KR102550866B1 - Species-specific multiplex PCR primer sets for identification of six species of Bivalvia, and uses thereof - Google Patents

Abstract

The present invention relates to a species-specific multiplex PCR primer set for discrimination of six species of bivalve and its use, and in detail, to multiplex PCR applicable to scallops, large scallops, furrow scallops, common scallops, It is for one or more discrimination primer sets selected from the group consisting of sea scallop and sea scallop, and when multiplex PCR was performed using the primer set according to the present invention, there was no non-specific binding band, It was confirmed that furrow scallops, common scallops, sea scallops, and key clams could be accurately and quickly identified. Therefore, each individual can be identified from the muscle tissues of silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and key clams, which are difficult to identify morphologically during processing. It can be usefully used to distinguish scallops, common scallops, sea scallops, and key clams.

Description

Species-specific multiplex PCR primer sets for identification of six species of Bivalvia, and uses thereof {Species-specific multiplex PCR primer sets for identification of six species of Bivalvia, and uses thereof}

The present invention relates to a species-specific multiplex PCR primer set for discriminating six species of Bivalvia and its use.

Twenty-four species of scallops are reported to live in Korea, among which the silky scallop (Chlamys farreri), large scallop (Patinopecten yessoensis), common scallop (Chlamys nobilis), sea bay scallop (Argopecten irradians), furrow scallop (Swiftopecten swiftii), and clams ( Atrina pectinata) is an important aquaculture production species, and its consumption is increasing. In the case of large scallops, production of 1,200 tons in the East Sea has been gradually reduced since production in 1997, but demand is increasing. Sea bay scallops live in the Gulf of Mexico, but are currently being farmed in the Gyeongnam region, the southern coast of Korea.

Production and consumption requirements for such aquaculture are increasing. Among bivalve molluscs distributed in Korea, the types that mainly eat shell roots are silk scallops, large scallops, common scallops, seaman scallops, furrow scallops, and key clams. Cases of deceiving the country of origin by confusing the species are increasing, and violations of the country of origin labeling by confusing silk scallops with sea scallops often occur.

The types of scallops consumed in Korea are distributed after separately extracting and freezing the shell muscles, that is, the scallops, of bivalves. Due to these distribution cases, silk scallops, large scallops, common scallops, sea scallops, furrow scallops, and key clams can be morphologically distinguished by using shells, but it is difficult to differentiate between species only with the extracted shell muscles.

Therefore, in the case of primary processed food from which the tissue inside the shell is peeled off, or when the shell muscle is extracted and processed, it is difficult to determine the species based on morphological characteristics, so technology that can identify the above six types from processed food this is required

Therefore, in order to solve the above problems, it is possible to quickly and accurately discriminate silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and key clams, and there is no risk of nonspecific binding. It is necessary to develop a composition for discrimination.

US registered patent US 6,514,705 B2 (registered on 2003.02.04)

An object of the present invention is a primer set for determining scallop species belonging to the bivalve class (Bivalvia), a kit for determining scallop species belonging to the bivalve class (Bivalvia) including the primer set, and discrimination of scallop species belonging to the bivalve class (Bivalvia) using the same is to provide a way

In order to achieve the above object, the present invention provides a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 7, a primer set represented by SEQ ID NO: 2 and SEQ ID NO: 7, and; Primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7; And it provides a primer set for identifying scallop species belonging to the bivalve family (Bivalvia) including any one or more primer sets selected from the group consisting of primer sets represented by SEQ ID NO: 6 and SEQ ID NO: 7.

In addition, the present invention provides a kit for identifying scallop species belonging to the bivalve class (Bivalvia) including the primer set.

In addition, the present invention provides a method for identifying scallop species belonging to the bivalve class (Bivalvia) using a primer set for determining the scallop species belonging to the bivalve class (Bivalvia).

The present invention relates to a species-specific multiplex PCR primer set for discrimination of six species of bivalve and its use, and in detail, to multiplex PCR applicable to scallops, large scallops, furrow scallops, common scallops, It is for one or more discrimination primer sets selected from the group consisting of sea scallop and sea scallop, and when multiplex PCR was performed using the primer set according to the present invention, there was no non-specific binding band, It was confirmed that furrow scallops, common scallops, sea scallops, and key clams could be accurately and quickly identified. Therefore, each individual can be identified from the muscle tissues of silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and key clams, which are difficult to identify morphologically during processing. It can be usefully used to distinguish scallops, common scallops, sea scallops, and key clams.

1 is a result of multiplex PCR using a primer set according to the present invention for DNA samples of silk scallop, large scallop, furrow scallop, common scallop, sea scallop, and sea scallop. (1: Argopecten irradians 110 bp, 2: Chlamys nobilis 328 bp, 3: Patinopecten yessoensis 518 bp, 4: Chlamys farreri 596 bp, 5: Atrina pectinata 180 bp, 6: Scallop Swiftopecten swiftii 405 bp)
2 is a result of confirming the optimized annealing temperature in the primer set according to the present invention.
3 is a result of confirming detection sensitivity in the primer set according to the present invention.

Accordingly, the present inventors are researching a technology that can accurately identify each individual when silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and key clams are processed and difficult to identify. When species-specific primers were prepared for furrow scallops, common scallops, sea scallops, and scallops, and multiplex PCR was performed using these primers, bands of specific sizes for each individual were generated to accurately and quickly detect each individual. The present invention was completed by confirming that it could be discriminated.

The present invention is a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 7, a primer set represented by SEQ ID NO: 2 and SEQ ID NO: 7, and; Primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7; And it provides a primer set for identifying scallop species belonging to the bivalve family (Bivalvia) including any one or more primer sets selected from the group consisting of primer sets represented by SEQ ID NO: 6 and SEQ ID NO: 7.

Preferably, the scallop species belonging to the bivalve class are silk scallops (Chlamys farreri), large scallops (Patinopecten yessoensis), furrow scallops (Swiftopecten swiftii), common scallops (Chlamys nobilis), sea scallops (Argopecten irradians) or key clams (Atrina pectinata), but is not limited thereto.

Preferably, the primer set may target the cytochrome c oxidase subunit 1 ( C01 ) gene of mitochondrial DNA.

In the present invention, the "Cytochrome c Oxidase 1 ( CO1 )" is a gene present in mitochondria and represents a different nucleic acid sequence for each species.

The primer set of the present invention is a base sequence having a sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% with the base sequences of SEQ ID NOs: 1 to 7, respectively. can include The "percentage of sequence homology" for polynucleotides is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).

In particular, in the primer represented by SEQ ID NO: 7, D, R, V, and Y in the nucleotide sequence mean positions where exchange between bases can occur. More specifically, D is a mixture of A, G or T, R is a mixture of G or A, V is a mixture of A, G or C, and Y is a mixture of C or T.

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a template of a complementary nucleic acid and prevents strand copying of the nucleic acid template. A short nucleic acid sequence that serves as a starting point for Primers can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.

When designing the primers, various restrictions are followed, such as the A, G, C, and T content ratio of the primers, prevention of primer dimer formation, and prohibition of repeating the same base sequence three or more times. (template) Conditions such as the amount of DNA, concentration of primer, concentration of dNTP, concentration of Mg ²⁺ , reaction temperature, and reaction time should be appropriate.

The length of the primer generally has a close relationship with the temperature at which a stable hybrid is formed with the template. In general, the longer the length, the higher the temperature. Although it may vary depending on the purpose of use, it is usually 15 to 30 nucleotides, preferably 15 to 25 nucleotides, but is not limited thereto. The primer sequence need not be perfectly complementary to the template, but must be sufficiently complementary to hybridize with the template.

The above primers can incorporate additional features that do not change the basic properties. That is, nucleic acid sequences can be modified using a number of means known in the art. Examples of such modifications are methylation, capping, substitution of nucleotides with one or more homologues, and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates, or phosphorothioates or phosphorodithioates. Transformation of nucleotides into charged linkages such as Nucleic acids may also contain one or more nucleic acids, such as nucleases, toxins, antibodies, signal peptides, proteins such as poly-L-lysine, intercalating agents such as acridine or psoralen, chelating agents and alkylating agents such as metals, radioactive metals, and iron oxidizing metals. It may have additional covalently linked moieties.

In addition, the primer sequence of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The primer may include a label that can be detected using spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISA), biotin or haptens, and proteins for which antiserum or monoclonal antibodies are available.

The primers of the present invention are suitable for cloning of appropriate sequences, digestion with restriction enzymes, and phosphotriester methods such as Narang (1979, Meth, Enzymol. 68:90-99), diethylphosphoramidase such as Beaucage. (1981, Tetrahedron Lett. 22: 1859-1862), and any other well-known method including direct chemical synthesis, such as the solid support method of US Pat. No. 4,458,066.

In the present invention, "forward primer" and "reverse primer" bind to the 3'-end and 5'-end of a specific region of a gene to be amplified by gene amplification, respectively, and serve as the starting point of DNA synthesis. Primer that works.

In addition, the present invention provides a kit for identifying scallop species belonging to the bivalve class (Bivalvia), including a primer set for determining the scallop species belonging to the bivalve class (Bivalvia).

In addition to the primer set of the present invention, conventional components included in a PCR kit may be included. Conventional components included in the kit may be ^a reaction buffer, a polymerase, a cofactor such as dNTP (dATP, dCTP, dGTP and dTTP) and Mg ²⁺ . A variety of DNA polymerases can be used in the amplification step of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of these polymerases can be isolated from the bacteria themselves or purchased commercially.

The kit may also take the form of a bottle, tub, sachet, envelope, tube, ampoule, etc., which may be partially or wholly made of plastic, glass, paper, foil, It may be formed from wax or the like. The container may be equipped with a fully or partially removable closure that may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, allowing access to the contents by means of a needle. In addition, the kit of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The kit includes a multiplex polymerase chain reaction (multiplex PCR, multiplex PCR) kit, a polymerase chain reaction (PCR) kit, a ligase chain reaction (LCR) kit, a Gap-LCR, a repair chain reaction kit, Transcription-mediated amplification (TMA) kits, self sustained sequence replication kits, selective amplification of target polynucleotide sequences kits, consensus sequence priming polymerase chain reaction (CP- PCR) kit, random priming polymerase chain reaction (AP-PCR) kit, nucleic acid sequence-based amplification (NASBA) kit, strand displacement amplification kit, loop-mediated thermostatic amplification (LAMP) kit, double polymerization nested-PCR kit, single tube nested-PCR kit, reverse transcription-polymerase chain reaction (RT-PCR) kit, inverse PCR kit, It may be at least one selected from the group consisting of a real-time polymerase chain reaction (RT-PCR) kit and a real-time polymerase chain reaction quantitative test (RQ-PCR) kit, preferably the multiplex polymerase chain reaction (multiplex PCR) , multiplex PCR) kit, but is not limited thereto.

In addition, the present invention includes (1) separating DNA from a sample; (2) a primer set represented by SEQ ID NO: 1 and SEQ ID NO: 7, and a primer set represented by SEQ ID NO: 2 and SEQ ID NO: 7, using the isolated DNA as a template; Primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7; and performing PCR amplification using one or more primer sets selected from the group consisting of primer sets represented by SEQ ID NO: 6 and SEQ ID NO: 7; And (3) it provides a scallop species discrimination method belonging to the bivalve class (Bivalvia) comprising the step of analyzing the PCR amplification product.

Preferably, the PCR may be multiplex PCR (multiplex PCR), but is not limited thereto.

Preferably, the scallop species belonging to the bivalve class are silk scallops (Chlamys farreri), large scallops (Patinopecten yessoensis), furrow scallops (Swiftopecten swiftii), common scallops (Chlamys nobilis), sea scallops (Argopecten irradians) or key clams (Atrina pectinata), but is not limited thereto.

Preferably, the primer sets represented by SEQ ID NO: 1 and SEQ ID NO: 7 are specific for Chlamys farreri, and the primer sets represented by SEQ ID NO: 2 and SEQ ID NO: 7 are specific for Patinopecten yessoensis. , and the primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 7 are specific to the scallop (Swiftopecten swiftii), and the primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 7 are specific to common scallops (Chlamys nobilis), The primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7 are specific for Argopecten irradians, and the primer sets represented by SEQ ID NO: 6 and SEQ ID NO: 7 may be specific for Atrina pectinata.

Specifically, according to one embodiment of the present invention, when multiplex PCR amplification is performed using the primer set according to the present invention, oligonucleotides having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 7 are used for the CO1 gene of the scallop. Oligonucleotides amplifying a product with a size of 596 bp and having the base sequences of SEQ ID NO: 2 and SEQ ID NO: 7 amplified a product with a size of 518 bp for the CO1 gene of large scallop, and the base sequences of SEQ ID NO: 3 and SEQ ID NO: 7 The oligonucleotide having amplified a 405 bp product for the CO1 gene of the crow scallop, and the oligonucleotides having the nucleotide sequences of SEQ ID NO: 4 and SEQ ID NO: 7 amplified a 328 bp product for the CO1 gene of the common scallop And, the oligonucleotides having the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 7 amplified a 180 bp product for the CO1 gene of sea scallop, and the oligonucleotides having the nucleotide sequences of SEQ ID NO: 6 and SEQ ID NO: 7 A product with a size of 112 bp was amplified for the CO1 gene of .

In addition, according to another embodiment of the present invention, the primer set according to the present invention clearly identifies each species even if each DNA sample is at a low concentration of 1 ng in silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and scallops. It was confirmed that it could be identified.

Meanwhile, a method known in the art may be used as a method for isolating DNA from a sample of the present invention. In addition, PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the present invention, the "amplification reaction" means a reaction for amplifying a nucleic acid molecule. In one or more discrimination methods selected from the group consisting of silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and scallops according to the present invention, amplification of genomic DNA may be performed by a method known in the art, limited thereto. It is not, but for example, polymerase chain reaction (PCR), multiplex polymerase chain reaction (multiplex PCR), ligase chain reaction (LCR), Gap-LCR, repair chain reaction, transcription-mediated amplification (TMA), self sustained sequence replication, selective amplification of target polynucleotide sequences , consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), nucleic acid sequence based amplification , NASBA), strand displacement amplification, nested Polymerase chain reaction (nested-PCR), single tube nested Polymerase chain reaction (single tube nested-PCR) , multiplex reverse transcription Polymerase chain reaction (multiplex RT-PCR), single reverse transcription Polymerase chain reaction (RT-PCR), inverse Polymerase chain reaction reaction; at least one method selected from the group consisting of inverse PCR), real-time polymerase chain reaction (RT-PCR), and real-time quantitative polymerase chain reaction (RQ-PCR). can be heard Preferably, it may be performed using a method of multiplex polymerase chain reaction (multiplex PCR).

In the present invention, the "multiplex PCR" is a method of PCR amplification in one reaction tube at the same time using a plurality of primer sets. In general, when multiplex PCR is performed, the efficiency of generating PCR products is reduced compared to when each PCR reaction is performed, but there is an advantage in that multiple products can be simultaneously generated with one amplification. In the case of the primer set of the present invention, each PCR product is accurately produced even when the primer set is put into one tube and multiplex PCR is performed.

In addition, in the discrimination method, the concentration of the primer set may be 2.5 to 15 pmol/μl, more preferably 10 pmol/μl.

It can also be performed using a PCR reaction mixture containing various components known in the art required for PCR reaction. The PCR reaction mixture contains appropriate amounts of DNA polymerase, dNTP, PCR buffer, and water (dH ₂ O) in addition to the genomic DNA extracted from the sample to be analyzed and the primer set according to the present invention. The PCR buffer solution includes Tris-HCl, MgCl ₂ , KCl, and the like. At this time, the concentration of MgCl ₂ greatly affects the specificity and quantity of amplification. Preferably, it may be used in the range of 1.5-2.5 mM, but is not limited thereto. In general, when Mg ^{2+ is} excessive, non-specific PCR amplification products increase, and when Mg ²⁺ is insufficient, the yield of PCR products decreases. An appropriate amount of Triton X-100 may be further included in the PCR buffer.

In addition, in the PCR conditions of the present invention, the amplification reaction is denaturation at 92 to 97 ° C for 10 seconds to 1 minute, annealing at 45 to 60 ° C for 20 seconds to 1 minute, and 65 to 75 ° C for 20 seconds to 1 minute After repeating the polymerization process for 1 minute a total of 30 to 40 times, the polymerization process is performed at 65 to 75 ° C. for 3 minutes to 10 minutes.

More preferably, the amplification reaction is performed by repeating denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 30 seconds a total of 34 times, and then at 72°C for 7 minutes. polymerization process can be performed.

The temperature and time conditions in the amplification reaction are values set to generate a product when performing multiplex PCR using the primer set of the present invention, and can be appropriately selected by those skilled in the art according to experimental methods and equipment changes. can be changed numerically.

The 'amplification' uses the DNA of the CO1 gene mixed in the DNA extracted from samples of silk scallop, large scallop, furrow scallop, common scallop, sea scallop, and key clam as a template, specific to a specific DNA site in the template After repeating the reaction to mass-synthesize the corresponding DNA site in vitro using a primer set that binds to , and then visualizing and discriminating as a distinct band in electrophoresis.

In the present invention, the 'detection' may be performed by labeling the amplified target sequence with a detectable labeling substance. The labeling material may be a material that emits fluorescence, phosphorescence or radioactivity, but is not limited thereto.

In the method of the present invention, the labeling substance that can be used for detection may be Cy5 or Cy3. When the target sequence is amplified, PCR is performed by labeling the 5'-end of the primer with Cy5 or Cy3, and the target sequence can be labeled with a detectable fluorescent labeling material. In addition, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution during PCR, the radioactive material is incorporated into the amplification product as the amplification product is synthesized, and the amplification product can be radioactively labeled.

In the method of the present invention, detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. For the gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis may be used depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling the 5'-end of the primer with Cy5 or Cy3, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence can be measured using a fluorescence meter. In addition, the radioactivity measurement method is to label the amplification product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution during PCR, and then use a radioactivity measurement instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail according to examples that do not limit the present invention. Of course, the following examples of the present invention are only intended to embody the present invention and are not intended to limit or limit the scope of the present invention. Therefore, what can be easily inferred by an expert in the technical field to which the present invention belongs from the detailed description and examples of the present invention is interpreted as belonging to the scope of the present invention.

< Example 1> species specific primer produce

For simultaneous multiplex polymerase chain reaction targeting silk scallop (Chlamys farreri), large scallop (Patinopecten yessoensis), furrow scallop (Swiftopecten swiftii), common scallop (Chlamys nobilis), sea scallop (Argopecten irradians), and scallop (Atrina pectinata) A primer was prepared.

In order to prepare specific primers capable of discriminating among the six species, the mitochondrial cytochrome c oxidase subunit 1 (Cytochrome c Oxidase 1, CO1 ) gene was targeted. Based on the six gene sequences (EU023915, KC153059, EU715252, FJ415225, NC_009081, MW646296) registered in NCBI GenBank, multiple sequence alignment was performed using the Bioedit program, and species-specific primers in Table 1 below were prepared.

primer designation primer order direction Amplification product size
(bp) order
number C. farreri COI F4 CCTGGGATGTGGCTTCCTAGA forward 596 One P. yessoensis CO1 F2 GTTATGCCGGTTCTTATTGGA forward 518 2 S. swiftii COI F1 TGCGCTATACATAGTGGTGA forward 405 3 C. nobilis CO1 F TGCGCTATACATAGTGGTGA forward 328 4 A. irradians CO1 F CCCTTTCGTTTGGGCGCTT forward 180 5 A. pectinata CO1 F GTGGGATTACTATGCTCCTAAC forward 112 6 reverse primer
(Pectinidae_R) TCDGGRTGVCCAAARAAYCAA reverse - 7

In Table 1, the specific primers of the scallop, C. farreri COI F4 (SEQ ID NO: 1) and Pectinidae_R (SEQ ID NO: 7) are based on the nucleotide sequence of the 108-129 bp region and 683-704 bp region of the COI gene made with The specific primer of silk scallop, P. yessoensis CO1 F2 (SEQ ID NO: 2) is the base sequence of the 186-207 bp region, and the specific primer of the scallop, S. swiftii COI F1 (SEQ ID NO: 3) is the 299-319 bp region. The nucleotide sequence, the specific primer of common scallop, C. nobilis CO1 F (SEQ ID NO: 4) is the nucleotide sequence of 376-396 bp region, the specific primer of sea scallop, A. irradians CO1 F (SEQ ID NO: 5) is 593- The nucleotide sequence of the 611 bp region, the specific primer of key clam, A. pectinata CO1 F (SEQ ID NO: 6) was prepared based on the nucleotide sequence of the 593-611 bp region.

< Example 2> Fabrication of the primer Evaluation of species-specific discrimination

It was confirmed by performing multiplex PCR that the primers prepared in Example 1 could actually discriminate between silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and key clams. 1 μl of 50 ng of genomic DNA of each species and 1 μl of the primers of SEQ ID NO: 1 to SEQ ID NO: 7 of Example 1 in a 20 μl PCR premix kit (AccuPower Multiplex PCR premix Kit (Bioneer, Korea)) (10 pmole concentration) was added. This was repeated 34 times with a cycle of denaturation at 94 ° C for 30 seconds, annealing at 56 ° C for 30 seconds, and extension reaction at 72 ° C for 30 seconds, followed by 7 cycles at 72 ° C. Multiplex PCR was performed with a final elongation reaction of 10 minutes. Finally, the amplified product was electrophoresed using a 1.5% agarose gel stained with GelRed (Invitroogen, USA) to confirm species-specific discrimination.

As a result, as shown in Figure 1, when the PCR reaction was performed with the primers according to the present invention, 596 bp for silk scallop, 518 bp for large scallop, 405 bp for crow scallop, 328 bp for common scallop, It was confirmed that amplification products of 180 bp for scallops and 112 bp for clams were formed.

< Example 3> Check the optimized bonding temperature condition

Optimized binding temperature conditions of the primers according to the present invention were confirmed. To this end, PCR was performed in the same manner as in Example 2 at various binding temperatures ranging from 54 to 63 ° C, and then the formation and size of specific bands of the PCR products were confirmed through electrophoresis.

As a result, as shown in FIG. 2, it was confirmed that the PCR products of the size previously confirmed for each species were formed as a single band under the binding temperature conditions of 54 ° C to 59 ° C.

< Example 4> Evaluation of detection sensitivity

The detection sensitivity of the primers according to the present invention was confirmed. To this end, after diluting 50 ng, 10 ng, 1 ng, and 0.1 ng of DNA from silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and sea scallops, multiplex PCR was performed in the same manner as in Example 2 above. did

As a result, as shown in Figure 3, the primers according to the present invention can accurately discriminate each of the scallops, large scallops, furrow scallops, common scallops, sea scallops, and sea scallops even at a concentration of 1 ng DNA. did

Overall, the present invention relates to a primer set developed using the CO1 gene of mitochondrial DNA of silk scallop, large scallop, furrow scallop, common scallop, sea scallop, and sea scallop, and non-specific binding through multiplex PCR using the primer set. It was confirmed that each species can be accurately and quickly identified without a band, which can be usefully used in the fisheries industry to identify silk scallops, large scallops, furrow scallops, common scallops, sea scallops, and key clams.

<110> Soonchunhyang University Industry Academy Cooperation Foundation <120> Species-specific multiplex PCR primer sets for identification of six species of Bivalvia, and uses its <130> ADP-2021-0621 <160> 7 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Chlamys farreri <400> 1 cctgggatgt ggcttcctag a 21 <210> 2 <211> 21 <212> DNA <213> Patinopecten yessoensis <400> 2 gttatgccgg ttcttattgg a 21 <210> 3 <211> 20 <212> DNA <213> swiftopecten swiftii <400> 3 tgcgctatac atagtggtga 20 <210> 4 <211> 20 <212> DNA <213> Chlamys nobilis <400> 4 tgcgctatac atagtggtga 20 <210> 5 <211> 19 <212> DNA <213> Argopecten irradians <400> 5 ccctttcgtt tgggcgctt 19 <210> 6 <211> 22 <212> DNA <213> Atrina pectinata <400> 6 gtgggattac tatgctccta ac 22 <210> 7 <211> 21 <212> DNA <213> Chlamys farreri <400> 7 tcdggrtgvc caaaraayca a 21

Claims (9)

Primer sets represented by SEQ ID NO: 1 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 2 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7; And a bivalve scallop (Chlamys farreri), a large scallop (Patinopecten yessoensis), a furrow scallop (Swiftopecten swiftii) belonging to the bivalve family (Bivalvia) containing a primer set represented by SEQ ID NO: 6 and SEQ ID NO: 7, and a common scallop (Chlamys nobilis) , A multiplex PCR primer set composition for discriminating Argopecten irradians or Atrina pectinata. delete The multiplex PCR primer set composition according to claim 1, wherein the primer set targets the cytochrome c oxidase subunit 1 ( C01 ) gene of mitochondrial DNA. Chlamys farreri, large scallop (Patinopecten yessoensis), furrow scallop (Swiftopecten swiftii), common scallop (Chlamys nobilis), sea scallop (Argopecten irradians), or key clam (Atrina pectinata) identification kit. 5. The kit according to claim 4, further comprising a reagent for carrying out an amplification reaction. (1) isolating DNA from the sample;
(2) a set of primers represented by SEQ ID NO: 1 and SEQ ID NO: 7 using the isolated DNA as a template; Primer sets represented by SEQ ID NO: 2 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 3 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 4 and SEQ ID NO: 7; Primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7; and performing multiplex PCR amplification using the primer sets represented by SEQ ID NO: 6 and SEQ ID NO: 7; and
(3) Chlamys farreri, Patinopecten yessoensis, Swiftopecten swiftii, and Chlamys nobilis belonging to the Bivalvia family, including the step of analyzing the multiplex PCR amplification product. , How to identify sea bay scallops (Argopecten irradians) or key clams (Atrina pectinata). delete delete The method of claim 6, wherein the primer set represented by SEQ ID NO: 1 and SEQ ID NO: 7 is specific to scallop (Chlamys farreri), and the primer set represented by SEQ ID NO: 2 and SEQ ID NO: 7 is large scallop (Patinopecten yessoensis) The primer set represented by SEQ ID NO: 3 and SEQ ID NO: 7 is specific to the scallop (Swiftopecten swiftii), and the primer set represented by SEQ ID NO: 4 and SEQ ID NO: 7 is specific to the common scallop (Chlamys nobilis). , and the primer sets represented by SEQ ID NO: 5 and SEQ ID NO: 7 are specific for Argopecten irradians, and the primer sets represented by SEQ ID NO: 6 and SEQ ID NO: 7 are specific for Atrina pectinata. How to.

Images