KR102458499B1 - Composition for Preventing or Treating Melasma and A Methods for Screening the Same - Google Patents

Abstract

The present invention relates to: a pharmaceutical composition for preventing or treating melasma; a method for screening a pharmaceutical composition for preventing or treating melasma; and a kit for screening melasma medicine using the same. According to the present invention, the hyperpigmented skin cells have different mRNA or protein expression levels of NRF2, IFT88, GLI1, GLI2, PTCH1, involucrin, K10, tyrosinase, MITF, and filaggrin so as to screen melasma medicine through the expression levels of the genes of the cells. In addition, the pharmaceutical composition of the present invention, if used, can suppress the occurrence of melasma or improve melasma symptoms.

Description

Melasma prevention or treatment composition and its screening method {Composition for Preventing or Treating Melasma and A Methods for Screening the Same}

The present invention relates to a composition for preventing or treating melasma and a screening method thereof.

Primary cilia are antenna-like organelles protruding from the apical surface of eukaryotic cells, which contain axons consisting of a ring of nine microtubule doublets extending from the basal body at the base of the cilia derived from the maternal centriole. . Primary cilia are closely related to RPGRIP1L and IFT genes. RPGRIP1L (Retinitis pigmentosa GTPase regulator-interacting protein 1-like) is a basal body gene involved in ciliary formation, and IFT (Intrafalgellar Transport) is responsible for ciliary assembly. It is a gene involved in the development of the elongation of ciliary axons.

The hedgehog signal pathway is a highly conserved intracellular signaling system. In 1980, it was named the hedgehog (Hh) pathway because genetic mutations in this pathway in Drosophila can lead to larvae showing multiple hedgehog-shaped overhangs.

The Hh signaling pathway consists of an Hh ligand, two transmembrane protein receptor-patched membrane receptors (PTCH) and a smoothed transmembrane protein (SMO), downstream transcription factor Gli protein, and the like. PTCH is a cell surface receptor, a 12 transmembrane protein encoded by the tumor suppressor gene PTCH, with a dual role of isolation and transduction Hh, and SMO is structurally very similar to that of the G protein-coupled receptor family and Hh It is a 7 transmembrane protein with a signal transduction effect. PTCH and SMO act as receptors in the Hh signaling process. Here, PTCH is a receptor for Hh, and in the absence of Hh, PTCH prevents SMO translocation to the cell membrane, thereby inhibiting SMO activity and inhibiting transcriptional expression of downstream genes. On the other hand, in the presence of Hh signal, Hh binds to PTCH and induces phosphorylation of multiple serine/threonine residues at the C-terminus of SMO, leading to aggregation and activation of SMO on the cell surface; The activated SMO interacts with the kinesin-like molecule Costal2 (Cos2) and the fused serine/threonine kinase (Fus), the fused suppressor (Sufu) to form a complex and dissociate from the microtubule. SMO plays a role in transcriptional activation by the full-length conformation and ultimately induces activation of the zinc-like transcription factor Gli.

In general, melasma is an acquired hyperpigmented skin disease common to Asian women, and it often occurs on sun-exposed areas. UV exposure, female hormones, family history, etc. are known as the causes of the occurrence of spots, but the mechanism of the occurrence of spots has not been precisely elucidated. Research is being carried out continuously.

Therefore, if there is a method to screen for the treatment of melasma, it will be possible to further spur research on the treatment for melasma.

Republic of Korea Registration Publication No. 10-2165565 (2020.10.14)

One aspect is a) one selected from the group consisting of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin from hyperpigmented skin cells Measuring the expression level of mRNA or protein of the gene above; b) treating the hyperpigmented skin cells with a melasma treatment candidate; c) one or more genes selected from the group consisting of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin from the cells of step a) measuring the mRNA expression level or the protein expression level; and d) comparing the gene mRNA or protein expression levels measured in steps a) and c); It is to provide a screening method of a melasma treatment comprising a.

Another aspect is the mRNA or protein expression level of one or more genes selected from the group consisting of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin. It is to provide a screening kit for the treatment of melasma comprising a formulation for measuring

Another aspect is to provide a pharmaceutical composition for preventing or treating freckles comprising a substance that activates the expression of genes or proteins of NRF2, IFT88, or hedgehog signal pathway.

Another aspect is to provide a pharmaceutical composition for preventing or treating melasma comprising one or more substances from the group consisting of SAG (Smoothened Agonist) or SHH (Sonic hedgehog protein).

One aspect is a) one selected from the group consisting of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin from hyperpigmented skin cells Measuring the expression level of mRNA or protein of the gene above; b) treating the hyperpigmented skin cells with a melasma treatment candidate; c) one or more genes selected from the group consisting of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin from the cells of step a) measuring the mRNA expression level or the protein expression level; and d) comparing the gene mRNA or protein expression levels measured in steps a) and c); It is to provide a screening method of a melasma treatment comprising a.

The hyperpigmentation refers to skin symptoms that are black or brown due to an increase in melanin on the skin or nails, the mucous membrane surrounding the oral cavity or nasal cavity, etc. It may mean brown skin.

The hyperpigmented skin cells may be cells in which IFT88 gene expression is reduced compared to normal skin cells.

The hyperpigmented skin cells may be keratinocytes, melanocytes, or a cell line in which keratinocytes and melanocytes are co-cultured.

The hyperpigmented skin cells may be obtained by obtaining lesioned cells from a melasma patient.

According to one embodiment, e) when the mRNA or protein expression level of NRF2, IFT88, GLI1, GLI2, and PTCH1 increases in step c) than in step a), the method may further include the step of determining as a melasma treatment agent.

According to one embodiment, e) mRNA or protein expression levels of Involucrin, K10, Tyrosinase, Mitf, and Filagrin decrease in step c) than in step a). It may further include the step of

Measuring the mRNA expression level is a process of confirming the presence and expression level of mRNA of the gene in keratinocytes, melanocytes, and cell lines co-cultured with keratinocytes and melanocytes, and is performed by measuring the amount of mRNA. As an analysis method for this, for example, reverse transcription polymerase reaction (RT-PCR), competitive reverse transcription polymerase reaction (Competitive RT-PCR), real time reverse transcription polymerase reaction (Real time RT-PCR), Rnase protection assay (RPA) : RNase protection assay), Northern blotting, DNA chip, etc., but is not limited thereto.

The agent for measuring mRNA expression may be an antisense oligonucleotide, a primer pair or a probe. The antisense oligomer hybridizes with the target sequence in the RNA by Waxon-Crick base pairing, allowing the formation of an oligomeric heteroduplex, typically mRNA and RNA, within the target sequence and the intersubunit backbone between the sequence of nucleotide bases and subunits. Refers to an oligomer having An oligomer may have exact sequence complementarity or approximate complementarity to a target sequence. These antisense oligomers can block or inhibit the translation of mRNA and alter the processing of mRNA to produce splice variants of the mRNA.

The primer is a nucleic acid sequence having a short free 3-terminal hydroxyl group, and refers to a short nucleic acid sequence capable of forming a base pair with a complementary template and serving as a starting point for template strand copying. Primers are capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures.

The probe refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding to mRNA, and is labeled to confirm the presence or absence of a specific mRNA. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.

Since the gene of the present invention has a nucleic acid sequence registered in the gene bank, a person skilled in the art can design an antisense oligonucleotide, primer pair or probe that specifically amplifies a specific region of these genes based on the sequence.

Antisense oligonucleotides, primers or probes of the present invention can be chemically synthesized using the phosphor amidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoros. amidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

Measuring the protein expression level is melanocytes, keratinocytes, and melanocytes and keratinocytes co-cultured cell system in order to screen for an agent for treating melasma. To determine the presence and level of expression of the protein expressed from the gene of the present invention. As a process, it is achieved by measuring the amount of protein. Analysis methods for this include western blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket immunoelectrophoresis. , tissue immunostaining, immunoprecipitation assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter, FACS, protein chip, antibody, etc., but limited thereto it's not going to be The antibody refers to a specific protein molecule indicated by an antigenic site, and the antibody in the present invention refers to an antibody that specifically binds to a marker protein, and may include both polyclonal antibodies, monoclonal antibodies and recombinant antibodies. can

The melasma treatment includes not only the meaning of treatment for alleviating or alleviating the symptoms of melasma, but also the meaning of preventing the occurrence of melasma.

The candidate substance for treating melasma may be an individual nucleic acid, protein, other extract, natural product, or compound estimated to have the potential for treating melasma or randomly selected according to a conventional selection method.

Another aspect is the mRNA or protein expression level of one or more genes selected from the group consisting of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin. It is to provide a screening kit for the treatment of melasma comprising a formulation for measuring

According to one embodiment, the screening kit has an increase in the mRNA or protein expression levels of NRF2, IFT88, GLI1, GLI2, and PTCH1 measured in skin cells treated with a melasma treatment candidate substance than in skin cells not treated with the candidate substance. In this case, it may be determined that it is a melasma treatment agent.

According to one embodiment, the screening kit is mRNA or protein expression of Involucrin, K10, Tyrosinase, Mitf, and Filagrin measured in skin cells treated with a melasma treatment candidate. If the amount is lower than that of skin cells that have not been treated with the candidate substance, it may be judged as a melasma treatment agent.

The measurement of the mRNA expression level, the measurement of the protein expression level, the treatment for melasma, and the candidate substance for the treatment of melasma are the same as those described above.

The skin cells may be hyperpigmented skin cells, and the hyperpigmented skin cells are the same as described above.

The kit may further include one or more other component compositions, solutions, or devices suitable for the assay method, as well as primers, probes, antibodies, etc. for screening for the treatment of melasma, preferably RT-PCR kits, microarrays It may be in the form of a chip kit, a DNA chip kit, or a protein chip kit, but is not limited thereto.

The kit may include essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which cDNA or oligonucleotide corresponding to a gene or fragment thereof is attached, and reagents, agents, enzymes, etc. for preparing a fluorescent probe. The substrate may also contain cDNA or oligonucleotides corresponding to control genes or fragments thereof.

Another aspect is to provide a pharmaceutical composition for preventing or treating freckles, comprising a substance that activates gene or protein expression of NRF2.

The Nuclear factor erythroid-2-related factor 2 (NRF2) is a representative transcription factor affecting the induced expression of antioxidant genes, and may be distributed in major tissues of the human body, such as the liver, lung, digestive system, brain, and skin.

The activation means increasing gene or protein expression. According to one embodiment, when the NRF2 gene is suppressed, IFT88 and GLI1 gene or protein expression is suppressed, and it was confirmed that tyrosinase is increased.

The prevention means any action that suppresses or alleviates the occurrence of melasma through the composition.

The treatment refers to any action that allows the melasma symptoms to be improved or to be beneficial through the composition.

In the present invention, the pharmaceutical composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions, respectively, according to conventional methods. have. In detail, when formulating, it can be prepared using a diluent or excipient such as a filler, a weight agent, a binder, a wetting agent, a disintegrant, and a surfactant commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such a solid preparation may be prepared by mixing the composition and a pharmaceutically acceptable salt thereof with at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, and the like. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations and tasks. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As the base of the suppository, Witepsol, Macrosol, Tween 61, cacao butter, laurin fat, glycerogelatin, etc. can be used.

A suitable dosage of the composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the drug form, and time, but may be appropriately selected by those skilled in the art.

Another aspect is to provide a pharmaceutical composition for preventing or treating freckles comprising a substance that activates IFT88 gene or protein expression.

The IFT88 (Intraflagellar Transport 88) is a gene closely related to primary cilia, and according to one embodiment, it was confirmed that the expression of IFT88 was suppressed in lesioned cells of a melasma patient.

The description of the prevention, treatment, and pharmaceutical composition is the same as described above.

Another aspect is to provide a pharmaceutical composition for preventing or treating melasma comprising a substance that activates gene or protein expression of hedgehog signal pathway.

According to one embodiment, the genes of the hedgehog signaling pathway may be GLI1, GLI2 and PTCH1.

The description of the prevention, treatment, and pharmaceutical composition is the same as described above.

Another aspect is to provide a pharmaceutical composition for preventing or treating melasma comprising one or more substances from the group consisting of SAG (Smoothened Agonist) or SHH (Sonic hedgehog protin).

The SAG is a compound containing chlorobenzothiophene, and may be a substance that activates SMO (Smoothened), which is a component of the hedgehog signal pathway. The SHH is a protein that activates the hedgehog signaling pathway, and more specifically, may be a substance that activates GLI2.

According to one embodiment, when SAG (Smoothened Agonist) or SHH (Sonic hedgehog protin) is treated in cells in which the expression of NRF2, IFT88, and GLI1 are suppressed, the hedgehog signal pathway-related gene expression level, tyrosinase expression level, and It was confirmed that the expression levels of K10 and Involucrin, which are genes involved in keratinocyte differentiation, were similar to those of the control cells.

The description of the prevention, treatment, and pharmaceutical composition is the same as described above.

In the present invention, hyperpigmented skin cells have different mRNA or protein expression levels of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin, Melasma therapeutics can be screened through the expression level of the genes of the cells.

1A is a confocal microscope after staining primary pylium using an antiacetylated α-tubulin (Ac α-tublin) antibody in non-lesioned cells (N) and lesioned cells (L) of 7 patients with melasma. It is an observed photograph, and 1B is a graph showing the number of ciliated cells as a percentage of the total cells in order to know the number of primary cilia through 1A.
Figure 2A shows the relative mRNA ratios of IFT88 and PRGRIP1L in non-lesional skin (hereinafter, may be denoted as 'N') and lesional skin (hereinafter, denoted as 'L') of a patient suffering from melasma. Data confirmed using RT-PCR, and 2B is data confirming the relative expression ratios of the mRNA of PTCH1, GLI1, GLI2, and GLI3 in non-lesioned and lesioned cells of 5 patients whose IFT88 expression level was less than half in 2A.
Figure 3A is a comparative photograph confirmed by a confocal microscope by staining normal keratinocytes and melanocytes, ITF88-inhibited keratinocytes and melanocytes, 3B is the result of 3A; This is the data shown by comparing the relative proportions of primary cilia.
4 is data comparing PTCH1, GLI1, and GLI2 protein expression levels in normal cells and ITF88-inhibited cells by Western blot analysis.
5 is data confirming the relative expression level of tyrosinase protein when (A)PTCH1, (B)GLI1, (C)GLI2 is inhibited in keratinocytes.
6 is data confirming the protein expression level of PTCH1, GLI1, GLI2, and tyrosinase according to the treatment concentration of GANT61, a GLI1 inhibitor.
Figure 7A is a Western blot showing the protein expression levels of tyrosinase and GLI1 in cells according to whether IFT88 is inhibited and whether SAG (smoothened agonist 1.1) is treated, and is data presented as a graph, Figure 7B is IFT88 inhibition and sonic hedgehog (shh) protein), the protein expression levels of tyrosinase and GLI1 depending on whether or not the treatment was performed were confirmed by western blot, and the data are presented as a graph.
8 is a graph showing the protein expression levels of K14, K10, involucrin, and p53 in cells according to whether IFT88 is inhibited and whether SAG (smoothened agonist 1.1) is treated by Western blot and graphed.
9 is a graph showing the protein expression levels of K14, K10, involucrin, and p53 in cells according to whether GLI1 is inhibited and whether SAG (smoothened agonist 1.1) is treated by Western blot.
10 is a graph showing the expression levels of tyrosinase, IFT88, GLI1, K10, and involucrin proteins in normal cells and high-concentration calcium treatment by Western blot.
11 is a photograph of immunofluorescence analysis using anti-involucrin antibody on non-lesion (N) skin and lesion (L) skin of 5 patients with melasma with reduced primary cilia. Fluorescence according to staining It is a graph showing the strength comparison.
12 is data comparing the mRNA expression levels of tyrosinase, Mitf, PTCH1, and GLI1 in the skin of mice knocked out IFT88 and normal mice.
13A is data comparing the protein expression levels of ITF88, PTCH1, Gli, and tyrosinase in the skin of mice knocked out IFT88 and normal mice, and FIG. 13B is Filagrin (Filagrin) in the skin of mice knocked out IFT88 and normal mice. ), involucrin (involucrin), and data comparing the protein expression levels of p53.
14 is a graph comparing images confirmed by immunohistochemical analysis to compare the expression levels of involucrin in the skin of mice knocked out of IFT88 and normal mice and using the same.
FIG. 15A is a graph showing data obtained by analyzing the protein expression levels of IFT88 and GLI1 by Western blot analysis in keratinocytes in which NRF2 expression is knocked down (knockdown), and FIG. 15B is IFT88 expression suppressed (knockdown) and protein expression of NRF2. The amount was analyzed by western blot and is a graphed data.
FIG. 16 is data showing the expression level of tyrosinase according to SAG treatment in keratinocytes co-cultured with keratinocytes in which NRF2 expression is knocked down by western blot analysis and graphically.
17 is a graph showing the expression levels of K10 and involucrin according to SAG treatment in keratinocytes co-cultured with keratinocytes in which NRF2 expression is knocked down (knockdown) by Western blot and presented as a graph. .

Hereinafter, one or more specific embodiments will be described in more detail through examples. However, these examples are for illustrative purposes of one or more embodiments, and the scope of the present invention is not limited to these examples.

Experimental Example 1: Patient Selection

Fourteen female patients aged 32 to 66 years who were diagnosed with melasma participated in this study. The institutional review committee of Dongguk University Ilsan Hospital approved this study, and this study was conducted in accordance with the Declaration of Helsinki Principles. After obtaining written consent from each patient in advance, hyperpigmented skin samples and adjacent normopigmented skin samples were biopsied for direct comparison.

Experimental Example 2: Normal epidermal cell culture

Adult skin specimens obtained from cesarean section and circumcision were used for the formation of cultured cells. The epidermis was separated from the dermis, and a suspension of each epidermis was prepared. Keratinocytes are grown in EpiLife medium (Invitrogen, Carlsbad) supplemented with bovine pituitary extract (BPE), bovine insulin (BI), hydrocortisone, and bovine transferrin (BT (Invitrogen)). , CA). Melanocytes are derived from bovine pituitary extract (BPE), fetal bovine serum, bovine insulin (BI), hydrocortisone, basic fibroblast growth factor (basic fibroblast growth factor), bovine transferrin (BT), heparin, It was suspended in medium 254 (Medium 254 (Invitrogen)) supplemented with phorbol 12-myristate 13-acetate (Invitrogen). By subculture, keratinocytes of passages 3 to 6 and melanocytes of passages 10 to 20 were used as experiments, and cells were treated with 5 to 10uM GANT61 or 1 to 1.8mM CaCl ₂ and cultured for 48 hours.

Experimental Example 3: Conditional IFT88-knockout mouse preparation

The conditional allele of IFT88 (IFT88 ^flox ) containing the loxP site next to exons 4-6 of the intraflagellar transport 88 (IFT88) gene and CAGG-CreER ^TM (Esr1-Cre) mice were obtained from The Jackson Laboratory. IFT88 ^flox mice were crossed with Esr1-Cre transgenic mice and housed in a C57BL/6N base at Dongguk University Animal Facility. All mouse experiments, breeding and breeding were approved by the Animal Care Committee of Dongguk University. To induce Cre activity, tamoxifen was administered intraperitoneally (Sigma-Aldrich, St. Louis, MO) to mice at 5 mg/40 g for 5 consecutive days. Thereafter, skin specimens were biopsied from the back of the mice for real-time PCR, Western blot analysis and immunohistochemical analysis.

Experimental Example 4: IFT88, PTCH1, GLI1, GLI2, and NRF2 inhibition (knockdown)

CRISPRMAX transfection reagent (Thermo Fisher, Waltham, Calif.) was used for human IFT88, PTCH1, GLI1, GLI2, and NRF2 in melanocytes or keratinocytes with 25 nM CRISPR-CAS9 sgRNA, and sgRNA (Integrated DNA Technologies, San Diego, CA) as a negative control. MA) were used for transfection. Cells were transfected and used for experiments 48 hours later. 1 uM SMO agonist (SMO agonist; SAG, Sigma-Aldrich), 200 ng/ml Sonic hedgehog (Shh; R&D Systems, Minneapolis, Minn.), and 10 nM Bafilomycin A1 (Bafilomycin A1, Sigma-Aldrich) were administered to the cells for 24 h. processed.

Experimental Example 5: Real-time RT-PCR analysis

For RT-PCR (Promega, Fitchburg, WI), cDNA was synthesized from total RNA using a cDNA synthesis kit. GAPDH mRNA levels were measured by qPCR using Light Cycler Real-Time PCR (Roche, mannheim, Germany). Primers were used as shown in Table 1 below.

SEQ ID NO: gene location sequence (5' > 3') SEQ ID NO: 1 IFT88 (forward) ATTGCCAATAGTTGTGGAGACTT SEQ ID NO: 2 IFT88 (reverse) CTCGCTGTCTCACCAGGACT SEQ ID NO: 3 RPGRIP1L (forward) ACATCCCAAACTAAATAACCCTTCT SEQ ID NO: 4 RPGRIP1L (reverse) CCTAAGAAGTCAGTGCAATCTGG SEQ ID NO: 5 PTCH1 (forward) TGGATGTCATGGCTTATCCAG SEQ ID NO: 6 PTCH1 (reverse) CATTAACTGGAACATGGTCTGC SEQ ID NO: 7 GLI1 (forward) ATCAACTCGCGGATGCACA SEQ ID NO: 8 GLI1 (reverse) ATTCATCTGGGCTGGGAAT SEQ ID NO: 9 GLI2 (forward) ACGGCACTGGATGACACAC SEQ ID NO: 10 GLI2 (reverse) AGTGCTGGACACCTGGTTG SEQ ID NO: 11 GLI3 (forward) ACATGGAATATCTTCATGCTATGG SEQ ID NO: 12 GLI3 (reverse) GGTGATATGGACAGTGTACGTTTT SEQ ID NO: 13 GAPDH (forward) TCCACTGGCGCTTTCACC SEQ ID NO: 14 GAPDH (reverse) GCAGAGATGATGACCCTTT

Experimental Example 6: Western Blot Analysis

The same 20ug protein was digested using 8~12.5% SDS-PAGE and transferred to a nitrocellulose membrane, and the nitrocellulose membrane was transferred to IFT88 antibody (rabbit polyclonal; Proteintech, Chicago, IL), Filaggrin antibody (rabbit). polyclonal; Santa Cruz Biotechnology, Santa Cruz, CA), GLI1 antibody, p53 antibody, LAMP2 antibody, K14 antibody, K10 antibody (mouse monoclonal; Santa Cruz Biotechnology), tyrosinase antibody, involucrin antibody, PTCH1 antibody, GLI2 (goat; Santa Cruz) antibody Biotechnology) antibodies or NRF2 (rabbit polyclonal; Abcam, Cambridge, UK) antibodies were incubated. Thereafter, secondary antibodies such as anti-rabbit, anti-mouse, and anti-goat HRP (horseradish peroxidase) conjugated antibody (Santa Cruz Biotechnology) were incubated and treated with an enhanced chemiluminescence solution (Thermo, Tockford, IL). The signal was confirmed through Image Reader (LAS-3000; Fuji Photo film, Tokyo, Japan), and the cell membrane was reprobed with anti-β-actin antibody (Sigma-Aldrich), a mouse monoclonal antibody, and the above described treated as. Protein bands were analyzed densitometry.

Experimental Example 7: Immunohistochemistry and confocal microscopy

After deparaffinization and rehydration for immunofluorescence staining of biopsied skin specimens, the sections were pre-cultured with 3% bovine serumalbumin. In order to stain the cultured cells, it was fixed with 2% paraformaldehyde. Then, they were sequentially reacted with anti-Arl13b and anti-γ-tubulin (Santa Cruz Biotechnology), or antiacetylated α-tubulin (Sigma-Aldrich) and anti-involucrin antibodies. The fixed cells were sequentially double stained with anti-IFT88 or anti-Ar113b and anti-acetylated α-tubulin antibody. After staining with Alexa Fluor® 488-conjugated goat anti-rabbit IgG and/or Alexa Fluor® 594-conjugated goat anti-mouse IgG (Molecular Probes, Eugene, OR), nuclei were counterstained with Hoechst 33258 (Sigma-Aldrich) did. Fluorescence images were evaluated using an image analysis system (Dp Manager 2.1; Olympus Optical Co., Tokyo, Japan) and Wright Cell Imaging Facility ImageJ software (http://www.uhnresearch.ca/facilities/wcif/imagej). Confocal microscopy was performed using fixed cells stained with Cyto-ID (Enzo Life Sciences, Farmingdale, NY). Images were acquired using EZ-C1 software (EZ-C1; Nikon, Tokyo, Japan) and measurements were made using NIS-Elements AR 3.2 (Nikon Instruments, Melville, NY).

Experimental Example 8: Statistical Analysis

Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software, La Jolla CA). A P-value of less than 0.05 was considered significant and denoted as *P < 0.05, **P < 0.01 and ***P < 0.001. Statistical comparisons between the two groups were performed using two-tailed Student's unpaired t-test (parametric data). One-way ANOVA was used for comparisons between different groups and parameters. Mean ± SD values were calculated for in vitro experimental data. For human sample data, the difference between non-lesion and lesion was assessed by Mann-Whitney and expressed as mean ± standard error of the mean (SEM).

Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software, La Jolla CA).

Example 1: Confirmation of decrease in the number of primary cilia and hedgehog signaling molecules in the hyperpigmented epidermis of a melasma patient

Using an antiacetylated α-tubulin antibody, a set of non-lesioned skin specimens of 7 patients with melasma and the epidermis of the lesion were identified by confocal microscopy. As a result, as shown in FIG. 1 , a significant loss of primary cilia was confirmed in epidermal cells, particularly keratinocytes. In addition, as shown in FIG. 2 , IFT88 and RPGRIP1L mRNA in 5 out of 7 patients and 3 hyperpigmented skin of hyperpigmented skin (lesioned skin) and non-lesioned skin as seen through real-time PCR. It was confirmed that the relative ratio of each was reduced by 50% or more compared to non-lesioned skin. In addition, it was confirmed that the relative ratios of GLI1, GLI2 and PTCH1 mRNA were down-regulated while the relative ratio of GLI3 was increased in the skin of 5 patients who had IFT88 down-regulation.

Through this, as a result of knockdown of IFT88 in primary cultured human keratinocytes, as shown in FIG. 3 , knockdown of IFT88 was positive for acetylation α-tubulin in starvated keratinocytes and melanocytes ( It was confirmed that the number of acetylated α-tubulin-positive) and Arl13b-positive primary cilia was reduced.

Therefore, it was confirmed that the number of primary cilia and the molecular level of hedgehog signaling were decreased in the hyperpigmented epidermis of melasma patients. When IFT88 expression was suppressed, the number of primary cilia decreased.

Example 2: Confirmation of promotion of melanin production in melanocytes co-cultured with IFT88-inhibited (knockdown) keratinocytes

As shown in FIG. 4 , it was confirmed that inhibition of IFT88 in cultured keratinocytes also reduced the relative expression levels of GLI1, GLI2 or PTCH1. As shown in FIG. 5 , as a result of inhibiting GLI1, GLI2 or PTCH1 in keratinocytes, it was confirmed that the level of tyrosinase protein was increased in normal melanocytes co-cultured with keratinocytes. In addition, as shown in FIG. 6 , treatment with the co-cultured melanocytes with GLI1 inhibitor GANT-61 reduced the GLI2 and PTCH1 protein levels in a dose-dependent manner, but tyrosinase increased the dose-dependently of GANT-61. did. As shown in Figure 7, IFT88 inhibition (knockdown) in keratinocytes increased tyrosinase, whereas when the cells were treated with SAG (smoothened agonists 1.1) or Shh 200, GLI1 expression was normalized while tyrosinase was also normal. It was confirmed that expression similar to melanocytes.

Therefore, it was confirmed that when IFT88 was inhibited, the Hedgehog pathway genes GLI1, GLI2, and PTCH1 were inhibited and melanogenesis was promoted in melanocytes co-cultured with keratinocytes.

Example 3: Confirmation that keratinocyte differentiation via hedgehog pathway is a process involved in promoting melanogenesis induced by IFT88 inhibition

The hedgehog pathway can regulate keratinocyte proliferation (Boeckmann et al, 2020; Yang et al, 2020). As shown in FIG. 7 , it was confirmed that down-regulation of IFT88 enhances melanogenesis through GLI1 down-regulation. Therefore, the role of IFT88 and GLI1 in keratinocyte proliferation or differentiation was confirmed.

As shown in FIG. 8 , it was confirmed that the inhibition of IFT88 (knockdown) did not affect p53 and K14 protein expression, but increased K10 and involucrin protein levels. In addition, it was confirmed that the expression levels of increased K10 and involucrin were recovered again by SAG treatment.

As shown in FIG. 9 , GLI1 knockdown also increased K10 and involucrin without increasing K14. In addition, as shown in FIG. 10 , keratinocytes cultured in high calcium increased K10 and involucrin together with tyrosinase without significant changes in IFT88 and GLI1 protein levels. Since calcium acts to promote the differentiation of keratinocytes, the results of FIGS. 9 to 10 show that GLI1 inhibition promoted the differentiation of keratinocytes. As shown in FIG. 11 , the epidermal cells of five melasma patients with reduced cilia were confirmed by immunofluorescence staining using an anti-involucrin antibody. As a result, the hyperpigmented epidermis of melasma patients showed stronger staining intensity, and through this, it was confirmed that the expression of involucrin was strong in the epidermis with lesions.

Therefore, since it was confirmed that K10 and involucrin, which are used as markers of keratinocyte differentiation, were increased, it was confirmed that the keratinocyte differentiation process through the hedgehog pathway was included in the process of promoting melanogenesis induced by IFT88 inhibition.

Example 4: Hedgehog signaling molecules are down-regulated in IFT88-knockout mice, while keratinocyte differentiation and melanogenesis are increased

Melanogenesis, keratinocyte differentiation, and Hedgehog signaling molecule expression in skin samples from conditional IFT88-knockout mice were compared with control mice.

As shown in FIG. 12 , as a result of real-time PCR on IFT88-knockout mouse skin samples, it was confirmed that tyrosinase and Mitf mRNA levels increased while GLI1 and PTCH1 mRNA levels decreased. In addition, as shown in Figure 13, while confirming the increase of tyrosinase and the decrease of GLI1 and PTCH1 in IFT88-knockout mouse skin samples through Western blot, the level of involucrin and filaggrin proteins was confirmed to be increased in the skin of IFT88-knockout mice. As shown in FIG. 14 , immunofluorescence staining using an anti-involucrin antibody also showed stronger staining intensity in IFT88-knockout mouse skin.

That is, it was confirmed that when IFT88 was knocked out, the expression of GLI1 and PTCH1 decreased, while the expression of Mitf, tyrosinase, involucrin and filaggrin increased.

Example 5: Confirmation of expression regulation of IFT88 and hedgehog signaling molecules of NRF

Nuclear factor erythroid 2-related factor 2 (NRF2) has been proposed as an important regulator of primary cilia formation and key signaling (Martin-Hurtado et al, 2019; Liu et al, 2020). Therefore, we investigated whether NRF2 is involved in the expression of IFT88 and hedgehog signaling molecules and affects ciliary formation, melanogenesis and keratinocyte differentiation.

As a result, as shown in FIG. 15 , NRF2 knockdown in keratinocytes reduced the expression levels of IFT88 and GLI1 proteins, but it was confirmed that IFT88 knockdown did not affect NRF2 protein levels.

As a result of confirming the effect of NRF2 on melanin formation, as shown in FIG. 16 , the knockdown of NRF2 in keratinocytes increased tyrosinase, whereas the cells treated with SAG after NRF knockdown produced tyrosinase similarly to normal melanocytes. manifested.

As a result of confirming the effect of NRF2 on keratinocyte differentiation, as shown in FIG. 17 , it was confirmed that the knockdown of NRF2 increased K10 and involucrin levels, and the increased K10 and involucrin were recovered by SAG treatment. confirmed that.

<110> Dongguk University Industry-Academic Cooperation Foundation <120> Composition for Preventing or Treating Melasma and A Methods for Screening the Same} <130> BPN211031 <160> 14 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> IFT88(Forward) <400> 1 attgccaata gttgtggaga ctt 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IFT88 (Reverse) <400> 2 ctcgctgtct caccaggact 20 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> RPGRIP1L (forward) <400> 3 acatcccaaa ctaaataacc cttct 25 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> RPGRIP1L (reverse) <400> 4 cctaagaagt cagtgcaatc tgg 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PTCH1 (forward) <400> 5 tggatgtcat ggcttatcca g 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PTCH1 (reverse) <400> 6 cattaactgg aacatggtct gc 22 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GLI1 (forward) <400> 7 atcaactcgc gatgcaca 18 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLI1 (reverse) <400> 8 attcatctgg gctgggaat 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLI2 (forward) <400> 9 acggcactgg atgacacac 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLI2 (reverse) <400> 10 agtgctggac acctggttg 19 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GLI3 (forward) <400> 11 acatggaata tcttcatgct atgg 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GLI3 (reverse) <400> 12 ggtgatatgg acagtgtacg tttt 24 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GAPDH (forward) <400> 13 tccactggcg tcttcacc 18 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GAPDH (reverse) <400> 14 gcagagatga tgacccttt 19

Claims (11)

a) Measuring the expression level of mRNA or protein of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin genes from hyperpigmented skin cells to do;
b) treating the hyperpigmented skin cells with a melasma treatment candidate;
c) mRNA or protein expression levels of NRF2, IFT88, GLI1, GLI2, PTCH1, Involucrin, K10, Tyrosinase, Mitf, and Filagrin genes from the cells of step a) measuring; and
d) comparing the gene mRNA or protein expression levels measured in steps a) and c); containing,
A screening method for melasma treatment.
The method of claim 1,
e) NRF2, IFT88, GLI1, GLI2, and if the mRNA or protein expression level of PTCH1 increases in step c) rather than step a) further comprising the step of determining as a melasma treatment,
Screening method for melasma treatment.
The method of claim 1,
e) Involucrin (Involucrin), K10, Tyrosinase (Tyrosinase), Mitf, and if the mRNA or protein expression level of Filagrin decreases in step c) than step a), further comprising the step of determining as a melasma treatment agent ,
Screening method for melasma treatment.
NRF2, IFT88, GLI1, GLI2, PTCH1, involucrin, K10, tyrosinase (Tyrosinase), Mitf, and Filagrin (Filagrin) Screening of agents that measure the mRNA or protein expression level of genes including agents kit.
5. The method of claim 4,
The screening kit is a melasma treatment agent when the mRNA or protein expression levels of NRF2, IFT88, GLI1, GLI2, and PTCH1 measured in skin cells treated with a melasma treatment candidate material increase compared to skin cells not treated with the candidate material. to judge,
A screening kit for melasma treatment.
5. The method of claim 4,
In the screening kit, mRNA or protein expression levels of Involucrin, K10, Tyrosinase, Mitf, and Filagrin measured in skin cells treated with a melasma treatment candidate substance are not treated with the candidate substance. If it is reduced compared to non-exfoliated skin cells, it is judged as a melasma treatment agent,
A screening kit for melasma treatment.
delete delete delete delete delete

Images