KR102532739B1 - Composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, and pretreatment method using same - Google Patents

Abstract

The present specification provides for detection of coronavirus and / or corona virus, including at least one member selected from the group consisting of gentamicin, amphotericin B, dithiothreitol (DTT) and polysorbate 20. It relates to a pretreatment composition for diagnosing a viral infection and a pretreatment method using the same, and the composition and diagnosis method enable highly efficient corona virus diagnosis without nucleic acid extraction.

Description

Composition for pretreatment for detecting coronavirus and/or infection diagnosing coronavirus, and pretreatment method using same}

The present specification provides for detection of coronavirus and / or corona virus, including at least one member selected from the group consisting of gentamicin, amphotericin B, dithiothreitol (DTT) and polysorbate 20. It relates to a pretreatment composition for diagnosing a viral infection and a pretreatment method using the same.

Several tests are used to screen for respiratory viruses. Among them, the RT-qPCR method is a test method with high sensitivity and specificity, but it takes a relatively long time compared to other test methods, so it may not be effective in a pandemic situation. Therefore, the antigen rapid test method, which is a rapid test method that takes relatively less time than the RT-qPCR test method, is used in clinical practice for influenza and COVID-19 among respiratory viruses. Another rapid test method, the saliva test method, is used to diagnose COVID-19, and its sensitivity is 90% compared to RT-qPCR tests using general nasopharyngeal swabs.

The nucleic acid extraction process required in the RT-qPCR method is an obstacle to rapidly analyzing a large amount of samples, and costs are incurred in the process, requiring high costs and a lot of labor. In particular, the antigen rapid test method used for the diagnosis of COVID-19 has limitations as it can only be used for selective tests with a sensitivity of 17.5% compared to the PCR test method, and the saliva test method, which is a rapid test method, is used for the diagnosis of COVID-19. However, consumption in the process of nucleic acid extraction occurs in the same way, so there are similar limitations. Accordingly, it is necessary to develop a rapid and accurate diagnostic method without a nucleic acid extraction process for efficient diagnosis.

In order to solve the above problems, the present inventors have developed a composition for pretreatment and/or a composition for transporting coronavirus that enables efficient coronavirus detection and/or diagnosis of coronavirus infection without a nucleic acid extraction process.

An example of the present specification is a coronavirus transport, detection and / or a composition for pretreatment for diagnosing a coronavirus infection and / or a composition for transporting a coronavirus is provided.

Another example provides a composition for detecting coronavirus and/or a composition for diagnosing coronavirus infection, including the composition for pretreatment and/or transport of coronavirus as an active ingredient.

Another example provides a kit for diagnosing coronavirus infection, including the composition for pretreatment and/or the composition for transporting coronavirus as an active ingredient.

Another example is

(1) mixing a first agent containing at least one selected from the group consisting of gentamicin and amphotericin B with a biological sample isolated from the subject; and

(2) mixing a second agent containing at least one selected from the group consisting of dithiothreitol (DTT) and polysorbate 20 with the biological sample reacted with the first agent in step (1); Provides a pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, a method for detecting coronavirus, and/or a method for diagnosing coronavirus infection, including.

An example of this specification is

(1) a first agent comprising at least one selected from the group consisting of gentamicin and amphotericin B; and

(2) A second agent containing at least one selected from the group consisting of DTT (Dithiothreitol) and polysorbate 20

Provided is a composition for pretreatment and/or a composition for transporting coronavirus for coronavirus detection, transportation, and/or diagnosis of coronavirus infection, comprising at least one selected from the group consisting of:

Another example provides a composition for detecting coronavirus and/or a composition for diagnosing coronavirus infection, including the composition for pretreatment and/or transport of coronavirus as an active ingredient.

Another example provides a kit for diagnosing coronavirus infection, including the composition for pretreatment and/or the composition for transporting coronavirus as an active ingredient.

Another example is

(1) mixing a first agent containing at least one selected from the group consisting of gentamicin and amphotericin B with a biological sample isolated from the subject; and

(2) mixing a second agent containing at least one selected from the group consisting of dithiothreitol (DTT) and polysorbate 20 with the biological sample reacted with the first agent in step (1); Provides a pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, a method for detecting coronavirus, and/or a method for diagnosing coronavirus infection, including.

The pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, the method for detecting coronavirus and/or diagnosing coronavirus infection includes the steps of performing PCR on the mixture in which steps (1) and (2) have been performed. It may further include, but is not limited thereto.

Another example is

(1) mixing a second agent containing at least one selected from the group consisting of dithiothreitol (DTT) and polysorbate 20 with a biological sample separated from the subject; and

(2) mixing a first agent containing at least one selected from the group consisting of gentamicin and amphotericin B with the biological sample reacted with the second agent in step (1); Provides a pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, a method for detecting coronavirus, and/or a method for diagnosing coronavirus infection, including.

The pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, the method for detecting coronavirus, and/or the method for diagnosing coronavirus infection may further include diluting the biological sample, but is not limited thereto.

Hereinafter, the present invention will be described in detail.

The composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, the composition for transporting coronavirus, the composition for detecting coronavirus and/or the composition for diagnosing coronavirus infection provided herein directly detects and/or detects virus without extracting nucleic acid. Alternatively, it is possible to rapidly diagnose coronavirus as a sample transport medium that enables diagnosis of viral infection.

In addition, the composition may not affect the PCR reaction, enables rapid diagnosis without a nucleic acid extraction process, and can detect coronavirus with high efficiency without a sample extraction process, unlike virus transport media having other compositions.

The composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, the composition for transporting coronavirus, the composition for detecting coronavirus, and/or the composition for diagnosing coronavirus infection provided herein contains guanidine thiocyanate may not contain, the guanidine thiocyanate may cause PCR reaction inhibition, and the composition for pretreatment for detecting and/or diagnosing coronavirus infection provided herein, the composition for transporting coronavirus , A composition for detecting coronavirus and/or a composition for diagnosing coronavirus infection may have higher PCR efficiency than a transportation medium containing guanidine thiocyanate, but is not limited thereto.

The composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, the composition for transporting coronavirus, the composition for detecting coronavirus, and/or the composition for diagnosing coronavirus infection provided in the present specification are prepared by using a virus transport medium having other compositions. A smaller Ct value may be measured than in the case of performing PCR, but is not limited thereto.

When PCR is performed using the composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, the composition for transporting coronavirus, the composition for detecting coronavirus, and/or the composition for diagnosing coronavirus infection provided herein, and/or Alternatively, when PCR is performed through the pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection provided herein, the method for detecting coronavirus and/or the method for diagnosing coronavirus infection, the Ct value is 50 or less, 45 or less, or 40 Below, 35 or less, 33 or less, 31 or less, 30 or less, 29 or less, 28 or less, 27 or less, 26 or less, or 25 or less can be determined as positive for coronavirus, but is not limited thereto. When performing the PCR, the Ct value can be determined at a threshold reference value of 0.2, but is not limited thereto.

When PCR is performed using the composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, the composition for transporting coronavirus, the composition for detecting coronavirus, and/or the composition for diagnosing coronavirus infection provided herein, and/or Alternatively, when PCR is performed through the pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection provided herein, the threshold cycle (Ct) at a threshold reference value of 0.2 With the value, it is possible to determine whether the detection target is positive or negative for the coronavirus, and at this time, the RdRP (RNA dependent RNA polymerase) gene and the E-sarbeco gene can be used as the target gene, and both genes for the target gene It can be judged as positive if the Ct value is 35 or less for both genes, negative if it is 40 or more or not detected for both genes, and if the Ct value is more than 35 and less than 40 for both genes, it can be judged as negative for one of the two genes. In the case of detection only, it may be judged as "undetermined" rather than both positive and negative, but is not limited thereto. If the result of PCR is determined to be "undecided", a retest may be performed to determine positive or negative, but is not limited thereto.

As used herein, "diagnosis" means confirming the presence or characteristics of a pathological condition, and includes detecting whether or not the pathological condition has occurred, the risk of developing, or the likelihood of developing the pathological condition, and monitoring the pathological condition. For the purposes of the present invention, diagnosis is the determination of the presence or absence of a coronavirus.

As used herein, “subject” refers to a human or non-human animal selected for diagnosis, improvement, prevention or treatment. The subject may have a corona virus-related disease, have a possibility of developing the disease, or may have undergone surgery to treat a related disease.

As used herein, "biological sample" or "sample" refers to a solid tissue sample such as blood and other liquid samples of biological origin, biopsy specimens, tissue culture, or cells derived therefrom, and refers to a subject (eg, hypertensive It may be isolated from an individual with a disease due to vascular leakage). The sample may be, for example, tissue, extract, cell lysate, whole blood, plasma, serum, saliva, ocular fluid, cerebrospinal fluid, sweat, urine, milk, ascites fluid, synovial fluid, or peritoneal fluid. The sample may be obtained from an animal, such as a mammal or a human. The sample may be pre-treated prior to the identification step. For example, pretreatment steps such as homogenization, filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, etc. may be performed.

In this specification, "biological sample" or "sample" is 10 ¹⁰ copies/μl or less, 5 x 10 ¹⁰ copies/μl or less, 4.9 x 10 ¹⁰ copies/μl or less, 10 ⁹ copies/μl or less, 10 ⁸ copies/μl or less , 10 ⁷ copies/μl or less, 10 ⁶ copies/μl or less, 10 ⁵ copies/μl or less, 10 ⁴ copies/μl or less, 10 ³ copies/μl or less, 10 ² copies/μl or less, 10 copies/μl or less, 8 It may contain viruses at a concentration of less than or equal to copies/μl, or 7.6 copies/μl or less, and may contain viruses at concentrations of 0.1 copies/μl or more, 1 copies/μl or more, or 5 copies/μl or more, but are limited thereto It is not. A composition for pretreatment for detecting, transporting and/or diagnosing a coronavirus infection provided herein and/or a composition for transporting a coronavirus and/or a pretreatment method for detecting and/or diagnosing a coronavirus infection provided herein, The coronavirus detection method and/or the coronavirus infection diagnosis method may be capable of detecting the coronavirus even when the biological sample or sample includes the virus concentration.

As used herein, "coronavirus" refers to viruses belonging to the family Coronaviridae and generally refers to viruses found in various mammals, including humans, in addition to birds. The coronavirus may be one or more selected from the group consisting of SARS-CoV, MERS-CoV, 229E, OC43, NL63, and HKU1, but is not limited thereto.

"First agent" and "second agent" provided herein mean a type of virus transport medium composition, respectively, in the group consisting of gentamicin, amphotericin B, DTT and polysorbate 20 (polysorbate 20). A preparation containing one or more selected species, for example, may refer to a preparation used for transporting coronavirus when detecting coronavirus and/or diagnosing coronavirus infection.

The composition for pretreatment and/or the composition for transporting coronavirus for detecting, transporting, and/or diagnosing a coronavirus infection provided herein includes the first agent and the second agent at a ratio of 100:1 to 1:10 (first Formulation: second formulation), 100:1 to 1:5, 100:1 to 1:3, 100:1 to 2:3, 100:1 to 1:1, 100:1 to 3:2, 100:1 to 2:1, 50:1 to 1:10, 50:1 to 1:5, 50:1 to 1:3, 50:1 to 2:3, 50:1 to 1:1, 50:1 to 3 :2, 50:1 to 2:1, 20:1 to 1:10, 20:1 to 1:5, 20:1 to 1:3, 20:1 to 2:3, 20:1 to 1:1 , 20:1 to 1:3, 20:1 to 1:2, 10:1 to 1:10, 10:1 to 1:5, 10:1 to 1:3, 10:1 to 2:3, 10 :1 to 1:1, 10:1 to 3:2, 10:1 to 2:1, 5:1 to 1:10, 5:1 to 1:5, 5:1 to 1:3, 5:1 to 2:3, 5:1 to 1:1, 5:1 to 3:2, 5:1 to 2:1, 3:1 to 1:10, 3:1 to 1:5, 3:1 to 1 :3, 3:1 to 2:3, 3:1 to 1:1, 3:1 to 3:2, or 3:1 to 2:1, for example, may be included in a volume ratio of 5:2, but It is not limited.

The first agent may further include Fetal Bovine Serum (FBS) and/or Hank's Balanced Salt Solution (HBSS), but is not limited thereto.

The first agent may stabilize viral transport, and the second agent may activate a PCR reaction, but is not limited thereto.

The first agent may be diluted by adding a Hank's Balanced Salt Solution (HBSS) buffer, but is not limited thereto.

In the present specification, "Gentamicin" refers to an antibiotic used to treat various types of bacterial infections, and is effective for osteomyelitis, endocarditis, pelvic inflammatory disease, meningitis, pneumonia, urinary tract infections, sepsis, and plague.

Gentamicin provided herein is 10 μg/ml to 1000 μg/ml, 10 μg/ml to 500 μg/ml, 10 μg/ml to 200 μg/ml, 10 μg/ml to 10 μg/ml based on the volume of the first agent. 150 μg/ml, 10 μg/ml to 120 μg/ml, 10 μg/ml to 110 μg/ml, 50 μg/ml to 1000 μg/ml, 50 μg/ml to 500 μg/ml, 50 μg/ml to 200 μg/ml, 50 μg/ml to 150 μg/ml, 50 μg/ml to 120 μg/ml, 50 μg/ml to 110 μg/ml, 70 μg/ml to 1000 μg/ml, 70 μg/ml to 500 μg/ml, 70 μg/ml to 200 μg/ml, 70 μg/ml to 150 μg/ml, 70 μg/ml to 120 μg/ml, 70 μg/ml to 110 μg/ml, 90 μg/ml to 1000 μg/ml, 90 μg/ml to 500 μg/ml, 90 μg/ml to 200 μg/ml, 90 μg/ml to 150 μg/ml, 90 μg/ml to 120 μg/ml, or 90 μg/ml to 110 μg/ml, for example, may be included at a concentration of 100 μg/ml, but is not limited thereto.

In the present specification, "Amphotericin B" refers to an antifungal agent for mycoses and leishmaniasis, and treats aspergillosis, blastomycosis, candidiasis, coccidioidomycosis, cryptococcosis, etc. It is a substance used to

Amphotericin B provided herein is 0.001 μg/ml to 10 μg/ml, 0.001 μg/ml to 5 μg/ml, 0.001 μg/ml to 1 μg/ml, 0.001 μg/ml based on the volume of the first agent. ml to 0.8 μg/ml, 0.001 μg/ml to 0.6 μg/ml, 0.01 μg/ml to 10 μg/ml, 0.01 μg/ml to 5 μg/ml, 0.01 μg/ml to 1 μg/ml, 0.01 μg/ml ml to 0.8 μg/ml, 0.01 μg/ml to 0.6 μg/ml, 0.1 μg/ml to 10 μg/ml, 0.1 μg/ml to 5 μg/ml, 0.1 μg/ml to 1 μg/ml, 0.1 μg/ml ml to 0.8 μg/ml, 0.1 μg/ml to 0.6 μg/ml, 0.3 μg/ml to 10 μg/ml, 0.3 μg/ml to 5 μg/ml, 0.3 μg/ml to 1 μg/ml, 0.3 μg/ml ml to 0.8 μg/ml, 0.3 μg/ml to 0.6 μg/ml, 0.4 μg/ml to 10 μg/ml, 0.4 μg/ml to 5 μg/ml, 0.4 μg/ml to 1 μg/ml, 0.4 μg/ml It may be included in a concentration of ml to 0.8 μg/ml, or 0.4 μg/ml to 0.6 μg/ml, for example, 0.5 μg/ml, but is not limited thereto.

In the present specification, "dithiothreitol (DTT)" is a general term for small molecule redox reagents and refers to a substance having a chemical formula of C ₄ H ₁₀ O ₂ S ₂ .

The DTT provided herein is based on the volume of the composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, the composition for transporting coronavirus, the composition for detecting coronavirus, and/or the composition for diagnosing coronavirus infection provided herein 0.1 mM to 10 mM, 0.1 mM to 5 mM, 0.1 mM to 2.5 mM, 0.1 mM to 2 mM, 0.1 mM to 1.5 mM, 0.1 mM to 1.3 mM, 0.5 mM to 10 mM, 0.5 mM to 5 mM, 0.5 mM to 2.5 mM, 0.5 mM to 2 mM, 0.5 mM to 1.5 mM, 0.5 mM to 1.3 mM, 1 mM to 10 mM, 1 mM to 5 mM, 1 mM to 2.5 mM, 1 mM to 2 mM, 1 mM to 1.5 mM mM, 1 mM to 1.3 mM, 1.2 mM to 10 mM, 1.2 mM to 5 mM, 1.2 mM to 2.5 mM, 1.2 mM to 2 mM, 1.2 mM to 1.5 mM, or 1.2 mM to 1.3 mM, such as 1.25 mM Concentrations may be included, but are not limited thereto.

DTT provided herein is 1 mM to 100 mM, 1 mM to 50 mM, 1 mM to 25 mM, 1 mM to 20 mM, 1 mM to 15 mM, 1 mM to 13 mM, based on the volume of the second agent. 5 mM to 100 mM, 5 mM to 50 mM, 5 mM to 25 mM, 5 mM to 20 mM, 5 mM to 15 mM, 5 mM to 13 mM, 10 mM to 100 mM, 10 mM to 50 mM, 10 mM to 25 mM, 10 mM to 20 mM, 10 mM to 15 mM, 10 mM to 13 mM, 12 mM to 100 mM, 12 mM to 50 mM, 12 mM to 25 mM, 12 mM to 20 mM, 12 mM to 15 mM, or 12 mM to 13 mM, for example, may be included at a concentration of 12.5 mM, but is not limited thereto.

In the present specification, "polysorbate 20 (polysorbate 20)" means a polysorbate-type nonionic surfactant formed by ethoxylation of sorbitan before adding lauric acid, and is stable and relatively non-toxic, so it can be used for home use, A substance that can be used as a detergent and emulsifier for scientific and pharmacological purposes, and may be named Tween-20 as a trade name, but is not limited thereto.

"Polysorbate 20" provided herein refers to a composition for pretreatment for detecting coronavirus and/or diagnosing coronavirus infection, a composition for transporting coronavirus, a composition for detecting coronavirus, and/or or 0.1 to 2 (v/v)%, 0.1 to 1.5 (v/v)%, 0.1 to 1 (v/v)%, 0.1 to 0.7 (v/v)%, 0.1 based on the volume of the composition for diagnosing coronavirus infection to 0.5 (v/v)%, 0.2 to 2 (v/v)%, 0.2 to 1.5 (v/v)%, 0.2 to 1 (v/v)%, 0.2 to 0.7 (v/v)%, 0.2 to 0.5 (v/v)%, 0.3 to 2 (v/v)%, 0.3 to 1.5 (v/v)%, 0.3 to 1 (v/v)%, 0.3 to 0.7 (v/v)%, or 0.3 to 0.5 (v/v)%, e.g. It may be included at a concentration of 0.4 (v / v)%, but is not limited thereto.

"Polysorbate 20" provided herein is 1 to 20 (v / v)%, 1 to 15 (v / v)%, 1 to 10 (v / v) based on the volume of the second agent )%, 1 to 7 (v/v)%, 1 to 5 (v/v)%, 2 to 20 (v/v)%, 2 to 15 (v/v)%, 2 to 10 (v/v) )%, 2 to 7 (v/v)%, 2 to 5 (v/v)%, 3 to 20 (v/v)%, 3 to 15 (v/v)%, 3 to 10 (v/v) )%, 3 to 7 (v/v)%, or 3 to 5 (v/v)%, such as. It may be included in a concentration of 4 (v / v)%, but is not limited thereto.

The composition for pretreatment and/or the composition for transporting coronavirus for detecting coronavirus and/or diagnosing coronavirus infection provided herein may be included in a kit and provided. The kit includes primers, probes, antisense nucleic acids, aptamers, antibodies, peptides and compounds for detecting proteins and/or nucleic acids, as well as preparations capable of detecting genes or proteins, as well as one or more suitable for analysis methods. Any of the above other component compositions, solutions or devices may be included.

The pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, the method for detecting coronavirus, and/or the method for diagnosing coronavirus infection provided herein

(1) mixing a first agent containing at least one selected from the group consisting of gentamicin and amphotericin B with a biological sample isolated from the subject; and

(2) A second agent comprising at least one selected from the group consisting of DTT (Dithiothreitol) and polysorbate 20 in the biological sample reacted with the first agent in step (1). It may include the step of mixing.

The coronavirus detection method and/or diagnosis method may not include a nucleic acid extraction step, but is not limited thereto.

The first agent used in the step (1) and the step (2) in the pretreatment method, coronavirus detection method, and/or coronavirus infection diagnosis method for detecting coronavirus and/or diagnosing coronavirus infection provided herein. ) The second agent used in 100:1 to 1:10 (first agent: second agent), 100:1 to 1:5, 100:1 to 1:3, 100:1 to 2:3, 100 :1 to 1:1, 100:1 to 3:2, 100:1 to 2:1, 50:1 to 1:10, 50:1 to 1:5, 50:1 to 1:3, 50:1 to 2:3, 50:1 to 1:1, 50:1 to 3:2, 50:1 to 2:1, 20:1 to 1:10, 20:1 to 1:5, 20:1 to 1 :3, 20:1 to 2:3, 20:1 to 1:1, 20:1 to 1:3, 20:1 to 1:2, 10:1 to 1:10, 10:1 to 1:5 , 10:1 to 1:3, 10:1 to 2:3, 10:1 to 1:1, 10:1 to 3:2, 10:1 to 2:1, 5:1 to 1:10, 5 :1 to 1:5, 5:1 to 1:3, 5:1 to 2:3, 5:1 to 1:1, 5:1 to 3:2, 5:1 to 2:1, 3:1 to 1:10, 3:1 to 1:5, 3:1 to 1:3, 3:1 to 2:3, 3:1 to 1:1, 3:1 to 3:2, or 3:1 to It may be used in a volume ratio of 2:1, for example, 5:2, but is not limited thereto.

Step (1) is 50 to 150 ℃, 50 to 120 ℃, 50 to 110 ℃, 50 to 105 ℃, 50 to 100 ℃, 50 to 97 ℃, 80 to 150 ℃, 80 to 120 ℃, 80 to 110 ℃ , 80 to 105 ℃, 80 to 100 ℃, 80 to 97 ℃, 90 to 150 ℃, 90 to 120 ℃, 90 to 110 ℃, 90 to 105 ℃, 90 to 100 ℃, 90 to 97 ℃, 93 to 150 ℃ , 93 to 120 ℃, 93 to 110 ℃, 93 to 105 ℃, 93 to 100 ℃, or 93 to 97 ℃, for example, may be reacted at 95 ℃, but is not limited thereto.

The step (1) is 1 minute to 10 minutes, 1 minute to 9 minutes, 1 minute to 8 minutes, 1 minute to 7 minutes, 1 minute to 7 minutes 30 seconds, 1 minute to 6 minutes, 1 minute to 5 minutes 30 seconds seconds, 2 to 10 minutes, 2 to 9 minutes, 2 to 8 minutes, 2 to 7 minutes, 2 to 7 minutes 30 seconds, 2 to 6 minutes, 2 to 5 minutes 30 seconds, 3 minutes to 10 minutes, 3 minutes to 9 minutes, 3 minutes to 8 minutes, 3 minutes to 7 minutes, 3 minutes to 7 minutes 30 seconds, 3 minutes to 6 minutes, 3 minutes to 5 minutes 30 seconds, 3 minutes 30 seconds to 10 minutes, 3 minutes 30 seconds to 9 minutes, 3 minutes 30 seconds to 8 minutes, 3 minutes 30 seconds to 7 minutes, 3 minutes 30 seconds to 7 minutes 30 seconds, 3 minutes 30 seconds to 6 minutes, 3 minutes 30 seconds to 5 minutes minutes 30 seconds, 4 minutes to 10 minutes, 4 minutes to 9 minutes, 4 minutes to 8 minutes, 4 minutes to 7 minutes, 4 minutes to 7 minutes 30 seconds, 4 minutes to 6 minutes, 4 minutes to 5 minutes 30 seconds; 4 minutes 30 seconds to 10 minutes, 4 minutes 30 seconds to 9 minutes, 4 minutes 30 seconds to 8 minutes, 4 minutes 30 seconds to 7 minutes, 4 minutes 30 seconds to 7 minutes 30 seconds, 4 minutes 30 seconds to 6 minutes, Alternatively, it may be reacted for 4 minutes and 30 seconds to 5 minutes and 30 seconds, for example, 5 minutes, but is not limited thereto.

The step of diluting the biological sample is 5 to 5000 times, 5 to 3000 times, 5 to 1500 times, 5 to 1000 times, 5 to 500 times, 5 to 300 times, 5 to 110 times, 5 to 100 times, 5 to 100 times. 50 times, 5 to 30 times, 5 to 11 times, 5 to 10 times, 9 to 5000 times, 9 to 3000 times, 9 to 1500 times, 9 to 1000 times, 9 to 500 times, 9 to 300 times, 9 to 300 times 110 times, 9 to 100 times, 9 to 50 times, 9 to 30 times, 9 to 11 times, 9 to 10 times, 10 to 5000 times, 10 to 3000 times, 10 to 1500 times, 10 to 1000 times, 10 to 10 times 500 times, 10 to 300 times, 10 to 110 times, 10 to 100 times, 10 to 50 times, 10 to 30 times, 10 to 11 times, 50 to 5000 times, 50 to 3000 times, 50 to 1500 times, 50 to 1000 times, 50 to 500 times, 50 to 300 times, 50 to 110 times, 50 to 100 times, 90 to 5000 times, 90 to 3000 times, 90 to 1500 times, 90 to 1000 times, 90 to 500 times, 90 to 300 times, 90 to 110 times, 90 to 100 times, 100 to 5000 times, 100 to 3000 times, 100 to 1500 times, 100 to 1000 times, 100 to 500 times, 100 to 300 times, 100 to 110 times, 500 to 5000 times, 500 to 3000 times, 500 to 1500 times, 500 to 1000 times, 900 to 5000 times, 900 to 3000 times, 900 to 1500 times, or 900 to 1000 times. For example, it may be 10 times, 100 times, or 1000 times, but is not limited thereto.

In the pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, the method for detecting coronavirus, and/or the method for diagnosing coronavirus infection provided herein, the DTT is reacted with the first agent and mixed with the second agent. 0.1 mM to 10 mM, 0.1 mM to 5 mM, 0.1 mM to 2.5 mM, 0.1 mM to 2 mM, 0.1 mM to 1.5 mM, 0.1 mM to 1.3 mM, 0.5 mM to 10 mM, 0.5 mM to 0.5 mM based on the total sample volume 5 mM, 0.5 mM to 2.5 mM, 0.5 mM to 2 mM, 0.5 mM to 1.5 mM, 0.5 mM to 1.3 mM, 1 mM to 10 mM, 1 mM to 5 mM, 1 mM to 2.5 mM, 1 mM to 2 mM , 1 mM to 1.5 mM, 1 mM to 1.3 mM, 1.2 mM to 10 mM, 1.2 mM to 5 mM, 1.2 mM to 2.5 mM, 1.2 mM to 2 mM, 1.2 mM to 1.5 mM, or 1.2 mM to 1.3 mM, For example, it may be mixed at a concentration of 1.25 mM, but is not limited thereto.

In the pretreatment method for detecting coronavirus and/or diagnosing coronavirus infection, the method for detecting coronavirus, and/or the method for diagnosing coronavirus infection provided herein, the polysorbate 20 reacts with the first agent and reacts with the second agent. 0.1 to 2 (v/v)%, 0.1 to 1.5 (v/v)%, 0.1 to 1 (v/v)%, 0.1 to 0.7 (v/v)%, 0.1 to 1.5 (v/v)%, based on the total volume of the mixed biological sample 0.5 (v/v)%, 0.2 to 2 (v/v)%, 0.2 to 1.5 (v/v)%, 0.2 to 1 (v/v)%, 0.2 to 0.7 (v/v)%, 0.2 to 0.2 0.5 (v/v)%, 0.3 to 2 (v/v)%, 0.3 to 1.5 (v/v)%, 0.3 to 1 (v/v)%, 0.3 to 0.7 (v/v)%, or 0.3 to 0.5 (v/v)%, e.g. It may be mixed at a concentration of 0.4 (v / v)%, but is not limited thereto.

The present invention relates to a pretreatment composition for detecting coronavirus and/or diagnosing coronavirus infection and a pretreatment method using the same, and has an effect of enabling efficient virus diagnosis without a nucleic acid extraction process.

Figure 1 is a photograph showing the prepared viral transport medium composition of Buf-1 and Buf-2.
2 and 3 are graphs showing Ct values measured by RT-qPCR as a function of the concentration of the components in the Buf-2 composition.
4 is a graph showing Ct values measured by RT-qPCR according to the type of transport medium composition.
5 is a graph showing the Ct value measured by RT-qPCR according to the dilution factor of the sample to be detected.

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are intended to illustrate the present invention and do not limit the scope of the present invention.

Example 1. Preparation of virus transport medium composition

2 (v/v)% FBS (Fetal Bovine Serum), 100 μg/ml Gentamicin, and 0.5 μg/ml Amphotericin B were added to tertiary distilled water and mixed, and 10X HBSS (Hank's Balanced Salt Solution) Buffer 1 virus transport medium composition (Buf-1) was prepared by adding buffer and mixing to a final concentration of 1X HBSS. The volume of the prepared Buf-1 was 1000ml, and 2ml was dispensed into a 15ml conical tube and stored at 4°C.

In addition, Buffer 2 virus transport medium composition (Buf-2) was prepared by adding 12.5 mM dithiothreitol (DTT) and 4 (v/v)% Tween-20 to tertiary distilled water. The prepared Buf-2 had a volume of 5 ml, was dispensed into 1.5 ml conical tubes by 1 ml and stored at 4° C., and the prepared Buf-1 and Buf-2 compositions are shown in FIG. 1 .

The tertiary distilled water is tertiary sterilized distilled water, which has been treated with diethyl pyrocarbonate (DEPC) at a concentration of 0.1 (v / v)%, and Gentamicin and Amphotericin B in the composition of Buf-1 are used to prevent bacterial and fungal specimens. It was added to prevent contamination, and the concentration of gentamicin was determined by borrowing a composition for conventional human cell culture, and if the concentration exceeds 125 μg/ml, it may adversely affect human cells to be transported.

In addition, the concentration of amphotericin B of the Buf-1 was determined by borrowing a conventional composition for human cell culture, and if the concentration exceeds 5 μg/ml, it may adversely affect the transported human cells.

Example 2. Specimen pretreatment and viral nucleic acid extraction

In 2021, it was requested as a COVID-19 suspected sample from the ^Deokyang -gu Public Health Center in Goyang-si to the Gyeonggi-do Health and Environment Research Institute and tested positive. A 10-fold diluted standard sample was prepared by adding 900 μl of Buf-1 prepared in Example 1 to 100 μl of water, and the 10-fold diluted standard sample was repeated once and twice, respectively, in substantially the same manner as the above dilution process. 100-fold or 1000-fold diluted standard samples were prepared. After reacting the diluted sample at 95°C for 5 minutes, prepare an experimental group in which 50 μl of the 10-fold, 100-fold, or 1000-fold diluted sample and 20 μl of Buf-2 prepared in Example 1 are mixed in a 1.5 ml tube. did

In addition, 100 μl of the nasopharyngeal swab was added with 900 μl of commercially available viral transport media in Table 1 below, and a 10-fold diluted standard sample was prepared by substantially the same method as the dilution process. 200 μl of the standard sample diluted 100-fold or 1000-fold was repeated once and twice, and viral RNA was extracted using the nucleic acid extraction equipment Nextractor NX-48 (Genolution; Korea) according to the manufacturer's method. 70 μl of control 1 was prepared, 50 μl of the standard sample diluted 10-fold, 100-fold or 1000-fold with the commercial viral transport medium of Table 1 below and 20 μl of the commercial virus transport medium of Table 1 below, which were added when preparing each standard sample, were mixed in a 1.5 ml tube Control 2 was prepared. Information on the commercial viral transport medium is shown in Table 1 below.

transport medium manufacturing company product name MEDIA 1 ASAN PHARM ASAN Transport medium MEDIA 2 MEDILAND MEDILAND UTM-1 MEDIA 3 BD Science BD Universal transport media

Example 3. Confirmation of the microbial growth inhibitory effect of the components in the transport medium composition

After diluting 10 times in Example 2 and preparing three standard samples in substantially the same way as the standard sample without the addition of Buf-2, store for up to 72 hours, the longest sample storage period according to the guidelines for responding to COVID-19 , The average turbidity (OD, Optical Density) value was measured using a microplate reader (VERSA max) equipment at an intensity of 600 nm, and the results are shown in Table 2 below.

hour 0 hours 24 hours 48 hours 72 hours OD 0.0366 0.0366 0.0363 0.0363

As a result, there was no difference in OD value, and it was confirmed that the growth of microorganisms was inhibited by the Buf-1.

Example 4. Confirmation of PCR efficiency according to the concentration of components in the transport medium composition

In order to confirm the PCR efficiency according to the concentration of the components in the Buf-2 composition prepared in Example 1, a standard sample diluted 10 times in Example 2 was used and Buf-2 was prepared in substantially the same manner as the experimental group in Example 2. After taking a sample and reacting using -1, DTT at a concentration of 3.125, 6.25, 12.5, 25, 50, 100 or 200 mM or 0.5, 1, 2, 4, 8, 16 or 32 (v/v)% 20 μl of the concentration of Tween-20 was added. As a control, a sample was prepared without adding DTT or Tween-20 after reacting with Buf-1.

For virus diagnosis, RdRP (RNA dependent RNA polymerase) gene and E-sarbeco gene were used as target genes, and RT-qPCR was performed using Gene Amplifier 7500 Fast Real-Time PCR System (Applied Biosystems; USA) to confirm. . The RT-qPCR reaction conditions were reverse transcription at 50 ° C for 30 minutes, denaturation at 95 ° C for 10 minutes, 95 ° C for 15 seconds and 60 ° C for 1 minute. The cycle was repeated 40 times and the reaction was stopped. . Primer information used in PCR is shown in Table 3 below, the content of the RT-qPCR composition used is shown in Table 4 below, and the Ct values measured by the corresponding RT-qPCR are shown in Figures 2, 5 (DTT), and 3 and Table 6 (Tween-20).

Primers/probes Sequence Target size sequence number RdRP_Primer_For gtgaratggtcatgtctggcgg 100bp One RdRP_Primer_Rev caratgttaaasacactattagcata 2 RdRP_Primer_Probe caggtggaacctcatcaggagatgc 3 E-Sarbeco_Primer_For acaggtacgttaatagttaatagcgt 113bp 4 E-Sarbeco_Primer_Rev atattgcagcagtacgcacaca 5 E-Sarbeco_Primer_Probe acactagccatccttactgcgcttcg 6

Realtime RT-qPCR composition Content (μl) Taqpath-1 One-step RT-qPCR Master mix 5 10 pmol Primer-F One 10 pmol Primer-R One 10 pmol probe 0.5 Distilled water 5.5 specimen 7 gun 20

DTT concentration (mM) 3.125 6.25 12.5 25 50 100 200 RdRP Non-treated Ct value 29.81 29.81 29.81 29.81 29.81 29.81 29.81 RdRP Direct+DTT Ct value 28.06 27.4 25.87 26.61 29.24 31.38 35.28 E-sarbeco Non-treated Ct values 26.67 26.67 26.67 26.67 26.67 26.67 26.67 E-sarbeco Direct+DTT Ct value 25.47 24.04 22.82 24.5 25.4 25.93 28.49

Tween-20 concentration (v/v%) 0.5 One 2 4 8 16 32 RdRP Non-treated Ct value 29.94 29.94 29.94 29.94 29.94 29.94 29.94 RdRP Direct+Tween-20 Ct value 27.11 26.97 27.01 26.97 27.01 27.2 27.34 E-sarbeco Non-treated Ct values 26.83 26.83 26.83 26.83 26.83 26.83 26.83 E-sarbeco Direct+Tween-20 Ct value 23.94 23.69 23.69 23.4 23.54 23.38 23.32

As a result, for the two target genes, when the composition was added in a specific concentration range (6.25 to 25 mM) for DTT and 0.5 to 32 (v / v)% for Tween-20, the Ct value decreased and the PCR efficiency increased. 7 μl of 70 μl of the sample treated with Buf-1 and DTT or Tween-20 was added to the composition prepared for PCR, and 2 μl of DTT or Tween-20 was added to 2 μl of 20 μl of the total PCR composition, resulting in a 10-fold dilution Form, it was confirmed that the PCR efficiency increased substantially in the concentration range of 0.625 to 2.5 mM for DTT and 0.05 to 3.2 (v / v)% for Tween-20 based on the volume of the entire PCT composition.

Example 5. Confirmation of PCR efficiency of transport medium composition and commercial viral transport medium

A recombinant plasmid (PC) inserted into the pGEM-T Easy plasmid vector after amplifying the virus-specific genes ORF1b (100bp) and E (113bp) from RNA obtained from COVID-19 positive confirmed cases was obtained from the Korea Centers for Disease Control and Prevention and prepared. In addition, a transport medium (GGUTM) in which the compositions of Buf-1 and Buf-2 prepared in Example 1 were mixed with 5:2 booby blood and a transport medium (MEDIA 1 to 6) in Table 1 of Example 2 were prepared. . In order to compare and confirm the PCR efficiency when distilled water is added to the prepared PC and when GGUTM or MEDIA 1 to 3 are added, respectively, distilled water, GGUTM and MEDIA 1 to 3 are added to the prepared PC, and the above Example RT-qPCR was performed in substantially the same manner using the primers in Table 3 of 4, and specifically, content information of the composition used during PCR is shown in Table 7 below. The PCR performance results when distilled water was added to PC and when GGUTM was added are shown in Figure 4a, and the PCR results when distilled water was added and MEDIA 1 to 3 were added are shown in Figures 4b to 4d and Table 8, respectively. .

Realtime RT-qPCR composition (Example 5) Content (μl) Taqpath-1 One-step RT-qPCR Master mix 5 10 pmol Primer-F One 10 pmol Primer-R One 10 pmol probe 0.5 PC 5.5 Distilled water, GGUTM or MEDIA 1 to 3 7 gun 20

Primer type used Added medium type Ct value RdRP Distilled water 22.38 GGUTM 23.02 MEDIA 1 26.54 MEDIA 2 24.77 MEDIA 3 27.08 E-sarbeco Distilled water 22.77 GGUTM 22.61 MEDIA 1 27.32 MEDIA 2 25.5 MEDIA 3 27.24

As a result, when GGUTM was added, Ct values and graphs similar to those when distilled water were added were shown. However, when MEDIA 1 to 3, which is a transport medium of another manufacturer, was added, the Ct value increased and it was confirmed that PCR was inhibited. Through this, it was confirmed that GGUTM is suitable for omitting the nucleic acid extraction process because it does not exhibit the PCR inhibitory effect that occurs in the virus transport medium of other manufacturers.

Example 6. Confirmation of PCR efficiency of transport medium composition according to nucleic acid extraction

A control group 2 prepared using the experimental group, control group 1, and MEDIA 1 diluted 10-fold, 100-fold or 1000-fold prepared in Example 2 was prepared. RT-qPCR was performed in substantially the same way using the primers in Table 3 of Example 4 for the prepared experimental group and control group 1 and 2, and the experimental group was the RT-qPCR composition of Table 4 in Example 4. In terms of content, PCR was performed in Control 1 with the content of the RT-qPCR composition in Table 9 below, and in Control 2 with the content of the composition in Table 10 below. The PCR results performed for each sample dilution factor and the type of primer in Table 3 are shown in Table 11 and FIGS. 5a to 5f.

Realtime RT-qPCR composition (Control 1) Content (μL) Taqpath-1 One-step RT-qPCR Master mix 5 10 pmol Primer-F One 10 pmol Primer-R One 10 pmol probe 0.5 Distilled water 7.5 Sample (extracted nucleic acid) 5 gun 20

Realtime RT-PCR composition (Control 2) Content (μL) Taqpath-1 One-step RT-PCR Master mix 5 10 pmol Primer-F One 10 pmol Primer-R One 10 pmol probe 0.5 Distilled water 5.5 Samples (samples transported in third-party transport media) 7 gun 20

Primer type used dilution factor Added medium type Ct value RdRP 10 times Control 1 24.7 Control 2 29.6 GGUTM 24.4 100 times Control 1 29.0 Control 2 32.9 GGUTM 27.9 1000 times Control 1 32.6 Control 2 36.6 GGUTM 31.2 E-sarbeco 10 times Control 1 23.2 Control 2 26.8 GGUTM 22.2 100 times Control 1 28.1 Control 2 29.7 GGUTM 25.5 1000 times Control 1 32.1 Control 2 33.0 GGUTM 28.8

As a result, the test group prepared using Buf 1 and 2 showed a Ct value similar to that of the control group 1 tested after general nucleic acid extraction, or the Ct value was lower and the intensity of fluorescence increased, so the PCR efficiency of the test group was normal. It was confirmed that it was similar to or better than the control 1 level tested after nucleic acid extraction. In addition, as a result of conducting PCR of control 2 prepared using a commercially available viral transport medium (MEDIA 1), it was confirmed that the efficiency was very low. Through this, it was confirmed that the virus transport medium composition of the experimental group was suitable for RT-qPCR without nucleic acid extraction, and that the PCR efficiency was similar to that of conventional RT-qPCR with nucleic acid extraction.

Example 7. Confirmation of the effect of transport medium composition on coronavirus-19

112 coronavirus positive samples and 100 negative samples were prepared, diluted 10-fold with Buf-1 in substantially the same manner as in Example 2, and an experimental group in which Buf-2 was mixed was prepared. In the case of the above positive sample, it was requested as a suspected sample from the Bukbu branch of the Institute of Health and Environment in the first half of 2021, and a total of 10 city and county public health centers (Uijeongbu-si, Namyangju-si, Namyangju-pungyang, Goyang-si Deokyang-gu, Ilsandong-gu, Ilsandeo-gu, Gapyeong-gun, Dongducheon-si, Yeoncheon-gun, Paju-si ), the sample information is shown in Table 12 below.

Ct Value number of samples total number of samples Ct<25 428 675 25≤Ct<30 137 30≤Ct<35 110

The 112 positive samples are similar to the ratio by concentration of coronavirus-19 positive samples requested as suspected samples at the Northern Branch of the Institute of Health and Environment in the first half of 2021. 57 samples that satisfy Ct <25, 25 ≤ Ct <30 37 samples satisfying , and 18 samples satisfying 30≤Ct<35 were prepared.

The sample prepared as above was diluted 10 times with Buf-1 in substantially the same manner as in Example 2, and Real-time RT-PCR was performed with 7500Fast equipment for the test group mixed with Buf-2, Threshold 0.2, Baseline start 3, Baseline By setting end 15, it was judged positive if Ct was 35 or less, and negative if Ct was 40 or more (if there was no amplification signal). Specifically, sensitivity was measured to determine how many percent of positive samples could be judged positive, and specificity was measured to determine what percent of actual negative samples could be judged negative, which is based on Korea CDC Protocol ver1 It was measured based on the Ct cutoff 35 used for .0, and the results are shown in Tables 13 and 14, respectively, and the sensitivity and specificity were calculated through Equations 1 and 2, respectively.

[Equation 1]

Sensitivity = (Number of samples tested positive when PCR was performed with the above test group / Number of samples that satisfied the positive Ct value before preparing the test group: 112) X 100

[Equation 2]

Specificity = (Number of samples tested negative when PCR was performed with the above test group / Number of samples that satisfied the negative Ct value before preparing the test group: 100) X 100

Ct value Sensitivity (%) Total Sensitivity (%) General RT-qPCR CT < 25 100 100 25 ≤ Ct < 35 100 experimental group CT < 25 100 95.5 25 ≤ Ct < 35 90.9

Ct value Specificity (%) Total specificity (%) General RT-qPCR CT < 25 100 100 25 ≤ Ct < 35 100 experimental group CT < 25 100 100 25 ≤ Ct < 35 100

As a result, compared to the general RT-qPCR test, the sensitivity was 95.5% and the specificity was 100%, showing superior results to the currently used antigen rapid test and saliva test. In addition, for samples with a Ct value of 30 or less, the sensitivity was 100% compared to the general test method, confirming that it was very suitable for emergency use.

Since the sensitivity was only 52% when diagnosis was made by omitting nucleic acid extraction with an existing commercial virus transport medium, when diagnosis after pretreatment by mixing Buf 1 and 2 is very strong in rapid diagnosis without nucleic acid extraction. When the Ct value of 35 was set as the positive standard, only 5 out of 112 positive samples exceeded the standard, and the sample was a weak positive sample with a Ct of 30 or more and less than 35, and appeared as undetermined, not a false negative value. If the undetermined value is set as the quarantine standard in the emergency test, the accuracy of the test is expected to be 100%.

Claims (22)

delete delete delete delete delete delete delete delete delete delete (1) mixing a first agent containing at least one selected from the group consisting of gentamicin and amphotericin B with a biological sample isolated from the subject; and
(2) A second agent comprising at least one selected from the group consisting of DTT (Dithiothreitol) and polysorbate 20 in the biological sample reacted with the first agent in step (1). Including the step of mixing,
The DTT is mixed in the first agent and the second agent at a concentration of 0.5 mM to 2.5 mM based on the total volume of the biological sample mixed,
The polysorbate 20 is mixed at a concentration of 0.1 to 2 (v / v)% based on the total volume of the biological sample mixed in the first agent and the second agent, pretreatment for detecting coronavirus or diagnosing coronavirus infection method. delete delete The pretreatment method for detecting coronavirus or diagnosing coronavirus infection according to claim 11, wherein the step (1) is reacted at 50 to 150 ° C. The pretreatment method for detecting coronavirus or diagnosing coronavirus infection according to claim 11, wherein step (1) is reacted for 1 to 10 minutes. The pretreatment method for detecting coronavirus or diagnosing coronavirus infection according to claim 11, wherein the DTT is contained in an amount of 1 mM to 100 mM based on the volume of the second agent. The pretreatment method for detecting coronavirus or diagnosing coronavirus infection according to claim 11, wherein the polysorbate 20 is contained in an amount of 1 to 20 (v/v)% based on the volume of the second agent. The method according to any one of claims 11 and 14 to 17, wherein the coronavirus is at least one selected from the group consisting of SARS-CoV, MERS-CoV, 229E, OC43, NL63, and HKU1, Coronavirus detection Or a pretreatment method for diagnosing coronavirus infection. (1) mixing a first agent containing at least one selected from the group consisting of gentamicin and amphotericin B with a biological sample isolated from the subject;
(2) A second agent comprising at least one selected from the group consisting of DTT (Dithiothreitol) and polysorbate 20 in the biological sample reacted with the first agent in step (1). mixing; and
(3) further comprising the step of performing PCR on the mixture in which steps (1) and (2) were performed;
The DTT is mixed in the first agent and the second agent at a concentration of 0.5 mM to 2.5 mM based on the total volume of the biological sample mixed,
The polysorbate 20 is mixed at a concentration of 0.1 to 2 (v / v)% based on the total volume of the biological sample mixed in the first agent and the second agent, coronavirus detection method. The method for detecting coronavirus according to claim 19, wherein when the Ct value is 35 or less during PCR, it is judged to be positive for coronavirus. delete delete

Images