KR102469920B1 - Composition comprising cd146 protein for preventing or treating muscle-aging related diseases - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle aging-related diseases comprising CD146 protein and collagen. It was confirmed that the CD146 protein has an effect of removing damaged muscle tissue and promoting the differentiation of new muscle tissue. In addition, since it was confirmed that removal of damaged muscle, delayed muscle differentiation, and muscle regeneration effects can be maximized by adjusting the weight ratio of CD146 protein and collagen, the composition according to the present invention is useful for preventing or treating muscle aging-related diseases. can be used

Description

Composition for preventing or treating muscle aging-related diseases containing CD146 protein

The present invention relates to a composition for preventing, improving or treating muscle aging-related diseases comprising at least one selected from the group consisting of a CD146 protein, a CD146 protein expression promoter, and a CD146 protein activator.

In addition, the present invention relates to a method for screening a substance having an effect of treating, improving or preventing muscle aging-related diseases.

Aging is largely divided into physiological aging and pathological aging. Physiological aging is aging that inevitably occurs as we age, and changes in hair, skin, eyes, bones, brain, etc., and deterioration in exercise capacity or energy metabolism appear.

On the other hand, the decrease in muscle strength or endurance caused by aging reduces the ability of daily life. In addition, the decrease in energy metabolism causes an imbalance between energy intake and energy consumption, which may cause lifestyle-related diseases such as obesity or diabetes.

As a type of muscular atrophy in which muscle mass or strength decreases, disuse muscle atrophy or sarcopenia are known. When muscle atrophy occurs, a decrease in muscle function accompanies it. In particular, the elderly are prone to fractures due to muscle atrophy or decreased muscle strength due to old age, and when activities are restricted by fixing a cast for the treatment of this, a vicious cycle in which pulmonary muscle atrophy or decline in muscle function rapidly progresses is repeated. It becomes (Korean Patent Publication KR 10-2015-0131555).

On the other hand, senescence-induced sarcopenia due to myoblasts whose differentiation potential is reduced due to aging is a disease that is distinguished from neuromuscular disease caused by damage to nerve cells that control autonomous muscles. The neuromuscular disease includes muscle dystrophy, neuromuscular junction disease, motor neuron disease, and the like, and it is known that there is a difference in pathogenesis and treatment method from age-related sarcopenia.

Korean Patent Publication KR 10-2015-0131555

As a result of intensive research efforts to suppress muscle aging and treat muscle aging-related diseases, the present inventors have found that CD146 protein is associated with muscle aging, and when treated with aged muscle by adjusting the weight ratio of CD146 protein and collagen, damaged The present invention was completed by finding that the effects of muscle removal, delayed muscle differentiation, and muscle regeneration can be maximized.

Accordingly, an object of the present invention is to provide a composition for preventing, improving or treating muscle aging-related diseases, comprising as an active ingredient a substance capable of increasing the amount of CD146 protein.

Another object of the present invention is to provide a screening method for substances having therapeutic, ameliorating, or preventing effects on muscle aging-related diseases using the expression level of CD146 protein.

In order to solve the above problems, one aspect of the present invention provides a pharmaceutical composition for preventing or treating muscle aging-related diseases comprising CD146 protein, a CD146 protein expression promoter, and a CD146 protein activator as active ingredients.

In addition, another aspect of the present invention provides a food composition for preventing or improving muscle aging-related diseases comprising CD146 protein, a CD146 protein expression promoter, and a CD146 protein activator as active ingredients.

In addition, another aspect of the present invention provides a feed composition for preventing or improving muscle aging-related diseases of livestock, comprising CD146 protein, a CD146 protein expression promoter, and a CD146 protein activator as active ingredients.

In addition, another aspect of the present invention provides a method for screening a substance having an effect of treating, improving or preventing muscle aging-related diseases, comprising the step of selecting a test substance that increases the expression level of CD146 protein in muscle cells.

CD146 protein has the effect of promoting the removal of muscle tissue damaged by aging and the regeneration of new muscle tissue. In addition, the effect can be maximized by adjusting the weight ratio of the collagen processed together with the CD146 protein. Therefore, the composition of the present invention can be usefully used for purposes such as treatment and improvement of muscle aging-related diseases. In addition, the screening method of the present invention can effectively screen substances effective for treating or improving muscle aging-related diseases by utilizing the expression level of the CD146 protein.

1 is a result of analyzing the physical properties of a hydrogel containing CD146 protein.
Figure 2 is the result of evaluating the muscle tissue regeneration effect according to the weight ratio of CD146 protein and collagen.
3A and 3B show the measurement of the expression levels of CD146 protein and CD146 mRNA according to the degree of aging in muscle tissues of mice, and FIG. 3C measures the expression level of CD146 protein according to the degree of differentiation of skeletal muscle cells (C2C12). will be.
Figure 4A analyzes the binding concentration of the VEGFR2 receptor and CD146 adhesion ability through SPR analysis, and Figure 4B analyzes the concentration bound over time by treating differentiated muscle cells with fluorescently labeled CD146 protein.
Figure 5A is the evaluation of the adhesion ability to the muscle tissue according to the concentration of the CD146 protein, Figure 5B is the evaluation of the adhesion ability of the treatment time of the CD146 protein in the inflammation-induced muscle tissue.
Figure 6 is an evaluation of the phagocytic activity in muscle tissue according to the treatment concentration of CD146 protein.
Figure 7A shows the degree of adhesion of immune cells according to the treatment time of the CD146 protein in the muscle tissue induced by inflammation, and Fig. 7B evaluates the phagocytic activity according to the treatment time of the CD146 protein in the muscle tissue induced by inflammation. .
Figure 8 evaluates the expression levels of myogenin (A), myosin heavy chain type II (B) and MyoD (C) according to CD146 protein treatment in muscle tissue.
Figure 9 evaluates the expression levels of myostatin (A), NF-κB (B), apoptosis (C), and caspase-3/7 (D) according to CD146 protein treatment in muscle tissue.
Figure 10 confirms the level of expression of Ly6G and CD14 in muscle tissue (A) and the level of association between muscle tissue and immune cells (neutrophils and macrophages) (B) when CD146 is treated with muscle cells induced by LPS inflammation. will be.
11 is an evaluation of the body distribution and residence time of samples in the muscle tissues of mice treated with CD146 protein samples.
FIG. 12 evaluates the expression of muscle differentiation-related marker proteins in muscle tissues of mice treated with CD146 protein samples.
FIG. 13 evaluates the expression of inflammation-related marker proteins in muscle tissues of mice treated with CD146 protein samples.
FIG. 14 evaluates the expression of marker proteins related to autophagy in muscle tissues of mice treated with CD146 protein samples.
15 shows the evaluation of the therapeutic effect of mouse muscle tissues over time after treatment with CD146 protein samples.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention provides a pharmaceutical composition for preventing or treating muscle aging-related diseases comprising at least one selected from the group consisting of a CD146 protein, a CD146 protein expression promoter, and a CD146 protein activator as an active ingredient.

As used herein, the term "cluster of differentiation 146 (CD146)" is known as melanoma cell adhesion molecule (MCAM) or cell surface glycoprotein MUC18, and is a cell adhesion molecule having a molecular weight of 113 kDa. The CD146 is known to bind to vascular endothelial growth factor receptor 2 (VEGFR2), a signal transduction domain.

As used herein, the term "CD146 protein expression promoter" refers to a substance that enhances the expression of CD146 protein in muscle cells. The CD146 protein expression promoter includes any substance that enhances the expression of CD146 at a transcriptional level or a protein level.

As used herein, the term "activator of CD146 protein" refers to a substance that positively regulates the activity of CD146 protein by directly interacting with or indirectly interacting with CD146 protein. For example, the activator of the CD146 protein may be a substance that binds to the CD146 protein and enhances the activity of the CD146 protein.

In one embodiment of the present invention, the CD146 protein may be a polypeptide having the amino acid sequence of SEQ ID NO: 1. Meanwhile, the nucleotide sequence encoding the CD146 protein having the amino acid sequence of SEQ ID NO: 1 may be the nucleotide sequence of SEQ ID NO: 2.

The pharmaceutical composition may further include a biodegradable material. Specifically, it may further include collagen.

In one embodiment of the present invention, the weight ratio of at least one selected from the group consisting of CD146 protein, CD146 protein expression promoter, and CD146 protein activator included in the composition may be 2 to 15% (w/w) based on the weight of collagen. Yes, preferably 12.3% (w / w).

In the present invention, by adjusting the weight ratio of the collagen, the extent of the area affected by the treatment of the CD146 protein and the residence time can be appropriately adjusted. Thus, side effects caused by the accumulation of CD146 protein can be minimized.

When the weight ratio of one or more selected from the group consisting of the CD146 protein, the expression promoter of the CD146 protein, and the activator of the CD146 protein is 2 to 15% (w/w) relative to the weight of collagen, a sufficient therapeutic effect on aged muscle tissue can be exerted. and can appropriately control the residence time of the CD146 protein in the body.

Regeneration of muscle tissue damaged by aging can be achieved by first removing damaged muscle cells and then generating new muscle tissue through muscle differentiation. At this time, it is possible to promote the regeneration of muscle tissue by alleviating the inflammation of the damaged muscle tissue.

In one embodiment of the present invention, the CD146 protein enhances the activity of immune cell-related markers in muscle cells induced by inflammation. The markers related to the immune cells are Ly6G and CD14. Ly6G is a representative marker of neutrophils, and CD14 is a representative marker of macrophages (Fig. 10).

In one embodiment of the present invention, the CD146 protein enhanced the activity of autophagy-related markers in muscle cells induced by inflammation (FIG. 14).

As used herein, the term "autophagy" refers to an action in which materials inside a cell are removed by the cell itself. Cytoplasmic wastes, degenerative proteins, or organelles with reduced function due to end of life or denaturation are removed by autophagy. Proteins/organelles to be removed are sequestered in double-membrane vesicles called autophagosomes in the cell, and these vesicles combine with lysosomes to form autophagolysosomes. In it, degradation occurs by lysosomal enzymes. The decomposed materials are used to make energy necessary for cell survival or to create new organelles.

The marker associated with autophagy may be any one or more selected from the group of p62, Beclin-1, ATP-5, ATP-7 and Bnip3.

In one embodiment of the present invention, the CD146 protein enhances the activity of markers related to muscle differentiation in muscle cells induced by inflammation (FIG. 12) and inhibits the activity of markers related to inflammation (FIG. 13).

Specifically, the muscle differentiation marker may be at least one selected from the group consisting of myogenin, myosin heavy chain (MyHC) type II, MyoD, and amphiregulin.

In addition, the inflammation-related marker may be any one or more selected from the group of myostatin, NF-κB, apoptosis, and caspase-3/7.

As used herein, the term "muscular aging" refers to the gradual weakening of muscle density and function with aging, and the "muscular aging-related disease" is caused by changes in the state of muscles and abnormalities caused by aging. In particular, muscle loss due to aging is also called age-related sarcopenia. It is common for people who experience muscle aging to be prone to falls and fractures. The muscle aging-related disease may specifically be a disease selected from the group consisting of muscular atrophy, disuse muscle atrophy, and age-related sarcopenia. The above muscle aging-related diseases may be accompanied by muscle inflammation due to trauma, and the composition of the present invention has an effect of alleviating or improving muscle inflammation.

The pharmaceutical composition of the present invention may further include pharmaceutically acceptable additives.

The pharmaceutical composition may be administered in various oral and parenteral dosage forms during actual clinical administration. When formulated, diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants are used. It can be prepared by

In one embodiment of the present invention, the formulation of the pharmaceutical composition may be a hydrogel. The physical properties of the hydrogel are shown in FIG. 1, and even when CD146 protein and collagen are mixed with the hydrogel, it is confirmed that the gel is formed well (left) and the viscosity at low temperature is maintained (right). In addition, the concentration of the hydrogel may be 18 to 22%, preferably 20%. When the concentration of the hydrogel is 18 to 22%, the gelation retention time is increased when administered to muscle tissue, and the release rate of the CD146 protein can be appropriately controlled (FIG. 2).

The dosage of the pharmaceutical composition of the present invention varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease.

The pharmaceutical composition of the present invention can be administered orally or parenterally depending on the desired method, and in the case of parenteral administration, external skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection Injection method can be selected. The dosage may vary depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease.

In addition, the present invention provides a step of administering to a subject a pharmaceutical composition for preventing or treating muscle aging-related diseases comprising at least one selected from the group consisting of a CD146 protein, an expression promoter of CD146 protein, and an activator of CD146 protein as an active ingredient. It provides a method for preventing or treating muscle aging-related diseases comprising

The method may further include collagen as an active ingredient.

The treatment method of the present invention is applicable to any animal capable of preventing or treating muscle aging-related diseases, and animals may include livestock such as cattle, pigs, sheep, horses, dogs, and cats, as well as humans and primates. .

In addition, another aspect of the present invention provides a food composition for preventing or improving muscle aging-related diseases comprising at least one selected from the group consisting of a CD146 protein, an expression promoter of CD146 protein, and an activator of CD146 protein as an active ingredient.

The CD146 protein, the CD146 protein expression promoter, and the CD146 protein activator included in the food composition of the present invention are as described above.

The food may be a health functional food. As used herein, the term "health functional food" refers to food manufactured and processed using raw materials or ingredients having useful functionalities for the human body in accordance with the Health Functional Food Act (Article 3, Subparagraph 1), and "Functionality" means to obtain useful effects for health purposes such as regulating nutrients for the structure and function of the human body or physiological actions (Article No. 2). The health functional food of the present invention can perform functions related to preventing or improving muscle aging-related diseases.

The food composition may additionally contain food additives, and the suitability as a "food additive" is determined by the general rules and general test methods of the Food Additive Code approved by the Korea Food and Drug Administration, unless otherwise specified. judged by criteria. For example, the food composition may include various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin , alcohol, carbonation agents used in carbonated beverages, and the like. In addition, the composition of the present invention may include fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination.

In addition, another aspect of the present invention is a feed or feed for preventing or improving muscle aging-related diseases of livestock comprising at least one selected from the group consisting of a CD146 protein, an expression promoter of CD146 protein, and an activator of CD146 protein as an active ingredient. An additive composition is provided.

The CD146 protein, the CD146 protein expression promoter, and the CD146 protein activator included in the feed or feed additive composition of the present invention are as described above.

When the composition is prepared as a feed additive, the composition may be 20 to 90% high concentration or may be prepared in powder or granular form. The feed additives are organic acids such as citric acid, fumaric acid, adipic acid, lactic acid, and malic acid, sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate (polyphosphate), polyphenol, catechin, alpha-tocopherol, and rosemary. extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, phytic acid, and the like, or any one or more natural antioxidants may be further included. When prepared as a feed, the composition may be formulated in a conventional feed form, and may include common feed ingredients together.

The feed and feed additive compositions may include grains such as milled or crushed wheat, oats, barley, corn and rice; vegetable protein feeds such as those based on rape, soybean, and sunflower; animal protein feed such as blood meal, meat meal, bone meal and fish meal; It may further include sugar and dairy products, for example, dry ingredients composed of various powdered milk and whey powder, etc., and may further include nutritional supplements, digestion and absorption enhancers, growth promoters, and the like.

The feed additive composition may be administered to animals alone or in combination with other feed additives in an edible carrier. In addition, the feed additives can be easily administered to animals as a top dressing, directly mixed with animal feed, or in an oral formulation separate from feed. When the feed additive is administered separately from animal feed, it can be prepared as an immediate release or sustained release formulation by combining it with a pharmaceutically acceptable edible carrier, as is well known in the art. Such edible carriers can be solid or liquid, for example corn starch, lactose, sucrose, soybean flakes, peanut oil, olive oil, sesame oil and propylene glycol. When a solid carrier is used, the feed additive may be a tablet, capsule, powder, troche or sugar-containing tablet or top dressing in a microdispersible form. When a liquid carrier is used, the feed additive may be in the form of a gelatin soft capsule, or a syrup, suspension, emulsion, or solution formulation.

In addition, the feed and feed additive composition may contain auxiliary agents, for example, preservatives, stabilizers, wetting agents or emulsifiers, solution accelerators, and the like. The feed additive may be used by adding it to an animal's feed by steeping, spraying or mixing.

The feed or feed additive composition of the present invention can be applied to a number of animal diets including mammals, poultry and fish. As the mammal, it can be used for pigs, cows, horses, sheep, rabbits, goats, rats, hamsters, and guinea pigs, which are rodents and laboratory rodents, as well as pets (eg, dogs and cats). It can also be used for turkeys, ducks, geese, pheasants, and quails, and can be used for carp, crucian carp, and trout as the fish, but is not limited thereto.

In addition, another aspect of the present invention is to (a) process a test substance in a biological sample, and (b) select a test substance that increases the expression of CD146 protein compared to a test substance untreated group in the biological sample. It provides a screening method for a substance having an efficacy for treating, improving or preventing muscle aging-related diseases, comprising the steps of:

The muscle aging-related disease may be selected from the group consisting of muscular dystrophy, pulmonary muscular dystrophy and age-related sarcopenia. In addition, the muscle aging-related diseases are as described above.

The biological sample may be an experimental model animal or cell line. Specifically, the experimental model animal may be a mouse with damaged muscles or a mouse aged 20 months or older, and the cell line may be myogenic cells or muscle cells derived from mammals or differentiated and cultured from stem cells.

As used herein, the term "test substance" refers to an unknown substance used in screening to examine whether or not it affects the expression level of CD146 protein in muscle cells. The test substance includes, but is not limited to, compounds, nucleotides, antisense nucleotides, siRNA, and natural extracts.

In the method of the present invention, the method may mean 'contact'. As used herein, the term "contacting" is a general meaning, and is used to bind two or more agents (eg, two polypeptides) or to bind an agent and a cell (eg, a protein and a cell). say that Contacting can occur in vitro, and can also occur in cells or in situ.

In the above method, enhancing the expression level of CD146 may include increasing both the expression level of CD146 mRNA or the expression level of CD146 protein. Therefore, whether or not the expression level of CD146 is increased can be determined by measuring the amount of CD146 mRNA in a biological sample. The analysis method for this purpose is not particularly limited and may follow a method commonly used in the art. Non-limiting examples of the analysis method include RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), competitive RT-PCR (Competitive RT-PCR), real-time RT-PCR (Real-time RT-PCR), RNase protection assay (RNase protection assay; RPA), Northern blot, DNA chip, and the like. In addition, whether or not the increase in the expression of CD146 can be performed by checking the presence and level of CD146 protein expressed in muscle cells. Specifically, the protein can be identified using an antibody that specifically binds to the CD146 protein. For example, the CD146 protein identification method includes Western Blot, Enzyme Linked Immunosorbent Assay (ELISA), Radioimmunoassay (RIA), Radioimmunodiffusion, Ouchterlony Immunosorbent Assay, It may be Rocket Immuno Electrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip, and the like.

Hereinafter, the present invention will be described in more detail by the following examples. However, the following examples are only for exemplifying the present invention, and the scope of the present invention is not limited only to these.

Example 1. Preparation of mice

8-month-old and 23-month-old C57B6 mice (Orient Bio, Korea) were used. Mice were purchased 1 week prior to the experiment and adapted to the laboratory environment, and were provided with unlimited food and water intake. Animals were bred by maintaining the temperature of the animal breeding room at 24 ± 0.5 ° C and humidity at about 50 ± 5%.

Example 2. Preparation of muscle tissue model

After isolating myoblasts from the tibialis anterior muscle (TA) of the mouse prepared in Example 1, DMEM containing 2% horse serum (HS) and 1% P / S in a 90% confluence state After differentiation into skeletal muscle cells (Myotube) cells for 5 days through the culture medium, they were placed in a mold containing OCT (Optimal Cutting Temperature) compound and prepared by freezing the muscle tissue model using liquid nitrogen.

Example 3. Preparation of damaged muscle tissue cell model

The muscle tissue model prepared in Example 2 was cultured in DMEM medium containing LPS (1 μg/ml) and 1% P/S for 24 hours to induce damage to skeletal muscle cells, and then placed in a frame containing OCT compound. and prepared by freezing the damaged muscle tissue model using liquid nitrogen.

Example 4.1. Preparation of samples containing CD146 protein

To separate and purify the entire nucleotide sequence of the CD146 protein, the pCMV-MCAM-Flag plasmid (HG10115-CF) with a FLAG tag attached to the C-terminus was transfected into HEK293T cells (CRL-11268, ATCC, USA) ( transfection). The transfected HEK293T cells were selected with Hygromycin for 14 days and lysed using a lysis buffer containing protease inhibitor and phosphatase inhibitor cocktail in RIFA buffer. The lysed sample was centrifuged at 13,000 RPM for 20 minutes to extract whole cell lysate. 3x Flag CD146 protein was purified from whole cell lysate using Flag tag magnetic beads.

Example 4.2. Preparation of hydrogel containing CD146 protein and collagen

In order to control the effective weight ratio of CD146 protein and collagen, inflammation was induced by subcutaneous injection of LPS at a concentration of 1 mg/kg into the thigh of the mouse prepared in Example 1, and then the ratio of CD146 protein and collagen was varied to induce muscle The regeneration effect was evaluated.

Specifically, after treating the inflammation-induced mouse with a hydrogel containing 2.3, 5.65, and 12.3% (w/w) of CD146 protein relative to the weight of collagen, respectively, the muscle tissue of Example 2 was subjected to immunohistochemistry. After treatment, the muscle regeneration effect was imaged with a digital camera (Olympus Model #; CX41, IMTcam3 P/N; UP900310A (IMT Solution Inc.) (FIG. 2).

As a result, referring to FIG. 2, as the weight ratio of CD146 protein in the hydrogel increased, the regeneration effect of muscle tissue was excellent, and thus, the case where the CD146 protein was included in 2 to 15% (w/w) relative to the weight of collagen The effective weight ratio was selected.

On the other hand, in the hydrogel containing the CD146 protein and collagen, the concentration of the hydrogel was adjusted to 16, 18, 20, 22 and 24%, and 50 μl of the thigh prepared in Example 1 was injected subcutaneously into the mouse thigh, The degree of gelation within the muscle tissue was evaluated. As a result, it was confirmed that when the concentration of the hydrogel was 20%, the gel form was maintained even after 3 hours. Therefore, in the following experiment, the concentration of the hydrogel was used at 20%.

Experimental Example 1. Confirmation of CD146 expression according to aging of muscle tissue

In order to investigate the relationship between muscle aging and CD146, CD146 protein and mRNA expression levels were evaluated in the muscle of the mouse of Example 2 (FIG. 3).

Specifically, in order to measure the amount of protein expression in the tibialis anterior muscle (TA) of the 8-month-old and 23-month-old C57B6 mice of Example 1, the protease inhibitor phosphatase inhibitor cocktail was added to RIFA buffer by isolating the tibialis anterior muscle (TA) from each mouse. Each was dissolved using the contained lysis buffer. Western blot was performed on the dissolved tibialis anterior muscle sample using anti-rabbit-CD146 (P1H12, abcam, an110142) and anti-mouse-β-actin (santa cruz, sc-74501) as antibodies. .

In addition, in order to measure the amount of mRNA expression in the tibialis anterior muscle (TA) of the mouse, the tibialis anterior muscle (TA) was isolated from each mouse and total RNA was extracted with trizol. After cDNA synthesis, the mRNA level was confirmed with the CD146 primer, and the base sequence of each primer is shown in Table 1 below.

division designation base sequence SEQ ID NO: 3 mouse CD146 Forward 5' GTGTTGAATCTGTCTTGTGAA 3' SEQ ID NO: 4 mouse CD146 Reverse 5' ATGCCTCAGATCGATG 3'

As a result, referring to FIG. 3, it was confirmed that the expression levels of CD146 protein (FIG. 3A) and mRNA (FIG. 3B) were higher in young mice than in old mice. In addition, the amount of CD146 protein decreased according to the degree of differentiation in skeletal muscle cells (C2C12) (FIG. 3C).

Experimental Example 2. Confirmation of adhesion ability of VEGFR2 and CD146

After coating the VEGFR2 antibody on a surface plasma resonance (SPR) sensor chip, binding the VEGFR2 protein, and flowing the CD146 protein through the flow, the binding affinity (Kd) of the CD146 protein and the VEGFR2 receptor was evaluated (FIG. 4A).

As a result, referring to FIG. 4A, it was found that the binding affinity between the VEGFR2 receptor and the CD146 protein was 1.77 nM.

In addition, Alexa Fluor 488 NHS Ester (Succinimidyl Ester, Thermo Fisher Scientific, USA), a fluorescent sample, was bound to the CD146 protein obtained in Example 4.1 according to the manufacturer's protocol. After processing the muscle tissue model obtained in Example 2, the binding level of the CD146 protein and the VEGFR2 receptor was measured using an ELISA reader (Excitation/Emission = 495/519 nm) (FIG. 4B).

As a result, referring to FIG. 4B , when the CD146 protein was treated, it bound to the VEGFR2 receptor at a concentration of 200 nM, but it was confirmed that the degree of binding decreased over time.

Experimental Example 3. Confirmation of the regenerative ability of damaged muscle tissue according to the treatment of CD146 protein

The regeneration ability of damaged muscle cells according to the CD146 protein treatment of Example 4.1 was confirmed.

Experimental Example 3.1. Confirmation of adhesion ability of muscle tissue and CD146

The ability to attach to muscle tissue according to the concentration of CD146 protein was evaluated (FIG. 5A).

Specifically, the muscle tissue model prepared in Example 2 was treated with CD146 protein, which was bound to a fluorescent sample, by concentration (0.5, 1, 2, and 4 mM) and cultured in DMEM medium containing 10% FBS and 1% P/S for 24 After incubation for an hour, the changed fluorescence value was measured with an ELISA reader (Excitation/Emission = 495/519 nm) (FIG. 5a).

As a result, referring to FIG. 5A, as the concentration of CD146 protein increased, the ability to adhere to muscle tissue increased.

In addition, the adhesion ability according to the treatment time of the CD146 protein in the damaged muscle tissue was evaluated (FIG. 5B).

Specifically, the damaged muscle tissue model prepared in Example 3 was treated with CD146 protein bound to a fluorescent sample at a concentration of 1 μM. On the other hand, after transferring vascular cells (C57-6009, C57BL/6 Mouse Primary Vein Endothelial Cells, Cell Biologics, USA) cultured in the upper chamber of the trans well plate to the damaged muscle tissue model, neutrophils (MPRO) stained with CellTracker dye After incubation with Cell Line, Clone 2.1, ATCC ^® CRL-11422 ^TM ) or macrophages (J774A.1, ATCC ^® TIB67 ^TM ) for 1 to 2 hours, the changed fluorescence value was measured with an ELISA reader (FIG. 5B) .

As a result, referring to FIG. 5B, the adhesion ability of the CD146 protein was significantly increased in the damaged muscle tissue model.

Experimental Example 3.2. Confirmation of phagocytosis

When the muscle tissue model was treated with CD146 protein, the activity of phagocytosis by concentration was evaluated (FIG. 6).

Specifically, the muscle tissue model prepared in Example 2 was treated with CD146 protein bound to a fluorescent sample at different concentrations (0.5, 1, 2, and 4 nM) and cultured for 12 hours.

In addition, the damaged muscle tissue model prepared in Example 3 was treated with CD146 protein bound to the fluorescent sample at different concentrations (0.5, 1, 2, and 4 nM). On the other hand, after transferring the vascular cells cultured in the upper chamber of the Transwell plate to the damaged muscle tissue model, they were cultured for 24 hours with neutrophils or macrophages stained with CellTracker dye. The blood vessel cells are treated in vitro to realize that neutrophils and macrophages in blood pass through blood vessels and adhere to muscle cells and have a phagocytic effect due to muscle damage.

The muscle tissue model prepared in Example 2, which was not treated with anything, was used as a control group, and the phagocytosis assay was analyzed using a Phagocytosis Assay Kit according to the manufacturer's protocol.

As a result, referring to FIG. 6, phagocytosis in muscle tissue increased in proportion to the concentration of CD146 protein treated, and in particular, when 1 mM or more CD146 protein was treated, phagocytosis in muscle cells significantly increased. .

In addition, when the muscle tissue model was treated with CD146 protein, the activity of phagocytosis over time was evaluated (FIGS. 7A and 7B).

Specifically, the muscle tissue model prepared in Example 2 was treated with CD146 protein bound to a fluorescent sample at a concentration of 1 μM and cultured for 12 or 24 hours.

In addition, the damaged muscle tissue model prepared in Example 3 was treated with CD146 protein bound to a fluorescent sample at a concentration of 1 μM. On the other hand, after transferring the vascular cells cultured in the upper chamber of the Transwell plate to the damaged muscle tissue model, they were cultured for 12 or 24 hours with neutrophils or macrophages stained with CellTracker dye.

The muscle tissue model prepared in Example 2, which was not treated with anything, was used as a control, and the cell morphology was confirmed through a microscope (FIG. 7A), and the relative phagocytosis (FIG. 7B) was evaluated through a phagocytosis assay.

As a result, referring to FIG. 7A, the degree of association between inflammation-induced muscle tissue and CD146 protein decreased with time after treatment with CD146 protein, and referring to FIG. 7B, muscle tissue was treated with CD146 protein over time. My phagocytic activity decreased.

The above results show that the CD146 protein induces the attachment of immune cells to the inflammatory site of damaged skeletal muscle cells, promotes the decomposition of damaged skeletal muscle cells through phagocytosis, and the attached immune cells naturally fall off after a certain period of time, leading to an excessive immune response. implying that it doesn't happen.

Experimental Example 3.3. Identification of myogenic markers

After treating the muscle tissue models of Examples 2 and 3 with the CD146 protein of Example 4.1, myogenin and myosin heavy chain (MyHC), which are markers for differentiation of muscle cells in muscle tissue ) activities of type II and MyoD were evaluated (FIG. 8).

Specifically, the muscle tissue model prepared in Example 2 was treated with CD146 protein bound to a fluorescent sample at a concentration of 1 μM and cultured for 24 hours.

In addition, the damaged muscle tissue model prepared in Example 3 was treated with CD146 protein bound to a fluorescent sample at a concentration of 1 μM. On the other hand, after transferring the vascular cells cultured in the upper chamber of the Transwell plate to the damaged muscle tissue model, they were cultured for 24 hours with neutrophils or macrophages stained with CellTracker dye.

As a control, the muscle tissue model prepared in Example 2 was used as a control, and total RNA was isolated, cDNA synthesized, and mRNA levels of muscle differentiation markers were measured using protein-specific pump primers. Real-time PCR , and the specific nucleotide sequence of the francmer is shown in Table 2 below.

division designation base sequence SEQ ID NO: 5 mouse Myogenin Forward 5' TGCCCAGTGAATGCAACTCC 3' SEQ ID NO: 6 mouse Myogenin Reverse 5' TTGGGCATGGTTTCGTCTGG 3' SEQ ID NO: 7 mouse myoD Forward 5' GGCTACGACACCGCCTACTA 3' SEQ ID NO: 8 mouse myoD Reverse 5′ CGACTCTGGTGGTGCATCTG 3′ SEQ ID NO: 9 mouse MyHc II Forward 5' GCTGAGCGAGCTGAAATCC 3' SEQ ID NO: 10 mouse MyHC II Reverse 5' ACTGAGACACCAGAGCTTCT 3'

As a result, referring to FIG. 8, the activities of myogenin (FIG. 8A), myosin heavy chain type II (FIG. 8B), and MyoD (FIG. 8C) were markedly increased in muscle tissue damaged by the treatment of CD146 protein.

Experimental Example 3.4. Identification of inflammatory markers

In the muscle tissue model treated with CD146 protein according to the method of Experimental Example 3.3, the activity of myostatin was evaluated using the inflammatory marker primer instead of the muscle differentiation marker primer (FIG. 9).

Base sequences of specific primers are shown in Table 3 below.

division designation base sequence SEQ ID NO: 11 mouse Myostatin Forward 5' ACGCTACCACGGAAACAATC 3' SEQ ID NO: 12 mouse Myostatin Reverse 5' CTGGTCCTGGGAAGGTTACA 3'

In addition, NF-κB activity, an inflammatory marker, was measured by luciferase assay (Promega, USA), Caspase-3/7 activity was measured by Caspase-3/7 kit (Promega, USA), and the degree of apoptosis was measured by Cell Death detection ELISA PLUS (Roche , USA) was measured according to the manufacturer's protocol.

As a result, referring to FIG. 9, myostatin (FIG. 9A), NF-κB (FIG. 9B), apoptosis (FIG. 9C), and caspase-3/7 (FIG. 9D) in muscle tissue damaged by CD146 protein treatment. activity was markedly reduced.

Experimental Example 4. Confirmation of the treatment effect of damaged skeletal muscle cells according to the treatment of CD146 protein and hydrogel

The treatment effect of damaged muscle cells according to the treatment of the hydrogel sample containing the CD146 protein was confirmed.

Example 4.1. Confirmation of immune cell migration to damaged skeletal muscle cells

The damaged muscle tissue model of Example 3 was treated with 50 μl of PBS, the sample of Example 4.1. and the sample of Example 4.2, respectively, and the muscle tissue was separated every 3, 12, 24 and 72 hours, and the OCT compound was contained. After placing the separated tissue in a mold and freeze-drying it using liquid nitrogen, it was sectioned into 10 μm using a Microtome device. The cut muscle tissue was attached to a microscope slide, and the tissue on the slide was fixed with 4% paraformaldehyde to detect anti-Ly6G antibody (BD biosciences, 551461) and anti-CD14 antibody (BD Biosciences 557153, USA). Immunohistochemistry was performed using , and imaging was performed using a microscope (anti-Ly6G antibody Ex/Em = 496/578, anti-CD14 antibody Ex/Em = 494/520) (FIG. 10A).

As a result, referring to FIG. 10A, when the inflammation-induced muscle tissue was treated with the CD146 protein, the expression of Ly6G and CD14, markers of immune cells, increased in the muscle tissue.

In addition, in the damaged muscle tissue model of Example 3, Example 4.1. And after processing the sample of Example 4.2., the adhesion ability of neutrophils and macrophages in muscle tissue was evaluated (FIG. 10B).

Specifically, PBS, the sample of Example 4.1. or the sample of Example 4.2. was treated with a cell plate for culturing the damaged muscle tissue model of Example 3 and coated for 24 hours, followed by Vybrant DiD Cell-Labeling Neutrophils and macrophages labeled with Solution (V22887, Thermo Fisher Scientific, USA) were cultured and reacted together for 24 hours. After the reaction, neutrophils and macrophages were fixed using 4% Paraformaldehyde, and the fixed samples were imaged under a fluorescence microscope.

As a result, referring to FIG. 10B, the CD146 protein increases the adhesion ability of neutrophils and macrophages in the muscle tissue where inflammation is induced. increased further.

The above results suggest that the CD146 protein increases the number and adhesion of immune cells migrating to the damaged muscle tissue, thereby effectively inducing early phagocytosis in the damaged muscle tissue.

Experimental Example 4.2. Check the body distribution and residence time of the sample

The sample of Example 4.1. and the sample of Example 4.2. were treated with the mouse of Example 1, and the distribution and residence time of the sample in the body of the mouse were evaluated (FIG. 11).

Specifically , after stabilizing BALB/c-nu/nu mice (Orient Bio, Korea) for one week, subcutaneous injection of Alexa 680-coupled CD146 protein and nanoparticles containing a mixture of the CD146 protein and hydrogel was subcutaneously injected into the mouse's thigh. was injected with At 1, 3 and 24 hours after administration, the fluorescence of CD146 protein remaining in mice was confirmed using IVIS® Spectrum CT (IVIS ^® ).

As a result, referring to FIG. 11, the treated samples were intensively distributed in the administration site, and when the CD146 protein was treated alone, it remained in the body for about 1 hour, but the sample treated with the CD146 protein and the hydrogel together was 24 Remained for hours.

Experimental Example 4.3. Identification of myogenic markers

The damaged muscle tissue model of Example 3 was treated with the sample of Example 4.1. and the sample of Example 4.2. to evaluate the expression of markers related to muscle differentiation (FIG. 12).

Specifically, a sample of hydrogel (nanoparticle, N) containing CD146 protein (P) and CD146 was administered to the damaged muscle tissue model of Example 3, and 24 hours later, a dissolution buffer containing protease inhibitor phosphatase inhibitor cocktail in RIFA buffer , respectively, and anti-Mouse-MyHC II antibody (upstate, 05-833, USA), anti-mouse-eMyHC II antibody (Santa Cruz sc376157, USA), anti-Myogenin antibody (5FD-Novus biotechne brand, NB100-56510, USA), anti-Amphregulin antibody (Santa Cruz, sc-74501, USA) and anti-tubulin antibody (Santa Cruz, sc-8035, USA) were used to measure the expression level of myogenic markers through Western blotting. was measured (Fig. 12 left). The muscle tissue model (C) of Example 2 was used as a control group, and the damaged muscle tissue model (L) of Example 3, which was not subjected to treatment, was used as a positive control group.

In addition, 50 μl of the sample of Example 4.2 was administered to the damaged muscle tissue model of Example 3, and the expression levels of muscle differentiation markers after 12, 24, 48, and 96 hours were measured by Western blot (Fig. 12 right ).

As a result, referring to FIG. 12, when the CD146 protein is treated, myosin heavy chain type II (MyHC II), new myosin heavy chain type II (eMyHC II), myogenin and mpiregulin ( Amphiregulin) was excellent, and when the hydrogel containing the CD146 protein was treated, the expression level of the muscle differentiation marker was more excellent. In particular, the expression of muscle differentiation-related markers after sample treatment tended to be maintained or increased over time.

Experimental Example 4.4. Identification of inflammatory markers

The expression level of inflammatory markers according to the treatment of CD146 protein was evaluated in damaged muscle tissue using an inflammatory marker antibody instead of the myogenic marker antibody used in Experimental Example 4.3 (FIG. 13).

Anti-NF-κB p65 (Santa Cruz, sc-8008, USA), anti-IκB (Santa Cruz, sc-371, USA), anti-Myostatin (Santa Cruz, sc-134345, USA) and anti-antibodies -tubulin (Santa Cruz, sc-8035, USA) was used.

As a result, referring to FIG. 13, when the CD146 protein was treated, the expression of NF-κB and myostatin decreased in the damaged muscle tissue, and when the CD146 protein and the hydrogel were treated together, NF-κB and It was confirmed that the expression level of myostatin was further decreased. After treatment of the sample, the expression of inflammation-related markers tended to be maintained or decreased over time.

Experimental Example 4.5. Confirmation of autophagy formation

Autophagy is one of the key mechanisms required to remove damaged muscle tissue before generating new muscle tissue.

Therefore, 50 μl of the sample of Example 4.2 was administered to the damaged muscle tissue model of Example 3, and the expression level of autophagy-related markers after 12, 24, 48, and 96 hours was measured by Western blot using the autophagy-related marker antibody. It was measured by blotting (FIG. 14).

Anti-p62 (cell signaling, 5114s (Santa Cruz, sc-8035, USA), anti-Beclin1 (cell signaling, 3495T (Santa Cruz, sc-8035, USA)), anti-ATG5 (cell signaling, 2630s) , USA), anti-ATG7 (cell signaling, 8558s, USA), anti-Bnip3 (cell signaling, #44060, USA), anti-MyoD (Santa Cruz, sc377186, USA) and anti-β-actin (Santia Cruz sc47778 , USA) was used.

As a result, referring to Figure 14, when the CD146 protein and the hydrogel are treated together, the expression of p62, Beclin-1, ATP-5, ATP-7, Bnip3 and MyoD in the damaged muscle tissue increases over time showed a tendency

Experimental Example 4.6. Confirmation of the healing effect of damaged muscle tissue according to the treatment of CD146 protein

In the muscle tissue model of Example 2, Example 4.1. Alternatively, after processing the sample of Example 4.2., the condition of the muscle tissue was evaluated (FIG. 15).

Specifically, 24 hours after LPS was administered to the muscle tissue model of Example 2 at a concentration of 1 mg/kg, the hydrogel (nanoparticle) containing the CD146 protein of Example 4.1. or the CD146 of Example 4.2. of samples were processed. After processing the sample, separate muscle tissue every 3 hours, 12 hours, 24 hours and 72 hours, put the separated tissue in a mold containing OCT compound, freeze-dry using liquid nitrogen, and then use Microtome equipment and cut into 10 μm (section). The cut muscle tissue was attached to a microscope slide, and the tissue on the slide was fixed with 4% paraformaldehyde. The fixed sample was H&E stained with hematoxylin and eosin and imaged using a digital camera (IMTcam3_Plus, P/NUP900310A).

Referring to FIG. 15, the CD146 protein had an excellent healing effect on muscle tissue from which inflammation was induced, and in particular, when the hydrogel containing the CD146 protein was treated, the healing effect on muscle damage was the best after 24 hours. did

<110> Korea Research Institute of Bioscience and Biotechnology <120> COMPOSITION COMPRISING CD146 PROTEIN FOR PREVENTING OR TREATING MUSCLE-AGING RELATED DISEASES <130> FPD/201910-0107/C <150> KR 10-2019-0079520 <151> 2019-07-02 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 646 <212> PRT <213> artificial sequence <220> <223> CD146 protein <400> 1 Met Gly Leu Pro Arg Leu Val Cys Ala Phe Leu Leu Ala Ala Cys Cys 1 5 10 15 Cys Cys Pro Arg Val Ala Gly Val Pro Gly Glu Ala Glu Gln Pro Ala 20 25 30 Pro Glu Leu Val Glu Val Glu Val Gly Ser Thr Ala Leu Leu Lys Cys 35 40 45 Gly Leu Ser Gln Ser Gln Gly Asn Leu Ser His Val Asp Trp Phe Ser 50 55 60 Val His Lys Glu Lys Arg Thr Leu Ile Phe Arg Val Arg Gln Gly Gln 65 70 75 80 Gly Gln Ser Glu Pro Gly Glu Tyr Glu Gln Arg Leu Ser Leu Gln Asp 85 90 95 Arg Gly Ala Thr Leu Ala Leu Thr Gln Val Thr Pro Gln Asp Glu Arg 100 105 110 Ile Phe Leu Cys Gln Gly Lys Arg Pro Arg Ser Gln Glu Tyr Arg Ile 115 120 125 Gln Leu Arg Val Tyr Lys Ala Pro Glu Glu Pro Asn Ile Gln Val Asn 130 135 140 Pro Leu Gly Ile Pro Val Asn Ser Lys Glu Pro Glu Glu Val Ala Thr 145 150 155 160 Cys Val Gly Arg Asn Gly Tyr Pro Ile Pro Gln Val Ile Trp Tyr Lys 165 170 175 Asn Gly Arg Pro Leu Lys Glu Glu Lys Asn Arg Val His Ile Gln Ser 180 185 190 Ser Gln Thr Val Glu Ser Ser Gly Leu Tyr Thr Leu Gln Ser Ile Leu 195 200 205 Lys Ala Gln Leu Val Lys Glu Asp Lys Asp Ala Gln Phe Tyr Cys Glu 210 215 220 Leu Asn Tyr Arg Leu Pro Ser Gly Asn His Met Lys Glu Ser Arg Glu 225 230 235 240 Val Thr Val Pro Val Phe Tyr Pro Thr Glu Lys Val Trp Leu Glu Val 245 250 255 Glu Pro Val Gly Met Leu Lys Glu Gly Asp Arg Val Glu Ile Arg Cys 260 265 270 Leu Ala Asp Gly Asn Pro Pro Pro His Phe Ser Ile Ser Lys Gln Asn 275 280 285 Pro Ser Thr Arg Glu Ala Glu Glu Glu Thr Thr Asn Asp Asn Gly Val 290 295 300 Leu Val Leu Glu Pro Ala Arg Lys Glu His Ser Gly Arg Tyr Glu Cys 305 310 315 320 Gln Gly Leu Asp Leu Asp Thr Met Ile Ser Leu Leu Ser Glu Pro Gln 325 330 335 Glu Leu Leu Val Asn Tyr Val Ser Asp Val Arg Val Ser Pro Ala Ala 340 345 350 Pro Glu Arg Gln Glu Gly Ser Ser Leu Thr Leu Thr Cys Glu Ala Glu 355 360 365 Ser Ser Gln Asp Leu Glu Phe Gln Trp Leu Arg Glu Glu Thr Gly Gln 370 375 380 Val Leu Glu Arg Gly Pro Val Leu Gln Leu His Asp Leu Lys Arg Glu 385 390 395 400 Ala Gly Gly Gly Tyr Arg Cys Val Ala Ser Val Pro Ser Ile Pro Gly 405 410 415 Leu Asn Arg Thr Gln Leu Val Asn Val Ala Ile Phe Gly Pro Pro Trp 420 425 430 Met Ala Phe Lys Glu Arg Lys Val Trp Val Lys Glu Asn Met Val Leu 435 440 445 Asn Leu Ser Cys Glu Ala Ser Gly His Pro Arg Pro Thr Ile Ser Trp 450 455 460 Asn Val Asn Gly Thr Ala Ser Glu Gln Asp Gln Asp Pro Gln Arg Val 465 470 475 480 Leu Ser Thr Leu Asn Val Leu Val Thr Pro Glu Leu Leu Glu Thr Gly 485 490 495 Val Glu Cys Thr Ala Ser Asn Asp Leu Gly Lys Asn Thr Ser Ile Leu 500 505 510 Phe Leu Glu Leu Val Asn Leu Thr Thr Leu Thr Pro Asp Ser Asn Thr 515 520 525 Thr Thr Gly Leu Ser Thr Ser Thr Ala Ser Pro His Thr Arg Ala Asn 530 535 540 Ser Thr Ser Thr Glu Arg Lys Leu Pro Glu Pro Glu Ser Arg Gly Val 545 550 555 560 Val Ile Val Ala Val Ile Val Cys Ile Leu Val Leu Ala Val Leu Gly 565 570 575 Ala Val Leu Tyr Phe Leu Tyr Lys Lys Gly Lys Leu Pro Cys Arg Arg 580 585 590 Ser Gly Lys Gln Glu Ile Thr Leu Pro Pro Ser Arg Lys Ser Glu Leu 595 600 605 Val Val Glu Val Lys Ser Asp Lys Leu Pro Glu Glu Met Gly Leu Leu 610 615 620 Gln Gly Ser Ser Gly Asp Lys Arg Ala Pro Gly Asp Gln Gly Glu Lys 625 630 635 640 Tyr Ile Asp Leu Arg His 645 <210> 2 <211> 3332 <212> DNA <213> artificial sequence <220> <223> CD146 cDNA <400> 2 acttggctct cgccctccgg ccgggaagca tggggcttcc caggctggtc tgcgccttct 60 tgctcgccgc ctgctgctgc tgtcctcgcg tcgcgggtgt gcccggagag gctgagcagc 120 ctgcgcctga gctggtggag gtggaagtgg gcagcacagc ccttctgaag tgcggcctct 180 cccagtccca aggcaacctc agccatgtcg actggttttc tgtccacaag gagaagcgga 240 cgctcatctt ccgtgtgcgc cagggccagg gccagagcga acctggggag tacgagcagc 300 ggctcagcct ccaggacaga ggggctactc tggccctgac tcaagtcacc ccccaagacg 360 agcgcatctt cttgtgccag ggcaagcgcc ctcggtccca ggagtaccgc atccagctcc 420 gcgtctacaa agctccggag gagccaaaca tccaggtcaa ccccctgggc atccctgtga 480 acagtaagga gcctgaggag gtcgctacct gtgtagggag gaacgggtac cccattcctc 540 aagtcatctg gtacaagaat ggccggcctc tgaaggagga gaagaaccgg gtccacattc 600 agtcgtccca gactgtggag tcgagtggtt tgtacacctt gcagagtatt ctgaaggcac 660 agctggttaa agaagacaaa gatgcccagt tttactgtga gctcaactac cggctgccca 720 gtgggaacca catgaaggag tccagggaag tcaccgtccc tgttttctac ccgacagaaa 780 aagtgtggct ggaagtggag cccgtgggaa tgctgaagga agggggaccgc gtggaaatca 840 ggtgtttggc tgatggcaac cctccaccac acttcagcat cagcaagcag aaccccagca 900 ccagggaggc agaggaagag acaaccaacg acaacggggt cctggtgctg gagcctgccc 960 ggaaggaaca cagtgggcgc tatgaatgtc agggcctgga cttggacacc atgatatcgc 1020 tgctgagtga accacaggaa ctactggtga actatgtgtc tgacgtccga gtgagtcccg 1080 cagcccctga gagacaggaa ggcagcagcc tcaccctgac ctgtgaggca gagagtagcc 1140 aggacctcga gttccagtgg ctgagagaag agacaggcca ggtgctggaa agggggcctg 1200 tgcttcagtt gcatgacctg aaacgggagg caggaggcgg ctatcgctgc gtggcgtctg 1260 tgcccagcat acccggcctg aaccgcacac agctggtcaa cgtggccatt tttggccccc 1320 cttggatggc attcaaggag aggaaggtgt gggtgaaaga gaatatggtg ttgaatctgt 1380 cttgtgaagc gtcagggcac ccccggccca ccatctcctg gaacgtcaac ggcacggcaa 1440 gtgaacaaga ccaagatcca cagcgagtcc tgagcaccct gaatgtcctc gtgaccccgg 1500 agctgttgga gacaggtgtt gaatgcacgg cctccaacga cctgggcaaa aacaccagca 1560 tcctcttcct ggagctggtc aatttaacca ccctcacacc agactccaac acaaccactg 1620 gcctcagcac ttccactgcc agtcctcata ccagagccaa cagcacctcc acagagagaa 1680 agctgccgga gccggagagc cggggcgtgg tcatcgtggc tgtgattgtg tgcatcctgg 1740 tcctggcggt gctgggcgct gtcctctatt tcctctataa gaagggcaag ctgccgtgca 1800 ggcgctcagg gaagcaggag atcacgctac ccccgtctcg taagagcgaa cttgtagttg 1860 aagttaagtc agataagctc ccagaagaga tggggcctcct gcagggcagc agcggtgaca 1920 agagggctcc gggagaccag ggagagaaat acatcgatct gaggcattag ccccgaatca 1980 cttcagctcc cttccctgcc tggaccattc ccagctccct gctcactctt ctctcagcca 2040 aagcctccaa agggactaga gagaagcctc ctgctcccct cgcctgcaca ccccctttca 2100 gagggccact gggttaggac ctgaggacct cacttggccc tgcaaggccc gcttttcagg 2160 gaccagtcca ccaccatctc ctccacgttg agtgaagctc atcccaagca aggagcccca 2220 gtctcccgag cgggtaggag agtttcttgc agaacgtgtt ttttctttac acacattatg 2280 gctgtaaata cctggctcct gccagcagct gagctgggta gcctctctga gctggtttcc 2340 tgccccaaag gctggcttcc accatccagg tgcaccactg aagtgaggac acaccggagc 2400 caggcgcctg ctcatgttga agtgcgctgt tcacacccgc tccggagagc accccagcag 2460 catccagaag cagctgcagt gttgctgcca ccaccctcct gtctgcctct tcaaagtctc 2520 ctgtgacatt ttttctttgg tcagaagcca ggaactggtg tcattcctta aaagatacgt 2580 gccggggcca ggtgtggtgg ctcacgcctg taatcccagc actttggggg gccgaggcgg 2640 gcggatcaca aagtcaggac gagaccatcc tggctaacac ggtgaaaccc tgtctctact 2700 aaaaatacaa aaaaaaatta gctaggcgta gtggttggca cctatagtcc cagctactcg 2760 gaaggctgaa gcaggagaat ggtatgaatc caggaggtgg agcttgcagt gagccgagac 2820 cgtgccactg cactccagcc tgggcaacac agcgagactc cgtctcgagg aaaaaaaaag 2880 aaaagatacg tgcctgcggt gaggaagctg ggcgctgttt tcgagttcag gtgaattagc 2940 ctcaatcccc cgtgttcact tggctcccat agccctcttg atggatcacg taaaactgaa 3000 aggcagcggg gagcagacaa agatgaggtc tacactgtcc ttcatgggga ttaaagctat 3060 ggttatatta gcaccaaact tctacaaacc aagctcaggg ccccaaccct agaagggccc 3120 aaatgagaga atggtactta gggatggaaa acgggcctgg ctagagcttc gggtgtgtgt 3180 gtctgtctgt gtgtatgcat acatatgtgt gtatatatgg ttttgtcagg tgtgtaaatt 3240 3300 aaaaataaag cttaattgtc ccagaaatca ta 3332 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> mouse CD146 Forward <400> 3 gtgttgaatc tgtcttgtga a 21 <210> 4 <211> 16 <212> DNA <213> artificial sequence <220> <223> mouse CD146 Reverse <400> 4 atgcctcaga tcgatg 16 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse Myogenin Forward <400> 5 tgcccagtga atgcaactcc 20 <210> 6 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse myogenin reverse <400> 6 ttgggcatgg tttcgtctgg 20 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse myoD Forward <400> 7 ggctacgaca ccgcctacta 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse myoD Reverse <400> 8 cgactctggt ggtgcatctg 20 <210> 9 <211> 19 <212> DNA <213> artificial sequence <220> <223> mouse MyHc II Forward <400> 9 gctgagcgag ctgaaatcc 19 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse MyHC II Reverse <400> 10 actgagacac cagagcttct 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse Myostatin Forward <400> 11 acgctaccac ggaaacaatc 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> mouse myostatin reverse <400> 12 ctggtcctgg gaaggttaca 20

Claims (11)

A pharmaceutical composition for preventing or treating muscle aging-related diseases comprising CD146 protein and collagen as active ingredients,
The muscle aging-related disease is a disease selected from the group consisting of muscular atrophy, disuse muscle atrophy and age-related sarcopenia, a pharmaceutical agent for preventing or treating muscle aging-related disease. composition. According to claim 1,
The CD146 protein has an amino acid sequence of SEQ ID NO: 1, a pharmaceutical composition for preventing or treating muscle aging-related diseases. According to claim 2,
The CD146 protein is encoded by the nucleotide sequence of SEQ ID NO: 2, a pharmaceutical composition for preventing or treating muscle aging-related diseases. delete According to claim 1,
The weight ratio of the CD146 protein is 2 to 15% (w / w) relative to the weight of collagen, a pharmaceutical composition for preventing or treating muscle aging-related diseases. According to claim 1,
The composition is a hydrogel formulation, a pharmaceutical composition for the prevention or treatment of muscle aging-related diseases. delete A food composition for preventing or improving muscle aging-related diseases comprising CD146 protein and collagen as active ingredients,
The muscle aging-related disease is a disease selected from the group consisting of muscular atrophy, pulmonary muscular atrophy and senescence-related sarcopenia, a food composition for preventing or improving muscle aging-related disease. A feed or feed additive composition for preventing or improving muscle aging-related diseases of livestock containing CD146 protein and collagen as active ingredients,
The muscle aging-related disease is a disease selected from the group consisting of muscular atrophy, pulmonary muscular atrophy and senescence-related sarcopenia, a feed or feed additive composition for preventing or improving livestock muscle aging-related diseases.
delete delete

Images