g/L of KH ₂ PO ₄ , 12 g/L of K ₂ HPO ₄ , 5 g/L (NH ₄ ) ₂ SO ₄ , 0.3 g/L of citric acid, 2 g/L MgSO ₄ X 7H ₂ O, 0.1 g/L NaCl and 0.015 g/L The E. coli strain described in Example 5 was cultured in a 3L culture tank at 33° C. using an optimized inorganic salt medium containing CaCl ₂ X 6H ₂ O and 2% glycerol as a carbon source batch. The pH was maintained at 7.0 by titration with 25% ammonia. The fermentor was inoculated with the pre-cultured growth in the same medium at an OD of 0.1 _{600 nm} . When the culture obtained an OD _{600 nm} of 5, lactose was added to obtain a concentration of 30 mM. A concentration of 20-30 mM lactose was maintained throughout the entire fermentation process and was adjusted according to HPLC-analysis. After the glycerol in the batch was consumed at a flow rate of 4.5 ml/L/h for 20 hours, glycerol feed (60% v/v) was started, followed by 5.7 ml/L/h for 33 hours and 18 hours in a cycle of 18 hours. 7.1 ml/L/h (feed ratio refers to starting volume). Overall, after 93 h, a 2'-fucosyllactose titer of 106.5 g/L (217 mM) was obtained.

Example 7

Engineering of strains producing enhanced 2'-fucosyllactose by metabolic challenge

Fructose-1,6 from peas to enhance the flux of metabolized carbon source glycerol through the triose-phosphate to fructose-6-phosphate gluconeogenesis pathway, which supplies GDP-L-fucose biosynthesis Genes encoding bisphosphate aldolase ( fbaB ) and heterologous fructose-1,6-bisphosphate phosphatase ( fbpase ) were overexpressed in the strains described in Example 5. this. The fbaB gene from E. coli BL21 (DE3) was fused with the Ptet promoter. The activity of chloroplastic pea FBPase was allosterically regulated by disulfide-dithiol exchange due to reduction of thioredoxin. Exchange of cysteine residue 153 to serine resulted in an essentially active enzyme. this. The gene encoding a chloroplastic FBPase from pea (accession number AAD10213 ) was purchased. The fbpase gene was transcribed from the T7 promoter. Cassette <P _tet -fbaB-P _T7 -His ₆ -fbpase-lox-aacC1-lox> (SEQ ID NO: 7) was used for EZ-Tn5™ transposase mediated integration in the host strain. this. After removal of the gentamicin resistance gene from the E. coli genome, the strain was used for 2'-fucosyllactose production.

Example 8

Production of 150 g/L 2'-fucosyllactose by fermentation process

A genetically modified strain producing 2'-fucosyllactose as described in Example 7 was cultured at 33°C in the same medium as described in Example 5. Additionally, for the 2% glycerol batch, 60 mM lactose was initially added to the fermentation medium. A continuous lactose feed with 0.66 M lactose was started at an OD _{600 nm} of about 10. Additionally, lactose supplementation was performed as a 1M stock-solution. Lactose concentration was maintained at approximately 30 mM. After starting the batch phase, the glycerol feed (60% v/v) was started at a flow rate of 6.9 ml/L/h for 37 hours (starting volume referred to as). After that, the feed was reduced to 9.4 ml/L/h over 19 hours and then raised to 7.3 ml/L/g over another 19 hours. A 2'-fucosyllactose titer of 150.2 g/L was reached at 93 hours after fermenter seeding.

Example 9

Production of 3-fucosyllactose from glycerol

E. with genomic integration of genes encoding enzymes for de novo synthesis of GDP-fucose (ManB, ManC, Gmd, WcaG). A strain producing 3-fucosyllactose was constructed using E. coli BL21(DE3) lacZ ΔwcaJ ΔfucIK.

The gene encoding the alpha-1,3-fucosyltransferase from Bacteroides fragilis (EP 2439264 A1) and E. E. coli (US2014/0120611 A1) with a gene encoding the sugar efflux transporter SetA and a gene conferring resistance to gentamicin. integrated into the E. coli genome. Fermentation of the strain for the production of 3-fucosyllactose was carried out under the conditions described in Example 6. The glycerol feed was started after starting the batch step at a feed rate of 7.4 ml/L/h (referring to the starting volume). When an OD of 30 _{600 nm} was reached, lactose was added to the culture to a concentration of 33 mM. Throughout the process, lactose was added to maintain a concentration of at least 10 mM in the supernatant. After 88 h, the process was stopped at a 3-fucosyllactose concentration of 30 g/L in the supernatant.

SEQUENCE LISTING <110> Jennewein Biotechnologie GmbH <120> IMPROVED PROCESS FOR THE PRODUCTION OF FUCOSYLATED OLIGOSACCHARIDES <130> IPA190398-DE <150> EP 16196486.1 <151> 2016-10-29 <160> 8 <170> PatentIn version 3.5 <2 10 > 1 <211> 6783 <212> DNA <213> Artificial Sequenz <220> <223> Transposon cassette <400> 1 gccagatgat taattcctaa tttttgttga cactctatca ttgatagagt tatttacca 60 ctccctatca gtgatagaga aaagtgaaat gaatagttcg acaaaaat ct agaaataatt 120 ttgtttaact ttaagaagga gatatacaat ttcgtcgaca cacaggaaac atattaaaaa 180 ttaaaacctg caggagtttg aaggagatag aaccatggcg cagtcgaaac tctatccagt 240 tgtgatggca ggtggctccg gtagccgctt atggccgctt tcccgcgtac tttatcccaa 300 gcagttttta tgcctgaaag gcgatctcac catgctgcaa accaccatct gccgcctgaa 360 cggcgtggag tgcgaaagcc cggtggtgat ttgcaatgag cagcaccgct ttattgtcgc 420 ggaacagctg cgtcaactga acaaacttac cgagaacatt attctcgaac cggcagggcg 480 aaacacggca cctgccattg cgctggcggc gctggcggca aaacgtcata gcccggagag 540 cgac ccgtta atgctggtat tggcggcgga tcatgtgatt gccgatgaag acgcgttccg 600 tgccgccgtg cgtaatgcca tgccatatgc cgaagcgggc aagctggtga ccttcggcat 660 tgtgccggat ctaccagaaa ccggttatgg ctatattcgt cgcggtgaag tgtctgcggg 720 tgagcaggat atggtggcct ttgaagtggc gcagtttgtc gaaaaaccga atctggaaac 780 cgctcaggcc tatgt ggcaa gcggcgaata ttactggaac agcggtatgt tcctgttccg 840 cgccggacgc tatctcgaag aactgaaaaa atatcgcccg gatatcctcg atgcctgtga 900 aaaagcgatg agcgccgtcg atccggatct caatttatt cgcgtggatg aagaagcgtt 960 tctcgcctgc ccggaagagt cggtggatta cgcggtcatg gaacgtacgg cagatgctgt 1020 tgtggtgccg atggatgcgg gctggagcga tgttggctcc tggtcttcat tatgggagat 1080 cagcgcccac accgccgagg gcaacgtttg ccacggcgat gtgattaatc acaaaactga 1140 aaacagctat gtgtatgctg aatctggcct ggtcaccacc gtcggggtga aagatctggt 1200 agtggtgcag accaaagatg cggtg ctgat tgccgaccgt aacgcggtac aggatgtgaa 1260 aaaagtggtc gagcagatca aagccgatgg tcgccatgag catcgggtgc atcgcgaagt 1320 gtatcgtccg tggggcaaat atgactctat cgacgcgggc gaccgctacc aggtgaaacg 1380 catcacc gtg aaaccgggcg agggcttgtc ggtacagatg caccatcacc gcgcggaaca 1440 ctgggtggtt gtcgcgggaa cggcaaaagt caccattgat ggtgatatca aactgcttgg 1500 tgaaaacgag tccatttata ttccgctggg ggcgacgcat tgcctggaaa acccggggaa 1560 aattccgctc gatttaattg aagtgcgctc cggctcttat ctcgaagagg atgatgtggt 1620 gcgtttcgcg gatcgctacg gacgggt gta aacgtcgcat caggcaatga atgcgaaacc 1680 gcggtgtaaa taacgacaaa aataaaattg gccgcttcgg tcagggccaa ctattgcctg 1740 aaaaagggta acgatatgaa aaaattaacc tgctttaaag cctatgatat tcgcgggaaa 1800 ttagg cgaag aactgaatga agatatcgcc tggcgcattg gtcgcgccta tggcgaattt 1860 ctcaaaccga aaaccattgt gttaggcggt gatgtccgcc tcaccagcga aaccttaaaa 2040 accgccagcc ataatccgat ggattataac ggcatgaagc tggt tcgcga gggggctcgc 2100 ccgatcagcg gagataccgg actgcgcgac gtccagcgtc tggctgaagc caacgacttt 2160 cctcccgtcg atgaaaccaa acgcggtcgc tatcagcaaa tcaacctgcg tgacgcttac 2220 gttgatcacc tgtt cggtta tatcaatgtc aaaaacctca cgccgctcaa gctggtgatc 2280 aactccggga acggcgcagc gggtccggtg gtggacgcca ttgaagcccg ctttaaagcc 2340 ctcggcgcgc ccgtggaatt aatcaaagtg cacaacacgc cggacggcaa tttccccaac 2400 ggtattccta acccactact gccggaatgc cgcgacgaca cccgcaatgc ggtcatcaaa 2460 cacggcgcgg atatgggcat tgcttttgat ggcgattttg accgct gttt cctgtttgac 2520 gaaaaagggc agtttattga gggctactac attgtcggcc tgttggcaga agcattcctc 2580 gaaaaaaatc ccggcgcgaa gatcatccac gatccacgtc tctcctggaa caccgttgat 2640 gtggtgactg ccgcaggtgg cac gccggta atgtcgaaaa ccggacacgc ctttattaaa 2700 gaacgtatgc gcaaggaaga cgccatctat ggtggcgaaa tgagcgccca ccattacttc 2760 cgtgatttcg cttactgcga cagcggcatg atcccgtggc tgctggtcgc cgaactggtg 2820 tgcctgaaag ataaaacgct gggcgaactg gtacgcgacc ggatggcggc gtttccggca 2880 agcggtgaga tcaacagcaa actggcgcaa cccgttgagg cgattaaccg cgtgga acag 2940 cattttagcc gtgaggcgct ggcggtggat cgcaccgatg gcatcagcat gacctttgcc 3000 gactggcgct ttaacctgcg cacctccaat accgaaccgg tggtgcgcct gaatgtggaa 3060 tcgcgcggtg atgtgccgct gatggaagcg cgaacgc gaa ctctgctgac gttgctgaac 3120 gagtaaaaac gcggccgcga tatcgttgta aaacgacggc cagtgcaaga atcataaaaa 3180 atttattgc tttcaggaaa atttttctgt ataatagatt cataaatttg agagaggagt 3240 ttttgtgagc ggataacaat tccccatctt agtattag ttaagtataa atacaccgcg 3300 gaggacgaag gagatagaac catgtcaaaa gtcgctctca tcaccggtgt aaccggacaa 3360 gacggttctt acc tggcaga gtttctgctg gaaaaaggtt acgaggtgca tggtattaag 3420 cgtcgcgcat cgtcattcaa caccgagcgc gtggatcaca tttatcagga tccgcacacc 3480 tgcaacccga aattccatct gcattatggc gacctgagtg atacctctaa cctgacgcgc 3 540 attttgcgtg aagtacagcc ggatgaagtg tacaacctgg gcgcaatgag ccacgttgcg 3600 gtctcttttg agtcaccaga atataccgct gacgtcgacg cgatgggtac gctgcgcctg 3660 ctggaggcga tccgcttcct cggtctggaa aagaaaactc gtttctatca ggcttccacc 3720 tctgaactgt atggtctggt gcaggaaatt ccgcagaaag agaccacgcc gttctacccg 3780 cgatctccgt atgcggtcgc caaactgtac gcctactgga tcaccgttaa ctaccgtgaa 3840 tcctacggca tgtacgcctg taacggaatt ctcttcaacc atgaatcccc gcgccgcggc 3900 gaaaccttcg ttacccgcaa aatcacccgc gcaatcgcca acatcgccca ggggctgg ag 3960 tcgtgcctgt acctcggcaa tatggattcc ctgcgtgact ggggccacgc caaagactac 4020 gtaaaaatgc agtggatgat gctgcagcag gaacagccgg aagatttcgt tatcgcgacc 4080 ggcgttcagt actccgtgcg tcagttcgtg gaaatggcgg cagcacagct gggcatcaaa 4140 ctgcgctttg aaggcacggg cgttgaagag aagggcattg tggtttccgt caccgggcat 4200 gacgcgccgg gcgttaa acc gggtgatgg attatcgctg ttgacccgcg ttacttccgt 4260 ccggctgaag ttgaaacgct gctcggcgac ccgaccaaag cgcacgaaaa actgggctgg 4320 aaaccggaaa tcaccctcag agagatggtg tctgaaatgg tggctaatga cctcgaag cg 4380 gcgaaaaaac actctctgct gaaatctcac ggctacgacg tggcgatcgc gctggagtca 4440 taagcatgag taaacaacga gtttttattg ctggtcatcg cgggatggtc ggttccgcca 4500 tcaggcggca gctcgaacag cgcggtgatg tggaactggt attacgcacc cgcgacgagc 4560 tgaacctgct ggacagccgc gccgtgcatg atttctttgc cagcgaacgt attgaccagg 4620 tctatctggc ggcggcgaaa gt c gagttgttg cagggcacgc tggagccgac taacgagcct tatgctattg 4860 ccaaaatcgc cgggatcaaa ctgtgcgaat catacaaccg ccagtacgga cgcgattacc 4920 gctcagtcat gccgaccaac ctgtacgggc cacacgacaa cttccacccg agtaattcgc 4980 atgtgatccc agcattgctg cgtcgcttcc acgaggcgac ggcacagaat gcgccggacg 5040 tggtggtatg gggcagcggt acaccgatgc gcgaatttct gc acgtcgat gatatggcgg 5100 cggcgagcat tcatgtcatg gagctggcgc atgaagtctg gctggagaac acccagccga 5160 tgttgtcgca cattaacgtc ggcacgggcg ttgactgcac tatccgcgag ctggcgcaaa 5220 ccatcgccaagt aggtgggt tacaaagg cc gggtggtttt tgatgccagc aaaccggatg 5280 gcacgccgcg caaactgctg gatgtgacgc gcctgcatca gcttggctgg tatcacgaaa 5340 tctcactgga agcggggctt gccagcactt accagtggtt ccttgagaat caagaccgct 5400 ttcggggggg gagctaacgc gccatttaaa tcaacctcag cggtcatagc tgtttcctgt 5460 gactgagcaa taactagcat aaccccttgg ggcctctaaa cgggtcttga gg ggtttttt 5520 gctgaaacca atttgcctgg cggcagtagc gcggtggtcc cacctgaccc catgccgaac 5580 tcagaagtga aacgccgtag cgccgatggt agtgtggggt ctccccatgc gagagtaggg 5640 aactgccagg catcaaataa aacgaaaggc tcagtcgaaa gactgggcct ttcgggatcc 5700 aggccggcct gttaacgaat taatcttccg cggcggtatc gataagcttg atatcgaatt 5760 ccgaagttcc tattctctag aaagtatagg aacttcaggt ctgaagagga gtttacgtcc 5820 agccaagcta gcttggctgc aggtcgtcga aattctaccg ggtaggggag gcgcttttcc 5880 caaggcagtc tggagcatgc gctttagcag ccccgctggg cacttggcgc tacacaagtg 5940 gcctctggcc tcgcacacat tccacatcca ccggtaggcg ccaaccggct ccgttctttg 6000 gtggcccctt cgcgccacct tctactcctc ccctagtcag gaagttcccc cccgccccgc 6060 agctcgcgtc gtgcaggacg tgacaaatgg aagtagcac g tctcactagt ctcgtgcaga 6120 tggacagcac cgctgagcaa tggaagcggg taggcctttg gggcagcggc caatagcagc 6180 tttgctcctt cgctttctgg gctcagaggc tgggaagggg tgggtccggg ggcgggctca 6240 ggggcgggct caggggcggg gcgggcgccc gaaggtcctc cggaggcccg gcattctgca 6300 cgcttcaaaa gcgcacgtct gccgcgctgt tctcctcttc ctcatctccg ggcctttc ga 6360 cctgcagcct gttgacaatt aatcatcggc atagtatatc ggcatagtat aatacgacaa 6420 ggtgaggaac taaaccatgg gtcaaagtag cgatgaagcc aacgctcccg ttgcagggca 6480 gtttgcgctt cccctgagtg ccacctttgg cttaggggat cgcgtac gca agaaatctgg 6540 tgccgcttgg cagggtcaag tcgtcggttg gtattgcaca aaactcactc ctgaaggcta 6600 tgcggtcgag tccgaatccc acccaggctc agtgcaaatt tatcctgtgg ctgcacttga 6660 acgtgtggcc taatgagggg atcaattctc tagagctcgc tgatcagaag ttcctattct 6720 ctagaaagta taggaacttc gatggcgcct catccctgaa gccaataggg ataacagggt 6780 aat 6783 <210> 2 <211> 2851 <212> DNA <213> Artificial Sequence <220> <223> integration cassette <400> 2 tggccagatg attaattcct aatttttgtt gacactctat cattgataga gttattttac 60 cactccctat cagtgataga gaaaagtgaa atgaatagtt cgacaaaaat ctagaaataa 120 ttttgtttaa ctttaagaag gagatataca aatgtactat ttaaaaaaca caaacttttg 180 gatgttcggt ttattctttt tcttttactt ttttatcatg ggagcctact tcccgttttt 240 cccgatttgg ctacatgaca tcaaccatat cagcaaaagt gatacgggta ttatttttgc 300 cgctatttct ctgttctcgc tattattcca accgctgttt ggtctgcttt ctgacaaact 360 cgggctgcgc aaatacctgc tgtggattat taccggcatg ttagtgatgt ttgcgccgtt 420 ctttattttt atcttcgggc cactgttaca atacaacatt ttagtaggat cgattgttgg 480 tggtatttat ctaggctttt gttttaacgc cggtgcgcca gcagtagagg catttattga 540 gaaagtcagc cgtcgcagta atttcgaatt tggtcgcgcg cggatgtttg gctgtgttgg 600 ctgggcg ctg tgtgcctcga ttgtcggcat catgttcacc atcaataatc agtttgtttt 660 ctggctgggc tctggctgg cactcatcct cgccgtttta ctctttttcg ccaaaacgga 720 tgcgccctct tctgccacgg ttgccaatgc ggtaggtgcc aaccattcgg catttag cct 780 taagctggca ctggaactgt tcagacagcc aaaactgtgg tttttgtcac tgtatgttat 840 tggcgtttcc tgcacctacg atgtttttga ccaacagttt gctaatttct ttacttcgtt 900 ctttgctacc ggtgaacagg gtacgcgggt atttggctac gtaacgacaa tgggcgaatt 960 acttaacgcc tcgattatgt tctttgcgcc actgatcatt aatcgcatcg gtgggaaaaa 1020 cgccctgctg ct ggctggca ctattatgtc tgtacgtatt attggctcat cgttcgccac 1080 ctcagcgctg gaagtggtta ttctgaaaac gctgcatatg tttgaagtac cgttcctgct 1140 ggtgggctgc tttaaatata ttaccagcca gtttgaagtg cgtttttcag cgacgattta 1200 tctggtctgt ttctgcttct ttaagcaact ggcgatgatt tttatgtctg tactggcggg 1260 caatatgtat gaaagcatcg gtttccaggg cgctttctg gtgctgggtc tggtggcgct 1320 gggcttcacc ttaatttccg tgttcacgct tagcggcccc ggcccgcttt ccctgctgcg 1380 tcgtcaggtg aatgaagtcg ctgggagcta agcggccgcg tcgacacgca aaaaggccat 1440 ccgtcaggat ggccttctgc ttaatttgat gcctggcagt ttatggcggg cgtcctgccc 1500 gccaccctcc gggccgttgc ttcgcaacgt tcaaatccgc tcccggcgga tttgtcctac 1560 tcaggagagc gttcaccgac aaacaacaga taaaacgaaa ggcccagtct t tcgactgag 1620 cctttcgttt tatttgatgc ctggcagttc cctactctcg catggggaga ccccacacta 1680 ccatcatgta tgaatatcct ccttagttcc tattccgaag ttcctattct ctagaaagta 1740 taggaacttc ggcgcgtcct acctgtgaca cgcgtgccgc agtctcacgc ccggagcgta 1800 gcgaccgagt gagctagcta tttgtttatt tttctaaata cattcaaata tgtatccgct 1860 catgagacaa taaccctgat aaatgcttca ataat attga aaaaggaaga gtatgaggga 1920 agcggtgatc gccgaagtat cgactcaact atcagaggta gttggcgtca tcgagcgcca 1980 tctcgaaccg acgttgctgg ccgtacattt gtacggctcc gcagtggatg gcggcctgaa 2040 gccacacagt gatattgatt tgctgg ttac ggtgaccgta aggcttgatg aaacaacgcg 2100 gcgagctttg atcaacgacc ttttggaaac ttcggcttcc cctggagaga gcgagattct aa agcaagag aacatagcgt 2340 tgccttggta ggtccagcgg cggaggaact ctttgatccg gttcctgaac aggatctatt 2400 tgaggcgcta aatgaaacct taacgctatg gaactcgccg cccgactggg ctggcgatga 2460 gcgaaatgta gtgcttacgt tgtccc gcat ttggtacagc gcagtaaccg gcaaaatcgc 2520 gccgaaggat gtcgctgccg actgggcaat ggagcgcctg ccggcccagt atcagcccgt 2580 catacttgaa gctagacagg cttatcttgg acaagaagaa gatcgcttgg cctcgcgcgc 2640 agatcagttg gaagaatttg tccactacgt gaaaggcgag atcaccaagg tagtcggcaa 2700 ataatgtcta acaattcgtt caagccgagg ggccgcaaga tccggccacg atgacccgg t 2760 cgtcgggtac cggcagggcg gggcgtaagg cgcgccattt aaatgaagtt cctattccga 2820 agttcctatt ctctagaaag tataggaact t 2851 <210> 3 <211> 2858 <212> DNA <213> Artificial Sequence <220> <223> Integration Cassette <400> 3 ggccagatga ttaatttttttg acactctAg ATTTTTACC 60 Acttttacc 60 TTC gacaaaaatc tagaataat 120 ttttttttaac tttttttttttttttaaggggggttacaa atgggcagttcagttcagtctct Gcaggggtgt 180 CCGCTGTATTAG CCATTAG CCATTATGCC GAAACATTAG ATCATGTGTGTGTG 300 AATAATCTGC AgatCGA AGAATCTGGG cagtattata ccccgaaaat taataatatt 360 tataaactgc tggtgcgtgg cagccgtctg tatccggata ttttctgtt tctgggcttt 420 tgcaacgaat ttcatgccta tggctacgat tttgaatata ttgcccagaa atggaaaagc 480 aaaaaataca t tggctactg gcagagcgaa cacttttttc ataaacatat tctggacctg 540 aaagaatttt ttattccgaa aaatgtgagc gaacaggcaa atctgctggc agcaaaaatt 600 ctggaaagcc agagcagcct gagcattcat attcgtcgtg gcgattatat taaaaacaaa 660 accgcaaccc tgacacatgg tgtttgtagc ctggaatatt ataaaaaagc cctgaacaaa 720 atccgcgatc tggcaatgat tcgtgatgtg tttatcttta a gcagcgcaa gccagattgt tatttatccg 960 accccgtggt atgatattac cccgaaaaac acctatatcc cgattgtgaa ccattggatc 1020 aacgttgata aacatagcag ctgctaagcg gccgcgtcga cacgcaaaaa ggccatccgt 1080 caggatggcc ttctgcttaa tt tgatgcct ggcagtttat ggcgggcgtc ctgcccgcca 1140 ccctccgggc cgttgcttcg caacgttcaa atccgctccc ggcggatttg tcctactcag 1200 gagagcgttc accgacaaac aacagataaa acgaaaggcc cagtctttcg actgagcctt 1260 tcgttttatt tgatgcctgg cagttcccta ctctcgcatg gggagacccc acactaccat 1320 catgtatgaa tatcctcctt agttcctatt ccgaagt a gctactggg ctatctggac aagggaaaac gcaagcgcaa 1560 agagaaagca ggtagcttgc agtgggctta catggcgata gctagactgg gcggttttat a caagatgga ttgcacgcag 1800 gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg 1860 gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca 1920 agaccgacct gtccggt gcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc 1980 tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg 2040 actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg 2100 ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta 2160 cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cgg atggaag 2220 ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac 2280 tgttcgccag gctcaaggcg cgcatgcccg acggcgagga tctcgtcgtg acccatggcg 2340 atgcctgctt gccgaatatc atggtggaaa atggccgct t ttctggattc atcgactgtg 2400 gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg 2460 aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg 2520 attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgagcg ggactctggg 2580 gttcgaaatg accgaccaag cgacgcccaa cctgccatca cgagatttcg attccaccgc 2640 cgccttctat gaaaggttgg gcttcggaat cgttttccgg gacgccggct ggatgatcct 2700 ccagcgcggg gatctcatgc tggagttctt cgcccacccc agcttcaaaa gcgctctcgg 2760 taccggcagg gcggggcgta aggcgc gcca tttaaatgaa gttcctattc cgaagttcct 2820 attctctaga aagtatagga acttcgaagc agctccag 2858 <210> 4 <211> 2631 <212> DNA <213> Artificial Sequence <220> <223> integration cassette <400> 4 ggccagatga ttaattccta atttttgttg acactctatc attgatagag ttattttacc 60 actccctatc agtgatagag aaaagtgaaa tgaatagttc gacaaaaatc tagaaataat 12 0 tttgtttaac tttaagaagg agatatacaa atgaagtcgg cactgacctt ttcccgtcgc 180 atcaatccgg tgtttctggc gttctttgtc gttgcttttc tgagcggtat cgcaggcgca 240 ctgcaggctc cgaccctgag tctgtttctg tccacggaag tgaaagttcg tccgctgtgg 300 gttggtctgt tctataccgt caacgcaatc gctggcatta cggttagctt tatcctggcg 360 aaacgttcag attcgcg cgg tgaccgtcgc aagctgatta tggtgtgcta tctgatggcg 420 gttggcaact gtctgctgtt tgccttcaat cgtgattacc tgaccctgat cacggcaggt 480 gtgctgctgg cgagcgttgc caacaccgca atgccgcaga ttttcgcgct ggcccgtgaa 540 tatgccgaca gctctgcacg cgaagtggtt atgtttagtt ccatcatgcg cgctcaactg 600 agtctggcat gggtgattgg tccgccgctg tcctttatgc tggcgctgaa ttacggtttt 660 accctgatgt tctcaatcgc ggccggcatt ttcgttctgt cggccctggt cgtgtggttt 720 atcctgccga gtgtcccgcg tgcagaaccg gttgtcgatg caccggtggt tgtccagggt 780 tcactgttcg cagacaaaaa cgttctgctg ctgtttatcg cgtcgatgct gatgtggacc 840 tgcaatacga tgtatattat cgatatgccg ctgtacatta ccgcaagcct gggtctgccg 900 gaacgtctgg ctggtctgct gatgggtacc gcagctggcc tggaaatt g atcatgctg 960 ctggcgggtt attctgtgcg ttactttggc aaacgcaaga ttatgctgtt cgctgttctg 1020 gcgggtgtcc tgttttatac cggcctggtt ctgtttaaat tcaagacggc cctgatgctg 1080 ctgcagatct ttaacgcaat tttcatcggt att gtggctg gcattggtat gctgtacttc 1140 caagatctga tgccgggtcg tgcaggtgca gcaaccacgc tgtttaccaa tagcatctct 1200 acgggtgtca ttctggcagg cgtgctgcaa ggcggtctga ccgaaacgtg gggccatgac 1260 agcgtctatg tgatggcgat ggtcctgtct attctggccc tgattatctg tgcacgtgg 1320 cgcgaagctt aaatcgatac tagcataacc ccttggggcc tctaaacgcg t gtt caccgac aaacaacaga taaaacgaaa ggcccagtct 1560 ttcgactgag cctttcgttt tatttgatgc ctggcagttc cctactctcg catggggaga 1620 ccccacacta ccatcatgta tgaatatcct ccttagttcc tattccgaag ttcctattct 1680 ctagaaagta taggaacttc ggcgcgtcct acctgtgacg gaagatcact tcgcagaata 1740 aataaatcct ggtgtccctg ttgataccgg gaagccctgg gccaactttt ggcgaaaatg 1800 ag acgttgat cggcacgtaa gaggttccaa ctttcaccat aatgaaataa gatcactacc 1860 gggcgtattt tttgagttgt cgagattttc aggagctaag gaagctaaaa tggagaaaaa 1920 aatcactgga tataccaccg ttgatatatc ccaatggcat cgtaaagaac attttgaggc 1980 atttcagtca gttgctcaat gtacctataa ccagaccgtt cagctggata ttacggcctt 2040 tttaaagacc gtaaagaaaa ataagcacaa gttttatccg gccttattc acattcttgc 2100 ccgcctgatg aatgctcatc cggaattacg tatggcaatg aaagacggtg agct ggtgat 2160 atgggatagt gttcaccctt gttacaccgt tttccatgag caactgaaa cgttttcatc 2220 gctctggagt ga ataccacg acgatttccg gcagtttcta cacatatatt cgcaagatgt 2280 ggcgtgttac ggtgaaaacc tggcctattt ccctaaaggg ttattgaga atatgttttt 2340 cgtctcagcc aatccctggg tgagtttcac cagttttgat ttaaacgtgg ccaatatgga 24 00 caacttcttc gccccccgttt tcaccatggg caaatattat acgcaaggcg acaaggtgct 2460 gatgccgctg gcgattcagg ttcatcatgc cgtttgtgat ggcttccatg tcggcagatg 2520 cttaatgaat acaacagtac tgcgatgagt ggcagggcgg ggcgtaaggc gcgccattta 2580 aatgaagttc ctattccgaa gttcctattc tctagaaagt ataggaactt c 2631 <210> 5 <211> 4259 <21 2> DNA <213> Artificial Sequence <220> <223> integration cassette <400> 5 ttactcagca ataaactgat attccgtcag gctggaatac tcttcgccag gacgcaggaa 60 gcagtccggt tgcggccatt cagggtggtt cgggctgtcc ggtagaaact cgctttccag 120 agccagccct tgccagtcgg cgtaaggttc ggttccccgc gacggtgtgc cgccgaggaa 180 gttgccggag tagaattgca gag ccggagc ggtggtgtag accttcagct gcaatttttc 240 atctgctgac cagacatgcg ccgccacttt cttgccatcg cctttggcct gtaacaagaa 300 tgcgtgatcg taacctttca ctttgcgctg atcgtcgtcg gcaagaaact cactggcgat 360 gattttggc g ctgcggaaat caaaagacgt tccggcgaca gatttcaggc cgtcgtgcgg 420 aatgccgcct tcatcaaccg gcagatattc gtccgccaga atctgcaact c catcatctg aactcagggc 660 aaacagcacc tgacgatcgt tctggttcac aatctgccag cgacgtttgt cgaacccttc 720 cggcccgccg tgcagctggt taacgccctg acttggcgaa agcgtcacgg tttcaccgtc 780 aaaggtataa cggctattgg cgatacggt t ggcataacga ccaatagagg cccccagaaa 840 cgcggcctga tcctgatagc attccgggct ggcacagccg agcagcgcct cgcggacgct 900 gccatcggaa agcggaatac gggcggaaag taaagtcgca ccccagtcca tcagcgtgac 960 taccatccct gcgttgttac gcaaagttaa cagtcggtac ggctgaccat cgggtgccag 1020 tgcgggagtt tcgttcagca ctgtcctgct ccttgtgatg gtttacaaac gtaaaaagtc 1080 tctttaatac ctgtttttgc ttcatattgt tcagcgacag cttgctgtac ggcaggcacc 1140 agctcttccg ggatcagcgc gacgatacag ccgccaaatc cgccgccggt catgcgtacg 1200 ccacctttgt cgcc aatcac agctttgacg atttctacca gagtgtcaat ttgcggcacg 1260 gtgatttcga aatcatcgcg catagaggca tgagactccg ccatcaactc gcccatacgt 1320 ttcaggtcgc cttgctccag cgcgctggca gcttcaacgg tgcgggcgtt ttcagtcagt 1380 atatgacgca cgcgttttgc cacgatcggg tccagttcat gcgcaacagc gttgaactct 1440 tcaatggtga catcacgcag ggctggctgc tggaaga aac gcgcaccggt ttcgcactgt 1500 tcacgacggg tgttgtattc gctgccaacc agggtacgtt tgaagttact gttgatgatg 1560 acgacagcca cacctttggg catggaaact gctttggtcc ccagtgagcg gcaatcgatc 1620 agcaaggcat gatctt tctt gccgagcgcg gaaattagct gatccatgat cccgcagtta 1680 cagcctacaa actggttttc tgcttcctga ccgttaagcg cgatttgtgc gccgtccagc 1740 ggcagatgat aaagctgctg caatacggtt ccgaccgcga cttccagtga agcggaagaa 1800 cttaacccgg caccctgcgg cacattgccg ctgatcacca tgtccacgcc gccgaagctg 1860 ttgttacgca gttgcagatg tttcaccacg ccacgaacgt agttagccca ttga tagtt 1920 tcatgtgcga caatgggcgc atcgagggaa aactcgtcga gctgattttc ataatcggct 1980 gccatcacgc gaactttacg gtcatcgcgt ggtgcacaac tgatcacggt ttgataatca 2040 atcgcgcagg gcagaacgaa accgtcgttg tagtc ggtgt gttcaccaat caaattcacg 2100 cggccaggcg cctgaatggt gtgagtggca gggtagccaa atgcgttggc aaacagagat 2160 tgtgtttttt ctttcagact catttcttac actccggatt cgcgaaaatg gatatcgctg 2220 actgcgcgca aacgctctgc tgcctgttct gcggtcaggt ctcgctgggt ctctgccagc 2280 atttcataac caaccataaa tttacgtacg gtggcggagc gcagcagagg cggataaaag 2340 t gcgcgtgca gctgccagtg ttgattctct tcgccattaa atggcgcgcc gtgccagccc 2400 atagagtagg ggaaggagca ctggaagagg ttgtcataac gactggtcag ctttttcaac 2460 gccagcgcca gatcgctgcg ctgggcgtcg gtcaaatcgg tga tccgtaa aacgtgggct 2520 ttgggcagca gtagcgtttc gaacggccag gcagcccagt aaggcacgac ggctaaccag 2580 tgttcggttt cgacaacggt acggctaccg tctgccagct cgcgctgaac ataatccacc 2640 agcattggtg atttctgttc ggcaaaatat tctttttgca ggcggtcttc gcgctcagct 2700 tcgttaggca ggaagctatt tgcccaaatc tgaccgtgcg gatgcgggtt agagcagccc 2760 atcgccgcgc ctttgttttc aaaaacctgc acccatgggt acgttttccc cagttctgcg 2820 gtttgctcct gccaggtttt gacgatttcc gtcaatgctg caacgctgag ctctggcagc 2880 gttttactgt gatccggtga aaagcagatc acccggctgg tg ccgcgcgc gctctggcaa 2940 cgcatcagcg gatcgtgact ttctggcgca tctggcgtgt cagacatcaa agccgcaaag 3000 tcattagtga aaacgtaagt cccggtgtaa tcggggtttt tatcgcctgt cacccgcaca 3060 ttacctgcgc agaggaagca atctggatcg tgcgcaggta acacctgttt ggctggcgtt 3120 tcctgcgccc cctgccaggg gcgcttagcg cggtgcggtg aaaccagaat ccattgcccg 3180 gtgagcgggt t gtagcggcg atgtggatga tcaacgggat taaattgcgt catggtcgtt 3240 ccttaatcgg gatatccctg tggatggcgt gactgccagt gccaggtgtc ctgcgccatt 3300 tcatcgagtg tgcgcgttac gcgccagttc agttcacggt cggctttgct ggcgtccgcc 3360 cagtaggccg gaaggtcgcc ctcgcgacgc ggtgcaaaat gataattaac cggtttgccg 3420 caggctttgc tgaaggcatt aaccacgtcc agcacgctgt tgcctacgcc agcgccgagg 3480 ttgtagatgt gtacgcctgg cttgttcgcc agtttttcca tcgccacgac gtgaccgtcc 3540 gccagatcca ttacgtgat gtaatcgcgt acgccagtac catcttcggt cggataatcg 3600 ttaccaaaaa tcgccagcga gtc gcgacgg cctacagcaa cctgggcgat gtatggcatc 3660 aggttattcg gaatgccttg cggatcttcg cccatatcgc ccgacggatg cgcgccaacc 3720 gggttgaagt agcgcagcag ggcaatgctc cagtccggct gggctttttg cagatcggtg 3 780 aggatctgtt ccaccatcag cttgcttttg ccgtaagggc tttgcggtgt gccggtcggg 3840 aagctttcaa cgtatggaat tttgggctga tcgccataaa cggtggcgga ggagctaaaa 4020 aagtggatca cggtgtcgat agcgtgatcg t gcaggatct cggtcatcaa cgcttcgtta 4080 cgaatatcgc cttcaacaaa cgttggatgt ttgccgccta aacgctcgat aacaggcagt 4140 acgctgcgct tactgttaca gaggttatca agaatgatga catcatgacc gttttgcagt 4200 aattgcacac aggtatgact tccaatgtaa ccgctaccac cggtaaccag aactctcat 4259 <210> 6 <211> 4223 <212> DNA <213> Artificial Sequence <220> <223> integration cassette <400> 6 tggccagatg attaattcct aatttttgtt gacactctat cattgataga gttatttac 60 cactccctat cagtgataga gaaaagtgaa atgaatagtt cgacaaaaat ctagaaataa 120 ttt tgtttaa ctttaagaag gagatataca aatgcaaaaa ctactatctt taccgtccaa 180 tctggttcag tcttttcatg aactggagag ggtgaatcgt accgattggt tttgtacttc 240 cgacccggta ggtaagaaac ttggttccgg tggtggaaca tcctggctgc ttgaagaatg 300 ttataatgaa tattcagatg gtgctacttt tggagagtgg cttgaaaaag aaaaaagaat 360 tcttcttcat gcgggtgggc aaagccgtcg tttacccggc tatg cacctt ctggaaagat 420 tctcactccg gttcctgtgt tccggtggga gagagggcaa catctgggac aaaatctgct 480 ttctctgcaa cttcccctat atgaaaaaat catgtctttg gctccggata aactccatac 540 actgattgcg agtggtgatg tctatattcg tt cggagaaa cctttgcaga gtattcccga 600 agcggatgtg gtttgttatg gactgtgggt agatccgtct ctggctaccc atcatggcgt 660 gtttgcttcc gatcgcaaac atcccgaaca actcgacttt atgcttcaga agccttcgtt 720 ggcagaattg gaatctttat cgaagaccca tttgttcctg atggacatcg gtatatggct 780 tttgagtgac cgtgccgtag aaatcttgat gaaacgttct cataaagaaa gctctgaaga 840 act aaagtat tatgatcttt attccgattt tggattagct ttgggaactc atccccgtat 900 tgaagacgaa gaggtcaata cgctatccgt tgctattctg cctttgccgg gaggagagtt 960 ctatcattac gggaccagta aagaactgat ttcttcaact ctttccgtac agaataaggt 102 0 ttacgatcag cgtcgtatca tgcaccgtaa agtaaagccc aatccggcta tgtttgtcca 1080 aaatgctgtc gtgcggatac ctctttgtgc cgagaatgct gatttatgga tcgagaacag 1140 tcatatcgga ccaaagtgga agattgcttc acgacatatt attaccgggg ttccggaaaa 1200 tgactggtca ttggctgtgc ctgccggagt gtgtgtagat gtggttccga tgggtgataa 126 0 gggctttgtt gcccgtccat acggtctgga cgatgttttc aaaggagatt tgagagattc 1320 caaaacaacc ctgacgggta ttccttttgg tgaatggatg tccaaacgcg gtttgtcata 1380 tacagatttg aaaggacgta cggacgattt acaggcagtt t ccgtattcc ctatggttaa 1440 ttctgtagaa gagttgggat tggtgttgag gtggatgttg tccgaacccg aactggagga 1500 aggaaagaat atctggttac gttccgaaca ttttctgcg gacgaaattt cggcaggtgc 1560 caatctgaag cgtttgtatg cacaacgtga agagttcaga aaaggaaact ggaaagcatt 1620 ggccgttaat catgaaaaaa gtgtttttta tcaacttgat ttggccgatg cagctgaaga 1680 ttttgtacgt cttggtttgg atatgcctga attattgcct gaggatgctc tgcagatgtc 1740 acgcatccat aaccggatgt tgcgtgcgcg tattttgaaa ttagacggga aagattatcg 1800 tccggaagaa caggctgctt ttgatttgct tcgtgacggc ttgctggac g ggatcagtaa 1860 tcgtaagagt accccaaaat tggatgtata ttccgatcag attgtttggg gacgtagccc 1920 cgtgcgcatc gatatggcag gtggatggac cgatactcct ccttattcac tttattcggg 1980 aggaaatgtg gtgaatctag ccattgagtt gaacggacaa cctcccttac aggtctatgt 2040 gaagccgtgt aaagacttcc atatcgtcct gcgttctatc gatatgggtg ctatggaaat 2100 agtatctacg tttgatgaat tgca agatta taagaagatc ggttcacctt tctctattcc 2160 gaaagccgct ctgtcattgg caggctttgc acctgcgttt tctgctgtat cttatgcttc 2220 attagaggaa cagcttaaag atttcggtgc aggtattgaa gtgactttat tggctgctat 2280 tcctgccgg t tccggtttgg gcaccagttc cattctggct tctaccgtac ttggtgccat 2340 taacgatttc tgtggtttag cctgggataa aaatgagatt tgtcaacgta ctcttgttct 2400 tgaacaattg ctgactaccg gaggtggatg gcaggatcag tatggaggtg tgttgcaggg 2460 tgtgaagctt cttcagaccg aggccggctt tgctcaaagt ccattggtgc gttggctacc 2520 cgatcattta tttacgcatc ctgaatacaa agactgtcac ttgctttatt ataccggtat 2580 aactcgtacg gcaaaaggga tcttggcaga aatagtcagt tccatgttcc tcaattcatc 2640 gttgcatctc aatttacttt cggaaatgaa ggcgcatgca ttggatatga atgaagctat 2700 acagcgtgga agtttt gttg agtttggccg tttggtagga aaaacctggg aacaaaacaa 2760 agcattggat agcggaacaa atcctccggc tgtggaggca attatcgatc tgataaaaga 2820 ttataccttg ggatataaat tgccgggagc cggtggtggc gggtacttat atatggtagc 2880 gaaagatccg caagctgctg ttcgtattcg taagatactg acagaaaacg ctccgaatcc 2940 gcgggcacgt tttgtcgaaa tgacgttatc tgataa ggga ttccaagtat cacgatcata 3000 actgaaacca atttgcctgg cggcagtagc gcggtggtcc cacctgaccc catgccgaac 3060 tcagaagtga aacgccgtag cgccgatggt agtgtggggt ctccccatgc gagagtaggg 3120 aactgccagg catcaaataa aacgaaaggc tcagtcgaaa gactgggcct ttcgggatcc 3180 aggccggcct gttaagacgg ccagtgaatt cgagctcggt acctaccgtt cgtataatgt 3240 atgctatacg aagttatcga gctctagaga atgatcccct cattaggcca cacgttcaag 3300 tgcagcgcac accgtggaaa cggatgaagg cacgaaccca gttgacataa gcctgttcgg 3360 ttcgtaaact gtaatgcaag tagcgtatgc gctcacgcaa ctggtccaga accttgacc a gcaacgatg ttacgcagca gggcagtcgc 3600 cctaaaacaa agttaggtgg ctcaagtatg ggcatcattc gcacatgtag gctcggccct 3660 gaccaagtca aatccatgcg ggctgctctt gatcttttcg gtcgtgagtt cggagacgta 3720 gccacctact cccaacatca gccggactcc gattacctcg ggaacttgct ccgtagtaag 3780 acattcatcg cgcttgctgc cttcgaccaa gaagcggttg ttggcgctct cgcggctt ac 3840 gttctgccca ggtttgagca gccgcgtagt gagatctata tctatgatct cgcagtctcc 3900 ggcgagcacc ggaggcaggg cattgccacc gcgctcatca atctcctcaa gcatgaggcc 3960 aacgcgcttg gtgcttatgt gatctacgtg caagcagatt acggtg acga tcccgcagtg 4020 gctctctata caaagttggg catacgggaa gaagtgatgc actttgatat cgacccaagt 4080 accgccacct aacaattcgt tcaagccgag atcgtagaat ttcgacgacc tgcagccaag 4140 cataacttcg tataatgtat gctatacgaa cggtaggatc ctctagagtc gacctgcagg 4200 catgagatgt gtataagaga cag 4223 <210> 7 <211> 3792 <212> DNA <213> Artificial Sequence <220> <223> integration cassette <400> 7 gggaattgat tctggtacca aatgagtcga ccggccagat gattaattcc taatttttgt 60 tgacactcta tcattgatag agttatttta ccactcccta tcagtgatag agaaaagtga 120 aatgaatagt tcgacaaaaa tctagaaata attttgttta actttaagaa ggagatatac 180 aaatgattac ccgcaaaagg cgggccagga caatccatag ccgatatcc a atcggaattt 240 acgggagcat agtaatgaca gatattgcac agttgcttgg caaagacgcc gacaaccttt 300 tacagcaccg ttgtatgact attccttctg accagcttta tctccccgga catgactacg 360 tagaccgcgt gatgattgac aataatcgcc cgccagcggt gttacgtaat atgcagacgt 420 tgtacaacac tgggcgtctg gctggcacag gatatctttc tattctgccg gttgaccagg 480 gcgttgagca ctctgccgga gcttcatttg ctgctaaccc gctctacttt gacccgaaaa 540 acattgttga actggcgatc gaagcgggct gtaactgtgt ggcatcaact tacggcgtgt 600 tggcgtcggt atcgcggcgc tatgcgcatc gcattccatt cctcgtcaaa cttaatcaca 660 acgagacgct aagttacccg aacacctacg atcaaacgct gtatgccagc gtggagcagg 720 ccttcaacat gggcgcggtg gcggttggtg cgactatcta ttttggttcg gaagagtcac 780 gtcgccagat tgaagaaatt tctgcggctt ttga acgtgc gcacgagctg ggcatggtga 840 cagtgctgtg ggcctatttg cgtaactccg cctttaagaa agatggcgtt gattaccatg 900 c gttatcagt 1080 tagctaactg ctatatgggc cgggccgggt tgataaactc cggcggtgct gcaggcggtg 1140 aaactgacct cagcgatgca gtgcgtactg cggttatcaa caaacgcgct ggcggaatgg 1200 ggctgattct tggacgtaag gcgttcaaga aatcga tggc tgacggcgtg aaactgatta 1260 acgccgtgca ggatgtttat ctcgatagca aaattactat cgcctaagag gatcgagatc 1320 tcgatcccgc gaaattaata cgactcacta taggggaatt gtgagcggat aacaattccc 1380 ctctagaaat aattttgttt aactttaaga aggagatata ccatgggcca tcatcatcat 1440 catcatcatc atcatcacag cagcggccat atcgaaggtc gtcatatggc ggtgaaagaa 1500 gcgaccagcg agaccaaga a gcgtagcggt tacgagatca ttaccctgac cagctggctg 1560 ctgcaacaag aacagaaggg tatcattgac gcggaactga ccatcgttct gagcagcatt 1620 agcatggcgt gcaaacagat cgcgagcctg gtgcaacgtg cgaacattag caacctgacc 1680 ggtacccaag gcg cggttaa catccagggt gaagaccaaa agaaactgga tgttattagc 1740 aacgaggtgt tcagcaactg cctgcgtagc agcggtcgta ccggcatcat tgcgagcgag 1800 gaagaggacg tggcggttgc ggtggaagag agctacagcg gtaactatat cgtggttttt 1860 gacccgctgg atggcagcag caacctggat gcggctgtga gcaccggtag catcttcggc 1920 at ttacagcc cgaacgacga gagcctgccg gattttggtg acgatagcga cgataacacc 1980 ctgggcaccg aagagcaacg ttgcatcgtt aacgtggcc aaccgggtag caacctgctg 2040 gcggcgggct actgcatgta tagcagcagc gttgcgttcg tgctgaccat tggcaag ggc 2100 gttttcgtgt ttaccctgga cccgctgtac ggtgaattcg tgctgaccca ggagaacctg 2160 caaatcccga agagcggtga aatttacagc tttaacgagg gcaactataa actgtgggat 2220 gaaaacctga agaaatatat cgacgatctg aaggaaccgg gtccgagcgg taaaccgtac 2280 agcgcgcgtt atatcggtag cctggttggc gacttccacc gtaccctgct gtacggtggc 2340 atttacggtt atccgcgtga taagaaaagc aagaacggca aactgcgtct gctgtatgaa 2400 tgcgcgccga tgagctttat tgttgagcag gcgggtggca aaggtagcga cggccaccag 2460 cgtgtgctgg atatccaacc gaccgaaatt caccagcgtg ttccgctgta cattggtagc 2520 accgaagagg ttgaaaaagt tgaaaagtat ctggcgtaat cgagtctggt aaagaaaccg 2580 ctgctgcgaa atttgaacgc cagcacatgg actcgtctac tagcgcagct taattaacct 2640 aggctgctgc caccgctgag caataactag cataacccct tggggcctct aaacgggtct 2700 tgaggggttt tttgctgaaa ggaggaacta tatccggatt ggcgaatggg acgcgccctg 2760 tagcggcgca ttaagcgcgg cgggtgg acg gccagtgaat tcgagctcgg tacctaccgt 2820 tcgtataatg tatgctatac gaagttatcg agctctagag aatgatcccc tcattaggcc 2880 acacgttcaa gtgcagcgca caccgtgggaa acggatgaag gcacgaaccc agttgacata 2940 agcctgttcg gttc gtaaac tgtaatgcaa gtagcgtatg cgctcacgca actggtccag 3000 aaccttgacc gaacgcagcg gtggtaacgg cgcagtggcg gttttcatgg a agttaggtg gctcaagtat gggcatcatt cgcacatgta 3240 ggctcggcccc tgaccaagtc aaatccatgc gggctgctct tgatcttttc ggtcgtgagt 3300 tcggagacgt agccacctac tcccaacatc agccggactc cgattacctc gggaacttgc 3360 tccgtagtaa gacattcatc gcgcttgctg ccttcgacca aga agcggtt gttggcgctc 3420 tcgcggctta cgttctgccc aggtttgagc agccgcgtag tgagatctat atctatgatc 3480 tcgcagtctc cggcgagcac cggaggcagg gcattgccac cgcgctcatc aatctcctca 3540 agcatgaggc caacgcg ctt ggtgcttatg tgatctacgt gcaagcagat tacggtgacg 3600 atcccgcagt ggctctctat acaaagttgg gcatacggga agaagtgatg cactttgata 3660 tcgacccaag taccgccacc taacaattcg ttcaagccga gatcgtagaa tttcgacgac 3720 ctgcagccaa gcataacttc gtataatgta tgctatacga acggtaggat cctctagagt 3780 cgacctgcag gc 3792 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence ence <220> <223> Primer<400> 8 ctgtctctta tacacatct 19

Claims (25)

A method for producing a fucosylated oligosaccharide using a genetically modified prokaryotic host cell, comprising:
- at least (i) the activity of fructose-6-phosphate-converting enzyme having a constant level in the unmodified host cell is reduced or abolished, wherein the fructose-6-phosphate-converting enzyme is phosphofruc phosphofructokinase, glucose-6-phosphate isomerase, fructose-6-phosphate aldolase, transketolase and transal is selected from the group consisting of transaldolase; (ii) at least one gene encoding an enzyme required for de novo synthesis of GDP-fucose is overexpressed in the host cell; (iii) providing a prokaryotic host cell that has been genetically modified such that an exogenous gene encoding alpha-1,2-fucosyltransferase, alpha-1,3-fucosyltransferase or both is expressed within the host cell. ;
- culturing or growing said genetically modified host cell in a culture medium from a source of carbon and energy selected from at least one of glycerol, succinate, malate, pyruvate, lactate, ethanol, citrate; and
- providing lactose to the culture medium
A method for producing a fucosylated oligosaccharide obtainable from the medium in which the host cell is cultured by comprising a. The method of claim 1, wherein the fucosylated oligosaccharide is selected from the group consisting of 2'-fucosyllactose, 3-fucosyllactose or difucosyllactose. The host cell according to claim 1 or 2, wherein the host cell consists of a bacterial host cell, an Escherichia coli strain, a Lactobacillus species or a Corynebacterium glutamicum strain. How to be selected from the group. The method of claim 1 or 2, wherein the fructose-6-phosphate pool in the cell is phosphofructokinase, glucose-6-phosphate isomerase, fructose-6-phosphate aldolase, transketol A method of increasing by reducing or eliminating the activity of a fructose-6-phosphate converting enzyme selected from the group of enzymes or transaldolases and increasing the activity of fructose-1,6-bisphosphate phosphatase. The method of claim 1 or 2, wherein the gene encoding the enzyme necessary for the de novo synthesis of GDP-fucose is a phosphomannomutase encoding gene or manB , mannose-1-phosphate guanosyltransferase (mannose-1 -phosphate guanosyltransferase) coding gene or manC , GDP-mannose-4,6-dehydratase (GDP-mannose-4,6-dehydratase) coding gene or gmd , and GDP-L-fucose synthase (GDP-L -fucose synthase) encoding gene or wcaG . 3. The method according to claim 1 or 2, wherein the gene encoding at least one fucosyltransferase inhibits the activity of alpha-1,2-fucosyltransferase, alpha-1,3-fucosyl-transferase or both. how to indicate. According to claim 6, the gene encoding alpha-1,2-fucosyltransferase is E. coli. A method selected from the group consisting of wbgL from E. coli O126 or fucT2 from Helicobacter pylori . The method of claim 6, wherein the gene encoding alpha-1,3-fucosyltransferase is Akkermansia muciniphila , Bacteroides fragilis , Helicobacter pylori or Helicobacter hepaticus ( Helicobacter hepaticus ) A method selected from the group consisting of alpha-1,3-fucosyltransferase genes of species (species). 3. The method of claim 1 or 2, wherein the host cell is further genetically modified to express genes encoding proteins that enable or facilitate export of the desired fucosylated oligosaccharide into the culture medium. 3. The method according to claim 1 or 2, wherein an endogenous or exogenous permease for the import of lactose is overexpressed. 3. The method according to claim 1 or 2, wherein the gene to which the host cell is modified internally or together is an endogenous or exogenous gene. 3. The method of claim 1 or 2, wherein at least one of the genes that the host cell is internally or co-modified is overexpressed upon endogenous or exogenous induction or in a constitutive manner. 10. The method according to claim 9, wherein the gene encoding a protein enabling or promoting export of the desired fucosylated oligosaccharide is a sugar efflux transporter, yberc0001_9420 or SetA. 5. The method of claim 4, wherein the fructose-1,6-bisphosphate phosphatase is encoded by a gene that is a functionally active variant of fructose-1,6-bisphosphate phosphatase ( fbpase ) from peas ( Pisum sativum ). 11. The method of claim 10, wherein the lactose permease is E. coli. E. coli LacY method. The method of claim 1 or 2, wherein the provision of lactose is at a concentration of at least 5 mM, at a concentration of 30, 40, 50, 60, 70, 80, 90, 100, or 150 mM, from the start of the culture, or A method achieved by adding lactose to a concentration of >300 mM. 3. The method of claim 1 or 2, wherein the provision of lactose is achieved by adding lactose to the culture medium at a concentration such that a lactose concentration of at least 5 mM, 10 mM or 30 mM is obtained throughout the production phase of the culture. 3. The method of claim 1 or 2, wherein the host cells are cultured for at least 60, 80, 100 or 120 hours or cultured in a continuous manner. 3. The method according to claim 1 or 2, wherein the exogenous gene is integrated into the genome of the host strain. delete delete delete delete delete delete

Images