KR102208837B1 - Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent - Google Patents
Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent Download PDFInfo
- Publication number
- KR102208837B1 KR102208837B1 KR1020190056340A KR20190056340A KR102208837B1 KR 102208837 B1 KR102208837 B1 KR 102208837B1 KR 1020190056340 A KR1020190056340 A KR 1020190056340A KR 20190056340 A KR20190056340 A KR 20190056340A KR 102208837 B1 KR102208837 B1 KR 102208837B1
- Authority
- KR
- South Korea
- Prior art keywords
- salmonella
- composition
- methyl gallate
- mabofloxacin
- invasion
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
- A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
- A61K31/235—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids having an aromatic ring attached to a carboxyl group
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N31/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic oxygen or sulfur compounds
- A01N31/08—Oxygen or sulfur directly attached to an aromatic ring system
- A01N31/16—Oxygen or sulfur directly attached to an aromatic ring system with two or more oxygen or sulfur atoms directly attached to the same aromatic ring system
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/48—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with two nitrogen atoms as the only ring hetero atoms
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/72—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms
- A01N43/84—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms six-membered rings with one nitrogen atom and either one oxygen atom or one sulfur atom in positions 1,4
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/111—Aromatic compounds
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/116—Heterocyclic compounds
- A23K20/137—Heterocyclic compounds containing two hetero atoms, of which at least one is nitrogen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/4995—Pyrazines or piperazines forming part of bridged ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines having two or more nitrogen atoms in the same ring, e.g. oxadiazines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
- A61K8/36—Carboxylic acids; Salts or anhydrides thereof
- A61K8/368—Carboxylic acids; Salts or anhydrides thereof with carboxyl groups directly bound to carbon atoms of aromatic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
- A61K8/494—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with more than one nitrogen as the only hetero atom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/02—Local antiseptics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q17/00—Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
- A61Q17/005—Antimicrobial preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/10—Washing or bathing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 장 부착 또는 장 침입 억제용 조성물 및 이의 이용에 관한 것이다. 본 발명의 조성물은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 저농도로 포함함으로써 항생제 내성균 유발의 문제 없이 살모넬라 균주의 숙주세포로의 부착, 침입 및 세포 내 생존을 현저하게 억제하는 우수한 효과를 가지고 있다. 따라서 본 발명의 조성물은 약학적 조성물 뿐만 아니라 사료 첨가용, 소독용, 세척용 및 방부용 조성물 등 다양한 분야에서 사용될 수 있다.The present invention relates to a composition for inhibiting intestinal adhesion or intestinal invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antimicrobial agents as active ingredients, and use thereof. The composition of the present invention has an excellent effect of remarkably inhibiting the adhesion, invasion and intracellular survival of Salmonella strains to host cells without the problem of causing antibiotic-resistant bacteria by containing methyl gallate and fluoroquinolone-based antimicrobial agents at low concentrations. Therefore, the composition of the present invention can be used in various fields such as a pharmaceutical composition, as well as a composition for feed addition, disinfection, cleaning and preservation.
Description
본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 장 부착 또는 장 침입 억제용 조성물 및 이의 이용에 관한 것이다. The present invention relates to a composition for inhibiting intestinal adhesion or intestinal invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antimicrobial agents as active ingredients, and use thereof.
살모넬라(Salmonella)는 장내세균과에 속하는 그람음성의 통성혐기성 세균으로, 아포를 형성하지 않는 간균이다. 살모넬라균은 사람뿐만 아니라 돼지, 소, 닭 등을 비롯한 다양한 가축에 감염되어 질병을 유발하는데, 사람에게 감염되어 식중독을 유발하고 동물에게 있어서 다양한 살모넬라증 (Salmonellosis)을 유발하는 병원성 미생물이다. 살모넬라 엔테리카(Salmonella enterica)는 혈청학적 구분에 의해 장티푸스를 일으키는 살모넬라 타이피(Salmonella Typhi), 쥐티푸스의 원인균인 살모넬라 티피뮤리움(Salmonella Typhimurium), 장염균인 살모넬라 엔테리티디스 (Salmonella Enteritidis), 가금티푸스의 원인균인 살모넬라 갈리나륨(Salmonella Gallinarum), 추백리 원인균인 살모넬라 플로럼(Salmonella Pullorum), 급성 패혈증 및 돼지 콜레라의 원인균인 살모넬라 콜레라수이스(Salmonella Choleraesuis) 등의 혈청종을 포함한다. 살모넬라균은 혈청형에 따라 인간뿐만 아니라 가축에게도 질병을 일으킬 수 있는 인수공통 감염원을 포함한다. 살모넬라 콜레라수이스 (Salmonella Choleraesuis)는 돼지에 감염되어 돼지 콜레라를 일으킬 수 있어 돼지 콜레라균으로 잘 알려져 있는 균으로 사람과 동물 모두에게 감염되는 균이다. 이 균은 살모넬라 타이피수이스(Salmonella Typhisuis)와 함께 살모넬라에 의한 급성 패혈증을 일으키며, 살모넬라 감염에 의한 돼지의 급성 또는 만성의 소화기 전염병은 돼지 파라타이포이드(paratyphoid)라 불리며, 위장염 및 패혈증을 동반하고 주로 비육기에 많이 발생한다. 이 균에 의한 질병의 발생은 계절적으로는 주로 여름에 흔히 발생하며 급성패혈증형은 2~4개월령의 어린 돼지에서 흔히 발생하며, 주된 증상은 체온상승(41~42℃), 원기소실과 식욕감퇴, 귀 주위와 다리 부위에 청색증(cyanosis)이 생기며, 발병 2~4일 이내에 대부분 폐사된다. 급성 장염형은 비육기 가축에 주로 발생하며 식욕이 일정하지 않고 심한 수양성 설사와 고열, 원기쇠약, 폐염 및 신경증상을 동반하며 중증의 경우 피부변색이 나타난다. 만성 장염형은 가축이 계속적인 설사로 인하여 심하게 여위여 있고 초기 황백색 또는 회백색의 연변에서 점차적으로 젤라틴량의 점액성 설사로 변하고 설사변은 장점막상피세포의 괴사편을 함유하고 있으며 간혹 혈액이 섞여 있는 경우도 있다. 국내의 경우 상기 균에 의한 질병 발생은 빈도가 매우 낮은 것으로 보고되고 있으나, 질병이 발생하면 전염성 및 피해가 크게 나타날 수 있다. 또한, 살모넬라균이 전염되는 경우의 대부분이 그렇듯이 오염된 원료사료나 물 또는 별 증상 없이 균을 보균하고 있는 성돈이 중요한 전염원이 될 수 있다. Salmonella (Salmonella) is a facultative anaerobic bacteria belonging to gram-negative enteric bacteria and a bacillus which does not form a spore. Salmonella is a pathogenic microorganism that infects not only humans, but also various livestock including pigs, cows, chickens, etc., and causes diseases. It infects humans, causing food poisoning, and causing various salmonellosis in animals. Salmonella enterica is known as Salmonella Typhi, which causes typhoid fever by serological classification, Salmonella Typhimurium, which is the causative agent of Zut typhus, Salmonella Enteritidis, which is an enteritis bacteria , and poultry. serum contains species such as Salmonella Galina volume (Salmonella gallinarum) the causative agents of typhoid, chubaekri causative agent of salmonellosis flow column (Salmonella Pullorum), acute septicemia and salmonella can be a causative agent of cholera hog cholera device (Salmonella choleraesuis). Salmonella, depending on the serotype, contains a common source of infection that can cause diseases not only in humans but also in livestock. Salmonella Choleraesuis ( Salmonella Choleraesuis) is a fungus known as swine cholera because it can infect pigs and cause pig cholera. It is a fungus that infects both humans and animals. Together with Salmonella Typhisuis, this fungus causes acute sepsis caused by Salmonella, and the acute or chronic gastrointestinal infectious disease of pigs caused by Salmonella infection is called pig paratyphoid, and is accompanied by gastroenteritis and sepsis. It mainly occurs during the fattening period. Diseases caused by this fungus are common seasonally, mainly in summer, and acute septicemia is common in young pigs aged 2 to 4 months. The main symptoms are elevated body temperature (41~42℃), loss of energy and loss of appetite, Cyanosis occurs around the ears and in the legs, and most of them die within 2 to 4 days of onset. Acute enteritis occurs mainly in fattening livestock. Appetite is not constant. It is accompanied by severe watery diarrhea, high fever, weakness, pneumonia, and neurological symptoms. In severe cases, skin discoloration appears. Chronic enteritis is when livestock is severely thin due to continuous diarrhea, and gradually changes from yellowish-white or grayish-white soft stool to gelatinous mucous diarrhea, and the diarrhea contains necrotic fragments of intestinal epithelial cells, and sometimes contains blood. There is also. In Korea, it has been reported that the incidence of diseases caused by the above fungi is very low, but when a disease occurs, contagiousness and damage can appear large. In addition, as in most cases where Salmonella is transmitted, contaminated feedstock, water, or adult pigs carrying the bacteria without any symptoms can be an important source of infection.
현재 살모넬라 감염증을 예방 및 치료하기 위해 항생제를 주로 사용하고 있으나 살모넬라는 동물에 감염 시 세포 내에 침투하여 증식하고 감염하는 경우가 많아 항생제나 약제, 기타 생균제가 침투하여 작용하기는 어려우며, 최근 많은 분야에서 항생제 내성에 대한 문제가 발생하고 있어 이에 대한 원인을 항생제 오남용으로 규명하고 항생제를 충분히 사용하지 못하게 되었다. Currently, antibiotics are mainly used to prevent and treat Salmonella infection, but when Salmonella is infected with animals, it is difficult to penetrate and act with antibiotics, drugs, and other probiotics because it is often infiltrated into cells and infects. The problem of antibiotic resistance was occurring, and the cause of this was identified as an antibiotic misuse, and antibiotics were not sufficiently used.
특히, 살모넬라는 퀴놀론계 항균제에 대하여 내성 획득이 쉬운 균주로 알려져 있어, 항생제 내성의 문제를 방지하면서도 살모넬라 균주의 숙주세포로의 부착 및 침입을 억제할 수 있는 새로운 항생제의 개발이 요구되고 있다. In particular, since Salmonella is known as a strain that is easily resistant to quinolones-based antimicrobial agents, development of a new antibiotic capable of inhibiting the adhesion and invasion of Salmonella strains to host cells is required while preventing the problem of antibiotic resistance.
이에 본 발명자들은 살모넬라 균주의 숙주세포로의 장 부착 및 침입을 억제하고, 항생제 내성을 억제할 수 있는 새로운 방법을 연구하던 중, 단독으로는 항균 효과를 나타내지 않는 저농도의 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 병용 처리한 결과, 항생제 내성 문제 발생 없이 살모넬라 균주의 장 부착 및 침입이 현저하게 억제됨을 확인함으로써 본 발명을 완성하였다.Accordingly, the inventors of the present invention were studying a new method that can inhibit the intestinal adhesion and invasion of Salmonella strains into host cells, and inhibit antibiotic resistance, while low concentrations of methyl gallate and fluoroquinolone, which alone do not exhibit antibacterial effects. The present invention was completed by confirming that the intestinal adhesion and invasion of Salmonella strains were remarkably suppressed without the occurrence of antibiotic resistance problems as a result of the combination treatment of the antimicrobial agent.
따라서 본 발명의 목적은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 장 부착 또는 침입 억제용 조성물 및 이의 용도를 제공하는 것이다.Accordingly, an object of the present invention is to provide a composition for inhibiting intestinal adhesion or invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients, and uses thereof.
상기 목적을 달성하기 위하여, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 장 부착 또는 침입 억제용 조성물을 제공한다.In order to achieve the above object, the present invention provides a composition for inhibiting intestinal adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 항생제 내성 억제용 조성물을 제공한다. In addition, the present invention provides a composition for inhibiting antibiotic resistance, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주에 의한 감염성 질병의 예방 또는 치료용 병용 제제를 제공한다.In addition, the present invention provides a combination preparation for the prevention or treatment of infectious diseases caused by Salmonella strains, comprising methyl gallate and fluoroquinolone-based antimicrobial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 사료 첨가용 조성물을 제공한다.In addition, the present invention provides a composition for feed addition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 소독용 조성물을 제공한다.In addition, the present invention provides a disinfectant composition for inhibiting adhesion or invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 세척용 조성물을 제공한다.In addition, the present invention provides a cleaning composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 방부용 조성물을 제공한다.In addition, the present invention provides a preservative composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
본 발명의 조성물은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 저농도로 포함함으로써 항생제 내성균 유발의 문제 없이 살모넬라 균주의 숙주세포로의 부착, 침입 및 세포 내 생존을 현저하게 억제하는 우수한 효과를 가지고 있다. 따라서 본 발명의 조성물은 약학적 조성물 뿐만 아니라 사료 첨가용, 소독용, 세척용 및 방부용 조성물 등 다양한 분야에서 사용될 수 있다.The composition of the present invention has an excellent effect of remarkably inhibiting the adhesion, invasion and intracellular survival of Salmonella strains to host cells without the problem of causing antibiotic-resistant bacteria by containing methyl gallate and fluoroquinolone-based antimicrobial agents at low concentrations. Therefore, the composition of the present invention can be used in various fields such as a pharmaceutical composition, as well as a composition for feed addition, disinfection, cleaning and preservation.
도 1은 메틸 갈레이트가 농도별로 세포 생존에 미치는 영향을 나타낸 도이다.
도 2는 메틸 갈레이트 및 마보플록사신의 병용 처리(MGM)가 살모넬라 균주의 숙주세포로의 부착에 미치는 영향을 나타낸 도이다.
도 3은 메틸 갈레이트 및 마보플록사신의 병용 처리(MGM)가 살모넬라 균주의 세포 내 침입에 미치는 영향을 나타낸 도이다 (좌 : Caco-2 세포, 우: Raw 264.7 세포).
도 4는 메틸 갈레이트 및 마보플록사신의 병용 처리(MGM)가 살모넬라 균주의 Raw 264.7 세포 내 생존에 미치는 영향을 나타낸 도이다.
도 5는 Caco-2 세포에 메틸 갈레이트 또는 마보플록사신를 처리한 후 공초점 현미경으로 관찰한 결과를 나타낸 도이다 (A: 비 감염 세포, B: 살모넬라 감염 후 비처리 세포, C: 살모넬라 감염 후 sub-MIC의 마보플록사신 처리 세포, D: 살모넬라 감염 후 메틸 갈레이트 (30 μg/mL) 처리 세포, E: 살모넬라 감염 후 메틸 갈레이트 (30 μg/mL) 및 sub-MIC의 마보플록사신의 병용 처리 세포)
도 6은 메틸 갈레이트 및 마보플록사신의 병용 처리(MGM)가 살모넬라 균주의 운동성에 미치는 영향을 나타낸 도이다.
도 7은 메틸 갈레이트 및 마보플록사신의 병용 처리(MGM)가 살모넬라 균주의 쿼럼 센싱 유전자의 발현에 미치는 영향을 나타낸 도이다(A: srgE 유전자, B: sdiA 유전자, C: rck 유전자).
도 8은 메틸 갈레이트 및 마보플록사신의 병용 처리(MGM)가 살모넬라 균주의 병원성 독소 유전자의 발현에 미치는 영향을 나타낸 도이다(A: rac-1 유전자, B: cheY 유전자, C: ompD 유전자, D: sipB 유전자, E: lexA 유전자).
도 9는 다양한 농도의 메틸 갈레이트 및 마보플록사신의 병용 처리가 살모넬라 균주의 Caco-2 세포 내 생존에 미치는 영향을 나타낸 도이다.1 is a diagram showing the effect of methyl gallate on cell survival by concentration.
Figure 2 is a diagram showing the effect of the combined treatment of methyl gallate and mabofloxacin (MGM) on the adhesion of Salmonella strains to host cells.
Figure 3 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the invasion of Salmonella strains into cells (left: Caco-2 cells, right: Raw 264.7 cells).
Figure 4 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the survival of Salmonella strains in Raw 264.7 cells.
5 is a diagram showing the results of observation with a confocal microscope after treatment with methyl gallate or mabofloxacin on Caco-2 cells (A: non-infected cells, B: untreated cells after Salmonella infection, C: after Salmonella infection sub-MIC mabofloxacin-treated cells, D: methyl gallate (30 μg/mL)-treated cells after Salmonella infection, E: methyl gallate (30 μg/mL) after Salmonella infection, and mabofloxacin of sub-MIC Combined treatment cells)
6 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the motility of Salmonella strains.
7 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the expression of the quorum sensing gene of Salmonella strains (A: srgE gene, B: sdiA gene, C: rck gene).
Figure 8 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the expression of pathogenic toxin genes of Salmonella strains (A: rac-1 gene, B: cheY gene, C: ompD gene, D: sipB gene, E: lexA gene).
9 is a diagram showing the effect of the combination treatment of methyl gallate and mabofloxacin at various concentrations on the survival of Salmonella strains in Caco-2 cells.
이하, 본 발명에 대해 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제용 조성물을 제공한다.The present invention provides a composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
또한, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 항생제 내성 억제용 조성물을 제공한다. In addition, the present invention provides a composition for inhibiting antibiotic resistance, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
상기 조성물은 바람직하게는 항생용 조성물이다. 상기 용어 “항생용 조성물”은 약제 형태로 개체에 제공되어 균을 사멸시킬 수 있는 제제를 의미하며, 방부제, 살균제, 항생제 및 항균제를 총칭하는 것이다. The composition is preferably an antibiotic composition. The term “antibiotic composition” refers to an agent that is provided to an individual in the form of a drug to kill bacteria, and refers to preservatives, fungicides, antibiotics and antibacterial agents.
본 발명에서, 상기 살모넬라 균주는 살모넬라 티피뮤리움(Salmonella Typhimurium), 살모넬라 콜레라수이스(Salmonella Choleraesuis), 살모넬라 엔테리티디스(Salmonella Enteritidis), 살모네랄 갈리나륨(Salmonella Gallinarum), 살모넬라 타이피(Salmonella Typhi) 및 살모넬라 플로럼(Salmonella Pullorum)으로 구성된 군으로부터 선택된 1종 이상 일 수 있으며, 바람직하게는 살모넬라 티피뮤리움(Salmonella Typhimurium)이나 이에 제한되지 않는다. In the present invention, the salmonella strain is Salmonella typhimurium (Salmonella Typhimurium), Salmonella choleraesuis could device (Salmonella Choleraesuis), Salmonella Entebbe utility disk (Salmonella Enteritidis), live Monet LAL Galina volume (Salmonella Gallinarum), Salmonella tie blood (Salmonella Typhi) and Salmonella Florum ( Salmonella Pullorum) may be one or more selected from the group consisting of, preferably Salmonella Typhimurium ( Salmonella Typhimurium), but is not limited thereto.
본 발명에 따른 메틸 갈레이트는 살모넬라 균주 자체의 생존에 영향을 미치지 않는 저농도로 조성물 내에 포함되는 것이 바람직하다. 구체적으로, 메틸 갈레이트는 10 내지 150 μg/mL의 접촉 농도로 포함될 수 있고, 더욱 바람직하게는 30 내지 120 μg/mL의 접촉 농도로 포함될 수 있다. The methyl gallate according to the present invention is preferably included in the composition at a low concentration that does not affect the survival of the Salmonella strain itself. Specifically, methyl gallate may be included at a contact concentration of 10 to 150 μg/mL, more preferably at a contact concentration of 30 to 120 μg/mL.
본 발명에 따른 플로로퀴놀론(fluoroquinolone) 계열 항균제는 마보플록사신, 다노플록사신, 디플록사신, 엔로플록사신, 오비플록사신, 사라플록사신, 시프로플록사신, 레보플록사신, 목시플록사신, 제미플록사신, 날리딕산 및 플루메퀸으로 이루어진 군으로부터 선택된 1 이상일 수 있고, 바람직하게는 마보플록사신이나 이에 제한되지 않는다. The fluoroquinolone-based antimicrobial agent according to the present invention is mabofloxacin, danofloxacin, difloxacin, enrofloxacin, obifloxacin, sarafloxacin, ciprofloxacin, levofloxacin, moxifloxacin, gemifloxacin, It may be one or more selected from the group consisting of nalidic acid and flumequine, preferably mabofloxacin, but is not limited thereto.
상기 플로로퀴놀론 계열 항균제는 항생제 내성 균주의 유발을 방지하기 위하여, 최소 저해 농도(MIC) 이하로 조성물 내에 포함되는 것이 바람직하며, 더욱 바람직하게는 sub-MIC 이하로 조성물 내에 포함될 수 있고, 상기 MIC 및 sub-MIC는 살모넬라 균주의 감수성 및 저항성 여부에 따라 달라질 수 있다. 구체적으로, 플로로퀴놀론 계열 항균제는 0.015 내지 1 μg/mL의 접촉 농도로 포함될 수 있고, 더욱 바람직하게는 0.25 내지 0.5 μg/mL의 접촉 농도로 포함될 수 있으나, 이에 제한되지 않는다. The fluoroquinolone-based antimicrobial agent is preferably contained in the composition at a minimum inhibitory concentration (MIC) or less, and more preferably sub-MIC or less in the composition, in order to prevent the induction of antibiotic-resistant strains, and the MIC And sub-MIC may vary depending on whether the Salmonella strain is susceptible and resistant. Specifically, the fluoroquinolone-based antimicrobial agent may be included at a contact concentration of 0.015 to 1 μg/mL, more preferably at a contact concentration of 0.25 to 0.5 μg/mL, but is not limited thereto.
본 발명에 따른 조성물은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 단독으로는 항균 효과를 나타내지 않는 저농도로 포함하고 있어 플로로퀴놀론 계열 항균제가 살모넬라 균주에서 항생제 내성 문제를 유발시키는 것을 방지할 수 있는바, 항생제 내성 억제를 위한 용도로 사용될 수 있다. 또한, 상기 조성물은 살모넬라 균주의 쿼럼 센싱 및 병원성 독소 유전자의 발현을 억제함으로써 살모넬라 균주의 숙주세포로의 부착, 침입 및 세포 내 생존을 현저하게 억제하는 우수한 효과를 가지고 있다. 따라서 본 발명의 조성물은 약학적 조성물 뿐만 아니라 사료 첨가용, 소독용, 세척용 및 방부용 조성물 등 다양한 분야에서 사용될 수 있다.The composition according to the present invention contains methyl gallate and a fluoroquinolone-based antimicrobial agent at a low concentration that does not exhibit an antibacterial effect alone, so that the fluoroquinolone-based antimicrobial agent can prevent the problem of antibiotic resistance in Salmonella strains. , It can be used for inhibition of antibiotic resistance. In addition, the composition has an excellent effect of remarkably inhibiting the adhesion of the Salmonella strain to host cells, invasion, and intracellular survival by inhibiting the quorum sensing of the Salmonella strain and the expression of the pathogenic toxin gene. Therefore, the composition of the present invention can be used in various fields such as a pharmaceutical composition, as well as a composition for feed addition, disinfection, cleaning and preservation.
이에, 일 양태로서 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주에 의한 감염성 질병의 예방 또는 치료용 병용 제제를 제공한다. 상기 제제는 약학적 제제일 수 있다. Accordingly, as an aspect, the present invention provides a combination preparation for preventing or treating infectious diseases caused by Salmonella strains, comprising methyl gallate and a fluoroquinolone-based antibacterial agent as active ingredients. The formulation may be a pharmaceutical formulation.
본 발명에 따른 살모넬라 균주에 의한 감염성 질병은, 예컨대 유행성 또는 급성으로 발병하는 전염성 질환으로, 살모넬라증 외에, 식중독, 위염, 장염, 폐렴, 패혈증, 돼지 콜레라 및 추백리 등이 포함된다. Infectious diseases caused by the Salmonella strain according to the present invention are, for example, epidemic or acute infectious diseases, including food poisoning, gastritis, enteritis, pneumonia, sepsis, pig cholera, and chubaekri, in addition to salmonellosis.
상기 살모넬라증은 살모넬라균 감염에 의해 발열, 두통, 설사, 구토 등을 수반하는 증상을 총칭하는 것으로, 살모넬라증은 장티푸스와 같은 증세를 나타내는 패혈증형과 식중독 증세를 나타내는 급성위장염형으로 대별되며, 장염, 식중독, 급성 균혈증 등이 포함된다.Salmonellosis is a generic term for symptoms accompanying fever, headache, diarrhea, vomiting, etc. due to Salmonella infection, and salmonellosis is broadly classified into sepsis type showing symptoms such as typhoid fever and acute gastroenteritis type showing symptoms of food poisoning, enteritis, food poisoning. , Acute bacteremia, etc.
본 발명의 용어 “예방”이란 조성물의 투여로 질병을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다.The term “prevention” of the present invention refers to any action that suppresses or delays the onset of disease by administration of the composition.
본 발명의 용어 “치료”란 조성물의 투여로 상기 질병의 증세가 호전되거나 상기 질병의 억제 또는 경감 및 이롭게 변경되는 모든 행위를 의미한다.The term "treatment" of the present invention refers to all actions in which the symptoms of the disease are improved or the disease is suppressed or alleviated and beneficially changed by the administration of the composition.
본 발명의 약학적 제제(약학적 조성물과 혼용됨)는 유효성분 외에 약학적으로 허용 가능한 담체를 추가로 포함할 수 있다.The pharmaceutical formulation of the present invention (mixed with the pharmaceutical composition) may further include a pharmaceutically acceptable carrier in addition to the active ingredient.
본 발명에서 용어, “약학적으로 허용 가능한 담체”란 생물체를 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 의미한다. 액상 용액으로 제제화되는 조성물에 있어서 허용되는 약학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로오스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. In the present invention, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions are sterilized and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as necessary.
또한 본 발명의 조성물은 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.In addition, the composition of the present invention may be formulated as an injectable formulation such as an aqueous solution, suspension, emulsion, pill, capsule, granule or tablet by additionally adding a diluent, a dispersant, a surfactant, a binder and a lubricant.
본 발명의 약학적 조성물을 포함하는 경구 투여용 제형으로는, 예를 들어 정제, 트로키제, 로렌지, 수용성 또는 유성현탁액, 조제분말 또는 과립, 에멀젼, 하드 또는 소프트 캡슐, 시럽 또는 엘릭시르제로 제제화할 수 있다. 정제 및 캡슐 등의 제형으로 제제화하기 위해, 락토오스, 사카로오스, 솔비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제, 디칼슘 포스페이트와 같은 부형제, 옥수수 전분 또는 고구마 전분과 같은 붕괴제, 스테아르산 마스네슘, 스테아르산 칼슘, 스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유를 포함할 수 있으며, 캡슐 제형의 경우 상기 언급한 물질 외에도 지방유와 같은 액체 담체를 더 함유할 수 있다.Formulations for oral administration comprising the pharmaceutical composition of the present invention may be formulated as, for example, tablets, troches, lozenges, water-soluble or oily suspensions, powders or granules, emulsions, hard or soft capsules, syrups or elixirs. I can. For formulation into tablets and capsules, etc., a binder such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, and masne stearate Lubricating oils such as calcium, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax may be included. In the case of a capsule formulation, a liquid carrier such as fatty oil may be further included in addition to the above-mentioned substances.
본 발명의 약학적 조성물을 포함하는 비경구 투여용 제형으로는, 피하주사, 정맥주사 또는 근육 내 주사 등의 주사용 형태, 좌제 주입방식 또는 호흡기를 통하여 흡입이 가능하도록 하는 에어로졸제 등 스프레이용으로 제제화할 수 있다. 주사용 제형으로 제제화하기 위해서는 본 발명의 조성물을 안정제 또는 완충제와 함께 물에서 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알의 단위 투여용으로 제제화할 수 있다. 에어로졸제 등의 스프레이용으로 제형화하는 경우, 수분산된 농축물 또는 습윤 분말이 분산되도록 추진제 등이 첨가제와 함께 배합될 수 있다.Formulations for parenteral administration containing the pharmaceutical composition of the present invention include injection forms such as subcutaneous injection, intravenous injection, or intramuscular injection, suppository injection, or spray, such as an aerosol that allows inhalation through the respiratory tract. It can be formulated. In order to formulate a formulation for injection, the composition of the present invention may be prepared as a solution or suspension by mixing in water together with a stabilizer or a buffer, and formulated for unit administration of ampoules or vials. When formulated for spraying such as an aerosol, a propellant or the like may be blended together with an additive so that the aqueous concentrated or wet powder is dispersed.
본 발명의 조성물은 살모넬라 균주에 의한 감염성 질병에 대한 예방 또는 치료 효과를 갖는 공지의 유효성분을 1종 이상 더 함유할 수 있다. The composition of the present invention may further contain one or more known active ingredients having a preventive or therapeutic effect on infectious diseases caused by Salmonella strains.
본 발명에서 용어 "투여"는 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.In the present invention, the term "administering" means providing a given composition of the present invention to a subject by any suitable method.
본 발명의 방법에서 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있으며, 구체적으로, 구강, 직장, 국소, 정맥 내, 복강 내, 근육 내, 동맥 내, 경피, 비측 내, 흡입 등을 통해 통상적인 방식으로 투여될 수 있다.In the method of the present invention, the route of administration of the composition may be administered through various routes, oral or parenteral, as long as it can reach the target tissue, and specifically, oral, rectal, topical, intravenous, intraperitoneal, intramuscular, arterial It can be administered in a conventional manner through internal, transdermal, intranasal, inhalation, and the like.
본 발명의 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 대상이 되는 동물 및 환자의 연령, 체중, 성, 질병 증상의 정도, 음식, 투여시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사나 수의사는 목적하는 치료에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다.Suitable dosages of the pharmaceutical composition of the present invention include formulation method, mode of administration, age, weight, sex, degree of disease symptoms, food, administration time, route of administration, excretion rate and response sensitivity of the subject animal and patient. It varies by factors, and usually an experienced physician or veterinarian can easily determine and prescribe an effective dosage for the desired treatment.
다른 양태로서, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 사료 첨가용 조성물을 제공한다.In another aspect, the present invention provides a composition for feed addition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
축산, 수산업에서 사용되는 사료 첨가용 항생제는 질병의 예방 목적으로 사용되고 있는데, 예방 목적의 항생제 투여는 내성균 발생 가능성을 높이고 가축에 잔류하는 항생제가 사람에게 전달될 수 있어서 문제이다. 항생제가 육류를 통해 인체에 흡수되면 항생제 내성을 유발해 질병의 확산을 부를 수도 있다. 또한, 사료에 섞어 먹이는 항생제의 종류가 많고 이는 다제 내성균 발생 확률이 높아지는 문제점이 있기 때문에 좀 더 자연 친화적이면서도 기존의 항생제의 사용에서 발생한 문제를 해결할 새로운 사료 첨가용 항생물질로서 본 발명의 상기 조성물을 이용할 수 있다.Feed-added antibiotics used in livestock and fishery industries are used for the purpose of preventing diseases, and administration of antibiotics for preventive purposes increases the likelihood of developing resistant bacteria and is a problem because antibiotics remaining in livestock can be delivered to humans. When antibiotics are absorbed into the body through meat, they can cause antibiotic resistance, which can lead to the spread of disease. In addition, since there are many kinds of antibiotics mixed with feed and this has a problem of increasing the probability of multidrug resistant bacteria, the composition of the present invention is used as a new feed additive antibiotic that is more natural friendly and solves the problem arising from the use of existing antibiotics. Can be used.
또한, 본 발명은 상기 사료 첨가용 조성물을 포함하는 사료를 제공할 수 있으며, 본 발명의 유효성분인 메틸 갈레이트 및 플로로퀴놀론 계열 항균제는 사료 첨가제 형태로 따로 제조하여 사료에 혼합시키거나, 사료 제조 시 직접 유효성분을 첨가시켜 제조할 수 있다. 본 발명의 사료 내 유효성분은 액상 또는 건조상태일 수 있으며, 바람직하게는 건조된 분말형태이다. 건조방법은 통풍건조, 자연건조, 분무건조 및 동결건조가 가능하지만, 이에 제한되는 것은 아니다. 본 발명의 유효성분은 분말형태로 사료 중량의 0.05 내지 10 중량%, 바람직하게는 0.1 내지 2 중량%의 성분비로 혼합될 수 있다. 또한, 상기 사료는 본 발명의 유효성분 외에 사료의 보존성을 높일 수 있는 통상의 첨가제들을 추가로 포함할 수 있다.In addition, the present invention may provide a feed comprising the composition for feed addition, and the active ingredients of the present invention, methyl gallate and fluoroquinolone-based antibacterial agents are separately prepared in the form of feed additives and mixed with feed or feed It can be prepared by directly adding the active ingredient during manufacture. The active ingredient in the feed of the present invention may be in a liquid or dry state, preferably in a dry powder form. The drying method may be ventilated drying, natural drying, spray drying, and freeze drying, but is not limited thereto. The active ingredient of the present invention may be mixed in a powder form in an ingredient ratio of 0.05 to 10% by weight, preferably 0.1 to 2% by weight of the feed weight. In addition, the feed may further include conventional additives that can increase the preservability of the feed in addition to the active ingredient of the present invention.
본 발명의 사료 첨가용 조성물에는 비병원성의 다른 미생물이 추가로 첨가될 수 있다. 첨가될 수 있는 미생물로는 단백질 분해 효소, 지질 분해 효소 및 당 전환 효소를 생산할 수 있는 바실러스 서브틸리스(Bacillus subtilis)와 같은 고초균, 소의 위와 같은 혐기적 조건에서 생리적 활성 및 유기물 분해능이 있는 락토바실러스 균주(Lactobacillus sp.), 가축의 체중을 증가시키며 우유의 산유량을 늘리고 사료의 소화 흡수율을 높이는 효과를 보여주는 아스퍼질러스 오리자에(Aspergillus oryzae)와 같은 사상균 및 사카로미세스 세레비지에(Saccharomyces cerevisiae)와 같은 효모로 구성된 군으로부터 선택될 수 있다.Other non-pathogenic microorganisms may be additionally added to the composition for feed addition of the present invention. Microorganisms that can be added include Bacillus subtilis , which can produce proteolytic enzymes, lipolytic enzymes, and sugar converting enzymes, and Lactobacillus, which has physiological activity and ability to degrade organic matter under anaerobic conditions such as the stomach of cattle. Strain ( Lactobacillus sp.), filamentous fungi such as Aspergillus oryzae and Saccharomyces cerevisiae showing the effect of increasing the weight of livestock, increasing milk production and increasing the digestion and absorption rate of feed. ) May be selected from the group consisting of yeast.
본 발명의 사료에는 식물성으로는 곡물류, 근과류, 식품가공 부산물류, 조류, 섬유질류, 제약 부산물류, 유지류, 전분류, 박류, 곡물부산물류 등이 있으며, 동물성으로는 단백질류, 무기물류, 유지류, 광물성류, 단세포 단백질, 동물성 플랑크톤류, 남은 음식물 등이 있으며 이에 제한되는 것은 아니다.The feed of the present invention includes cereals, root fruits, food processing by-products, algae, fiber, pharmaceutical by-products, oils and fats, starches, meals, grain by-products, etc. as vegetable, and protein, inorganic logistics as animal , Oils and fats, minerals, single cell proteins, zooplanktons, food leftovers, etc., but are not limited thereto.
본 발명의 사료 첨가용 조성물에는 품질 저하를 방지하기 위하여 첨가하는 결착제, 유화제, 보존제 등이 포함될 수 있고, 효용 증대를 위하여 사료에 첨가하는 아미노산제, 비타민제, 효소제, 생균제, 향미제, 비단백태질소화합물, 규산염제, 완충제, 착색제, 추출제, 올리고당 등이 포함될 수 있으며, 그 외에도 사료 혼합제 등을 추가로 포함할 수 있다.The composition for feed addition of the present invention may contain binders, emulsifiers, preservatives, etc. added to prevent quality deterioration, and amino acids, vitamins, enzymes, probiotics, flavoring agents, non-proteinaceous agents added to the feed to increase utility Nitrogen compounds, silicates, buffers, colorants, extractants, oligosaccharides, etc. may be included, and in addition, feed mixing agents may be additionally included.
또 다른 양태로서, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 식품 첨가용 조성물 또는 음용수 첨가제를 제공한다.In another aspect, the present invention provides a food additive composition or a drinking water additive for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and a fluoroquinolone-based antibacterial agent as active ingredients.
본 발명의 식품 첨가용 조성물은 상기 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 포함하는 조성물을 그대로 첨가하거나 다른 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합양은 그의 사용 목적에 따라 적절하게 결정될 수 있다. 일반적으로, 본 발명의 메틸 갈레이트 및 플로로퀴놀론 계열 항균제는 원료에 대하여 15 중량부 이하, 바람직하게는 10 중량부 이하의 양으로 첨가된다. The composition for food addition of the present invention may be added as it is to the composition containing the methyl gallate and fluoroquinolone-based antimicrobial agent, or may be used together with other food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use. In general, the methyl gallate and fluoroquinolone-based antimicrobial agents of the present invention are added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on the raw material.
본 발명의 음용수 첨가제는 상기 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 포함하는 조성물을 음용수 첨가제 형태로 따로 제조하여 음용수에 혼합하는 방식으로 사용되거나, 음용수 제조 시 직접 첨가하는 방식으로 사용할 수 있다. 상기와 같이 음용수에 혼합하여 공급함으로써 지속적으로 살모넬라 균주의 숙주세포로의 부착 및 침입을 감소시킬 수 있는 효과가 있다.The drinking water additive of the present invention may be used in a manner in which a composition containing the methyl gallate and fluoroquinolone-based antimicrobial agent is separately prepared in the form of a drinking water additive and mixed with drinking water, or directly added when preparing drinking water. By mixing and supplying the drinking water as described above, there is an effect of continuously reducing the adhesion and invasion of Salmonella strains to host cells.
본 발명에서 음용수는 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용되는 음용수를 사용할 수 있다.In the present invention, drinking water is not particularly limited, and drinking water commonly used in the art may be used.
또 다른 양태로서, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 소독용 조성물을 제공한다.In another aspect, the present invention provides a disinfectant composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and a fluoroquinolone-based antibacterial agent as active ingredients.
살모넬라 균주의 숙주세포로의 부착 및 침입 억제 효과가 우수한 본 발명에 따른 소독용 조성물은 병원감염을 막기 위한 병원 및 보건용의 소독제로 유용하게 사용될 수 있고 일반 생활 소독제, 식품 및 조리 장소 및 설비의 소독제, 양계장, 축사 등의 건물, 축체, 음수, 깔짚, 난좌, 운반차량, 식기 등의 각종 생육 용품의 소독 등에 사용될 수 있다.The disinfectant composition according to the present invention, which has excellent effect of inhibiting the adhesion and invasion of Salmonella strains to host cells, can be usefully used as a disinfectant for hospitals and health care to prevent hospital infection. It can be used for disinfection of various growth products such as disinfectants, poultry farms, buildings such as barns, livestock, drinking water, litter, nangja, transport vehicles, and tableware.
또 다른 양태로서, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 세척용 조성물을 제공한다.In another aspect, the present invention provides a cleaning composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
본 발명의 메틸 갈레이트 및 플로로퀴놀론 계열 항균제는 살모넬라 균주의 숙주세포로의 부착 및 침입을 억제하는 효과를 가지므로, 상기 살모넬라 균주에 노출되었거나 노출될 가능성이 있는 가축의 피부 표면 또는 신체 각 부위 등을 세척하는 용도로도 사용될 수 있다.Since the methyl gallate and fluoroquinolone-based antimicrobial agents of the present invention have the effect of inhibiting the adhesion and invasion of the Salmonella strain into the host cell, the skin surface or each part of the body of livestock exposed to or likely to be exposed to the Salmonella strain It can also be used for washing the back.
또 다른 양태로서, 본 발명은 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 유효성분으로 포함하는, 살모넬라 균주의 부착 또는 침입 억제를 위한 방부용 조성물을 제공한다.In another aspect, the present invention provides a preservative composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.
상기 방부용 조성물에는 식품의 방부제, 화장품 보존제 또는 의약품 보존제 등이 있다. 상기 식품의 방부제, 화장품 보존제 및 의약품 보존제는 의약품의 변질, 부패, 변색 및 화학변화를 방지하기 위해 사용되는 첨가물로서 살균제, 산화방지제가 이에 포함되며 세균, 곰팡이, 효모 등 미생물의 증식을 억제하여 식품 및 의약품에서 부패미생물의 발육저지 또는 살균작용을 하는 등의 기능성 항생제도 포함된다. 이러한 방부 조성물의 이상적인 조건으로는 독성이 없어야 하며, 미량으로도 효과가 있어야 한다.The preservative composition may include food preservatives, cosmetic preservatives or pharmaceutical preservatives. The food preservatives, cosmetic preservatives and pharmaceutical preservatives are additives used to prevent deterioration, spoilage, discoloration, and chemical change of pharmaceuticals. These include fungicides and antioxidants, and inhibit the growth of microorganisms such as bacteria, mold, and yeast. And functional antibiotics such as inhibiting the growth of decaying microorganisms or sterilizing in pharmaceuticals are also included. Ideal conditions for such an antiseptic composition should be non-toxic and should be effective even in trace amounts.
또한, 본 발명의 조성물은 의약외품의 유효성분으로 사용될 수 있다. 본 발명의 의약외품 조성물은 이에 제한되지는 않으나, 바람직하게는 소독청결제, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제, 패치, 또는 필터 충진제일 수 있다.In addition, the composition of the present invention can be used as an active ingredient in quasi-drugs. The quasi-drug composition of the present invention is not limited thereto, but preferably, it may be a disinfectant cleaner, a shower foam, a gagrin, a wet tissue, a detergent soap, a hand wash, a humidifier filler, a mask, an ointment, a patch, or a filter filler.
본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.Terms not otherwise defined in the specification have the meanings commonly used in the art to which the present invention belongs.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.
준비예Preparation example 1. 실험 물질의 준비 1. Preparation of test material
메틸 갈레이트, 마보플록사신 및 이하 실험에 이용된 화합물 및 키트는 별다른 기재가 없는 한 시그마 사((Sigma,St. Louis, MO, USA)에서 구매하였다. Methyl gallate, mabofloxacin, and compounds and kits used in the following experiments were purchased from Sigma (Sigma, St. Louis, MO, USA) unless otherwise specified.
준비예Preparation example 2. 살모넬라 균주 및 세포의 배양 2. Culture of Salmonella strains and cells
모든 살모넬라 균주는 LB(Luria-Bertani) 배지(Difco, BD, USA)에서 배양하였다. 마우스 대식 세포인 RAW 264.7 세포는 10% FBS(fetal bovine serum) 및 1% 페니실린/스트렙토마이신(P/S)을 포함하는 RPMI 1640 배지에서 배양하였고, 인간 대장 상피 세포주인 Caco-2 세포는 1% 비-필수 아미노산, 20% FBS 및 1% P/S를 포함하는 MEM(minimum essential medium) 배지(Gibco, USA)에서 배양하였다. 모든 세포 배양은 37℃, 5% CO2 조건에서 이루어졌다. All Salmonella strains were cultured in LB (Luria-Bertani) medium (Difco, BD, USA). Mouse macrophage RAW 264.7 cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S), and Caco-2 cells, a human colon epithelial cell line, were 1%. It was cultured in MEM (minimum essential medium) medium (Gibco, USA) containing non-essential amino acids, 20% FBS and 1% P/S. All cell cultures were performed at 37°C and 5% CO 2 conditions.
실시예Example 1. One. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 처리 농도 선정 Treatment concentration selection
1-1. 메틸 갈레이트 농도 선정 1-1. Selection of methyl gallate concentration
메틸 갈레이트(MG)가 포유류 세포의 세포 독성에 미치는 영향을 확인하고, 이의 처리 농도를 결정하기 위하여, RAW 264.7 세포를 이용하였다. 먼저, RAW 264.7 세포를 96 웰 플레이트에 105 cells/mL의 농도로 시딩한 후 24시간 동안 배양하였다. 배지를 제거하고 다양한 농도의 MG를 포함하는 새로운 배지를 첨가한 후, 밤새 배양하였다. 배지를 0.45 mg/mL의 MTT를 포함하는 배지로 교체하고 4시간 동안 배양 한 후, DMSO를 첨가하고 VersaMax (molecular devices, USA)를 이용하여 570 nm에서 흡광도를 측정하였다. 하기 계산식을 이용하여 세포 생존율을 계산하였으며 그 결과를 도 1에 나타내었다. To confirm the effect of methyl gallate (MG) on the cytotoxicity of mammalian cells, and to determine the treatment concentration thereof, RAW 264.7 cells were used. First, RAW 264.7 cells were seeded in a 96-well plate at a concentration of 10 5 cells/mL and cultured for 24 hours. The medium was removed and a new medium containing various concentrations of MG was added, followed by incubation overnight. The medium was replaced with a medium containing 0.45 mg/mL of MTT, incubated for 4 hours, DMSO was added, and absorbance was measured at 570 nm using VersaMax (molecular devices, USA). Cell viability was calculated using the following calculation formula, and the results are shown in FIG. 1.
생존율= Survival rate=
도 1에 나타낸 바와 같이, MG는 2 mg/mL의 고농도에서는 약 9.5% 세포 생존율을 감소시켰으며, 약 30 μg/mL 이하의 농도에서는 세포 생존율에 큰 영향을 미치지 않음을 확인하였다. As shown in FIG. 1, it was confirmed that MG reduced the cell viability by about 9.5% at a high concentration of 2 mg/mL, and did not significantly affect the cell viability at a concentration of about 30 μg/mL or less.
또한, 추가적으로 3 가지의 살모넬라 균주(돼지 감염증 모델에서 분리한 2개의 필드 균주 및 ATCC 14028 균주)에 대해 메틸 갈레이트의 MIC 값을 계산한 결과, 500 μg/mL임을 확인하였으며, 125 μg/mL 접촉 농도 이하에서는 박테리아 생존 억제 활성을 나타내지 않음을 확인하였다. 따라서 이후 실험에서는 항균 활성을 전혀 나타내지 않는 농도인 30 μg/mL 접촉 농도의 메틸 갈레이트를 이용하였다. In addition, as a result of calculating the MIC value of methyl gallate for three additional Salmonella strains (two field strains isolated from the swine infectious disease model and
1-2. 마보플록사신의 농도 선정1-2. Selection of the concentration of mabofloxacin
플로로퀴놀론 계열의 항균제 중 하나인 마보플록사신의 농도를 선정하기 위하여, 최소 저해 농도(MIC) 이하 농도 (sub-MIC)를 이전에 공지된 문헌을 통해 확인하였다. 마보플록사신은 감수성 균주에 대해서는 0.03 μg/mL, 저항성 균주에 대해서는 0.5 μg/mL의 MIC를 나타내며, 이후 실험에서는 MIC의 1/2 농도인 sub-MIC 농도의 마보플록사신을 이용하였다. In order to select the concentration of mabofloxacin, one of the antimicrobial agents of the fluoroquinolone family, the concentration below the minimum inhibitory concentration (MIC) (sub-MIC) was confirmed through previously known literature. Mabofloxacin showed a MIC of 0.03 μg/mL for susceptible strains and 0.5 μg/mL for resistant strains, and in subsequent experiments, mabofloxacin at a sub-MIC concentration, which is 1/2 of the MIC, was used.
실시예Example 2. 2. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 병용 처리가 살모넬라 균주의 세포 부착에 미치는 영향 분석 Analysis of the effect of combined treatment on cell adhesion of Salmonella strains
세포 부착(adhesion)에 미치는 영향을 확인하기 위하여, sub-MIC (감수성 균주에 대해서는 0.015 μg/mL, 저항성 균주에 대해서는 0.25 μg/mL) 접촉 농도의 마보플록사신(MAR) 및 30 μg/mL의 메틸 갈레이트 (MG)를 완전하게 자란 Caco-2 세포에 처리한 후, 30분간 배양하였다. 비교를 위해, 마보플록사신 또는 메틸 갈레이트를 동일한 방법으로 단독 처리하였다. 상기 세포에 살모넬라 티피뮤리움(107 CFU/mL) 균주를 첨가한 후, 5분 동안 500g에서 원심분리하고 다시 45분 동안 배양하였다. 세포를 0.1% Triton® x-100로 10분 동안 녹였다. 마지막으로 용액을 연속 희석하고, 밤새 LB 아가 플레이트에서 배양하여 세포에 부착된 박테리아 수를 계수하였다. 그 결과를 도 2에 나타내었다. 이하의 도면에서, cell은 아무것도 처리하지 않은 음성대조군, Salmonella는 살모넬라 균주만을 접종한 군, sub-MIC는 sub-MIC 농도의 마보플록사신 단독, MIC는 MIC 농도의 마보플록사신 단독, MG-30은 30 μg/mL의 메틸 갈레이트 단독, MGM은 sub-MIC 농도의 마보플록사신 및 30 μg/mL의 메틸 갈레이트 병용 처리군을 의미한다. To confirm the effect on cell adhesion, sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of Mabofloxacin (MAR) and 30 μg/mL After treating completely grown Caco-2 cells with methyl gallate (MG), they were incubated for 30 minutes. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. After adding Salmonella typhimurium (10 7 CFU/mL) strain to the cells, centrifugation was performed at 500 g for 5 minutes, followed by incubation for 45 minutes. Cells were dissolved in 0.1% Triton® x-100 for 10 minutes. Finally, the solution was serially diluted and incubated on an LB agar plate overnight to count the number of bacteria attached to the cells. The results are shown in FIG. 2. In the following figure, the cell is a negative control without any treatment, Salmonella is a group inoculated with only Salmonella strain, sub-MIC is a sub-MIC concentration of mabofloxacin alone, MIC is a MIC concentration of mabofloxacin alone, MG-30 Silver means 30 μg/mL of methyl gallate alone, and MGM means a sub-MIC concentration of mabofloxacin and 30 μg/mL of methyl gallate.
도 2에 나타낸 바와 같이, 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)이 살모넬라 균주의 숙주세포로의 부착을 현저하게 억제함을 확인하였다. As shown in FIG. 2, it was confirmed that the combined treatment group (MGM) of mabofloxacin and methyl gallate significantly inhibited the adhesion of Salmonella strains to host cells, compared to mabofloxacin or methyl gallate alone.
실시예Example 3. 3. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 병용 처리가 살모넬라 균주의 세포 내 침입에 미치는 영향 분석 Analysis of the effect of combined treatment on intracellular invasion of Salmonella strains
세포 내 침입(invasion)에 미치는 영향을 확인하기 위하여, 기존에 공지된 겐타마이신 보호 어쎄이를 변형시켜 수행하였다. 먼저, sub-MIC (감수성 균주에 대해서는 0.015 μg/mL, 저항성 균주에 대해서는 0.25 μg/mL) 접촉 농도의 마보플록사신(MAR) 및 30 μg/mL의 메틸 갈레이트 (MG)를 완전하게 자란 Caco-2 또는 Raw 264.7 세포에 혼합 처리한 후, 30분간 배양하였다. 비교를 위해, 마보플록사신 또는 메틸 갈레이트를 동일한 방법으로 단독 처리하였다. 상기 세포에 살모넬라 티피뮤리움(107 CFU/mL) 균주를 첨가한 후, 5분 동안 500g에서 원심분리하고 다시 45분 동안 배양하였다. 여기에 겐타마이신(100 μg/mL)을 첨가한 후 30분 간 배양하고, 세포를 0.1% Triton® x-100로 10분 동안 녹였다. 마지막으로 용액을 연속 희석하고, 밤새 LB 아가 플레이트에서 배양하여 세포 내 박테리아 수를 계수하였다. 그 결과를 도 3에 나타내었다. In order to confirm the effect on intracellular invasion, it was performed by modifying the previously known gentamicin protection assay. First, the sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of Mabofloxacin (MAR) and 30 μg/mL of methyl gallate (MG) were fully grown Caco. After mixing treatment with -2 or Raw 264.7 cells, they were cultured for 30 minutes. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. After adding Salmonella typhimurium (10 7 CFU/mL) strain to the cells, centrifugation was performed at 500 g for 5 minutes, followed by incubation for 45 minutes. Gentamicin (100 μg/mL) was added thereto, followed by incubation for 30 minutes, and the cells were dissolved in 0.1% Triton® x-100 for 10 minutes. Finally, the solution was serially diluted and incubated on LB agar plates overnight to count the number of bacteria in the cells. The results are shown in FIG. 3.
도 3에 나타낸 바와 같이, Caco-2 또는 Raw 264.7 세포 모두에서 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)이 살모넬라 균주의 숙주세포로의 침입을 현저하게 억제함을 확인하였다. As shown in FIG. 3, compared to mabofloxacin or methyl gallate alone in both Caco-2 or Raw 264.7 cells, the combined treatment group (MGM) of mabofloxacin and methyl gallate invaded the host cells of Salmonella strains. It was confirmed that significantly suppressed.
실시예Example 4. 4. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 병용 처리가 살모넬라 균주의 세포 내 생존에 미치는 영향 분석 Analysis of the effect of combined treatment on intracellular survival of Salmonella strains
세포 내 생존에 미치는 영향을 확인하기 위하여, 다음과 같은 실험을 수행하였다. 먼저, RAW 264.7 세포 (105 cells/mL)를 24 웰 플레이트에서 성장시켰으며, 상기 세포에 살모넬라 티피뮤리움(107 CFU/mL) 균주를 첨가한 후, 5분 동안 500g에서 원심분리하고 다시 45분 동안 배양하였다. 세포를 세척한 후, sub-MIC (감수성 균주에 대해서는 0.015 μg/mL, 저항성 균주에 대해서는 0.25 μg/mL) 접촉 농도의 마보플록사신(MAR) 및 30 μg/mL의 메틸 갈레이트 (MG)를 첨가하고 37℃, 5% CO2에서 1시간 동안 배양하였다. 비교를 위해, 마보플록사신 또는 메틸 갈레이트를 동일한 방법으로 단독 처리하였다. 상기 세포에 겐타마이신(100 μg/mL)을 첨가한 후 1시간 동안 추가 배양하고, 0.1% Triton® x-100로 녹였다. 마지막으로 용액을 연속 희석하고, LB 아가 플레이트에서 배양한 후 박테리아 수를 계수하였다. 그 결과를 도 4에 나타내었다.In order to confirm the effect on intracellular survival, the following experiment was performed. First, RAW 264.7 cells (10 5 cells/mL) were grown in a 24-well plate, and Salmonella typhimurium (10 7 CFU/mL) strain was added to the cells, followed by centrifugation at 500 g for 5 minutes and again. Incubate for 45 minutes. After washing the cells, sub-MIC (0.015 μg/mL for sensitive strains, 0.25 μg/mL for resistant strains) contact concentrations of mabofloxacin (MAR) and 30 μg/mL of methyl gallate (MG) were added. And incubated at 37° C., 5% CO 2 for 1 hour. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. Gentamicin (100 μg/mL) was added to the cells, followed by additional culture for 1 hour, and dissolved with 0.1% Triton® x-100. Finally, the solution was serially diluted, and the number of bacteria was counted after incubation on an LB agar plate. The results are shown in FIG. 4.
도 4에 나타낸 바와 같이, 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)에서 살모넬라 균주의 숙주 세포 내 생존이 현저하게 감소함(약 74% 감소)을 확인하였다. As shown in FIG. 4, compared to mabofloxacin or methyl gallate alone, the survival of Salmonella strains in host cells in the combined treatment group (MGM) of mabofloxacin and methyl gallate significantly decreased (about 74% reduction) ) Was confirmed.
추가적으로, 세포 내 살모넬라 티피뮤리움의 침입 및 살아있는 정도를 시각적으로 확인하기 위하여, 공초점 현미경으로 관찰하였다. 이를 위해, Caco-2 세포(105 cells/mL)를 24 웰 플레이트에서 성장시켰으며, 상기와 동일한 방법으로 물질을 처리하였다. 물질이 처리된 세포를 1 mM MgCl2를 포함하는 pH 7.2의 0.1 M MOPS(3-(N-morpholino) propanesulfonic acid)로 세정하고, 세정 용액을 흡입한 후, 5 μM SYTO9, 30 μM PI(propidium iodide, Invitrogen, USA), 및 MOPS/MgCl2 내의 0.1% 사포닌을 포함하는 0.5 mL Live/Dead 염색 완충액을 첨가하였다. 세포를 15분간 암실 및 상온에서 배양한 후, MOPS/MgCl2로 세정하였다. Carl Zeiss (LSM700) 공초점 현미경을 사용하여 30분 이내에 이미지를 수득하였다. 그 결과를 도 5에 나타내었다. Additionally, in order to visually confirm the degree of invasion and viability of Salmonella typhimurium in the cells, it was observed with a confocal microscope. To this end, Caco-2 cells (10 5 cells/mL) were grown in a 24-well plate, and the material was treated in the same manner as above. The cells treated with the substance were washed with 0.1 M MOPS (3-(N-morpholino) propanesulfonic acid) at pH 7.2 containing 1 mM MgCl 2 , and the washing solution was aspirated, and then 5 μM SYTO9, 30 μM PI (propidium). iodide, Invitrogen, USA), and 0.5 mL Live/Dead staining buffer containing 0.1% saponin in MOPS/MgCl 2 were added. The cells were cultured in the dark and at room temperature for 15 minutes, and then washed with MOPS/MgCl 2 . Images were obtained within 30 minutes using a Carl Zeiss (LSM700) confocal microscope. The results are shown in FIG. 5.
도 5에 나타낸 바와 같이, 세포 내 박테리아를 SYTO-9 및 PI로 각각 염색하여 살아있는 박테리아와 죽은 박테리아의 존재 여부를 관찰한 결과, 숙주세포 내 살아있는 침입 박테리아(살모넬라 균주)의 수가 마보플록사신 및 메틸 갈레이트의 병용 처리에 의해 현저하게 감소하였음을 확인하였다. As shown in Figure 5, as a result of observing the presence or absence of live and dead bacteria by staining the intracellular bacteria with SYTO-9 and PI, respectively, the number of live invading bacteria (Salmonella strain) in the host cell is mabofloxacin and methyl It was confirmed that it was significantly reduced by the combined treatment of gallate.
실시예Example 5. 5. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 병용 처리가 살모넬라 균주의 운동성에 미치는 영향 분석 Analysis of the effect of combined treatment on the motility of Salmonella strains
0.3% (W/V) 아가를 포함하는 LB 배지를 이용하여 살모넬라 균주의 운동성을 확인하였다. 먼저, 살모넬라 티피뮤리움의 8시간 배양액 5 μL을 sub-MIC (감수성 균주에 대해서는 0.015 μg/mL, 저항성 균주에 대해서는 0.25 μg/mL) 접촉 농도의 마보플록사신(MAR) 및 30 μg/mL의 메틸 갈레이트 (MG)를 포함하는 배지에 접종한 후, 37℃에서 12시간 동안 배양하였다. 비교를 위해, 마보플록사신 또는 메틸 갈레이트를 동일한 방법으로 단독 처리하였다. 캘리퍼스를 이용하여 배지네 박테리아의 직경을 측정하였다. 그 결과를 도 6에 나타내었다. The motility of the Salmonella strain was confirmed using an LB medium containing 0.3% (W/V) agar. First, 5 μL of the 8-hour culture solution of Salmonella typhimurium was added to sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of Mabofloxacin (MAR) and 30 μg/mL. After inoculation in a medium containing methyl gallate (MG), it was incubated at 37°C for 12 hours. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. The diameter of the bacteria in the medium was measured using a caliper. The results are shown in FIG. 6.
도 6에 나타낸 바와 같이, 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)에서 살모넬라 균주의 운동성이 현저하게 감소함(직경의 크기가 현저하게 작아짐)을 확인하였다. As shown in Fig.6, compared to mabofloxacin or methyl gallate alone, the motility of Salmonella strains in the combined treatment group (MGM) of mabofloxacin and methyl gallate significantly decreased (the size of the diameter is significantly reduced. ) Was confirmed.
실시예Example 6. 6. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 병용 처리가 살모넬라 균주의 유전자 발현에 미치는 영향 분석 Analysis of the effect of combination treatment on gene expression of Salmonella strains
살모넬라 티피뮤리움의 QS(quorum sensing) 및 침입 관련 유전자의 발현에 미치는 영향을 확인하기 위하여, AHL(N-acyl homoserine lactone, 1 μmol/mL)을 살모넬라 티피뮤리움 (107 CFU/mL) 균주를 포함하는 LB 배지에 첨가하고, sub-MIC (감수성 균주에 대해서는 0.015 μg/mL, 저항성 균주에 대해서는 0.25 μg/mL) 접촉 농도의 마보플록사신(MAR) 및 30 μg/mL의 메틸 갈레이트(MG)를 처리한 후, 8시간 동안 배양하였다. 비교를 위해, 마보플록사신 또는 메틸 갈레이트를 동일한 방법으로 단독 처리하였으며, 양성대조군으로는 푸라논(Furanone, 10 μg/mL)을 이용하였다. 박테리아 혼합물을 원심분리한 후, 분리된 펠렛을 RNA 추출을 위해 처리하였다. 총 RNA는 Trizol® (Ambion®, Life Technologies, USA) 시약을 사용하여 제조사의 지침에 따라 수득하였다. RNA 순도 및 농도는 나노 드랍법에 따라 측정하였다. qRT-PCR(quantitative reverse transcription-PCR) 프리믹스를 이용하여 cDNA를 합성하였으며, IQ™ SYBR® Green supermix를 이용한 CFX96 Touch™ real-time PCR detection system (Biorad, USA)으로 RNA의 발현양을 측정하였다. 정규화를 위해 하우스킵핑 유전자로서 살모넬라 티피뮤리움의 경우 rrsG을, 숙주세포의 경우 β-액틴을 이용하였다. qRT-PCR을 통해 QS 관련 유전자인 srgE 및 sdiA, 그리고 침입 관련 유전자인 rck의 유전자 발현량을 측정하였다. 구체적으로, 95 ℃에서 30 초간 변성한 후, 95 ℃에서 5초, 60 ℃에서 30초, 및 95 ℃에서 15초간의 반응을 40 사이클 반복하고, 60 ℃에서 30초간 반응시켰다. 이때 이용된 프라이머 서열을 표 1에 나타내었으며, 실험 결과를 도 7에 나타내었다. To confirm the effect of Salmonella typhimurium on QS (quorum sensing) and the expression of invasion-related genes, AHL (N-acyl homoserine lactone, 1 μmol/mL) was added to Salmonella typhimurium (10 7 CFU/mL) strain. Add to the LB medium containing, sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of mabofloxacin (MAR) and 30 μg/mL methyl gallate ( MG) was treated and incubated for 8 hours. For comparison, mabofloxacin or methyl gallate was treated alone by the same method, and furanone (10 μg/mL) was used as a positive control. After centrifuging the bacterial mixture, the separated pellet was processed for RNA extraction. Total RNA was obtained using Trizol® (Ambion®, Life Technologies, USA) reagent according to the manufacturer's instructions. RNA purity and concentration were measured according to the nano drop method. cDNA was synthesized using qRT-PCR (quantitative reverse transcription-PCR) premix, and the amount of RNA expression was measured using a CFX96 Touch™ real-time PCR detection system (Biorad, USA) using an IQ™ SYBR® Green supermix. For normalization, rrsG was used for Salmonella typhimurium and β-actin was used for host cells as housekeeping genes. Through qRT-PCR, the expression levels of the QS-related genes srgE and sdiA, and the invasion-related genes rck were measured. Specifically, after denaturing at 95°C for 30 seconds, reactions for 5 seconds at 95°C, 30 seconds at 60°C, and 15 seconds at 95°C were repeated for 40 cycles, followed by reaction at 60°C for 30 seconds. The primer sequences used at this time are shown in Table 1, and the experimental results are shown in FIG. 7.
5′- GGCAGATTGTTCATGATTGC-3′5′- GCGCAGGTTGGTATTACTTG-3′
5′- GGCAGATTGTTCATGATTGC-3
5' - AACTGCTACGGGAGAACGAT-3′5′- TTACATTGGGATGACGTGCT-3′
5'-AACTGCTACGGGAGAACGAT-3'
5′-ATATGCCCAGAGCCGGATAGAG-3′5′-GTTGTATCCCGGCATGCTGAT-3′
5′-ATATGCCCAGAGCCGGATAGAG-3
5′- CACATCCGACTTGACAGACC 3′5′-GTTACCCGCAGAAGAAGCAC-3′
5′-
5′- GCACCGTGTTGGCGTAGAGG -3′5′- GGACTTCGAGCAGGAGATGG -3′
5′- GCACCGTGTTGGCGTAGAGG -3′
도 7에 나타낸 바와 같이, AHL 처리에 의해 증가한 QS 관련 유전자인 srgE 및 sdiA의 유전자 발현이 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)에서 현저하게 감소함을 확인하였다. 또한, 지퍼 메커니즘을 통해 숙주 세포로의 침입에 중요한 역할을 한다고 알려진 rck의 유전자 발현 역시 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)에서 현저하게 감소하였다. As shown in Figure 7, the gene expression of srgE and sdiA, which are QS-related genes increased by AHL treatment, was remarkable in the combined treatment group (MGM) of mabofloxacin and methyl gallate compared to mabofloxacin or methyl gallate alone. It was confirmed that it decreased significantly. In addition, the gene expression of rck, which is known to play an important role in invasion into host cells through a zipper mechanism, is also markedly in the combined treatment group (MGM) of mabofloxacin and methyl gallate compared to mabofloxacin or methyl gallate alone. Decreased.
추가적으로 상피세포에서 살모넬라의 침입은 rac-1의 과발현에 의해 촉진된다고 알려져있어, rac-1 유전자의 발현에 미치는 영향을 확인하였으며, 침입과 부착에 필수적인 살모넬라 균주의 병원성 독소 유전자인 cheY, ompD, sipB, 및 lexA 유전자의 발현에 미치는 영향을 qRT-PCR을 통해 확인하였다. 이때 이용된 프라이머 서열을 표 2에 나타내었으며, 실험 결과를 도 8에 나타내었다. In addition, it is known that Salmonella invasion in epithelial cells is promoted by overexpression of rac-1, so the effect on the expression of the rac-1 gene was confirmed. , And the effect on the expression of the lexA gene was confirmed through qRT-PCR. The primer sequences used at this time are shown in Table 2, and the experimental results are shown in FIG. 8.
5′-AGTAGGGATATATTCTCCAGGAAATGC-3′5′-CCTGATGCAGGCCATCAAG-3′
5′-AGTAGGGATATATTCTCCAGGAAATGC-3
5′-GACCATCAACACGGGTAACG-3′5′-TTATCTCCGACTGGAACATGC-3′
5′-GACCATCAACACGGGTAACG-3
5′-GCCAAAGAAGTCAGTGTTACGGT-3′5′-GCAACCGTACTGAAAGCCAGGG-3′
5′-GCCAAAGAAGTCAGTGTTACGGT-3
5′-CCCGTCGCCGCCTTCAC-3′5′-ACGCGCAAAGCCGAGGAAAC-3′
5′-CCCGTCGCCGCCTTCAC-3
5′-TATGTACCGCCAGCAAATCC-3′5′-TCGCGAGGTATCCGTCTG-3′
5′-TATGTACCGCCAGCAAATCC-3′
도 8에 나타낸 바와 같이, 살모넬라 균주를 접종한 대조군(Contol)에서의 Rac-1, cheY, ompD, sipB 및 lexA 유전자 발현을 기준으로 하였을 때, 마보플록사신 또는 메틸 갈레이트 단독에 비해, 마보플록사신 및 메틸 갈레이트의 병용 처리군(MGM)에서 상기 병원성 독소 유전자의 발현이 현저하게 감소함을 확인하였다.As shown in Figure 8, when based on the expression of Rac-1, cheY, ompD, sipB and lexA genes in the control group (Contol) inoculated with Salmonella strain, compared to mabofloxacin or methyl gallate alone, Mabofloc It was confirmed that the expression of the pathogenic toxin gene was significantly reduced in the combined treatment group (MGM) of sasin and methyl gallate.
실시예Example 7. 7. 메틸methyl 갈레이트Gallate 및 And 마보플록사신의Mabofloxacin 혼합 비율에 따른 효과 확인 Check the effect according to the mixing ratio
메틸 갈레이트 및 마보플록사신의 혼합 비율을 조절하여, 실시예 4와 동일한 방법으로 항균 효과를 확인하였다. 구체적으로, Caco-2 세포를 103 세포수/ml로 처리한 후 배양하였으며, 상기 세포에 살모넬라 티피뮤리움을 105 CFU/ml로 접종하였다. 상기 세포에 0~120 μg/mL의 메틸 갈레이트 및 0 내지 1 μg/mL의 마보플록사신을 처리한 후, 세포 내 세균의 수를 확인하였다. 이때 마보플록사신의 경우 MIC 이상의 농도에서는 항균 작용이 나타나며 내성균의 출현을 조장하므로 그 미만의 농도를 사용하였다. 각 군의 처리 농도를 표 3에 나타내었으며, 실험 결과를 도 9에 나타내었다. By adjusting the mixing ratio of methyl gallate and mabofloxacin, the antibacterial effect was confirmed in the same manner as in Example 4. Specifically, Caco-2 cells were treated with 10 3 cells/ml and then cultured, and Salmonella typhimurium was inoculated with 10 5 CFU/ml to the cells. After the cells were treated with 0 to 120 μg/mL of methyl gallate and 0 to 1 μg/mL of mabofloxacin, the number of bacteria in the cell was confirmed. At this time, in the case of mabofloxacin, an antimicrobial action appeared at a concentration of MIC or higher, and it promoted the emergence of resistant bacteria. The treatment concentration of each group is shown in Table 3, and the experimental results are shown in FIG. 9.
도 9에 나타낸 바와 같이, 메틸 갈레이트 30 내지 120 μg/mL 및 마보플록사신 0.25 내지 1 μg/mL의 병용처리 시 세포 내 세균 수가 현저하게 감소함을 확인하였다. 이는 메틸 갈레이트 및 마보플록사신이 적절한 비율로 첨가될 때 숙주 세포 내 세균의 생존이 현저하게 억제됨을 확인한 것으로, 두 물질의 병용 처리에 의해 세포 부착 및 침입을 억제됨을 확인할 수 있다. As shown in FIG. 9, it was confirmed that the number of bacteria in cells was significantly reduced when the combination treatment of 30 to 120 μg/mL of methyl gallate and 0.25 to 1 μg/mL of mabofloxacin was performed. This confirmed that when methyl gallate and mabofloxacin were added in an appropriate ratio, the survival of bacteria in the host cell was significantly suppressed, and it could be confirmed that cell adhesion and invasion were inhibited by the combination treatment of the two substances.
종합적으로, 이상의 실험 결과로부터 메틸 갈레이트 및 플로로퀴놀론 계열 항균제를 저 농도로 병용처리함으로써 살모넬라 균주의 쿼럼 센싱 및 병원성 독소 유전자의 발현이 억제되고, 이로 인해 살모넬라 균주에 대한 내성균 유발의 문제 없이 살모넬라 균주의 숙주세포로의 부착, 세포 내 침입 및 세포 내 생존을 억제시킬 수 있음을 확인하였다. 따라서 메틸 갈레이트 및 플로로퀴놀론 계열 항균제의 병용 제제는 살모넬라균에 의한 감염성 질병의 예방 또는 치료를 위한 약학적 조성물 뿐만 아니라 사료 첨가용, 소독용, 세척용 및 방부용 등 다양한 분야에서 활용될 수 있다. Overall, from the above experimental results, quorum sensing of Salmonella strains and expression of pathogenic toxin genes were suppressed by co-treating methyl gallate and fluoroquinolone-based antimicrobial agents at low concentrations. It was confirmed that the strain can inhibit adhesion to host cells, invasion into cells, and survival in cells. Therefore, the combination preparation of methyl gallate and fluoroquinolone-based antimicrobial agent can be used in various fields such as feed addition, disinfection, cleaning and preservation, as well as pharmaceutical compositions for the prevention or treatment of infectious diseases caused by Salmonella. have.
Claims (11)
In a Salmonella strain, characterized in that it contains methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibits adhesion or invasion of Salmonella strains. For antibiotic composition.
The method of claim 1, wherein the contact concentration of methyl gallate is a concentration that does not affect the survival of the Salmonella strain itself, and the contact concentration of mabofloxacin is a concentration that does not induce antibiotic resistance of the strain. Composition.
The method of claim 1, wherein the Salmonella strain is Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Enteritidis, Salmonella Gallinarum, Salmonella Gallinarum, and Salmonella Typhimurium. ( Salmonella Typhi) and Salmonella Florum ( Salmonella Pullorum) at least one member selected from the group consisting of, a composition.
Salmonellosis, comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains, Food poisoning, gastritis, enteritis, pneumonia, sepsis, pig cholera and a pharmaceutical composition for the prevention or treatment of infectious diseases caused by at least one strain of Salmonella selected from the group consisting of chubaekri.
It contains methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibits adhesion or invasion of Salmonella strains, for feed addition Composition.
A disinfectant composition comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains .
A cleaning composition comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains .
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190056340A KR102208837B1 (en) | 2019-05-14 | 2019-05-14 | Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020190056340A KR102208837B1 (en) | 2019-05-14 | 2019-05-14 | Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20200133032A KR20200133032A (en) | 2020-11-26 |
KR102208837B1 true KR102208837B1 (en) | 2021-02-01 |
Family
ID=73679151
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020190056340A KR102208837B1 (en) | 2019-05-14 | 2019-05-14 | Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102208837B1 (en) |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
PL2594272T3 (en) * | 2005-05-18 | 2018-11-30 | Horizon Orphan Llc | Aerosolized fluoroquinolones and uses thereof |
KR100926943B1 (en) | 2007-10-24 | 2009-11-17 | 주식회사 유라테크 | Spark plug manufacturing method and device |
KR100976927B1 (en) * | 2008-03-25 | 2010-08-18 | 권동렬 | Antibacterial activity of methyl gallate isolated from the Galla Rhois in combination with ciprofloxacin aganist salmonella |
US9286964B2 (en) | 2012-12-21 | 2016-03-15 | Intel Corporation | Method, apparatus and system for responding to a row hammer event |
-
2019
- 2019-05-14 KR KR1020190056340A patent/KR102208837B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
J. Microbiol. Biotechnol., 18(11), 1848-1852, 2008.* |
Also Published As
Publication number | Publication date |
---|---|
KR20200133032A (en) | 2020-11-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Ishihara et al. | Improvement of intestinal microflora balance and prevention of digestive and respiratory organ diseases in calves by green tea extracts | |
JP5259905B2 (en) | Medium chain fatty acids applicable as antibacterial agents | |
Hassan et al. | Innovative drugs, chemicals, and enzymes within the animal production chain | |
JP5461432B2 (en) | Lactylate for the prevention and treatment of infections caused by gram-positive bacteria in animals | |
US8318152B2 (en) | Effects of probiotics on humans and animals under environmental or biological changes | |
JPWO2010067883A1 (en) | Feed for prevention and / or treatment of diseases caused by Clostridium bacteria in livestock, and anti-Clostridial agent | |
JP2022115985A (en) | Methods for treating and preventing Clostridium difficile infection | |
KR20130046898A (en) | Pharmaceutical compositon prevention and treatment of vaginitis and urinary tract infection comprising fermented solution of plant-originated lactic acid bacteria | |
CN111690620B (en) | Clostridium welchii bacteriophage, bacteriophage composition and application thereof | |
KR100707988B1 (en) | Complex antibiotic composition for bovine mastitis | |
JP2005200339A (en) | Antimicrobial agent | |
KR20210053637A (en) | Probiotic yeast Kluyveromyces marxianus A5 from kefir and uses thereof | |
RU2197237C2 (en) | Method for treating animal diseases induced by bacteria (variants) and method for manufacturing a medicinal product | |
KR102208837B1 (en) | Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent | |
KR20210004221A (en) | antibiotic composition comprising alpha-mangostin, gamma mangostin or celastrol | |
KR101837658B1 (en) | Novel Aeromonas hydrophila specific bacteriophage and antibacterial composition comprising the same | |
CN108815151A (en) | Purposes of the lauroyl arginine ethyl ester as feed addictive | |
US20210128695A1 (en) | Ovotransferrin treatment for the reproductive tract | |
KR100438209B1 (en) | Complex antimicrobial composition based on carvacrol, thymol, and citral | |
US7476379B1 (en) | Emu-based formulations for the treatment of damaged skin by inhibiting microbial and fungal activity | |
KR20150024116A (en) | Probiotics composition for livestock farming containing a mixture of bacillus sp., lactobacillus sp., Yeast sp. and phage | |
KR102430080B1 (en) | Antibacterial composition comprising methyl gallate and tylosin | |
KR101842668B1 (en) | Novel Salmonella specific becteriophage SG2 and antibacterial composition comprising the same | |
CN117264910B (en) | Phage resistant to Gao Wenan spectrum salmonella and clinical application thereof | |
CN108992437A (en) | Purposes of the lauroyl arginine ethyl ester as antibacterial agent for animals |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right |