KR102450964B1 - Composition comprising acetanisol for inhibiting the formation of biofilm - Google Patents

Composition comprising acetanisol for inhibiting the formation of biofilm Download PDF

Info

Publication number
KR102450964B1
KR102450964B1 KR1020200051004A KR20200051004A KR102450964B1 KR 102450964 B1 KR102450964 B1 KR 102450964B1 KR 1020200051004 A KR1020200051004 A KR 1020200051004A KR 20200051004 A KR20200051004 A KR 20200051004A KR 102450964 B1 KR102450964 B1 KR 102450964B1
Authority
KR
South Korea
Prior art keywords
composition
faecium
biofilm
enterococcus
faecalis
Prior art date
Application number
KR1020200051004A
Other languages
Korean (ko)
Other versions
KR20210132513A (en
Inventor
김기영
김다슬
Original Assignee
경희대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경희대학교 산학협력단 filed Critical 경희대학교 산학협력단
Priority to KR1020200051004A priority Critical patent/KR102450964B1/en
Publication of KR20210132513A publication Critical patent/KR20210132513A/en
Application granted granted Critical
Publication of KR102450964B1 publication Critical patent/KR102450964B1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N31/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic oxygen or sulfur compounds
    • A01N31/08—Oxygen or sulfur directly attached to an aromatic ring system
    • A01N31/14—Ethers
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L3/00—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs
    • A23L3/34—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals
    • A23L3/3454—Preservation of foods or foodstuffs, in general, e.g. pasteurising, sterilising, specially adapted for foods or foodstuffs by treatment with chemicals in the form of liquids or solids
    • A23L3/3463—Organic compounds; Microorganisms; Enzymes
    • A23L3/34635—Antibiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/429—Thiazoles condensed with heterocyclic ring systems
    • A61K31/43—Compounds containing 4-thia-1-azabicyclo [3.2.0] heptane ring systems, i.e. compounds containing a ring system of the formula, e.g. penicillins, penems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/65—Tetracyclines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/7036—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin having at least one amino group directly attached to the carbocyclic ring, e.g. streptomycin, gentamycin, amikacin, validamycin, fortimicins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/14—Peptides containing saccharide radicals; Derivatives thereof, e.g. bleomycin, phleomycin, muramylpeptides or vancomycin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

본 발명은 아세타니솔(Acetanisol)을 포함하는 미생물의 바이오필름 형성 억제용 조성물에 관한 것이다.The present invention relates to a composition for inhibiting biofilm formation of microorganisms comprising acetanisol.

Description

아세타니솔을 포함하는 바이오필름 형성 억제용 조성물{COMPOSITION COMPRISING ACETANISOL FOR INHIBITING THE FORMATION OF BIOFILM}Composition for inhibiting biofilm formation comprising acetanisol {COMPOSITION COMPRISING ACETANISOL FOR INHIBITING THE FORMATION OF BIOFILM}

본 발명은 아세타니솔(Acetanisol)을 포함하는 미생물의 바이오필름 형성 억제용 조성물에 관한 것이다.The present invention relates to a composition for inhibiting biofilm formation of microorganisms comprising acetanisol.

일반적으로 세균이나 진균 등은 물체 표면에 부착하여 바이오필름이라는 집합체를 형성한다. 바이오필름의 점착성은 표면에 존재하는 고분자 매트릭스에서 유래한다. 고분자 매트릭스는 다당류와 단백질 등으로 구성되며, 다당류의 수산화기들 사이에 수소결합으로 인해 강하게 밀집되어 있다.In general, bacteria or fungi attach to the surface of an object to form an aggregate called a biofilm. The adhesion of biofilms is derived from the polymer matrix present on the surface. The polymer matrix is composed of polysaccharides and proteins, and is strongly packed due to hydrogen bonding between hydroxyl groups of polysaccharides.

바이오필름은 구강, 피부, 주방, 욕실, 배관 등 다양한 공간에 존재하며, 한번 형성된 바이오필름은 쉽게 제거되지 않기 때문에 빠른 세균 증식의 원인이 된다. 바이오필름 형성은 표면 물질의 부식, 병원균에 의한 감염 등의 원인이 되며, 구강 내에서는 충치 등과 같은 구강 질환을 유발하기도 한다.Biofilms exist in various spaces such as oral cavity, skin, kitchen, bathroom, and plumbing, and once formed, biofilm is not easily removed, so it causes rapid bacterial growth. Biofilm formation causes corrosion of surface materials, infection by pathogens, and the like, and also causes oral diseases such as tooth decay in the oral cavity.

바이오필름은 당 성분 등에 의해 만들어지는 복합체 내에 수용된 미생물 집단으로서, 상피, 폐 및 심장과 같은 표면 뿐 아니라 중앙 정맥 및 비뇨기 카테터, 자궁 내 장치 및 보철 심장판막과 같은 이식된 의료장치에 형성될 수 있다. 바이오필름은 미생물에 많은 이점을 제공하며, 특히 항생제에 대한 내성을 증가시킨다. 이로 인해 바이오필름에 관한 감염 및 합병증의 발생이 증가하고 치료가 힘들어진다. 또한, 미생물의 바이오필름은 숙주 면역계에 영향을 미쳐 미생물의 생존이 증가하게 된다. Biofilm is a group of microorganisms housed in a complex made by sugar components, etc., and can be formed on surfaces such as epithelium, lungs and heart, as well as implanted medical devices such as central venous and urinary catheters, intrauterine devices, and prosthetic heart valves. . Biofilms offer many benefits to microorganisms, especially by increasing resistance to antibiotics. This increases the incidence of infections and complications related to biofilms and makes treatment difficult. In addition, the biofilm of the microorganism affects the host immune system, thereby increasing the survival of the microorganism.

기존에는 이러한 바이오필름의 형성을 억제하기 위해 바이오필름을 형성하는 균주의 성장을 저해하는 방식을 이용하였으나, 체내에는 유해한 균과 유익한 균이 동시에 존재하고 있음에 따라 무조건적인 살균 보다는 세포의 성장은 유지하면서 바이오필름의 형성만을 억제하는 기술이 필요로 되고 있다.In the past, a method of inhibiting the growth of strains forming biofilms was used to inhibit the formation of such biofilms, but as harmful and beneficial bacteria exist simultaneously in the body, cell growth is maintained rather than unconditional sterilization. There is a need for a technology that suppresses only the formation of a biofilm.

또한, 기존 항생제의 오남용으로 인한 미생물의 내성 획득 등 다양한 문제가 발생함에 따라, 항생제 내성 획득 과정에 중요한 요소인 미생물의 바이오필름 형성을 억제하는 물질의 발굴에 대한 요구가 증가하고 있다.In addition, as various problems arise, such as acquisition of resistance of microorganisms due to the misuse of existing antibiotics, the demand for discovering substances that inhibit the formation of biofilms of microorganisms, which is an important factor in the process of acquiring resistance to antibiotics, is increasing.

한국공개특허 제10-2005-0019101호Korean Patent Publication No. 10-2005-0019101

본 발명의 목적은 아세타니솔을 포함하는, 바이오필름 형성 억제용 조성물을 제공하는 것이다.It is an object of the present invention to provide a composition for inhibiting biofilm formation, including acetanisol.

본 발명의 다른 목적은 상기 바이오필름 형성 억제용 조성물을 이용한 바이오필름 형성 억제방법을 제공하는 것이다Another object of the present invention is to provide a method for inhibiting biofilm formation using the composition for inhibiting biofilm formation.

본 발명의 또 다른 목적은 상기 바이오필름 형성 억제용 조성물을 포함하는 항균용 조성물을 제공하는 것이다.Another object of the present invention is to provide an antibacterial composition comprising the composition for inhibiting the formation of a biofilm.

본 발명의 또 다른 목적은 상기 항균용 조성물을 포함하는 미생물 감염에 대한 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating microbial infection comprising the antimicrobial composition.

본 발명의 또 다른 목적은 상기 항균용 조성물을 포함하는 항균용 식품 조성물을 제공하는 것이다.Another object of the present invention is to provide an antimicrobial food composition comprising the antimicrobial composition.

상기와 같은 목적을 달성하기 위한 본 발명의 일 측면은, 아세타니솔(Acetanisol)을 포함하는, 바이오필름 형성 억제용 조성물에 관한 것이다.One aspect of the present invention for achieving the above object relates to a composition for inhibiting biofilm formation, including acetanisol (Acetanisol).

본 발명에서 “아세타니솔(Acetanisole)”은 비버의 생식선낭에서 나오는 분비물인 캐스토리음(Castoreum)에서 주로 발견되는 것으로 알려진 방향족 화합물로서, 달콤하고, 바닐라, 카라멜, 버터와 같은 달콤한 향을 가지고 있어, 향료, 담배의 첨가제 등으로 주로 사용되는 화합물이나, 본 발명에서는 상기 아세타니솔 화합물이 미생물에 의해 생성된 바이오필름에 대해 우수한 억제 효과를 나타냄을 규명하였다.In the present invention, “acetanisole” is an aromatic compound known to be mainly found in Castorum, a secretion from the gonadal sac of beavers, and has a sweet, sweet flavor such as vanilla, caramel, and butter. Therefore, it was identified that the compound mainly used as an additive for flavoring and tobacco, but in the present invention, the acetanisole compound exhibits an excellent inhibitory effect on the biofilm produced by microorganisms.

구체적으로, 상기 아세타니솔은 하기 화학식 1의 구조로 이루어진 것일 수 있다. Specifically, the acetanisol may have a structure represented by the following formula (1).

Figure 112020043379439-pat00001
Figure 112020043379439-pat00001

상기 아세타니솔은 천연물로부터 수득한 것이라면 아세타니솔 및 이의 배당체를 모두 포함할 수 있다. 상기 아세타니솔은 천연 추출물로부터 분리된 화합물임에 따라, 인체에 부작용이 없는 안전한 물질로서, 본 발명 일 실시예에서는 인체 유래 세포에 대해 독성이 없음을 확인하였다(도 5).The acetanisol may include both acetanisol and its glycosides as long as it is obtained from a natural product. As the acetanisol is a compound isolated from a natural extract, it is a safe material without side effects to the human body.

본 발명에서, “바이오필름(biofilm)”은 미생물에 의하여 형성된 막 모양 구조체이며, 표면에 연결된 미생물 세포층으로 이루어진 잘 구성된 미생물계로 복잡한 구조적 기능적 특징을 가지고 있다. 생체막은 미생물의 대사 과정에 영향을 주는 물리 화학적 구배를 갖는다. 바이오필름을 형성하는 세포는 부유세포보다 항생제에 대한 저항성이 1000배 이상 높으며, 바이오필름 형성은 여러 질병의 발병(pathogenesis)에 중요한 역할을 한다(Anderson and O’Toole et al., 2008, Bacterial Biofilms 322:85-105).In the present invention, a “biofilm” is a membranous structure formed by microorganisms, and it is a well-formed microbial system composed of a microbial cell layer connected to the surface and has complex structural and functional characteristics. Biofilms have physicochemical gradients that affect the metabolic processes of microorganisms. Cells that form biofilms are more than 1000 times more resistant to antibiotics than floating cells, and biofilm formation plays an important role in the pathogenesis of various diseases (Anderson and O'Toole et al., 2008, Bacterial Biofilms). 322:85-105).

본 발명에서, “바이오필름 형성 억제”는 상기와 같이 미생물에 의해 생성된 구조체의 형성을 감소시키거나, 형성이 불가능하게 하는 것을 말한다. 이러한 바이오필름의 형성 억제효과는 미생물의 생육, 증식을 억제하거나 사멸시키는 효과와는 무관하게 고체 표면에 들러붙는 혼합체의 형성을 저해하는 효과를 포함한다.In the present invention, "biofilm formation inhibition" refers to reducing the formation of structures produced by microorganisms as described above, or making the formation impossible. The effect of inhibiting the formation of such a biofilm includes the effect of inhibiting the formation of a mixture adhering to the solid surface regardless of the effect of inhibiting or killing the growth, proliferation, or death of microorganisms.

미생물이 바이오필름을 형성함으로써 항생제 내성을 획득하는 과정은 다음과 같다. 첫 번째는 항생제가 바이오필름을 투과하지 못해 항생제가 바이오필름 내의 세균에 영향을 미치지 못하기 때문인데, 이는 세포 외 기질이 가지는 전하에 의한 것으로 음전하를 띄는 바이오필름 매트릭스에 양전하를 띄는 항생제들이 결합함으로써 항생제가 바이오필름을 투과하기 어렵기 때문에 내성이 발생한다. 두 번째는 바이오필름에 의해 미생물이 충분한 영양소와 산소를 공급받지 못해 바이오필름의 생장에 영향을 미치면서 생기는 내성이다. 산소와 영양소는 미생물 성장에 큰 영향을 미치는 요소이다. 바이오필름 내의 미생물은 바이오필름에 의해 영양소와 산소 공급 등이 제한되면서 대체로 낮은 대사 활동과 낮은 성장률을 가지며 이는 약물에 대한 저항성을 높이는 역할을 한다. The process by which microorganisms acquire antibiotic resistance by forming a biofilm is as follows. The first is that antibiotics do not penetrate the biofilm, so the antibiotics do not affect the bacteria in the biofilm, which is due to the charge of the extracellular matrix. Resistance develops because antibiotics are difficult to penetrate the biofilm. The second is resistance that occurs when microorganisms do not receive sufficient nutrients and oxygen by the biofilm to affect the growth of the biofilm. Oxygen and nutrients are factors that greatly influence microbial growth. Microorganisms in the biofilm generally have low metabolic activity and low growth rate as nutrients and oxygen supply are limited by the biofilm, which serves to increase resistance to drugs.

구체적으로, 상기 바이오필름은　엔테로코커스 패시움(Enterococcus faecium, E. faecium), 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis), 대장균(E. coli), 스트렙토코커스 뮤탄스(Streptococcus mutans, S. mutans), 스트렙토코커스 소브리누스(Streptococcus sobrinus, S. sobrinus), 스태필로코커스 아우레우스(Staphylococcus aureus, S. aureus), 포르피로모나스 진지발리스(Porphyromonas gingivalis, P. gingivalis), 슈도모나스 아에루지노사(Pseudomonas aeruginosa, P.aeruginosa) 및 프로피오니박테리움 아크네스(Propionibacterium acnes, P. acnes)로 구성된 군에서 선택된 하나 이상의 미생물에 의해 형성된 것일 수 있으나, 이에 제한되는 것은 아니다.Specifically, the biofilm is Enterococcus Faecium (Enterococcus faecium, E. faecium), Enterococcus Enterococcus faecalis, E. faecalis, E. coli, Streptococcus mutans, S. mutans, Streptococcus sobrinus, S. sobrinus, Staphylococcus Aureus (Staphylococcus aureus, S. aureus), Porphyromonas gingivalis (Porphyromonas gingivalis, P. gingivalis), Pseudomonas aeruginosa (Pseudomonas aeruginosa, P. aeruginosa) and Propionibacterium acnes (Propionibacterium acnes, P. acnes) may be formed by one or more microorganisms selected from the group consisting of, but is not limited thereto.

본 발명에서, “엔테로코커스 패시움(Enterococcus faecium)”은 엔테로코커스 속의 그람 양성, 알파 용혈 또는 비 용혈성 미생물로서, 인간과 동물의 위장관에서 공생할 수 있지만 병원성일 수도 있으며 신생아 수막염이나 심내막염과 같은 질병을 일으킬 수 있는 것으로 알려져 있다.In the present invention, " Enterococcus faecium" is Gram-positive, alpha-hemolytic or non-hemolytic microorganisms of the genus Enterococcus, which can coexist in the gastrointestinal tract of humans and animals, but may also be pathogenic and are known to cause diseases such as neonatal meningitis and endocarditis.

본 발명에서, “엔테로코커스 페칼리스(Enterococcus faecalis)”는 연쇄상구균계 D군의 일부로 분류된 바 있으며, 사람과 다른 포유 동물의 위장관에 서식하는 그람 양성, 공생 세균이다. 상기 엔테로코커스 페칼리스는 심내막염, 패혈증, 요로 감염(UTI), 수막염 및 기타 사람의 감염을 유발할 수 있으며, 높은 수준의 항생제 내성을 보이는 것으로 알려져 있다.In the present invention, " Enterococcus faecalis" is classified as a part of group D of the streptococcus family, and is a gram-positive, symbiotic bacterium that inhabits the gastrointestinal tract of humans and other mammals. The Enterococcus faecalis can cause endocarditis, sepsis, urinary tract infection (UTI), meningitis and other infections in humans, and is known to exhibit high levels of antibiotic resistance.

본 발명에서, “대장균(E. coli)”은 온혈동물의 창자에서 많이 볼 수 있는 미생물이다. 음식이나 물이 세균에 오염되면 고온다습한 환경에서 세균이 쉽게 번식하고 그 음식을 우리가 섭취하게 되면 대장균 감염에 걸리게 되며, 비위생적인 생활에서 대장균 감염이 발생된다.In the present invention, “ E. coli” is a microorganism that is frequently found in the intestines of warm-blooded animals. When food or water is contaminated with bacteria, bacteria easily multiply in a high-temperature and high-humidity environment, and when we ingest the food, we get E. coli infection.

본 발명에서, “스트렙토코커스 뮤탄스(Streptococcus mutans)”는 연쇄상구균의 일종으로서, 락토바실러스와 함께 충치의 주 원인균으로서 치아를 검게 썩게 만드는 것으로 알려져 있다.In the present invention, "Streptococcus Mutans (Streptococcus mutans)” is a type of streptococci and is known to cause tooth decay and blackening as the main causative bacteria of tooth decay together with Lactobacillus.

본 발명에서, “스트렙토코커스 소브리누스(Streptococcus sobrinus)”는 스트렙토코커스 속의 그람 양성균으로서, 상기 스트렙토코커스 뮤탄스와 함께 충치에 관련된 균으로 알려져 있다.In the present invention, “ Streptococcus sobrinus” is a gram-positive bacterium of the genus Streptococcus, and is known as a bacterium related to caries along with the Streptococcus mutans.

본 발명에서, “스태필로코커스 아우레우스(Staphylococcus aureus)”는 그람 양성균인 포도상구균의 한 종으로서, 코, 호흡계통, 피부에 존재한다. 피부 감염이나 호흡기계 감염, 부비강염, 식중독 등을 일으킬 수 있다.In the present invention, "Staphylococcus Aureus (Staphylococcus aureus)” is a species of gram-positive Staphylococcus aureus, present in the nose, respiratory system, and skin. It can cause skin infections, respiratory infections, sinusitis, and food poisoning.

본 발명에서, “포르피로모나스 진지발리스(Porphyromonas gingivalis)”는 그람 음성 균으로서 보통 치주질환을 일으키는 균으로 알려져 있다.In the present invention, " Porphyromonas gingivalis " is a Gram-negative bacteria, usually known as bacteria causing periodontal disease.

본 발명에서, “슈도모나스 아에루지노사(Pseudomonas aeruginosa)”는 녹농균으로도 알려져 있으며, 식물이나 동물, 사람을 감염시킬 수 있다. 이 균은 선천적으로 항생제에 대한 저항성을 가지고 있으며, 기회감염성을 띄고 있어 건강한 사람에겐 큰 해를 끼치지 않지만 낭포성 섬유증(cystic fibrosis) 환자나 면역력이 저하된 사람에게 매우 심각한 감염을 일으킬 수 있다. 녹농균은 최저 영양 조건에서도 성장이 가능하기 때문에 성장 범위가 매우 넓어 병원 내의 습한 환경, 기구들과 심지어 소독용 용액 등 도처에 존재하고 있다. 녹농균의 경우 호기성 세균이기 때문에 발효를 할 수 없지만 질산염이 있는 경우에는 산소 없이도 성장이 가능하다. 또한 주로 바이오필름의 형태로 감염을 일으키는 것으로 알려져 있다.In the present invention, "Pseudomonas Pseudomonas aeruginosa” , also known as Pseudomonas aeruginosa, can infect plants, animals and humans. This fungus is naturally resistant to antibiotics and is opportunistic, so it does not harm healthy people, but it can cause very serious infections in cystic fibrosis patients or people with weakened immunity. Because Pseudomonas aeruginosa can grow even under the lowest nutrient conditions, its growth range is very wide, and it is present everywhere in humid environments in hospitals, instruments and even disinfectant solutions. Pseudomonas aeruginosa cannot ferment because it is an aerobic bacterium, but in the presence of nitrate, it can grow without oxygen. It is also known to cause infections mainly in the form of biofilms.

본 발명에서 상기 “프로피오니박테리움 아크네스(Propionibacterium acnes)”는 그람 양성 미생물이며, 여드름의 주요 원인균으로서 피부 상태와 관련이 있는 것으로 알려져 있다. 또한 만성 안검염과 안구내염을 유발할 수 있으며, 후자는 특히 안구 내 수술 후 발생하는 것으로 알려져 있다.In the present invention, the "Propionibacterium Acne (Propionibacterium acnes)” is a gram-positive microorganism and is known to be related to skin conditions as a major causative agent of acne. It can also cause chronic blepharitis and endophthalmitis, the latter being known to occur especially after intraocular surgery.

본 발명 일 실시예에서는 상기 E. faecium, E. faecalis, E. coli, S. mutans, S. sorbrinus, S. aureus, P. gingivalis, P.aeruginosa 및 P. acnes 모두에 대하여 바이오필름 형성 억제 효과가 우수함을 확인하였는 바(도 1), 본 발명의 조성물을 이용하여 바이오필름 형성 억제 용도로 사용할 수 있다.In an embodiment of the present invention, the biofilm formation inhibitory effect on all of the E. faecium, E. faecalis, E. coli, S. mutans, S. sorbrinus, S. aureus, P. gingivalis, P.aeruginosa and P. acnes It was confirmed that the excellent (FIG. 1), the composition of the present invention can be used for inhibiting biofilm formation.

또한, 본 발명 일 실시예에서는 바이오필름 병독성 인자(virulence factors) 유전자인 Esp, EbrB, EbpA, EbpB, bps, Acm 및 Scm와 정족수 감지 유전자(quorum sensing genes)인 fsrB, fsrC 및 GelE의 발현이 농도 의존적으로 억제되는 것을 확인하였는 바(도 6), 바이오필름 형성 억제가 유전자 발현 단계부터 억제되는 것을 확인하였다.In addition, in one embodiment of the present invention, the expression of biofilm virulence factors genes Esp, EbrB, EbpA, EbpB, bps, Acm and Scm and quorum sensing genes fsrB, fsrC and GelE concentration As it was confirmed that the inhibition was dependently ( FIG. 6 ), it was confirmed that the inhibition of biofilm formation was inhibited from the gene expression stage.

본 발명의 다른 측면은 상기 바이오필름 형성 억제용 조성물을 바이오필름이 형성되었거나 바이오필름 형성이 예상되는 표면에 처리하는 단계;를 포함하는 바이오필름 형성 억제방법에 관한 것이다. Another aspect of the present invention relates to a method for inhibiting biofilm formation, comprising the step of treating the composition for inhibiting biofilm formation on a surface on which a biofilm is formed or is expected to form a biofilm.

본 발명의 조성물이 우수한 바이오필름 형성 억제 효과를 나타냄에 따라, 본 발명의 조성물을 형성된 바이오필름에 직접 처리하여 억제시키거나, 바이오필름의 형성이 예상되는 표면 또는 바이오필름이 형성될 경우 문제가 생길 수 있는 표면에 바이오필름 형성의 예방을 위해 처리할 수 있다.As the composition of the present invention exhibits an excellent biofilm formation inhibitory effect, the composition of the present invention is directly treated and inhibited on the formed biofilm, or a problem occurs when a surface or biofilm on which the formation of a biofilm is expected is formed Treated surfaces to prevent biofilm formation.

이러한 표면은 의료기기, 의료용 재료 또는 의료용 이식물의 표면 뿐 아니라 필터, 수처리막, 마스크소재 등 바이오필름의 억제가 필요한 곳이면 제한없이 적용될 수 있다.Such a surface can be applied without limitation wherever biofilm suppression is required, such as a filter, a water treatment membrane, a mask material, as well as the surface of a medical device, medical material or medical implant.

본 발명의 또 다른 측면은, 상기 바이오필름 형성 억제용 조성물을 포함하는 항균용 조성물에 관한 것이다.Another aspect of the present invention relates to an antibacterial composition comprising the composition for inhibiting the formation of a biofilm.

본 발명에서, “항균(antibiotic)”은 미생물의 성장 또는 생존을 감소, 방지, 억제 또는 제거하는 것을 말하며, “항균용 조성물”은 세균과 같은 미생물의 생육을 저해하는 활성을 가진 조성물로서, 항미생물제를 총칭하는 의미인 항생제와 같은 의미일 수 있고, 항균 효과가 요구되는 다양한 분야에 사용되는 모든 형태가 포함될 수 있으며, 예를 들어, 의약품, 의약외품, 식품 첨가제 또는 사료 첨가제 등의 형태일 수 있다.In the present invention, "antibiotic" refers to reducing, preventing, inhibiting, or removing the growth or survival of microorganisms, and "antibacterial composition" is a composition having an activity to inhibit the growth of microorganisms such as bacteria, It may have the same meaning as antibiotics, which is a generic term for microbial agents, and may include all forms used in various fields requiring an antibacterial effect, for example, in the form of pharmaceuticals, quasi-drugs, food additives, or feed additives. .

구체적으로, 상기 항균용 조성물은 항생제를 추가로 포함할 수 있다. 더욱 구체적으로, 상기 항생제는 반코마이신, 스트렙토마이신, 암피실린 및 옥시테트라사이클린으로 이루어진 군에서 선택된 하나 이상인 것일 수 있으나, 이에 제한되는 것은 아니다.Specifically, the antimicrobial composition may further include an antibiotic. More specifically, the antibiotic may be one or more selected from the group consisting of vancomycin, streptomycin, ampicillin and oxytetracycline, but is not limited thereto.

본 발명 일 실시예에서는 반코마이신, 스트렙토마이신, 암피실린 또는 옥시테트라사이클린을 각각 아세타니솔과 함께 처리한 경우, 아세타니솔을 단독 처리한 경우에 비해 바이오필름 형성 억제 효과가 증가하고, 항균 효과가 우수한 것을 확인하였는 바(도 2), 항생제와 복합 또는 병용하여 사용할 수 있다.In one embodiment of the present invention, when vancomycin, streptomycin, ampicillin or oxytetracycline is treated together with acetanisol, the biofilm formation inhibitory effect is increased, and the antibacterial effect is excellent compared to the case where acetanisol is treated alone As it was confirmed that (FIG. 2), it can be used in combination or in combination with antibiotics.

본 발명의 또 다른 측면은 상기 항균용 조성물을 포함하는 미생물 감염에 대한 예방 또는 치료용 약학적 조성물에 관한 것이다.Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating microbial infection comprising the antimicrobial composition.

본 발명 일 실시예에서는 아세타니솔을 처리한 경우에 미생물의 부착을 억제하여 감염을 억제하며(도 3), 대식세포의 활성을 농도 의존적으로 촉진(도 4)하는 것을 확인하였는 바, 본 발명의 조성물은 미생물에 의한 감염증에 대한 예방 또는 치료 용도로 적용될 수 있다.In one embodiment of the present invention, it was confirmed that when acetanisol was treated, the adhesion of microorganisms was inhibited to inhibit infection (FIG. 3), and it was confirmed that the activity of macrophages was promoted in a concentration-dependent manner (FIG. 4), the present invention The composition of can be applied for preventive or therapeutic use for infections caused by microorganisms.

구체적으로, 상기 미생물은 엔테로코커스 패시움(Enterococcus faecium, E. faecium), 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis), 대장균(E. coli), 스트렙토코커스 뮤탄스(Streptococcus mutans, S. mutans), 스트렙토코커스 소브리누스(Streptococcus sobrinus, S. sobrinus), 스태필로코커스 아우레우스(Staphylococcus aureus, S. aureus), 포르피로모나스 진지발리스(Porphyromonas gingivalis, P. gingivalis), 슈도모나스 아에루지노사(Pseudomonas aeruginosa, P.aeruginosa) 및 프로피오니박테리움 아크네스(Propionibacterium acnes, P. acnes)로 구성된 군에서 선택된 하나 이상인 것일 수 있다.Specifically, the microorganism is Enterococcus Faecium (Enterococcus faecium, E. faecium), Enterococcus Enterococcus faecalis, E. faecalis, E. coli, Streptococcus mutans, S. mutans, Streptococcus sobrinus, S. sobrinus, Staphylococcus Aureus (Staphylococcus aureus, S. aureus), Porphyromonas gingivalis (Porphyromonas gingivalis, P. gingivalis), Pseudomonas aeruginosa (Pseudomonas aeruginosa, P. aeruginosa) and It may be at least one selected from the group consisting of Propionibacterium acnes, P. acnes .

더욱 구체적으로, 상기 미생물 감염에 의해 발생된 감염증은 심내막염, 패혈증, 요로 감염(UTI), 수막염, 대장균 감염, 충치, 치주질환, 피부감염, 호흡기계 감염, 부비강염, 식중독, 여드름, 만성 안검염, 안구내염 등일 수 있으나, 이에 제한되는 것은 아니며 상기 미생물들에 의해 발생되는 모든 감염증을 포함한다.More specifically, the infection caused by the microbial infection is endocarditis, sepsis, urinary tract infection (UTI), meningitis, Escherichia coli infection, tooth decay, periodontal disease, skin infection, respiratory system infection, sinusitis, food poisoning, acne, chronic blepharitis, eye It may be stomatitis, and the like, but is not limited thereto, and includes all infections caused by the microorganisms.

또한 구체적으로, 상기 약학적 조성물은 항생제를 추가로 포함할 수 있다. 더욱 구체적으로, 상기 항생제는 반코마이신, 스트렙토마이신, 암피실린 및 옥시테트라사이클린으로 이루어진 군에서 선택된 하나 이상인 것일 수 있으나, 이에 제한되는 것은 아니다. Also specifically, the pharmaceutical composition may further include an antibiotic. More specifically, the antibiotic may be one or more selected from the group consisting of vancomycin, streptomycin, ampicillin and oxytetracycline, but is not limited thereto.

본 발명의 약학적 조성물은 투여를 위하여, 상기 본 발명의 아세타니솔 외에 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함할 수 있다. 상기 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.For administration, the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier, excipient or diluent in addition to the acetanisol of the present invention. The carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

또한, 본 발명의 약학적 조성물은 어떠한 제형으로도 적용가능하며, 구체적으로 경구용 제형 또는 비경구형 제형으로 적용될 수 있다. 경구형 제형으로 액제, 정제 형태를 적용할 수 있으며, 비경구형 제형으로는 주사용, 도포용, 에어로졸 등의 스프레이 형일 수 있다. 더욱 구체적으로는 주사제 형태일 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성 용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. In addition, the pharmaceutical composition of the present invention can be applied in any dosage form, specifically, it can be applied as an oral dosage form or a parenteral dosage form. The oral dosage form can be applied in the form of a liquid or tablet, and the parenteral dosage form can be in the form of a spray such as injection, application, or aerosol. More specifically, it may be in the form of an injection. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

또한, 본 발명의 약학적 조성물은 약학적으로 유효한 양으로 적용될 수 있으며, "약학적으로 유효한 양"은 의학적 치료에 적용가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자의 성별, 연령, 질병의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. In addition, the pharmaceutical composition of the present invention may be applied in a pharmaceutically effective amount, and "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and effective Dosage levels depend on the patient's sex, age, type of disease, severity, drug activity, drug sensitivity, administration time, administration route and excretion rate, duration of treatment, factors including concomitant drugs, and other factors well known in the medical field. It may depend on factors.

나아가, 본 발명의 약학적 조성물은 또 다른 치료제와 병용하여 투여될 수 있고, 종래의 다른 치료제와 순차적으로 또는 동시에 투여될 수 있다. 또한 본 발명의 약학적 조성물은 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 필요에 따라 용이하게 결정될 수 있다.Furthermore, the pharmaceutical composition of the present invention may be administered in combination with another therapeutic agent, and may be administered sequentially or simultaneously with other conventional therapeutic agents. In addition, the pharmaceutical composition of the present invention may be administered single or multiple. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect with a minimum amount without side effects, and can be easily determined by those skilled in the art as needed.

본 발명의 또 다른 측면은 상기 항균용 조성물을 포함하는, 항균용 식품 조성물에 관한 것이다. 구체적으로, 상기 항균용 식품 조성물은 미생물 감염에 대한 예방 또는 개선 효과를 나타내는 것일 수 있다.Another aspect of the present invention relates to an antimicrobial food composition comprising the antimicrobial composition. Specifically, the antimicrobial food composition may be one that exhibits a preventive or ameliorating effect on microbial infection.

본 발명에서 식품이라 함은 영양소를 한 가지 또는 그 이상 함유하고 있는 천연물 또는 가공품을 의미하며, 바람직하게는 어느 정도의 가공 공정을 거쳐 직접 먹을 수 있는 상태가 된 것을 의미하며, 통상적인 의미로서, 건강기능식품, 음료, 식품 첨가제 및 음료 첨가제를 모두 포함하는 의도이다. 구체적으로, 건강기능식품일 수 있다. In the present invention, food means a natural product or processed product containing one or more nutrients, and preferably means a state that can be eaten directly through some processing process, and in a conventional sense, It is intended to include all health functional foods, beverages, food additives and beverage additives. Specifically, it may be a health functional food.

본 발명에서 건강기능식품이란 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미한다. 상기 건강기능식품에는 식품학적으로 허용 가능한 식품 보조 첨가제를 포함할 수 있으며, 건강기능식품의 제조에 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더욱 포함할 수 있다.In the present invention, health functional food refers to a food group or food composition that has added value to act and express the function of the food for a specific purpose by using physical, biochemical, and bioengineering methods, etc. It refers to food that has been designed and processed to sufficiently express body control functions related to recovery, etc. The health functional food may include a food supplementary additive that is pharmaceutically acceptable, and may further include an appropriate carrier, excipient and diluent commonly used in the manufacture of health functional food.

상기 외에 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분을 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하지 않지만, 본 발명의 아세타니솔 100 중량부 당 0 내지 20 중량부 범위에서 선택될 수 있다.In addition to the above, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. These components may be used independently or in combination. The proportion of these additives is not so critical, but may be selected in the range of 0 to 20 parts by weight per 100 parts by weight of acetanisol of the present invention.

또한, 본 발명의 바이오필름 형성 억제용 조성물은 의료 및 기타 산업 분야에서 바이오필름 형성을 억제하기 위한 용도로서 다양하게 사용될 수 있다.In addition, the composition for inhibiting biofilm formation of the present invention can be used in various ways as a use for inhibiting biofilm formation in medical and other industrial fields.

구체적으로, 의료 분야에서는, 의료기기, 의료용 재료 또는 의료용 이식물의 표면에 형성되는 바이오필름의 형성을 억제하는데 사용될 수 있으며, 역삼투막 등과 같은 다양한 수처리막의 표면에 형성되는 바이오필름의 형성을 억제하는 데에도 사용될 수 있다. 더욱 구체적으로는, 진찰 및 진단기기, 임상검사기기, 방사선기기, IUD, 기관 튜브, 각종 카테터, 정형외과 기기 등과 같은 수술관련기기, 병원설비 및 응급장비, 비만 및 건강관련기기, 콘택트 렌즈, 스텐트, 밸브, 성형 보형물 등과 같은 다양한 의료 분야에 형성된 바이오필름의 형성 억제에 사용될 수 있다. 또한, 본 발명의 조성물은 이에 제한되지 않고 다양한 식품 및 세탁기, 가습기, 식기 세척기 등과 같은 다양한 생활용품의 표면에 형성되는 바이오필름의 형성을 억제하는 데에도 사용될 수 있다.Specifically, in the medical field, it can be used to suppress the formation of a biofilm formed on the surface of a medical device, a medical material, or a medical implant, and also to inhibit the formation of a biofilm formed on the surface of various water treatment membranes, such as a reverse osmosis membrane. can be used More specifically, surgery-related equipment such as examination and diagnostic equipment, clinical examination equipment, radiation equipment, IUD, tracheal tube, various catheters, orthopedic equipment, hospital equipment and emergency equipment, obesity and health-related equipment, contact lenses, stents , can be used to inhibit the formation of biofilms formed in various medical fields, such as valves, plastic implants, and the like. In addition, the composition of the present invention is not limited thereto, and may be used to suppress the formation of biofilms formed on the surface of various foods and various household items such as washing machines, humidifiers, and dishwashers.

본 발명에 따르면, 본 발명의 아세타니솔을 포함하는 바이오필름 형성 억제용 조성물은 의료기기, 의료용 재료 또는 수처리막의 표면 등에 형성되는 바이오필름의 형성 억제에 활용될 수 있다. 또한, 상기 아세타니솔은 천연물에서 유래한 성분을 포함하므로 인체에 독성이 낮은 물질로 유용하게 활용될 수 있다.According to the present invention, the composition for inhibiting biofilm formation containing acetanisol of the present invention can be utilized to inhibit the formation of biofilms formed on the surface of medical devices, medical materials, or water treatment membranes. In addition, since the acetanisol contains a component derived from a natural product, it can be usefully used as a material with low toxicity to the human body.

본 발명의 바이오필름 형성 억제용 조성물은 바이오필름의 형성을 억제함으로써, 항생제 내성을 억제하면서 미생물 감염을 치료하는 효과를 나타낼 수 있다.The composition for inhibiting biofilm formation of the present invention may exhibit the effect of treating microbial infection while suppressing antibiotic resistance by inhibiting the formation of a biofilm.

본 발명의 효과는 상기한 효과로 한정되는 것은 아니며, 본 발명의 상세한 설명 또는 청구범위에 기재된 발명의 구성으로부터 추론 가능한 모든 효과를 포함하는 것으로 이해되어야 한다.It should be understood that the effects of the present invention are not limited to the above-described effects, and include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.

도 1은 본 발명의 실시예에 따른 액체 배지에서 아세타니솔의 바이오필름 형성 저해 효과를 평가한 결과를 나타낸 것이다(A: E. faecalis, B: E. faecium, C: E. coli, D: S. aureus, E: S. mutans, F: S. sobrinus, G: P. gingivalis, H: P. acne, I: P. aeruginosa).
도 2는 본 발명의 실시예에 따라 항균제와 아세타니솔을 E. faecium 및 E. faecalis에 처리한 경우의 복합 효능을 확인한 결과를 나타낸 것이다(A: E. faecium, B: E. faecalis).
도 3은 아세타니솔이 농도 의존적으로 T24 세포에 대한 미생물 부착을 감소시키는 효과를 확인한 결과를 나타낸 것이다(A: E. faecium, B: E. faecalis).
도 4는 바이오필름이 형성된 경우에도 아세타니솔이 농도 의존적으로 대식세포의 식균작용을 촉진하는 결과를 확인한 결과를 나타낸 것이다(A: E. faecium, B: E. faecalis).
도 5는 아세타니솔이 T24 세포와 대식세포에 대하여 독성이 있는지 확인한 결과를 나타낸 것이다(A: T24세포, B: RAW 246.7 대식세포).
도 6은 아세타니솔에 의한 E. faecalis 와 E. faecium의 바이오필름 병독성 인자와 정족수 감지 유전자의 저해효과를 확인한 결과를 나타낸 것이다(A: E. faecium의 fsrB, fsrC, GelE, Acm, Scm, EbpA, Bps, EbrB, Esp 확인 결과, B: E. faecalis의 fsrB, fsrC, GelE, EbpB, Esp 확인 결과).
도 7은 아세타니솔에 의한 미생물 성장 억제 효과를 나타낸 것이다(A: E. faecalis, B: E. faecium).1 shows the results of evaluating the biofilm formation inhibitory effect of acetanisol in a liquid medium according to an embodiment of the present invention (A: E. faecalis, B: E. faecium, C: E. coli, D: S. aureus, E: S. mutans, F: S. sobrinus, G: P. gingivalis, H: P. acne, I: P. aeruginosa).
Figure 2 shows the results of confirming the combined efficacy of E. faecium and E. faecalis treated with an antibacterial agent and acetanisol according to an embodiment of the present invention (A: E. faecium , B: E. faecalis ).
Figure 3 shows the results confirming the effect of acetanisol to reduce the microbial adhesion to T24 cells in a concentration-dependent manner (A: E. faecium , B: E. faecalis ).
4 shows the results of confirming the results of acetanisol promoting phagocytosis of macrophages in a concentration-dependent manner even when a biofilm is formed (A: E. faecium , B: E. faecalis ).
5 shows the results of confirming whether acetanisol is toxic to T24 cells and macrophages (A: T24 cells, B: RAW 246.7 macrophages).
Figure 6 shows the results of confirming the inhibitory effect of the biofilm virulence factor and quorum sensing gene of E. faecalis and E. faecium by acetanisol (A: fsrB, fsrC, GelE, Acm, Scm, EbpA, Bps, EbrB, Esp confirmation result, B: E. faecalis fsrB, fsrC, GelE, EbpB, Esp confirmation result).
Figure 7 shows the effect of inhibiting the growth of microorganisms by acetanisol (A: E. faecalis , B: E. faecium ).

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명이 하기 실시예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

실시예 1. 바이오필름 형성 분석(Biofilm Formation Assay)Example 1. Biofilm Formation Assay

아세타니솔이 미생물의 바이오필름 형성을 저해하는지 확인하기 위하여, 엔테로코커스 패시움(Enterococcus faecium, E. faecium), 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis), 대장균(E. coli), 스트렙토코커스 뮤탄스(Streptococcus mutans, S. mutans), 스트렙토코커스 소브리누스(Streptococcus sobrinus, S. sobrinus), 스태필로코커스 아우레우스(Staphylococcus aureus, S. aureus), 포르피로모나스 진지발리스(Porphyromonas gingivalis, P. gingivalis), 슈도모나스 아에루지노사(Pseudomonas aeruginosa, P.aeruginosa) 및 프로피오니박테리움 아크네스(Propionibacterium acnes, P. acnes)에 대하여 아세타니솔을 농도에 따라 처리하여 바이오필름 형성 분석(formation assay)을 수행하였다. To determine whether acetanisol inhibits biofilm formation of microorganisms, Enterococcus Faecium (Enterococcus faecium, E. faecium), Enterococcus Enterococcus faecalis, E. faecalis, E. coli, Streptococcus mutans, S. mutans, Streptococcus sobrinus, S. sobrinus, Staphylococcus Aureus (Staphylococcus aureus, S. aureus), Porphyromonas gingivalis (Porphyromonas gingivalis, P. gingivalis), Pseudomonas aeruginosa (Pseudomonas aeruginosa, P. aeruginosa) and For Propionibacterium acnes (Propionibacterium acnes, P. acnes) , acetanisol was treated according to the concentration to perform a biofilm formation assay (formation assay).

구체적으로, 96 웰 플레이트에 OD600=0.1의 E. faecium, E. faecalis, E. coli, S. mutans, S. sorbrinus, S. aureus, P. gingivalis, P.aeruginosa 및 P. acnes을 각각 넣어준 후 각 화합물을 최대 100 μg/mL로부터 2배씩 희석하여 처리하였다. 각 플레이트는 37ºC에서 24시간 배양한 다음, 바이오필름 형성 억제를 확인하였다. 모든 실험은 3회 이상 반복 수행하였고, 그 결과를 도 1에 나타내었다.Specifically, E. faecium, E. faecalis, E. coli, S. mutans, S. sorbrinus, S. aureus, P. gingivalis, P.aeruginosa and P. acnes of OD 600 =0.1 were put in a 96-well plate, respectively. After giving, each compound was diluted two-fold from a maximum of 100 μg/mL and treated. Each plate was incubated at 37ºC for 24 hours, and then inhibition of biofilm formation was confirmed. All experiments were repeated three or more times, and the results are shown in FIG. 1 .

그 결과, 아세타니솔은 E. faecium, E. faecalis, E. coli, S. mutans, S. sorbrinus, S. aureus, P. gingivalis, P.aeruginosa 및 P. acnes 모두에 대하여 바이오필름 형성을 억제하는 효과가 있음을 확인하였다(도 1).As a result, acetanisol inhibits biofilm formation against all of E. faecium, E. faecalis, E. coli, S. mutans, S. sorbrinus, S. aureus, P. gingivalis, P.aeruginosa and P. acnes . It was confirmed that there is an effect (FIG. 1).

실시예 2. 아세타니솔과 항생제의 복합 효능 확인Example 2. Confirmation of the combined efficacy of acetanisol and antibiotics

상기 실시예 1에서 확인한 바와 같이 바이오필름 형성을 저해하는 아세타니솔이 미생물에 대한 기존의 항균제에 대한 감수성에 변화를 줄 수 있는지 확인하고자 E. faecium 및 E. faecalis에 기존의 항생제와 혼합 처리하여 항균 활성을 확인하였다. As confirmed in Example 1, in order to check whether acetanisol, which inhibits biofilm formation, can change the sensitivity to existing antimicrobial agents for microorganisms, E. faecium and E. faecalis were mixed with existing antibiotics to antibacterial Activity was confirmed.

구체적으로, 24시간 동안 형성시킨 바이오필름에 0.195 및 1.56 μg/mL 농도의 아세타니솔(Acetanisol, Acs)을 기존 항균제인 100 μg/mL 농도의 반코마이신(Vancomycin, VAN), 0.39 μg/mL 농도의 스트렙토마이신(Streptomycin, STR), 6.25 μg/mL 농도의 암피실린(Ampicilline, AMP) 그리고 3.125 μg/mL농도의 옥시테트라사이클린(Oxytetracycline, OXY)를 동시에 처리하고, 그 결과를 도 2에 나타내었다. 모든 실험은 3회 실시하였다.Specifically, 0.195 and 1.56 μg/mL concentrations of acetanisol (Acetanisol, Acs) were added to the biofilm formed for 24 hours at a concentration of 100 μg/mL Vancomycin (VAN), 0.39 μg/mL concentration. Streptomycin (STR), 6.25 μg/mL of ampicillin (AMP) and 3.125 μg/mL of oxytetracycline (OXY) were simultaneously treated, and the results are shown in FIG. 2 . All experiments were performed three times.

그 결과, Ace+VAN, Ace+AMP, Ace+STR 및 Ace+OXY 등 항균제와 아세타니솔을 함께 처리하여 바이오필름 형성을 억제한 경우의 미생물 수가 단독 처리시 보다 현저히 감소한 것을 확인하였다(도 2). As a result, it was confirmed that the number of microorganisms in the case of inhibiting biofilm formation by treatment with antibacterial agents such as Ace + VAN, Ace + AMP, Ace + STR, and Ace + OXY and acetanisol was significantly reduced than when treated alone (Fig. 2). ).

실시예 3. T24 세포에 대한 미생물 부착 실험Example 3. Microbial adhesion experiment on T24 cells

E. faecium 및 E. faecalis 등은 감염을 일으키기 위하여 우선 숙주 세포에 부착을 하게 되고, 상기 부착과정은 바이오필름에 의하여 영향을 받는다. 따라서 E. faecium 과 E. faecalis를 T24 세포에 감염을 시켰을 때 아세타니솔이 숙주세포의 부착 과정에 영향을 주는지 확인하기 위한 실험을 진행하였다. E. faecium and E. faecalis are first attached to the host cell to cause infection, and the attachment process is affected by the biofilm. Therefore, E. faecium and E. faecalis An experiment was conducted to determine whether acetanisol affects the adhesion process of host cells when T24 cells are infected.

구체적으로, T24 세포를 1X106의 세포로 24-웰 플레이트 상에서 배양하였다. E. faecalis 와 E. faecium을 24시간 동안 대두카제인소화액 배지(Tryptic Soy Broth, TSB)에서 성장시켜 바이오필름 형성을 유도시켰다. 아세타니솔을 T24 세포에 한 시간 동안 처리한 뒤에 E. faecalis 와 E. faecium을 MOI(multiplicity of infection) 100으로 5% CO2, 37℃에서 24시간 동안 감염시켰다. 24시간 후, T24 세포를 PBS로 씻어주고 크리스탈 바이올렛(Crystal violet)을 1분 동안 염색한 다음 PBS로 씻어준 후 건조하였다. 이후, 요오드를 이용하여 1분 동안 염색한 뒤에 요오드를 제거하고 비 특이적 결정 바이올렛 염색을 제거하기 위해서 탈색제를 플레이트에 30초 동안 넣어준 뒤 제거한 뒤 PBS로 씻어주었다. 이후, 사프린을 30초 동안 염색한 뒤에 현미경으로 확인하고, 그 결과를 도 3에 나타내었다. Specifically, T24 cells were cultured on a 24-well plate with 1X10 6 cells. E. faecalis and E. faecium were grown in soy casein digested medium (Tryptic Soy Broth, TSB) for 24 hours to induce biofilm formation. After acetanisol was treated with T24 cells for one hour, E. faecalis and E. faecium were infected with an MOI (multiplicity of infection) of 100 at 5% CO 2 , 37° C. for 24 hours. After 24 hours, T24 cells were washed with PBS, stained with crystal violet for 1 minute, washed with PBS, and then dried. Thereafter, after staining with iodine for 1 minute, the iodine was removed, and a decolorant was put on the plate for 30 seconds to remove non-specific crystalline violet staining, and then removed and washed with PBS. Thereafter, after staining with saprine for 30 seconds, it was confirmed under a microscope, and the results are shown in FIG. 3 .

그 결과, 아세타니솔이 E. faecalis 와 E. faecium의 감염을 효과적으로 억제하는 것을 확인하였다(도 3). As a result, it was confirmed that acetanisol effectively inhibited the infection of E. faecalis and E. faecium (FIG. 3).

실시예 4. 대식세포(RAW 264.7)에 의한 미생물 생존력 확인Example 4. Confirmation of microbial viability by macrophages (RAW 264.7)

대식세포(Macrophage)는 미생물 감염 시에 미생물을 제거하는 면역 작용을 한다. 바이오필름은 대식세포에 의한 미생물 제거를 어렵게 하는 것으로 알려져 있다. 따라서 마우스 유래의 대식세포인 RAW 264.7에 의한 E. faecium 과 E. faecalis 미생물 제거 기능이 아세타니솔에 의하여 영향을 받는지 확인하기 위한 실험을 수행하였다. Macrophages have an immune function that removes microorganisms during microbial infection. Biofilms are known to make it difficult to remove microorganisms by macrophages. Therefore, an experiment was performed to determine whether the removal of E. faecium and E. faecalis microorganisms by RAW 264.7, a mouse-derived macrophage, was affected by acetanisol.

바이오필름 형성을 유도한 E. faecalis 와 E. faecium을 RAW 264.7와 같이 배양한 다음 아세타니솔을 처리한 군과 그렇지 않은 군의 미생물 생존 정도를 관찰하였다. E. faecalis and E. faecium , which induced biofilm formation, were cultured as RAW 264.7, and then the microbial survival of the group treated with acetanisol and the group without it was observed.

구체적으로, E. faecalis 와 E. faecium을 24시간 동안 1% 글루코스를 함유하는 TSB 배지에서 배양하여 바이오필름 형성을 유도하고, MOI가 10일때 E. faecalis 와 E. faecium을 RAW 264.7에 24시간 동안 배양한 후 현미경으로 관찰한 결과를 도 4에 나타내었다. 모든 실험은 3회 실시하였다.Specifically, biofilm formation was induced by culturing E. faecalis and E. faecium in TSB medium containing 1% glucose for 24 hours, and when the MOI was 10, E. faecalis and E. faecium in RAW 264.7 for 24 hours. The results observed under a microscope after incubation are shown in FIG. 4 . All experiments were performed three times.

그 결과, 아무것도 처리하지 않은(control) 상태의 대식세포(RAW 264.7)와 바이오필름을 형성하지 못한 경우 비슷한 형태를 나타내는 것을 확인하였으며(도 4), 이는 대식세포에 의해 미생물이 제거되었음을 의미한다. As a result, it was confirmed that the macrophages in the untreated (control) state (RAW 264.7) and the biofilm did not form a similar shape (FIG. 4), which means that the microorganisms were removed by the macrophages.

반면, 미생물이 바이오필름을 형성한 경우엔 대조군 및 바이오필름이 없는 경우와 비교하였을 때 RAW 264.7 세포의 형태 및 살아있는 미생물의 수에서 확연하게 차이가 존재하였으며, 아세타니솔을 처리한 경우에는 농도 의존적으로 점점 대조군과 비슷한 형태를 나타내는 것을 확인하였다(도 4). 이로부터 아세타니솔이 바이오필름을 형성한 미생물에 대한 식균작용을 촉진하는 것을 확인하였다.On the other hand, when the microorganisms formed a biofilm, there was a marked difference in the form of RAW 264.7 cells and the number of living microorganisms compared to the control group and the case without the biofilm, and when acetanisol was treated, there was a concentration-dependent difference As a result, it was confirmed that it gradually showed a form similar to that of the control group (FIG. 4). From this, it was confirmed that acetanisol promotes phagocytosis on the microorganisms forming the biofilm.

실시예 5. 아세타니솔의 인체 유래 세포에 대한 독성 확인Example 5. Confirmation of toxicity of acetanisol to human-derived cells

아세타니솔이 인체 유래 세포에 대하여 독성을 나타내는지 확인하기 위한 독성 확인 실험을 수행하였다. A toxicity confirmation experiment was performed to determine whether acetanisol is toxic to human-derived cells.

구체적으로, T24 세포 및 대식세포에 대한 아세타니솔의 세포 독성을 MTT 분석법으로 확인하였다. 지시된 농도의 아세타니솔(0-100 μg/mL)을 함유하는 RPMI 1640배지, DMEM 배지에서 웰당 104 개의 T24 세포와 대식세포를 각각 첨가하고 24시간 동안 배양하였다. PBS 중의 MTT를 최종 농도 0.5 mg/mL로 첨가하고 37℃에서 1시간 동안 배양하였다. 배지를 제거하고 세포를 100% DMSO에 현탁시켰다. 세포 생존력은 마이크로 플레이트 리더(BioTek Instruments, Korea)를 사용하여 측정된 광학 밀도 (OD540) 값에 의해 계산되었고 표준 편차를 포함하는 대조군의 백분율을 도 5에 나타내었다. 모든 실험은 3회 실시하였다.Specifically, the cytotoxicity of acetanisol to T24 cells and macrophages was confirmed by MTT assay. 10 4 T24 cells and macrophages were added per well in RPMI 1640 medium and DMEM medium containing the indicated concentrations of acetanisol (0-100 μg/mL), respectively, and cultured for 24 hours. MTT in PBS was added to a final concentration of 0.5 mg/mL and incubated at 37° C. for 1 hour. The medium was removed and the cells were suspended in 100% DMSO. Cell viability was calculated by the optical density (OD 540 ) value measured using a microplate reader (BioTek Instruments, Korea) and the percentage of control including standard deviation is shown in FIG. 5 . All experiments were performed three times.

그 결과, 아세타니솔을 T24 세포와 RAW 264.7에 처리하였을 때 두 세포 모두에 독성이 나타나지 않은 것을 확인하였다(도 5). As a result, it was confirmed that when acetanisol was treated with T24 cells and RAW 264.7, toxicity did not appear on both cells ( FIG. 5 ).

실시예 6. 아세타니솔에 의한 바이오필름 병독성 인자 및 정족수 감지 유전자의 발현 억제 효과 확인Example 6. Confirmation of the effect of inhibiting the expression of biofilm virulence factors and quorum sensing genes by acetanisol

아세타니솔이 E. faecalis 및 E. faecium에 대한 바이오필름 병독성 인자(virulence factors) 및 정족수 감지 유전자(Quorum sensing genes)의 발현을 저해시키는지 확인하기 위해 RT-PCR을 수행하였다. RT-PCR was performed to confirm that acetanisol inhibits the expression of biofilm virulence factors and quorum sensing genes for E. faecalis and E. faecium .

RT-PCR 수행에 사용한 프라이머는 하기 표 1에 정리한 바와 같다. RT-PCR 프라이머 수행 조건으로는 40 싸이클로 95℃에서 15초, 40℃에서 60초, 72℃에 30초로 수행하였다.Primers used for performing RT-PCR are summarized in Table 1 below. RT-PCR primer performance conditions were 40 cycles at 95°C for 15 seconds, 40°C for 60 seconds, and 72°C for 30 seconds.

유전자gene 프라이머 종류Primer type 프라이머 서열(5'-3')Primer sequence (5'-3') 서열번호SEQ ID NO: biofilm virulence factorsbiofilm virulence factors EspEsp forwardforward CCACGAGTTAGAGGGAACAGCCACGAGTTAGAGGGAACAG 1One reversereverse TTGGAGCCCCATCTTTTTCATTGGAGCCCCATCTTTTTCA 22 EbrBEbrB forwardforward TGAGGGATTCTGGGATTGTTTTGAGGGATTCTGGGATTGTTT 33 reversereverse GCCGATGAATTGAACGACAGAGCCGATGAATTGAACGACAGA 44 EbpAEbpA forwardforward ACCAAGCCAGACGAAATAGAAGAAGACCAAGCCAGACGAAATAGAAGAAG 55 reversereverse ATTGTTTTGGTCAGGTGCATCATAGAATTGTTTTGGTCAGGTGCATCATAGA 66 EbpBEbpB forwardforward CGTACAGGAGGCAAGTCTTTCGTACAGGAGGCAAGTCTTT 77 reversereverse AGGTATTCCCCGCTTGATTTAGGTATTCCCCGCTTGATTT 88 bpsbps forwardforward TATCAGCAACAAGCGGTCATATCAGCAACAAGCGGTCA 99 reversereverse AATCCTGCCCTTTTTCGATTAATCCTGCCCTTTTTCGATT 1010 AcmAcm forwardforward TCAGCAGTAATGTCACTTCGTTGTCAGCAGTAATGTCACTTCGTTG 1111 reversereverse GAATAGGCTGTTCATCTGCTCGGAATAGGCTGTTCATCTGCTCG 1212 Scmscm forwardforward CTAACTGGTAACTATGGCTTGTCTAACTGGTAACTATGGCTTGT 1313 reversereverse GTCCGTGCTGTCACTTGTGTCCGTGCTGTCACTTGT 1414 Quorum sensing genesQuorum sensing genes fsrBfsrB forwardforward TGCTCAAAAAGCAAAGCCTTATAATGCTCAAAAAGCAAAGCCTTATAA 1515 reversereverse GATGACGAGACCGTAGAGTATTACTGAAGATGACGAGACCGTAGAGTATTACTGAA 1616 fsrCfsrC forwardforward GCTTATTTGGAAGAACAACGTATCAAGCTTATTTGGAAGAACAACGTATCAA 1717 reversereverse CGAAACATCGCTAGCTCTTCGTCGAAACATCGCTAGCTCTTCGT 1818 GelEGelE forwardforward CGGAACATACTGCCGGTTTAGACGGAACATACTGCCGGTTTAGA 1919 reversereverse GGATTAGATGCCACCCGAAATGGATTAGATGCCACCCGAAAT 2020

그 결과 도 6에 나타난 바와 같이, 아세타니솔이 E. faecalis 와 E. faecium의 바이오필름 병독성 인자(virulence factors) 유전자인 Esp, EbrB, EbpA, EbpB, bps, Acm 및 Scm와 정족수 감지 유전자(quorum sensing genes)인 fsrB, fsrC 및 GelE의 발현을 농도 의존적으로 억제함을 확인하였다. 이러한 결과는 아세타니솔이 정족수 감지 유전자의 발현을 억제하며, 결과적으로 바이오필름의 형성을 억제함을 의미한다.As a result, as shown in FIG. 6 , acetanisol was used as the biofilm virulence factor genes of E. faecalis and E. faecium , Esp, EbrB, EbpA, EbpB, bps, Acm and Scm , and quorum sensing. It was confirmed that the expression of genes) fsrB, fsrC and GelE was inhibited in a concentration-dependent manner. These results suggest that acetanisol suppresses the expression of quorum sensing genes, and consequently the formation of biofilms.

실시예 7. 아세타니솔에 의한 미생물 성장 억제 여부 확인Example 7. Confirmation of inhibition of microbial growth by acetanisol

상기 실험결과에서 확인한 아세타니솔의 바이오필름 형성 저해 효과가 균의 성장을 억제하기 때문에 당연히 수반되는 효과인지, 또는 직접적으로 바이오필름 자체의 형성을 억제하는 효과를 나타내는 것인지 확인하기 위하여, 아세타니솔에 의한 E. faecium 및 E. faecalis의 생존을 확인하였다.In order to confirm whether the biofilm formation inhibitory effect of acetanisol confirmed in the above experimental results is a naturally accompanying effect because it inhibits the growth of bacteria, or whether it directly exhibits the effect of inhibiting the formation of the biofilm itself, acetanisol The survival of E. faecium and E. faecalis was confirmed.

구체적으로, E. faecium 및 E. faecalis의 생존을 확인하기 위해 아세타니솔의 농도를 100 μg/ml로 처리하여 미생물의 성장을 관찰하였으며, 도 7에 성장 억제 결과를 나타내었다. 그 모든 실험은 3회 실시하였다.Specifically, in order to confirm the survival of E. faecium and E. faecalis , the growth of microorganisms was observed by treating the concentration of acetanisol at 100 μg/ml, and the growth inhibition results are shown in FIG. 7 . All the experiments were performed three times.

그 결과, 아세타니솔의 처리여부는 E. faecium 및 E. faecalis의 생존에 영향을 주지 않는 것을 확인하였다. 이에 따라, 아세타니솔이 특히 바이오필름 형성을 억제함으로써 항균 효과를 나타냄을 확인하였다(도 7).As a result, it was confirmed that treatment with acetanisol did not affect the survival of E. faecium and E. faecalis . Accordingly, it was confirmed that acetanisol exhibits an antibacterial effect by inhibiting the formation of a biofilm in particular (FIG. 7).

즉, 본 발명의 아세타니솔은 미생물의 성장과 무관하게 바이오필름의 형성만을 억제하는 것을 특징으로 하는 바, 이는 무차별적인 살균 보다는 병원성만을 억제할 수 있도록 함으로써 일반 항생제보다 저항성이 적게 유발이 된다. That is, the acetanisol of the present invention is characterized in that it inhibits only the formation of a biofilm regardless of the growth of microorganisms, which is capable of inhibiting only pathogenicity rather than indiscriminate sterilization, thereby induced less resistance than general antibiotics.

본 발명의 조성물은 항생제의 내성이 점차 큰 문제가 되고 있는 현 시점에서 감염성 세균의 성장에는 별다른 영향을 미치지 않아 항생제 내성 문제가 발생되지 않으면서, 동시에 병원성을 나타내는 바이오필름 및/또는 단백질의 생성을 억제하여 감염성 질환 등에 우수한 효과를 나타낼 수 있다.The composition of the present invention does not have a significant effect on the growth of infectious bacteria at the present time when antibiotic resistance is gradually becoming a big problem, so that antibiotic resistance problems do not occur, and at the same time, the production of biofilms and / or proteins showing pathogenicity By suppressing it, it can exhibit an excellent effect on infectious diseases and the like.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. 예를 들어, 단일형으로 설명되어 있는 각 구성 요소는 분산되어 실시될 수도 있으며, 마찬가지로 분산된 것으로 설명되어 있는 구성 요소들도 결합된 형태로 실시될 수 있다.The foregoing description of the present invention is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. For example, each component described as a single type may be implemented in a dispersed form, and likewise components described as distributed may also be implemented in a combined form.

본 발명의 범위는 후술하는 청구범위에 의하여 나타내어지며, 청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included in the scope of the present invention.

<110> University-Industry Cooperation Group of Kyung Hee University <120> University-Industry Cooperation Group of Kyung Hee University <130> 20PP30243 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Esp_forward <400> 1 ccacgagtta gagggaacag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Esp_reverse <400> 2 ttggagcccc atctttttca 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EbrB_forward <400> 3 tgagggattc tgggattgtt t 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EbrB_reverse <400> 4 gccgatgaat tgaacgacag a 21 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> EbpA_forward <400> 5 accaagccag acgaaataga agaag 25 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> EbpA_reverse <400> 6 attgttttgg tcaggtgcat cataga 26 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EbpB_forward <400> 7 cgtacaggag gcaagtcttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EbpB_reverse <400> 8 aggtattccc cgcttgattt 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> bps_forward <400> 9 tatcagcaac aagcggtca 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> bps_reverse <400> 10 aatcctgccc tttttcgatt 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Acm_forward <400> 11 tcagcagtaa tgtcacttcg ttg 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Acm_reverse <400> 12 gaataggctg ttcatctgct cg 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Scm_forward <400> 13 ctaactggta actatggctt gt 22 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Scm_reverse <400> 14 gtccgtgctg tcacttgt 18 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> fsrB_forward <400> 15 tgctcaaaaa gcaaagcctt ataa 24 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> fsrB_reverse <400> 16 gatgacgaga ccgtagagta ttactgaa 28 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> fsrC_forward <400> 17 gcttatttgg aagaacaacg tatcaa 26 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> fsrC_reverse <400> 18 cgaaacatcg ctagctcttc gt 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GelE_forward <400> 19 cggaacatac tgccggttta ga 22 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GelE_reverse <400> 20 ggattagatg ccacccgaaa t 21 <110> University-Industry Cooperation Group of Kyung Hee University <120> University-Industry Cooperation Group of Kyung Hee University <130> 20PP30243 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Esp_forward <400> 1 ccacgagtta gagggaacag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Esp_reverse <400> 2 ttggagcccc atctttttca 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EbrB_forward <400> 3 tgagggattc tgggattgtt t 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> EbrB_reverse <400> 4 gccgatgaat tgaacgacag a 21 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> EbpA_forward <400> 5 accaagccag acgaaataga agaag 25 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> EbpA_reverse <400> 6 attgttttgg tcaggtgcat cataga 26 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EbpB_forward <400> 7 cgtacaggag gcaagtcttt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EbpB_reverse <400> 8 aggtattccc cgcttgattt 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> bps_forward <400> 9 tatcagcaac aagcggtca 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> bps_reverse <400> 10 aatcctgccc tttttcgatt 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Acm_forward <400> 11 tcagcagtaa tgtcacttcg ttg 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Acm_reverse <400> 12 gaataggctg ttcatctgct cg 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Scm_forward <400> 13 ctaactggta actatggctt gt 22 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Scm_reverse <400> 14 gtccgtgctg tcacttgt 18 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> fsrB_forward <400> 15 tgctcaaaaa gcaaagcctt ataa 24 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> fsrB_reverse <400> 16 gatgacgaga ccgtagagta ttactgaa 28 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> fsrC_forward <400> 17 gcttatttgg aagaacaacg tatcaa 26 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> fsrC_reverse <400> 18 cgaaacatcg ctagctcttc gt 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> GelE_forward <400> 19 cggaacatac tgccggttta ga 22 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> GelE_reverse <400> 20 ggattagatg ccacccgaaa t 21

Claims (12)

아세타니솔(Acetanisol)을 포함하는, 바이오필름 형성 억제용 조성물에 있어서,
상기 바이오필름은　엔테로코커스 패시움(Enterococcus faecium, E. faecium), 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis), 대장균(E. coli), 스트렙토코커스 뮤탄스(Streptococcus mutans, S. mutans), 스트렙토코커스 소브리누스(Streptococcus sobrinus, S. sobrinus), 스태필로코커스 아우레우스(Staphylococcus aureus, S. aureus), 포르피로모나스 진지발리스(Porphyromonas gingivalis, P. gingivalis), 슈도모나스 아에루지노사(Pseudomonas aeruginosa, P.aeruginosa) 및 프로피오니박테리움 아크네스(Propionibacterium acnes, P. acnes)로 구성된 군에서 선택된 하나 이상의 미생물에 의해 형성되는 것인, 바이오필름 형성 억제용 조성물.In the composition for inhibiting biofilm formation, comprising acetanisol,
The biofilm is Enterococcus Faecium (Enterococcus faecium, E. faecium), Enterococcus Enterococcus faecalis, E. faecalis, E. coli, Streptococcus mutans, S. mutans, Streptococcus sobrinus, S. sobrinus, Staphylococcus Aureus (Staphylococcus aureus, S. aureus), Porphyromonas gingivalis (Porphyromonas gingivalis, P. gingivalis), Pseudomonas aeruginosa (Pseudomonas aeruginosa, P. aeruginosa) and Propionibacterium acnes (Propionibacterium acnes, P. acnes) will be formed by one or more microorganisms selected from the group consisting of, the composition for inhibiting biofilm formation. 제1항에 있어서, 상기 아세타니솔은 하기 화학식 1의 구조로 이루어진 것인, 바이오필름 형성 억제용 조성물.
[화학식 1]
Figure 112020043379439-pat00002
The composition for inhibiting biofilm formation according to claim 1, wherein the acetanisol has a structure of the following formula (1).
[Formula 1]
Figure 112020043379439-pat00002
 삭제delete 제1항의 조성물을 바이오필름이 형성되었거나 바이오필름 형성이 예상되는 표면에 처리하는 단계;를 포함하는 바이오필름 형성 억제방법에 있어서,
상기 바이오필름은　엔테로코커스 패시움(Enterococcus faecium, E. faecium), 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis), 대장균(E. coli), 스트렙토코커스 뮤탄스(Streptococcus mutans, S. mutans), 스트렙토코커스 소브리누스(Streptococcus sobrinus, S. sobrinus), 스태필로코커스 아우레우스(Staphylococcus aureus, S. aureus), 포르피로모나스 진지발리스(Porphyromonas gingivalis, P. gingivalis), 슈도모나스 아에루지노사(Pseudomonas aeruginosa, P.aeruginosa) 및 프로피오니박테리움 아크네스(Propionibacterium acnes, P. acnes)로 구성된 군에서 선택된 하나 이상의 미생물에 의해 형성되는 것인, 바이오필름 형성 억제방법.In the method for inhibiting biofilm formation comprising; treating the composition of claim 1 on a surface on which a biofilm is formed or is expected to form a biofilm,
The biofilm is Enterococcus Faecium (Enterococcus faecium, E. faecium), Enterococcus Enterococcus faecalis, E. faecalis, E. coli, Streptococcus mutans, S. mutans, Streptococcus sobrinus, S. sobrinus, Staphylococcus Aureus (Staphylococcus aureus, S. aureus), Porphyromonas gingivalis (Porphyromonas gingivalis, P. gingivalis), Pseudomonas aeruginosa (Pseudomonas aeruginosa, P. aeruginosa) and Propionibacterium acnes (Propionibacterium acnes, P. acnes) will be formed by one or more microorganisms selected from the group consisting of, biofilm formation inhibition method. 제1항의 조성물을 포함하는 항균용 조성물에 있어서,
상기 항균은　엔테로코커스 패시움(Enterococcus faecium, E. faecium), 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis), 대장균(E. coli), 스트렙토코커스 뮤탄스(Streptococcus mutans, S. mutans), 스트렙토코커스 소브리누스(Streptococcus sobrinus, S. sobrinus), 스태필로코커스 아우레우스(Staphylococcus aureus, S. aureus), 포르피로모나스 진지발리스(Porphyromonas gingivalis, P. gingivalis), 슈도모나스 아에루지노사(Pseudomonas aeruginosa, P.aeruginosa) 및 프로피오니박테리움 아크네스(Propionibacterium acnes, P. acnes)로 구성된 군에서 선택된 하나 이상의 미생물에 대한 것인, 항균용 조성물.In the antibacterial composition comprising the composition of claim 1,
The antibacterial agent is Enterococcus Faecium (Enterococcus faecium, E. faecium), Enterococcus Enterococcus faecalis, E. faecalis, E. coli, Streptococcus mutans, S. mutans, Streptococcus sobrinus, S. sobrinus, Staphylococcus Aureus (Staphylococcus aureus, S. aureus), Porphyromonas gingivalis (Porphyromonas gingivalis, P. gingivalis), Pseudomonas aeruginosa (Pseudomonas aeruginosa, P. aeruginosa) and Propionibacterium acnes (Propionibacterium acnes, P. acnes) for one or more microorganisms selected from the group consisting of, the antibacterial composition. 제5항에 있어서,
상기 항균용 조성물은 항생제를 추가로 포함하는 것인, 항균용 조성물.6. The method of claim 5,
The antibacterial composition further comprises an antibiotic, antibacterial composition. 제6항에 있어서,
상기 항생제는 반코마이신, 스트렙토마이신, 암피실린 및 옥시테트라사이클린으로 이루어진 군에서 선택된 하나 이상인 것인, 항균용 조성물.7. The method of claim 6,
The antibiotic is at least one selected from the group consisting of vancomycin, streptomycin, ampicillin and oxytetracycline, antibacterial composition. 제5항의 항균용 조성물을 포함하는, 미생물 감염에 대한 예방 또는 치료용 약학적 조성물에 있어서,
상기 미생물은 엔테로코커스 패시움(Enterococcus faecium, E. faecium) 및 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis)로 구성된 군에서 선택된 하나 이상인 것인, 약학적 조성물.In the pharmaceutical composition for preventing or treating microbial infection, comprising the antibacterial composition of claim 5,
The microorganism is Enterococcus Faecium (Enterococcus faecium, E. faecium) and Enterococcus Faecalis (Enterococcus faecalis, E. faecalis) Will at least one selected from the group consisting of, a pharmaceutical composition. 삭제delete 제8항에 있어서,
상기 약학적 조성물은 항생제를 추가로 포함하는 것인, 약학적 조성물.9. The method of claim 8,
The pharmaceutical composition will further comprise an antibiotic, the pharmaceutical composition. 제10항에 있어서, 항생제는 반코마이신, 스트렙토마이신, 암피실린 및 옥시테트라사이클린으로 이루어진 군에서 선택된 하나 이상인 것인, 약학적 조성물.The pharmaceutical composition of claim 10, wherein the antibiotic is at least one selected from the group consisting of vancomycin, streptomycin, ampicillin and oxytetracycline. 제5항의 항균용 조성물을 포함하는, 항균용 식품 조성물에 있어서,
상기 항균은 엔테로코커스 패시움(Enterococcus faecium, E. faecium) 및 엔테로코커스 페칼리스(Enterococcus faecalis, E. faecalis)로 구성된 군에서 선택된 하나 이상의 미생물에 대한 것인, 항균용 식품 조성물.
In the antibacterial food composition comprising the antimicrobial composition of claim 5,
The antibacterial agent is Enterococcus Faecium (Enterococcus faecium, E. faecium) and Enterococcus Faecalis (Enterococcus faecalis, E. faecalis) for one or more microorganisms selected from the group consisting of, antibacterial food composition.
KR1020200051004A 2020-04-27 2020-04-27 Composition comprising acetanisol for inhibiting the formation of biofilm KR102450964B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200051004A KR102450964B1 (en) 2020-04-27 2020-04-27 Composition comprising acetanisol for inhibiting the formation of biofilm

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200051004A KR102450964B1 (en) 2020-04-27 2020-04-27 Composition comprising acetanisol for inhibiting the formation of biofilm

Publications (2)

Publication Number Publication Date
KR20210132513A KR20210132513A (en) 2021-11-04
KR102450964B1 true KR102450964B1 (en) 2022-10-05

Family

ID=78521858

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200051004A KR102450964B1 (en) 2020-04-27 2020-04-27 Composition comprising acetanisol for inhibiting the formation of biofilm

Country Status (1)

Country Link
KR (1) KR102450964B1 (en)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1327823C (en) 2002-06-14 2007-07-25 弗门尼舍有限公司 Non-crystalline perfume or flavour delivery system
EP2268142B1 (en) * 2007-11-27 2017-02-22 Algipharma As Use of alginated oligomers in combating biofilms
KR102150006B1 (en) * 2018-06-12 2020-08-31 재단법인 포항테크노파크 composition for inhibiting biofilm formation and virulence of Staphylococcus aureus
KR102099534B1 (en) * 2019-07-01 2020-04-09 인제대학교 산학협력단 Composition for repressing or removing Staphylococcus spp. biofilm comprising the extract of Orostachys japonicas
KR102361131B1 (en) * 2020-02-25 2022-02-10 경희대학교 산학협력단 Composition for antibacterial activity of multi-drug resistant bacteria

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Letters in Applied Microbiology 2000, 30, 105-108, G.Bisignano외 7인, Antimicrobial activity of Mitracarpus scaber extract and isolated constituents(2001.12.25)
Letters in Applied Microbiology 2005, 40, 212.217, L. Rajabi 외 4인, Acetophenones with selective antimycobacterial activity(2005.01.26.)*

Also Published As

Publication number Publication date
KR20210132513A (en) 2021-11-04

Similar Documents

Publication Publication Date Title
US8679527B2 (en) Antimicrobial compositions
Saranraj et al. Pharmacology of honey: A review
US20200171077A1 (en) Compositions and methods for treating and preventing bacterial infections
CN111568919A (en) A preparation containing chitosan oligosaccharide for resisting helicobacter pylori
HUT61478A (en) Process for producing pharamceutical composition suitable for treating diarrhoae caused by clostridium difficile and by pseudomembranous colitis
KR102450964B1 (en) Composition comprising acetanisol for inhibiting the formation of biofilm
KR102441377B1 (en) Composition comprising pectolinarin for inhibiting the formation of biofilm
KR102342160B1 (en) Composition comprising taxifolin for inhibiting the formation of biofilm
KR102275801B1 (en) Composition comprising cis-jasmone for inhibiting the formation of biofilm
KR102390799B1 (en) Composition comprising imperata cylindrica for inhibiting the formation of biofilm
US10314813B2 (en) Antimicrobial compositions for Clostridium difficile
KR101919499B1 (en) Antimicrobial composition against pathogenic super-bacteria containing propolis and alpha-pinene
KR101916600B1 (en) Composition for antibiotic composition including amnion membrane extract or chorion membrane extract and method for preparing the same
KR102407606B1 (en) Composition comprising hedera rhombea for inhibiting the formation of biofilm
WO2024029756A1 (en) Candida anti-fungal composition containing lipoteichoic acid
KR102208837B1 (en) Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent
KR20240019689A (en) Composition for Preventing Biofilm Formation Comprising Diosgenin or Derivatives Thereof
KR20220164351A (en) Cultured Product of Lactic Acid Bacteria from Kefir, and Antibacterial Composition and Functional Food Comprising Same
KR20190042393A (en) Composition for treating inflammatory disease comprising protein kinsase C inhibitor
KR20180016243A (en) Composition for antibiotic composition including amnion membrane extract or chorion membrane extract and method for preparing the same
AU2015258179A1 (en) Antimicrobial compositions
KR20170006018A (en) A composition containing fucoidan as a active ingredient for the inhibition of mrsa
KR20140089821A (en) A composition for antibacteria effect containing essential oil of asarum sieboldii against antibiotic resistant bacteria
KR20150137929A (en) An antibacterial composition comprising an extract of corylopsis coreana

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
X091 Application refused [patent]
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant