KR102525206B1 - Primers set for diagnosing infection of Mycobacterium intracellulare and uses thereof - Google Patents

Abstract

The present invention relates to a primer set for diagnosing Mycobacterium intracellulare infection and its use, and the inventors designed five rep-PCR primers specific to M. intracellulare to rep-rep by existing non-specific primers. -Compared to the PCR technique, a specific and efficient rep-PCR technique was developed. This is expected to be useful by providing a potential tool for the diagnosis of mycobacterial infection and the identification of M. intracellulare strains.

Description

Primers set for diagnosing infection of Mycobacterium intracellulare and uses thereof {Primers set for diagnosing infection of Mycobacterium intracellulare and uses thereof}

The present invention relates to a primer set for diagnosing Mycobacterium intracellulare infection and its use.

Recently, as the number of immunocompromised patients increases and diagnostic methods are improved, infections caused by nontuberculous mycobacteria (NTM) are increasing. NTM accidentally penetrates the human body through routes such as inhalation, ingestion, and skin, causing infections in the lungs, skin, lymph nodes, musculoskeletal system, and genitourinary system. Lung disease is the most common local infection, and Mycobacterium avium is the causative agent. -Intracellulare complex (Mycobacterium avium-intracellulare complex; MAC) is the most common.

On the other hand, repetitive sequence based PCR (repetitive sequence based-PCR; rep-PCR) is one of the epidemiological techniques of pathogenic bacteria. The rep-PCR technique was a useful method to the extent that it was frequently used to diagnose clinical efficiency for mycobacterial infection, but production of previously used commercial products was discontinued due to non-specificity and poor reproducibility.

Accordingly, there is an urgent need for the development of new rep-PCR for the diagnosis of mycobacterial infection and the efficient identification of M. intracellulare strains.

US Patent Publication US 2011-0079512 (published on 2011.04.07)

The present invention provides a primer set for diagnosing Mycobacterium intracellulare infection, a composition for diagnosing Mycobacterium intracellulare infection comprising the primer set, and a method for diagnosing Mycobacterium intracellulare infection using the same. there is.

In order to achieve the above object, the present invention provides a primer set for diagnosing Mycobacterium intracellulare infection comprising the primers represented by SEQ ID NO: 1 to SEQ ID NO: 5.

In addition, the present invention provides a composition for diagnosing Mycobacterium intracellulare infection comprising the primer set.

In addition, the present invention provides a Mycobacterium intracellulare infection diagnosis kit comprising the composition.

In addition, the present invention (1) extracting DNA from the separated sample; (2) performing PCR using the extracted DNA as a template and using the primer set of claim 1; and (3) analyzing the PCR amplification product.

The present invention relates to a primer set for diagnosing Mycobacterium intracellulare infection and its use, and the inventors designed five rep-PCR primers specific to M. intracellulare to rep-rep by existing non-specific primers. -Compared to the PCR technique, a specific and efficient rep-PCR technique was developed. This is expected to be useful by providing a potential tool for the diagnosis of mycobacterial infection and the identification of M. intracellulare strains.

Figure 1 shows 27 species of M. intracellulare , other 4 species of NTM, E. coli , S. aureus and K. pneumoniae , the analysis results for the conventional ERIC-PCR (A) and the rep-PCR (B) of the present invention are shown. 6 to 32: M. intracellulare clinical strains, MAV 101 and 104: M. avium strains.
Figure 2 shows four species of M. intracellulare , four other species of NTM, E. coli , S. aureus and K. pneumoniae , reproducibility analysis results for the existing ERIC-PCR (A) and the rep-PCR (B) of the present invention are shown. 11, 28, 29 and 31: M. intracellulare clinical strains, MAV 101 and 104: M. avium strains, * No mark: PCR was performed using the DNA template of each strain, * mark: Subculture was carried out once using the above strains After that, a new DNA template was prepared and PCR was performed.
Figure 3 shows the Southern blot results of primer 2 for the designed rep-PCR. MI: M. intracellulare clinical strain no. 28, EC: E. coli , KP: K. pneumoniae , MA: M. abscessus , MF: M. fortuitum , MAV: M. avium.

The present invention provides a primer set for diagnosing Mycobacterium intracellulare infection, including the primers represented by SEQ ID NO: 1 to SEQ ID NO: 5.

Preferably, the primer set may be a primer set for repetitive sequence based-PCR (rep-PCR), but is not limited thereto.

The present invention provides a composition for diagnosing Mycobacterium intracellulare infection comprising the primer set.

In the present invention, a "primer" is a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and serving as a starting point for template strand copying. A short nucleic acid sequence. Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.

In the present invention, oligonucleotides used as primers may also contain nucleotide analogs, such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids, or Intercalating agents may be included.

In addition, the present invention provides a Mycobacterium intracellulare infection diagnosis kit comprising the composition.

In addition to the above primer sets, the kit of the present invention may include conventional components included in PCR kits. Conventional components included in the kit may be a reaction buffer, a polymerase, a cofactor such as dNTP (dATP, dCTP, dGTP and dTTP) and Mg2+. A variety of DNA polymerases can be used in the amplification step of the present invention, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of these polymerases can be isolated from the bacteria themselves or purchased commercially.

In the present invention, "PCR" is a method of amplifying a target nucleic acid from a primer set that specifically binds to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the present invention, "repetitive sequence based PCR (repetitive sequence-based PCR; rep-PCR)" can distinguish microorganisms to the level of phylogeny by amplifying interspersed repetitive DNA sequence segments present in the genome of microorganisms using PCR. It means an inspection method capable of obtaining a fingerprint analysis pattern with In this method, genetic fingerprints generated through PCR show different barcode forms depending on the type of microorganism, and can be classified at the level of species, subspecies, and strains of bacteria.

In addition, the present invention (1) extracting DNA from the separated sample; (2) performing PCR using the extracted DNA as a template and using the primer set; and (3) analyzing the PCR amplification product.

Preferably, the PCR may be rep-PCR, but is not limited thereto.

A method for extracting DNA from the separated sample is not particularly limited, and a technique known in the art or a commercially available DNA extraction kit may be used.

The method of the present invention includes analyzing the amplification product. Detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABI Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method is to label the amplification product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution during PCR, and then use a radioactivity measurement instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

<Experimental example>

The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

1. Bacteria samples

From 2016 to 2018, 25 M. intracellulare clinical strains were collected from patients with lung disease at Gyeongsang National University Hospital (GNUH, Gyeongnam, Korea), and 2 M. intracellulare control strains (Asan 37128 and ATCC 13950) were collected. and M. abscessus were collected from the Korean Collection for Type Cultures (KCTC, Jeongeup, Korea), and four strains ( M. Fortuitum , E. coli ) O157, S. aureus , K. pneumoniae ) were collected from the Pathogen Resource Bank (GNUH-NCCP) of Gyeongsang National University Hospital. Two species of M. avium (MAV 101, MAV 104) were collected from Yonsei University.

2. rep- PCR for primer design

About 20% of the entire genome sequence of M. intracellulare ATCC 13950 (https://www.ncbi.nlm.nih.gov/nuccore/NC_016946.1) was divided into a total of 200 sequence files of 5 kb-size. All sequence files were applied to Repeats-sequences-finder (https://www.novoprolabs.com/tools/repeats-sequences-finder), respectively, and about 7600 results were obtained. Among them, 51 candidate groups ranging from 16 bp to 62 bp were checked for alignment with the ATCC 13950 genome using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences repetitive at least at least 30 sites on the genome were selected, primers for rep-PCR were designed based on the selected sequences, and primers were matched at at least 30 sites with 90% affinity with the ATCC 13950 genome. . Through the above process, five primers were selected in the present invention.

3. rep- PCR and reproducibility test

Genomic DNA was extracted using AccuPrep®Genomic DNA Extraction Kit (bioneer, Korea). Per tube, 120 ng of DNA template and 5 mixed primers (10 pmol/primer) were used in the PCR reaction to maintain constant quality. PCR experiments were performed under the following conditions. 1 cycle at 95° C. for 5 minutes, 95° C. for 30 seconds; 65° C. for 1 minute; 35 cycles at 72°C for 2 minutes and 1 cycle at 72°C for 7 minutes. PCR products were loaded on a 3% agarose gel. For the reproducibility test, 4 species of M. intracellulare, M. foutuitum , M. abscessus , and 2 species of M. avium , E. coli , S. aureus and K. pneumoniae were subcultured at intervals of 7 days, and their DNA The template was re-extracted. PCR was performed for reproducibility under the same conditions as in the previous experiment. ERIC-PCR using ERIC primers (ERIC 1R, 5'-ATGTAAGCTCCTGGGGATTCAC-3'; ERIC 2, 5'-AAGTAAGTGGGGGAGCG-3') was performed under the following conditions. 1 cycle at 95° C. for 5 minutes, 95° C. for 30 seconds; 40° C. for 1 minute; 30 cycles at 72°C for 2 minutes and 1 cycle at 72°C for 7 minutes. Other conditions are the same as above.

4. Clustering analysis

The rep-PCR analysis was performed using the GelJ program (version 2.0) under the conditions of Dice coefficient, UPGMA clustering, resistance value of 1.0, and fms dendrogram generation according to the PCR pattern.

5. Southern blot (Southern Blot)

In the designed rep-PCR, a total of six electrophoretic bands ( M. intracellulare No. 28, E. coli , K. pneumoniae , M. abscessus , M. fortuitum , M. avium 104) were stained with GeneScreen Plus membrane (NEN, NEF988 ) moved to Southern blotting was performed using the ECL Direct Labeling and Detection System (GE, RPN3000). However, the probe labeling system was changed from ECL to a biotin labeling system. The detection system was also changed to the North2South Chemiluminescent Hybridization and Detection Kit (thermos, 17097) using streptavidin-HRP (sigma, N100). Primer 2 tagged with biotin at the 5' end was synthesized by Bioneer inc. (Korea). Hybridization and washing were performed at 50 °C and 40 °C, respectively.

< Example >

One. primer design

In order to replace the repetitive sequence of the existing ERIC sequence, five primers for rep-PCR were developed (Table 1). Primer 1 was derived from a 57 bp sequence encoding an unknown protein in ATCC 13950. Primer 2 was derived from a 20 bp sequence encoding an unknown protein specific to mycobacteria, which is shared by M. avium , M. kansasi , M. bovis and M. tuberculosis . Primer 3 was derived from a 50 bp sequence encoding an unknown protein, and Primers 4 and 5 were derived from a 62 bp sequence encoding the rfbE protein in the ATCC 13950 genome.

Repetitive sequence (size) Primer Sequences of primers (5'-3', size) Coding region in ATCC 13950 AGCTGGCGATCGCCGCGGAGCAGATGGTGGCGACCCGCTGCGCCCCGGCGCTGCCGG (57bp) Primer 1 GATGGTGGCGACCCGCTGCG (20bp)
(SEQ ID NO: 1) hypothetical protein GCCGCGCTTGCGATCGCCAC (20bp) Primer 2 GCCGCGCTTGCGATCGCCAC (20bp)
(SEQ ID NO: 2) Mycobacterial specific- hypothetical protein AGTGGCGCCTGATGGCGTGCTACGACGATGCAGAGCGAAGCGATGAGGAGG (50 bp) Primers 3 CGACGATGCAGAGCGAAGCGATG (23bp)
(SEQ ID NO: 3) hypothetical protein CCACTAGGTATCGATGGTGGCGACCCGCTTCGCCCGGCTCCGCCGCGCTCGCGATCGCCACT (62bp) Primer 4 CGCCGCGCTCGCGATCGCCACT (22bp)
(SEQ ID NO: 4) rfbE Primer 5 GGCGACCCGCTTCGCCCGGCTCCG (24bp)
(SEQ ID NO: 5)

2. Rep- PCR and reproducibility

In order to compare the existing primers and the rep-PCR of the present invention, rep-PCRs were performed using the ERIC primers and the primers of the present invention (FIG. 1). In addition, a reproducibility test of each rep-PCR was also performed (Fig. 2). In the rep-PCR of the present invention, 25 species of M. intracellulare showed different bands depending on the strain, which showed a pattern distinct from strains of other species. S. aureus did not show bands. In addition, other species ( E. coli , K. pneumoniae , M. abscessus , M. fortuitum , M. avium ) showed specific bands depending on the species. However, in the conventional ERIC-PCR, S. aureus showed a band, which was M. intracellulare and K. pneumoniae / The pattern could not be distinguished from M. intracellulare and M. abscessus . The above results confirmed the same reproducibility except for MAV 104 of ERIC-PCR (FIG. 2).

3. Southern blot (Southern Blot)

In order to confirm the specificity of the primer, primer 2 (mycobacteria specific probe) was hybridized with the rep-PCR band of the present invention. The E. coli rep-PCR pattern did not show a sequence complementary to primer 2, whereas the PCR product of M. intracellularare showed a complementary combination with three bands. K. pneumoniae , M. abscessus , M. fortuitum , and M. avium showed different patterns from M. intracellulare (Fig. 3).

Having described specific parts of the present invention in detail above, it is clear to those skilled in the art that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> Primers set for diagnosing infection of Mycobacterium intracellulare and uses its <130> ADP-2020-0467 <160> 5 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Mycobacterium intracellulare <400> 1 gatggtggcg acccgctgcg 20 <210> 2 <211> 20 <212> DNA <213> Mycobacterium intracellulare <400> 2 gccgcgcttg cgatcgccac 20 <210> 3 <211> 23 <212> DNA <213> Mycobacterium intracellulare <400> 3 cgacgatgca gagcgaagcg atg 23 <210> 4 <211> 22 <212> DNA <213> Mycobacterium intracellulare <400> 4 cgccgcgctc gcgatcgcca ct 22 <210> 5 <211> 24 <212> DNA <213> Mycobacterium intracellulare <400> 5 ggcgacccgc ttcgcccggc tccg 24

Claims (6)

A primer set for diagnosing Mycobacterium intracellulare infection comprising the primers represented by SEQ ID NO: 1 to SEQ ID NO: 5. The primer set for diagnosing Mycobacterium intracellulare infection according to claim 1, wherein the primer set is a primer set for repetitive sequence based-PCR (rep-PCR). A composition for diagnosing Mycobacterium intracellulare infection comprising the primer set of claim 1 or 2. A diagnostic kit for Mycobacterium intracellulare infection comprising the composition according to claim 3. (1) extracting DNA from the separated sample;
(2) performing PCR using the extracted DNA as a template and using the primer set of claim 1; and
(3) A method for providing information necessary for diagnosing Mycobacterium intracellulare infection, comprising the step of analyzing the PCR amplification product. [Claim 6] The method of claim 5 , wherein the PCR is rep-PCR.

Images