KR102208837B1 - Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent - Google Patents

Abstract

The present invention relates to a composition for inhibiting intestinal adhesion or intestinal invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antimicrobial agents as active ingredients, and use thereof. The composition of the present invention has an excellent effect of remarkably inhibiting the adhesion, invasion and intracellular survival of Salmonella strains to host cells without the problem of causing antibiotic-resistant bacteria by containing methyl gallate and fluoroquinolone-based antimicrobial agents at low concentrations. Therefore, the composition of the present invention can be used in various fields such as a pharmaceutical composition, as well as a composition for feed addition, disinfection, cleaning and preservation.

Description

Composition for inhibiting adhesion, invasion of bacteria or antibacterial resistance comprising methyl gallate and fluoroquinolone antibacterial agent}

The present invention relates to a composition for inhibiting intestinal adhesion or intestinal invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antimicrobial agents as active ingredients, and use thereof.

Salmonella (Salmonella) is a facultative anaerobic bacteria belonging to gram-negative enteric bacteria and a bacillus which does not form a spore. Salmonella is a pathogenic microorganism that infects not only humans, but also various livestock including pigs, cows, chickens, etc., and causes diseases. It infects humans, causing food poisoning, and causing various salmonellosis in animals. Salmonella enterica is known as Salmonella Typhi, which causes typhoid fever by serological classification, Salmonella Typhimurium, which is the causative agent of Zut typhus, Salmonella Enteritidis, which is an enteritis bacteria , and poultry. serum contains species such as Salmonella Galina volume (Salmonella gallinarum) the causative agents of typhoid, chubaekri causative agent of salmonellosis flow column (Salmonella Pullorum), acute septicemia and salmonella can be a causative agent of cholera hog cholera device (Salmonella choleraesuis). Salmonella, depending on the serotype, contains a common source of infection that can cause diseases not only in humans but also in livestock. Salmonella Choleraesuis ( Salmonella Choleraesuis) is a fungus known as swine cholera because it can infect pigs and cause pig cholera. It is a fungus that infects both humans and animals. Together with Salmonella Typhisuis, this fungus causes acute sepsis caused by Salmonella, and the acute or chronic gastrointestinal infectious disease of pigs caused by Salmonella infection is called pig paratyphoid, and is accompanied by gastroenteritis and sepsis. It mainly occurs during the fattening period. Diseases caused by this fungus are common seasonally, mainly in summer, and acute septicemia is common in young pigs aged 2 to 4 months. The main symptoms are elevated body temperature (41~42℃), loss of energy and loss of appetite, Cyanosis occurs around the ears and in the legs, and most of them die within 2 to 4 days of onset. Acute enteritis occurs mainly in fattening livestock. Appetite is not constant. It is accompanied by severe watery diarrhea, high fever, weakness, pneumonia, and neurological symptoms. In severe cases, skin discoloration appears. Chronic enteritis is when livestock is severely thin due to continuous diarrhea, and gradually changes from yellowish-white or grayish-white soft stool to gelatinous mucous diarrhea, and the diarrhea contains necrotic fragments of intestinal epithelial cells, and sometimes contains blood. There is also. In Korea, it has been reported that the incidence of diseases caused by the above fungi is very low, but when a disease occurs, contagiousness and damage can appear large. In addition, as in most cases where Salmonella is transmitted, contaminated feedstock, water, or adult pigs carrying the bacteria without any symptoms can be an important source of infection.

Currently, antibiotics are mainly used to prevent and treat Salmonella infection, but when Salmonella is infected with animals, it is difficult to penetrate and act with antibiotics, drugs, and other probiotics because it is often infiltrated into cells and infects. The problem of antibiotic resistance was occurring, and the cause of this was identified as an antibiotic misuse, and antibiotics were not sufficiently used.

In particular, since Salmonella is known as a strain that is easily resistant to quinolones-based antimicrobial agents, development of a new antibiotic capable of inhibiting the adhesion and invasion of Salmonella strains to host cells is required while preventing the problem of antibiotic resistance.

Domestic patent application number: 10-2009-0041757 Domestic patent application number: 10-2016-7035517 Domestic patent application number: 10-2016-0144516

Accordingly, the inventors of the present invention were studying a new method that can inhibit the intestinal adhesion and invasion of Salmonella strains into host cells, and inhibit antibiotic resistance, while low concentrations of methyl gallate and fluoroquinolone, which alone do not exhibit antibacterial effects. The present invention was completed by confirming that the intestinal adhesion and invasion of Salmonella strains were remarkably suppressed without the occurrence of antibiotic resistance problems as a result of the combination treatment of the antimicrobial agent.

Accordingly, an object of the present invention is to provide a composition for inhibiting intestinal adhesion or invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients, and uses thereof.

In order to achieve the above object, the present invention provides a composition for inhibiting intestinal adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

In addition, the present invention provides a composition for inhibiting antibiotic resistance, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

In addition, the present invention provides a combination preparation for the prevention or treatment of infectious diseases caused by Salmonella strains, comprising methyl gallate and fluoroquinolone-based antimicrobial agents as active ingredients.

In addition, the present invention provides a composition for feed addition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

In addition, the present invention provides a disinfectant composition for inhibiting adhesion or invasion of Salmonella strains, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

In addition, the present invention provides a cleaning composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

In addition, the present invention provides a preservative composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

The composition of the present invention has an excellent effect of remarkably inhibiting the adhesion, invasion and intracellular survival of Salmonella strains to host cells without the problem of causing antibiotic-resistant bacteria by containing methyl gallate and fluoroquinolone-based antimicrobial agents at low concentrations. Therefore, the composition of the present invention can be used in various fields such as a pharmaceutical composition, as well as a composition for feed addition, disinfection, cleaning and preservation.

1 is a diagram showing the effect of methyl gallate on cell survival by concentration.
Figure 2 is a diagram showing the effect of the combined treatment of methyl gallate and mabofloxacin (MGM) on the adhesion of Salmonella strains to host cells.
Figure 3 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the invasion of Salmonella strains into cells (left: Caco-2 cells, right: Raw 264.7 cells).
Figure 4 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the survival of Salmonella strains in Raw 264.7 cells.
5 is a diagram showing the results of observation with a confocal microscope after treatment with methyl gallate or mabofloxacin on Caco-2 cells (A: non-infected cells, B: untreated cells after Salmonella infection, C: after Salmonella infection sub-MIC mabofloxacin-treated cells, D: methyl gallate (30 μg/mL)-treated cells after Salmonella infection, E: methyl gallate (30 μg/mL) after Salmonella infection, and mabofloxacin of sub-MIC Combined treatment cells)
6 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the motility of Salmonella strains.
7 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the expression of the quorum sensing gene of Salmonella strains (A: srgE gene, B: sdiA gene, C: rck gene).
Figure 8 is a diagram showing the effect of the combined treatment (MGM) of methyl gallate and mabofloxacin on the expression of pathogenic toxin genes of Salmonella strains (A: rac-1 gene, B: cheY gene, C: ompD gene, D: sipB gene, E: lexA gene).
9 is a diagram showing the effect of the combination treatment of methyl gallate and mabofloxacin at various concentrations on the survival of Salmonella strains in Caco-2 cells.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

In addition, the present invention provides a composition for inhibiting antibiotic resistance, including methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

The composition is preferably an antibiotic composition. The term “antibiotic composition” refers to an agent that is provided to an individual in the form of a drug to kill bacteria, and refers to preservatives, fungicides, antibiotics and antibacterial agents.

In the present invention, the salmonella strain is Salmonella typhimurium (Salmonella Typhimurium), Salmonella choleraesuis could device (Salmonella Choleraesuis), Salmonella Entebbe utility disk (Salmonella Enteritidis), live Monet LAL Galina volume (Salmonella Gallinarum), Salmonella tie blood (Salmonella Typhi) and Salmonella Florum ( Salmonella Pullorum) may be one or more selected from the group consisting of, preferably Salmonella Typhimurium ( Salmonella Typhimurium), but is not limited thereto.

The methyl gallate according to the present invention is preferably included in the composition at a low concentration that does not affect the survival of the Salmonella strain itself. Specifically, methyl gallate may be included at a contact concentration of 10 to 150 μg/mL, more preferably at a contact concentration of 30 to 120 μg/mL.

The fluoroquinolone-based antimicrobial agent according to the present invention is mabofloxacin, danofloxacin, difloxacin, enrofloxacin, obifloxacin, sarafloxacin, ciprofloxacin, levofloxacin, moxifloxacin, gemifloxacin, It may be one or more selected from the group consisting of nalidic acid and flumequine, preferably mabofloxacin, but is not limited thereto.

The fluoroquinolone-based antimicrobial agent is preferably contained in the composition at a minimum inhibitory concentration (MIC) or less, and more preferably sub-MIC or less in the composition, in order to prevent the induction of antibiotic-resistant strains, and the MIC And sub-MIC may vary depending on whether the Salmonella strain is susceptible and resistant. Specifically, the fluoroquinolone-based antimicrobial agent may be included at a contact concentration of 0.015 to 1 μg/mL, more preferably at a contact concentration of 0.25 to 0.5 μg/mL, but is not limited thereto.

The composition according to the present invention contains methyl gallate and a fluoroquinolone-based antimicrobial agent at a low concentration that does not exhibit an antibacterial effect alone, so that the fluoroquinolone-based antimicrobial agent can prevent the problem of antibiotic resistance in Salmonella strains. , It can be used for inhibition of antibiotic resistance. In addition, the composition has an excellent effect of remarkably inhibiting the adhesion of the Salmonella strain to host cells, invasion, and intracellular survival by inhibiting the quorum sensing of the Salmonella strain and the expression of the pathogenic toxin gene. Therefore, the composition of the present invention can be used in various fields such as a pharmaceutical composition, as well as a composition for feed addition, disinfection, cleaning and preservation.

Accordingly, as an aspect, the present invention provides a combination preparation for preventing or treating infectious diseases caused by Salmonella strains, comprising methyl gallate and a fluoroquinolone-based antibacterial agent as active ingredients. The formulation may be a pharmaceutical formulation.

Infectious diseases caused by the Salmonella strain according to the present invention are, for example, epidemic or acute infectious diseases, including food poisoning, gastritis, enteritis, pneumonia, sepsis, pig cholera, and chubaekri, in addition to salmonellosis.

Salmonellosis is a generic term for symptoms accompanying fever, headache, diarrhea, vomiting, etc. due to Salmonella infection, and salmonellosis is broadly classified into sepsis type showing symptoms such as typhoid fever and acute gastroenteritis type showing symptoms of food poisoning, enteritis, food poisoning. , Acute bacteremia, etc.

The term “prevention” of the present invention refers to any action that suppresses or delays the onset of disease by administration of the composition.

The term "treatment" of the present invention refers to all actions in which the symptoms of the disease are improved or the disease is suppressed or alleviated and beneficially changed by the administration of the composition.

The pharmaceutical formulation of the present invention (mixed with the pharmaceutical composition) may further include a pharmaceutically acceptable carrier in addition to the active ingredient.

In the present invention, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions are sterilized and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as necessary.

In addition, the composition of the present invention may be formulated as an injectable formulation such as an aqueous solution, suspension, emulsion, pill, capsule, granule or tablet by additionally adding a diluent, a dispersant, a surfactant, a binder and a lubricant.

Formulations for oral administration comprising the pharmaceutical composition of the present invention may be formulated as, for example, tablets, troches, lozenges, water-soluble or oily suspensions, powders or granules, emulsions, hard or soft capsules, syrups or elixirs. I can. For formulation into tablets and capsules, etc., a binder such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, and masne stearate Lubricating oils such as calcium, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax may be included. In the case of a capsule formulation, a liquid carrier such as fatty oil may be further included in addition to the above-mentioned substances.

Formulations for parenteral administration containing the pharmaceutical composition of the present invention include injection forms such as subcutaneous injection, intravenous injection, or intramuscular injection, suppository injection, or spray, such as an aerosol that allows inhalation through the respiratory tract. It can be formulated. In order to formulate a formulation for injection, the composition of the present invention may be prepared as a solution or suspension by mixing in water together with a stabilizer or a buffer, and formulated for unit administration of ampoules or vials. When formulated for spraying such as an aerosol, a propellant or the like may be blended together with an additive so that the aqueous concentrated or wet powder is dispersed.

The composition of the present invention may further contain one or more known active ingredients having a preventive or therapeutic effect on infectious diseases caused by Salmonella strains.

In the present invention, the term "administering" means providing a given composition of the present invention to a subject by any suitable method.

In the method of the present invention, the route of administration of the composition may be administered through various routes, oral or parenteral, as long as it can reach the target tissue, and specifically, oral, rectal, topical, intravenous, intraperitoneal, intramuscular, arterial It can be administered in a conventional manner through internal, transdermal, intranasal, inhalation, and the like.

Suitable dosages of the pharmaceutical composition of the present invention include formulation method, mode of administration, age, weight, sex, degree of disease symptoms, food, administration time, route of administration, excretion rate and response sensitivity of the subject animal and patient. It varies by factors, and usually an experienced physician or veterinarian can easily determine and prescribe an effective dosage for the desired treatment.

In another aspect, the present invention provides a composition for feed addition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

Feed-added antibiotics used in livestock and fishery industries are used for the purpose of preventing diseases, and administration of antibiotics for preventive purposes increases the likelihood of developing resistant bacteria and is a problem because antibiotics remaining in livestock can be delivered to humans. When antibiotics are absorbed into the body through meat, they can cause antibiotic resistance, which can lead to the spread of disease. In addition, since there are many kinds of antibiotics mixed with feed and this has a problem of increasing the probability of multidrug resistant bacteria, the composition of the present invention is used as a new feed additive antibiotic that is more natural friendly and solves the problem arising from the use of existing antibiotics. Can be used.

In addition, the present invention may provide a feed comprising the composition for feed addition, and the active ingredients of the present invention, methyl gallate and fluoroquinolone-based antibacterial agents are separately prepared in the form of feed additives and mixed with feed or feed It can be prepared by directly adding the active ingredient during manufacture. The active ingredient in the feed of the present invention may be in a liquid or dry state, preferably in a dry powder form. The drying method may be ventilated drying, natural drying, spray drying, and freeze drying, but is not limited thereto. The active ingredient of the present invention may be mixed in a powder form in an ingredient ratio of 0.05 to 10% by weight, preferably 0.1 to 2% by weight of the feed weight. In addition, the feed may further include conventional additives that can increase the preservability of the feed in addition to the active ingredient of the present invention.

Other non-pathogenic microorganisms may be additionally added to the composition for feed addition of the present invention. Microorganisms that can be added include Bacillus subtilis , which can produce proteolytic enzymes, lipolytic enzymes, and sugar converting enzymes, and Lactobacillus, which has physiological activity and ability to degrade organic matter under anaerobic conditions such as the stomach of cattle. Strain ( Lactobacillus sp.), filamentous fungi such as Aspergillus oryzae and Saccharomyces cerevisiae showing the effect of increasing the weight of livestock, increasing milk production and increasing the digestion and absorption rate of feed. ) May be selected from the group consisting of yeast.

The feed of the present invention includes cereals, root fruits, food processing by-products, algae, fiber, pharmaceutical by-products, oils and fats, starches, meals, grain by-products, etc. as vegetable, and protein, inorganic logistics as animal , Oils and fats, minerals, single cell proteins, zooplanktons, food leftovers, etc., but are not limited thereto.

The composition for feed addition of the present invention may contain binders, emulsifiers, preservatives, etc. added to prevent quality deterioration, and amino acids, vitamins, enzymes, probiotics, flavoring agents, non-proteinaceous agents added to the feed to increase utility Nitrogen compounds, silicates, buffers, colorants, extractants, oligosaccharides, etc. may be included, and in addition, feed mixing agents may be additionally included.

In another aspect, the present invention provides a food additive composition or a drinking water additive for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and a fluoroquinolone-based antibacterial agent as active ingredients.

The composition for food addition of the present invention may be added as it is to the composition containing the methyl gallate and fluoroquinolone-based antimicrobial agent, or may be used together with other food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient can be appropriately determined depending on the purpose of use. In general, the methyl gallate and fluoroquinolone-based antimicrobial agents of the present invention are added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less based on the raw material.

The drinking water additive of the present invention may be used in a manner in which a composition containing the methyl gallate and fluoroquinolone-based antimicrobial agent is separately prepared in the form of a drinking water additive and mixed with drinking water, or directly added when preparing drinking water. By mixing and supplying the drinking water as described above, there is an effect of continuously reducing the adhesion and invasion of Salmonella strains to host cells.

In the present invention, drinking water is not particularly limited, and drinking water commonly used in the art may be used.

In another aspect, the present invention provides a disinfectant composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and a fluoroquinolone-based antibacterial agent as active ingredients.

The disinfectant composition according to the present invention, which has excellent effect of inhibiting the adhesion and invasion of Salmonella strains to host cells, can be usefully used as a disinfectant for hospitals and health care to prevent hospital infection. It can be used for disinfection of various growth products such as disinfectants, poultry farms, buildings such as barns, livestock, drinking water, litter, nangja, transport vehicles, and tableware.

In another aspect, the present invention provides a cleaning composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

Since the methyl gallate and fluoroquinolone-based antimicrobial agents of the present invention have the effect of inhibiting the adhesion and invasion of the Salmonella strain into the host cell, the skin surface or each part of the body of livestock exposed to or likely to be exposed to the Salmonella strain It can also be used for washing the back.

In another aspect, the present invention provides a preservative composition for inhibiting adhesion or invasion of Salmonella strains, comprising methyl gallate and fluoroquinolone-based antibacterial agents as active ingredients.

The preservative composition may include food preservatives, cosmetic preservatives or pharmaceutical preservatives. The food preservatives, cosmetic preservatives and pharmaceutical preservatives are additives used to prevent deterioration, spoilage, discoloration, and chemical change of pharmaceuticals. These include fungicides and antioxidants, and inhibit the growth of microorganisms such as bacteria, mold, and yeast. And functional antibiotics such as inhibiting the growth of decaying microorganisms or sterilizing in pharmaceuticals are also included. Ideal conditions for such an antiseptic composition should be non-toxic and should be effective even in trace amounts.

In addition, the composition of the present invention can be used as an active ingredient in quasi-drugs. The quasi-drug composition of the present invention is not limited thereto, but preferably, it may be a disinfectant cleaner, a shower foam, a gagrin, a wet tissue, a detergent soap, a hand wash, a humidifier filler, a mask, an ointment, a patch, or a filter filler.

Terms not otherwise defined in the specification have the meanings commonly used in the art to which the present invention belongs.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Preparation example 1. Preparation of test material

Methyl gallate, mabofloxacin, and compounds and kits used in the following experiments were purchased from Sigma (Sigma, St. Louis, MO, USA) unless otherwise specified.

Preparation example 2. Culture of Salmonella strains and cells

All Salmonella strains were cultured in LB (Luria-Bertani) medium (Difco, BD, USA). Mouse macrophage RAW 264.7 cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S), and Caco-2 cells, a human colon epithelial cell line, were 1%. It was cultured in MEM (minimum essential medium) medium (Gibco, USA) containing non-essential amino acids, 20% FBS and 1% P/S. All cell cultures were performed at 37°C and 5% CO ₂ conditions.

Example One. methyl Gallate And Mabofloxacin Treatment concentration selection

1-1. Selection of methyl gallate concentration

To confirm the effect of methyl gallate (MG) on the cytotoxicity of mammalian cells, and to determine the treatment concentration thereof, RAW 264.7 cells were used. First, RAW 264.7 cells were seeded in a 96-well plate at a concentration of 10 ⁵ cells/mL and cultured for 24 hours. The medium was removed and a new medium containing various concentrations of MG was added, followed by incubation overnight. The medium was replaced with a medium containing 0.45 mg/mL of MTT, incubated for 4 hours, DMSO was added, and absorbance was measured at 570 nm using VersaMax (molecular devices, USA). Cell viability was calculated using the following calculation formula, and the results are shown in FIG. 1.

Survival rate=

As shown in FIG. 1, it was confirmed that MG reduced the cell viability by about 9.5% at a high concentration of 2 mg/mL, and did not significantly affect the cell viability at a concentration of about 30 μg/mL or less.

In addition, as a result of calculating the MIC value of methyl gallate for three additional Salmonella strains (two field strains isolated from the swine infectious disease model and ATCC 14028 strain), it was confirmed that it was 500 μg/mL, and 125 μg/mL contact It was confirmed that it did not exhibit bacterial survival inhibitory activity below the concentration. Therefore, in the subsequent experiment, methyl gallate at a contact concentration of 30 μg/mL, which is a concentration that does not exhibit any antibacterial activity, was used.

1-2. Selection of the concentration of mabofloxacin

In order to select the concentration of mabofloxacin, one of the antimicrobial agents of the fluoroquinolone family, the concentration below the minimum inhibitory concentration (MIC) (sub-MIC) was confirmed through previously known literature. Mabofloxacin showed a MIC of 0.03 μg/mL for susceptible strains and 0.5 μg/mL for resistant strains, and in subsequent experiments, mabofloxacin at a sub-MIC concentration, which is 1/2 of the MIC, was used.

Example 2. methyl Gallate And Mabofloxacin Analysis of the effect of combined treatment on cell adhesion of Salmonella strains

To confirm the effect on cell adhesion, sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of Mabofloxacin (MAR) and 30 μg/mL After treating completely grown Caco-2 cells with methyl gallate (MG), they were incubated for 30 minutes. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. After adding Salmonella typhimurium (10 ⁷ CFU/mL) strain to the cells, centrifugation was performed at 500 g for 5 minutes, followed by incubation for 45 minutes. Cells were dissolved in 0.1% Triton® x-100 for 10 minutes. Finally, the solution was serially diluted and incubated on an LB agar plate overnight to count the number of bacteria attached to the cells. The results are shown in FIG. 2. In the following figure, the cell is a negative control without any treatment, Salmonella is a group inoculated with only Salmonella strain, sub-MIC is a sub-MIC concentration of mabofloxacin alone, MIC is a MIC concentration of mabofloxacin alone, MG-30 Silver means 30 μg/mL of methyl gallate alone, and MGM means a sub-MIC concentration of mabofloxacin and 30 μg/mL of methyl gallate.

As shown in FIG. 2, it was confirmed that the combined treatment group (MGM) of mabofloxacin and methyl gallate significantly inhibited the adhesion of Salmonella strains to host cells, compared to mabofloxacin or methyl gallate alone.

Example 3. methyl Gallate And Mabofloxacin Analysis of the effect of combined treatment on intracellular invasion of Salmonella strains

In order to confirm the effect on intracellular invasion, it was performed by modifying the previously known gentamicin protection assay. First, the sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of Mabofloxacin (MAR) and 30 μg/mL of methyl gallate (MG) were fully grown Caco. After mixing treatment with -2 or Raw 264.7 cells, they were cultured for 30 minutes. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. After adding Salmonella typhimurium (10 ⁷ CFU/mL) strain to the cells, centrifugation was performed at 500 g for 5 minutes, followed by incubation for 45 minutes. Gentamicin (100 μg/mL) was added thereto, followed by incubation for 30 minutes, and the cells were dissolved in 0.1% Triton® x-100 for 10 minutes. Finally, the solution was serially diluted and incubated on LB agar plates overnight to count the number of bacteria in the cells. The results are shown in FIG. 3.

As shown in FIG. 3, compared to mabofloxacin or methyl gallate alone in both Caco-2 or Raw 264.7 cells, the combined treatment group (MGM) of mabofloxacin and methyl gallate invaded the host cells of Salmonella strains. It was confirmed that significantly suppressed.

Example 4. methyl Gallate And Mabofloxacin Analysis of the effect of combined treatment on intracellular survival of Salmonella strains

In order to confirm the effect on intracellular survival, the following experiment was performed. First, RAW 264.7 cells (10 ⁵ cells/mL) were grown in a 24-well plate, and Salmonella typhimurium (10 ⁷ CFU/mL) strain was added to the cells, followed by centrifugation at 500 g for 5 minutes and again. Incubate for 45 minutes. After washing the cells, sub-MIC (0.015 μg/mL for sensitive strains, 0.25 μg/mL for resistant strains) contact concentrations of mabofloxacin (MAR) and 30 μg/mL of methyl gallate (MG) were added. And incubated at 37° C., 5% CO ₂ for 1 hour. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. Gentamicin (100 μg/mL) was added to the cells, followed by additional culture for 1 hour, and dissolved with 0.1% Triton® x-100. Finally, the solution was serially diluted, and the number of bacteria was counted after incubation on an LB agar plate. The results are shown in FIG. 4.

As shown in FIG. 4, compared to mabofloxacin or methyl gallate alone, the survival of Salmonella strains in host cells in the combined treatment group (MGM) of mabofloxacin and methyl gallate significantly decreased (about 74% reduction) ) Was confirmed.

Additionally, in order to visually confirm the degree of invasion and viability of Salmonella typhimurium in the cells, it was observed with a confocal microscope. To this end, Caco-2 cells (10 ⁵ cells/mL) were grown in a 24-well plate, and the material was treated in the same manner as above. The cells treated with the substance were washed with 0.1 M MOPS (3-(N-morpholino) propanesulfonic acid) at pH 7.2 containing 1 mM MgCl ₂ , and the washing solution was aspirated, and then 5 μM SYTO9, 30 μM PI (propidium). iodide, Invitrogen, USA), and 0.5 mL Live/Dead staining buffer containing 0.1% saponin in MOPS/MgCl ₂ were added. The cells were cultured in the dark and at room temperature for 15 minutes, and then washed with MOPS/MgCl ₂ . Images were obtained within 30 minutes using a Carl Zeiss (LSM700) confocal microscope. The results are shown in FIG. 5.

As shown in Figure 5, as a result of observing the presence or absence of live and dead bacteria by staining the intracellular bacteria with SYTO-9 and PI, respectively, the number of live invading bacteria (Salmonella strain) in the host cell is mabofloxacin and methyl It was confirmed that it was significantly reduced by the combined treatment of gallate.

Example 5. methyl Gallate And Mabofloxacin Analysis of the effect of combined treatment on the motility of Salmonella strains

The motility of the Salmonella strain was confirmed using an LB medium containing 0.3% (W/V) agar. First, 5 μL of the 8-hour culture solution of Salmonella typhimurium was added to sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of Mabofloxacin (MAR) and 30 μg/mL. After inoculation in a medium containing methyl gallate (MG), it was incubated at 37°C for 12 hours. For comparison, mabofloxacin or methyl gallate was treated alone in the same way. The diameter of the bacteria in the medium was measured using a caliper. The results are shown in FIG. 6.

As shown in Fig.6, compared to mabofloxacin or methyl gallate alone, the motility of Salmonella strains in the combined treatment group (MGM) of mabofloxacin and methyl gallate significantly decreased (the size of the diameter is significantly reduced. ) Was confirmed.

Example 6. methyl Gallate And Mabofloxacin Analysis of the effect of combination treatment on gene expression of Salmonella strains

To confirm the effect of Salmonella typhimurium on QS (quorum sensing) and the expression of invasion-related genes, AHL (N-acyl homoserine lactone, 1 μmol/mL) was added to Salmonella typhimurium (10 ⁷ CFU/mL) strain. Add to the LB medium containing, sub-MIC (0.015 μg/mL for susceptible strains, 0.25 μg/mL for resistant strains) contact concentration of mabofloxacin (MAR) and 30 μg/mL methyl gallate ( MG) was treated and incubated for 8 hours. For comparison, mabofloxacin or methyl gallate was treated alone by the same method, and furanone (10 μg/mL) was used as a positive control. After centrifuging the bacterial mixture, the separated pellet was processed for RNA extraction. Total RNA was obtained using Trizol® (Ambion®, Life Technologies, USA) reagent according to the manufacturer's instructions. RNA purity and concentration were measured according to the nano drop method. cDNA was synthesized using qRT-PCR (quantitative reverse transcription-PCR) premix, and the amount of RNA expression was measured using a CFX96 Touch™ real-time PCR detection system (Biorad, USA) using an IQ™ SYBR® Green supermix. For normalization, rrsG was used for Salmonella typhimurium and β-actin was used for host cells as housekeeping genes. Through qRT-PCR, the expression levels of the QS-related genes srgE and sdiA, and the invasion-related genes rck were measured. Specifically, after denaturing at 95°C for 30 seconds, reactions for 5 seconds at 95°C, 30 seconds at 60°C, and 15 seconds at 95°C were repeated for 40 cycles, followed by reaction at 60°C for 30 seconds. The primer sequences used at this time are shown in Table 1, and the experimental results are shown in FIG. 7.

Target gene primer order srgE 5′- GCGCAGGTTGGTATTACTTG-3′
5′- GGCAGATTGTTCATGATTGC-3′ sdiA 5′- TTACATTGGGATGACGTGCT-3′
5'-AACTGCTACGGGAGAACGAT-3' rck 5′-GTTGTATCCCGGCATGCTGAT-3′
5′-ATATGCCCAGAGCCGGATAGAG-3′ rrsG 5′-GTTACCCGCAGAAGAAGCAC-3′
5′- CACATCCGACTTGACAGACC 3′ Β-actin 5′- GGACTTCGAGCAGGAGATGG -3′
5′- GCACCGTGTTGGCGTAGAGG -3′

As shown in Figure 7, the gene expression of srgE and sdiA, which are QS-related genes increased by AHL treatment, was remarkable in the combined treatment group (MGM) of mabofloxacin and methyl gallate compared to mabofloxacin or methyl gallate alone. It was confirmed that it decreased significantly. In addition, the gene expression of rck, which is known to play an important role in invasion into host cells through a zipper mechanism, is also markedly in the combined treatment group (MGM) of mabofloxacin and methyl gallate compared to mabofloxacin or methyl gallate alone. Decreased.

In addition, it is known that Salmonella invasion in epithelial cells is promoted by overexpression of rac-1, so the effect on the expression of the rac-1 gene was confirmed. , And the effect on the expression of the lexA gene was confirmed through qRT-PCR. The primer sequences used at this time are shown in Table 2, and the experimental results are shown in FIG. 8.

Target gene primer order rac1 5′-CCTGATGCAGGCCATCAAG-3′
5′-AGTAGGGATATATTCTCCAGGAAATGC-3′ cheY 5′-TTATCTCCGACTGGAACATGC-3′
5′-GACCATCAACACGGGTAACG-3′ ompD 5′-GCAACCGTACTGAAAGCCAGGG-3′
5′-GCCAAAGAAGTCAGTGTTACGGT-3′ sipB 5′-ACGCGCAAAGCCGAGGAAAC-3′
5′-CCCGTCGCCGCCTTCAC-3′ lexA 5′-TCGCGAGGTATCCGTCTG-3′
5′-TATGTACCGCCAGCAAATCC-3′

As shown in Figure 8, when based on the expression of Rac-1, cheY, ompD, sipB and lexA genes in the control group (Contol) inoculated with Salmonella strain, compared to mabofloxacin or methyl gallate alone, Mabofloc It was confirmed that the expression of the pathogenic toxin gene was significantly reduced in the combined treatment group (MGM) of sasin and methyl gallate.

Example 7. methyl Gallate And Mabofloxacin Check the effect according to the mixing ratio

By adjusting the mixing ratio of methyl gallate and mabofloxacin, the antibacterial effect was confirmed in the same manner as in Example 4. Specifically, Caco-2 cells were treated with 10 ³ cells/ml and then cultured, and Salmonella typhimurium was inoculated with 10 ⁵ CFU/ml to the cells. After the cells were treated with 0 to 120 μg/mL of methyl gallate and 0 to 1 μg/mL of mabofloxacin, the number of bacteria in the cell was confirmed. At this time, in the case of mabofloxacin, an antimicrobial action appeared at a concentration of MIC or higher, and it promoted the emergence of resistant bacteria. The treatment concentration of each group is shown in Table 3, and the experimental results are shown in FIG. 9.

MG MAFX Control 0 0 MGM-1 0 0.25 MGM-2 0 One MGM-3 30 0 MGM-4 30 0.25 MGM-5 30 One MGM-6 60 0 MGM-7 60 0.25 MGM-8 60 One MGM-9 120 0 MGM-10 120 0.25 MGM-11 120 One

As shown in FIG. 9, it was confirmed that the number of bacteria in cells was significantly reduced when the combination treatment of 30 to 120 μg/mL of methyl gallate and 0.25 to 1 μg/mL of mabofloxacin was performed. This confirmed that when methyl gallate and mabofloxacin were added in an appropriate ratio, the survival of bacteria in the host cell was significantly suppressed, and it could be confirmed that cell adhesion and invasion were inhibited by the combination treatment of the two substances.

Overall, from the above experimental results, quorum sensing of Salmonella strains and expression of pathogenic toxin genes were suppressed by co-treating methyl gallate and fluoroquinolone-based antimicrobial agents at low concentrations. It was confirmed that the strain can inhibit adhesion to host cells, invasion into cells, and survival in cells. Therefore, the combination preparation of methyl gallate and fluoroquinolone-based antimicrobial agent can be used in various fields such as feed addition, disinfection, cleaning and preservation, as well as pharmaceutical compositions for the prevention or treatment of infectious diseases caused by Salmonella. have.

Claims (11)

In a Salmonella strain, characterized in that it contains methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibits adhesion or invasion of Salmonella strains. For antibiotic composition.
The method of claim 1, wherein the contact concentration of methyl gallate is a concentration that does not affect the survival of the Salmonella strain itself, and the contact concentration of mabofloxacin is a concentration that does not induce antibiotic resistance of the strain. Composition.
delete delete The method of claim 1, wherein the Salmonella strain is Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Enteritidis, Salmonella Gallinarum, Salmonella Gallinarum, and Salmonella Typhimurium. ( Salmonella Typhi) and Salmonella Florum ( Salmonella Pullorum) at least one member selected from the group consisting of, a composition.
Salmonellosis, comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains, Food poisoning, gastritis, enteritis, pneumonia, sepsis, pig cholera and a pharmaceutical composition for the prevention or treatment of infectious diseases caused by at least one strain of Salmonella selected from the group consisting of chubaekri.
delete It contains methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibits adhesion or invasion of Salmonella strains, for feed addition Composition.
A disinfectant composition comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains .
A cleaning composition comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains .
An antiseptic composition comprising methyl gallate at a contact concentration of 10 to 150 μg/mL and mabofloxacin at a contact concentration of 0.015 to 1 μg/mL as active ingredients, and inhibiting adhesion or invasion of Salmonella strains .

Images