KR102439335B1 - Bio-patch type cell therapy product for Regenerating skin comprising Placenta-derived stem cells - Google Patents

Abstract

The present invention relates to a biopatch-type cell therapeutic agent for skin regeneration comprising placenta-derived stem cells, which can be transplanted into the skin or the like in a biodegradable polymer film in the state where placenta-derived stem cells are present, so that there is an effect of being able to be easily used as a living body transplant material without contamination or manipulation complexity.

Description

Bio-patch type cell therapy product for Regenerating skin comprising placenta-derived stem cells

The present invention relates to a biopatch-type cell therapy agent for skin regeneration containing placental-derived stem cells.

Stem cells are capable of self-replication and differentiation and proliferation from one cell to cells constituting various tissues. have. It is recognized and known as a next-generation technology with very high medical utility in degenerative diseases for which there is currently no definite treatment or damage that is difficult to treat, such as severe trauma, and clinical trials and research using stem cells in the field of regenerative medicine are in progress.

Stem cells are largely divided into embryonic stem cells and adult stem cells according to the developmental state of the cell origin tissue, and in addition, induced pluripotent stem cells using gene editing technology. ) is there. In the study of regenerative treatment using stem cells, mesenchymal stem cells, a type of adult stem cells, are mainly used in consideration of the ease of obtaining tissue raw materials, stem cell separation efficiency, and tumor formation problems. It can be obtained from tissues such as fat and placenta.

Placental stem cells are stem cells derived from umbilical cord blood, amniotic membrane and amniotic fluid, and have been recently discovered and studied among other tissue-derived mesenchymal stem cells. Placental stem cells have excellent proliferative ability, no tumor formation problem, and have the ability to differentiate into tissues of mesoderm, endoderm, and ectoderm origin such as fat, bone, muscle, liver, and nerve. In particular, it is the only stem cell that overcomes ethical problems, and it has the advantage of being able to obtain it in a non-invasive way at birth. shows its potential as a cell therapy.

However, regenerative treatment using stem cells has a problem in that transplantation and delivery efficiency is limited due to a decrease in the survival rate of transplanted stem cells. This complementary strategic technology development is underway.

On the other hand, bio-patch is generally used as a kind of dressing attached to the skin for the purpose of preventing infection caused by surgery, injection, and skin wounds. It is being researched and developed as it is applied as a patch-type sensor that detects , chronic disease and an attachable bio-signal monitoring module that manages health.

US 10-1843293 B1

While the present inventors were researching to develop a biopatch-type cell therapy for skin tissue regeneration, placental-derived stem cells were cultured on a biodegradable polymer film and applied directly to the damaged area of the skin. By confirming the regenerative ability of the therapeutic agent through treatment, the present invention was completed.

Therefore, an object of the present invention is placenta-derived stem cells (Placenta-derived stem cells); It is to provide a biopatch-type cell therapy product comprising a porous biodegradable polymer film and a biocompatible polymer support.

While the present inventors were researching to develop a biopatch-type cell therapy for skin tissue regeneration, placental-derived stem cells were cultured on a biodegradable polymer film and applied directly to the damaged area of the skin. Through treatment, the regenerative ability of the therapeutic agent was confirmed.

Accordingly, the present invention is a placental-derived stem cell; It relates to a biopatch-type cell therapy product comprising a porous biodegradable polymer film and a biocompatible polymer support.

Hereinafter, the present invention will be described in more detail.

According to one embodiment of the present invention, the present invention relates to a biopatch-type cell therapy product in which placental-derived stem cells are cultured.

In the present invention, "stem cells" refers to master cells that can reproduce without limitation to form specialized cells of tissues and organs. Stem cells are pluripotent or pluripotent cells capable of developing. Stem cells can divide into two daughter stem cells, or one daughter stem cell and one derived ('transit') cell, which then proliferates into mature, complete cells of the tissue.

In the present invention, "placenta-derived stem cells" refers to stem cells that can be obtained from the placenta. Specifically, it includes placental stem cells, multipotent cells and progenitor cells.

A “pluripotent cell” as used herein refers to a cell having the ability to grow into any subset of about 260 cell types in the mammalian body. Unlike pluripotent cells, pluripotent cells do not have the ability to form all cell types.

As used herein, "progenitor cell" refers to a cell adapted to differentiate into a specific type of cell or to form a specific type of tissue.

In the present invention, "differentiation" refers to a phenomenon in which the structure or function of cells is specialized to each other during division and proliferation, that is, the form or function of cells, tissues, etc. of living organisms change in order to perform a given task.

In the present invention, the "biopatch" is in the form of a thin sheet or film, preferably in the form of a thin film, and can be attached to any part of the body, such as the skin or organs of the human body, to activate biological functions and prevent cell proliferation or differentiation. It means a patch that has biological, therapeutic, and medical functionality to make it possible. Essentially, the main component of the patch is in the form of cells being cultured and the patch material is biodegradable, so it is decomposed and destroyed in the human body.

In the present invention, "cell therapy agent" refers to cells and tissues manufactured through separation, culture, and special masturbation from humans, and is a drug (US FDA regulation) used for the purpose of treatment, diagnosis and prevention, restoring the function of cells or tissues. It refers to pharmaceuticals used for treatment, diagnosis and prevention purposes through a series of actions such as proliferating and selecting living autologous, allogeneic, or xenogeneic cells in vitro or changing the biological properties of cells in other ways. Cell therapy products are largely classified into somatic cell therapy products and stem cell therapy products according to the degree of cell differentiation, and the present invention particularly relates to stem cell therapy products.

The placenta-derived stem cells may be obtained by an isolation method comprising the following steps.

obtaining an equine amniotic membrane tissue from the placenta that is separated after the birth of a horse and animal mother;

crushing the amniotic tissue (chopping);

recovering the pellet by centrifugation;

isolating mononuclear cells by repeating washing and centrifugation; and

Culturing in a medium to which fetal bovine serum and antibiotics are added.

In the present invention, the term "horse animal" refers to a mammal belonging to the Equidae family (Genus Eauus ), and includes a horse, a donkey, a mule, a Grevy's zebra, a mountain zebra, a subgenus quaga, an Asian wild donkey, and an African wild donkey. , sek donkeys, tarpans, pshewalskimals, Syrian donkeys, or hybrids resulting from their crossbreeding.

In the present invention, "placenta" is made for the fetus during pregnancy, and one side of the placenta is in contact with the mother and the other side is in contact with the fetus, and the mother's blood is contained in the space between them, thereby supplying nutrients to the fetus. The placenta is composed of three layers: the amniotic membrane, the serous membrane, and the decidua.

In the present invention, "amniotic membrane" is one layer constituting the placenta in a triple-layered structure together with the chorion and decidua. It is a thin avascular membrane with a single layer of epithelial layer and a stromal membrane, and is a sac that binds to the fetus and constitutes the environment.

The placenta-derived stem cells of the present invention obtained by the above separation method exhibit positive immunological properties with respect to the mesenchymal stem cell markers CD44 , CD90 , and CD105 , and at the same time, the immune cell markers CD34, CD38, CD45, and immune-related markers. It shows negative immunological characteristics for MHC class II .

In addition, the placenta-derived stem cells of the present invention obtained by the above separation method are pluripotent genes ( Oct4 , c-Myc , and Klf4 ) and stem cells-specific genes ( PAX6 , ALCAM , Integrin-β1 , Endoglin , and HCAM ) both show positive genetic expression characteristics.

In addition, the placenta-derived stem cells of the present invention obtained by the above separation method exhibit morphological characteristics of a cubic shape (spindle-shape).

In addition, the placenta-derived stem cells of the present invention obtained by the above separation method have the ability to differentiate into ectoderm, mesoderm or endoderm-derived cells.

Furthermore, the placenta-derived stem cells of the present invention obtained by the above separation method have the self-proliferative ability to be cultured for more than 50 passages while maintaining the characteristics of the stem cells.

The ectoderm-derived cells may be skin cells, neurons, and/or astrocytes, the mesoderm-derived cells may be adipocytes, osteoblasts, chondrocytes, and/or myocytes, the endoderm-derived cells may be pancreatic cells, and/or lung cells. However, the present invention is not limited thereto.

According to another embodiment of the present invention, the present invention relates to a biopatch-type cell therapy agent in which placental-derived stem cells are cultured on the surface of a porous biodegradable polymer film.

In the present invention, "porous" means having a property of allowing air, moisture, or cells to permeate, and includes, for example, those having small through-holes formed in the shape of a sheet, film, thin film, or the like. In general, the form itself of a film, a thin film, etc. includes those having a porous form.

In one embodiment of the present invention, the porous biodegradable polymer film may be formed in which a plurality of circular or polygonal holes having a diameter of 1 to 10 μm are perforated. Here, the term 'many' means that the surface area of the total perforated holes occupies a range of 20 to 50% of the total film area.

In the present invention, "biodegradability" refers to a property of slowly decomposing without any effect on the human body through biological decomposition over time when applied to the human body.

The surface of the porous biodegradable polymer film may be treated with sonication and/or plasma. The surface of the porous biodegradable polymer film may be induced by ultrasonic and/or plasma treatment to induce cell adhesion suitable for culturing stem cells through surface hydrophilization.

The back surface of the porous biodegradable polymer film may have a release film attached thereto. Specifically, the release film may be included as an outermost layer on the back surface of the porous biodegradable polymer film. The release film used at this time may be a fluorine-coated polyethylene terephthalate (PET) film, but is not limited thereto.

The porous biodegradable polymer film is polylactic acid (Poly (lactic acid)), polyglycolic acid (Poly (glycolic acid)), polylactic glycol acid (Poly (latic-co-glycolic acid)), polydimethylsiloxane ((Poly) ) dimethylsiloxane), cellulose (Cellulose), polyhydroxybutyrate hydroxyvalerate (Poly (hydroxybutyrate hydroxyvalerate)), polyethylene glycol (Polyethylene glycol) and / or polycaprolactone (Poly-ε-caprolactone) film, However, the present invention is not limited thereto.

The polymer film is biodegradable because it has an amide bond, an ester bond, or a glycosidic bond in the polymer molecular structure, and has a nature-friendly advantage because it is decomposed in nature within a short period of several weeks to a long period of several months.

According to another embodiment of the present invention, the present invention relates to a biopatch-type cell therapy agent in which a biocompatible polymer support (hydrogel) is attached to the back of a porous biodegradable polymer film in which placental-derived stem cells are cultured.

The biocompatible polymer support may contain nutrients for cell culture. Specifically, the nutrient component for cell culture may include an extracellular matrix, but is not limited thereto.

The biocompatible polymer scaffold is attached to the back of the porous biodegradable polymer film in which the placenta-derived stem cells are cultured, and nutrients for cell culture (including stem cell culture solution) are supplied to the cells through the pores of the porous biodegradable polymer film. By supplying it, it can function to maintain cell activity and maximize the regenerative (therapeutic) effect of the affected area. In addition, it may serve as an incidental to contain the exudate from the affected area.

The biocompatible polymer support refers to a structure in the form of a thin film having a predetermined thickness made of a biocompatible polymer, and has the advantage that it can be cut into a desired shape.

The biocompatible polymer support may have a thickness of 0.05 to 10.0 mm, but is not limited thereto.

The biocompatible polymer support may be gelatin, hyaluronic acid, heparin, cellulose, dextran, alginate, chitosan, chitin, collagen, chondroitin sulfate and/or pectin support, but is not limited thereto.

According to a preferred embodiment of the present invention, the biopatch-type cell therapy agent of the present invention may have a form in which placental-derived stem cells are cultured and a biocompatible polymer support is laminated on a porous biodegradable polymer film.

14 shows a stacked structure of a biopatch-type cell therapy agent according to an embodiment of the present invention.

Referring to Figure 14, the biopatch-type cell therapy agent of the present invention is composed of a porous biodegradable film in which placental-derived stem cells are cultured and a biocompatible polymer support (hydrogel) containing nutrients for cell culture. can be

According to a preferred embodiment of the present invention, as an embodiment of using the biopatch type cell therapy product according to the present invention as described above, a skin regeneration method using the biopatch type cell therapy product of the present invention will be described as follows.

As shown in Figure 14, the biopatch in which the placenta-derived stem cells are cultured (A) and the biocompatible polymer support (hydrogel) (B) are laminated to an appropriate size or without cutting the application site paste it on Here, various application sites such as a treatment site for burn patients may be considered as the application site.

According to a preferred embodiment of the present invention, in the process of attaching to the application site, it can be applied in the form of attaching to the application site (skin) by additionally attaching an adhesive (C) to the biocompatible polymer support.

According to a preferred embodiment of the present invention, when the biopatch type cell therapy is applied in this way, the stem cells cultured on the surface of the porous biodegradable polymer film move down along the perforated hole, engraft and grow on the skin surface, and are very It can exhibit effective skin tissue regeneration activity. After a considerable period of time, the porous biodegradable polymer film decomposes and disappears, and the regenerative effect due to the activated cells is expressed.

The present invention relates to a biopatch-type cell therapy product for skin regeneration containing placental-derived stem cells, and since placental-derived stem cells in a biodegradable polymer film can be transplanted into the skin, etc., the complexity of contamination or manipulation There is an effect that it can be easily used as a bio-implantation material without this.

1 is a view showing the transfer of the horse's amnion tissue to a sterile culture medium.
Figure 2 shows the results of the initial culture of the amnion-derived cells of the present invention, according to an embodiment of the present invention.
3A and 3B show the self-replicating and proliferative ability of the amnion-derived stem cells of the present invention according to an embodiment of the present invention. 3b is a graph comparing the doubling time of amnion-derived stem cells and skin-derived fibroblasts.
4 is a result of comparing the colony-forming ability of amnion-derived stem cells and skin-derived fibroblasts.
5 is a result confirming the differentiation ability of the amnion-derived stem cells of the present invention into adipocytes according to an embodiment of the present invention. (A: before differentiation induction (X100), B: after 7 days of culture (X100), C: after 7 days of culture (X200))
6 is a result confirming the differentiation ability of the amnion-derived stem cells of the present invention into osteoblasts according to an embodiment of the present invention. (A: before differentiation induction (X100), B: after 7 days of culture (X100), C: after 7 days of culture (X200))
7 is a result confirming the differentiation ability of the amnion-derived stem cells of the present invention into chondrocytes according to an embodiment of the present invention. (A: before differentiation induction (X100), B: after 7 days of culture (X100), C: after 7 days of culture (X200))
8 is a result of confirming the pluripotency of the amnion-derived stem cells of the present invention using reverse transcription polymerase chain reaction (RT-PCR) according to an embodiment of the present invention. (control marker: beta-actin)
9 is a result of confirming the pluripotency of the amnion-derived stem cells of the present invention using real-time quantitative (qRT-PCR) according to an embodiment of the present invention.
10 is a result of confirming the pluripotency of the amnion-derived stem cells of the present invention using flow cytometry, according to an embodiment of the present invention. (red line: negative control, blue line: positive expression data)
11 shows the shape of a porous film cell culture surface prepared according to an embodiment of the present invention.
12A and 12B show cell engraftment rates of PLLA/SSA films according to plasma treatment conditions on a porous film cell culture surface prepared according to an embodiment of the present invention. adenocarcinoma cell line, sk-hep1 cells), FIG. 12b shows the results for human skin fibroblasts (CCD-986sk).
13 shows a schematic diagram of a silicone mold for producing a hydrogel according to an embodiment of the present invention. Hydrogels (C and F) fabricated through a mold contain gelatin and lyophilized mesenchymal stem cell culture solution.
14 shows a schematic diagram of a biopatch-type cell therapy product according to an embodiment of the present invention. It consists of a stem cell cultured film (A), a hydrogel (B), and an adhesive (Backing layer, C).
15 is a result of confirming the cell morphology according to the presence or absence of the biopatch-type cell therapy agent of the present invention, according to an embodiment of the present invention. (A: when there is no biopatch, B: when cells are cultured in the biopatch)
16 is a result of confirming the ability to proliferate stem cells according to the presence or absence of the biopatch-type cell therapy agent of the present invention, according to an embodiment of the present invention.
17 is a result of confirming cell activity and viability according to the presence or absence of the biopatch-type cell therapy agent of the present invention, according to an embodiment of the present invention.
18 is a diagram illustrating a biopatch-type stem cell therapeutic agent transplantation process in order to evaluate the skin treatment efficacy of the biopatch-type stem cell therapeutic agent of the present invention, according to an embodiment of the present invention.
Figures 19a and 19b confirm the change in the wound area over time for the skin damaged site implanted with the biopatch-type stem cell therapeutic agent of the present invention according to an embodiment of the present invention, and Figure 19a is a photograph of the wound area , Figure 19b is the result of deriving the wound area after the lapse of time compared to the wound area in %.
Figures 20a and 20b confirm the skin regeneration effect on the skin damaged site transplanted with the biopatch-type stem cell therapeutic agent of the present invention according to an embodiment of the present invention. As a result of the analysis, FIG. 20b is a result of quantifying the length from the normal skin tissue end (Skin margin) to the re-epithelialization portion in the tissue staining photograph.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1. Isolation and culture of placental-derived cells

At the time of delivery of a mare whose pregnancy was confirmed, the amniotic membrane tissue that was separated from the mother and wrapped around the pups was transferred to a sterile barrel using a sterile surgical tool, and then transferred to the laboratory within about 3 hours on average while maintaining about 4 °C. The transported amnion tissue was sterilized once by soaking it in 70% ethanol in a UV-sterilized sterile work bench, and then washed three or more times with PBS (phosphate buffered saline) containing 5% penicillin/streptomycin. After transferring the washed amniotic tissue to a sterile dish (see FIG. 1), finely minced using a sterile surgical scalpel, transferred to a sterile tube, and centrifuged at 2500 rpm for 7 minutes to recover a pellet. From the recovered pellet, the washing (PBS containing 5% penicillin/streptomycin) and centrifugation (2500 rpm, 7 minutes) were performed twice to separate mononuclear cells.

For the initial culture of the isolated amnion-derived mononuclear cells, DMEM (dulbecco Modified Eagle Medium) culture medium containing 15% fetal bovine serum (FBS), 1% Glutamax and 1% penicillin/streptomycin was used. At this time, in order to increase cell adhesion, the culture dish was coated with 0.1% gelatin and cultured, and incubated in an incubator of 5% CO ₂ environment at 38.5 ° C., the same as the body temperature of Equidae animals.

In order to remove dead tissue and cells, the culture medium was replaced within 48 h of the start of the initial culture, and the culture medium was replaced even when cells were observed to adhere to the bottom of the culture dish. or frozen and stored.

As a result, the amnion-derived cells could be observed in an attached form after an average of about 5 days, and as can be seen in FIG. 2, the shape of the cells was observed in a cubic (spindle) type similar to fibroblasts (FIG. 2A). , which is similar to that seen in other mesenchymal stem cells. Additionally, for detailed observation (X100) of cell morphology, it was confirmed by staining with Diff-quik (FIG. 2B).

Example 2. Confirmation of self-replication and proliferation ability of placental-derived stem cells (doubling time analysis)

After dispensing the amnion-derived stem cells stored in Example 1 at a density of 200,000 cells/well in a 6-well culture dish, in a method that does not add any new medium at all, put it in an incubator of 38.5 ° C, 5% CO ₂ and culture Incubation time and total number of active cells were observed. As a control, skin-derived fibroblasts were used.

Doubling time analysis is expressed as an index indicating the proliferation rate of cells through time analysis in which cells double from the initial number, and is expressed by the following calculation formula.

[formula]

TT ₀ : cell culture time (hr)

N ₀ : number of initially seeded cells, N: number of final cultured cells

Viable cells were counted using trypan blue staining. Specifically, the medium in the 6-well culture dish was removed, washed with PBS, and then cells were separated from the basal plane using 0.05% Typsin-EDTA. Thereafter, the action of Trypsin was stopped with a culture solution containing fresh 5% FBS, and the separated cells from the cell culture dish were counted.

As a result, as can be seen in FIGS. 3A and 3B , the doubling time of the amnion-derived stem cells (AM-MSC) of the present invention was lower than that of the skin-derived fibroblasts (Skin cells) having no therapeutic ability. This indicates that the time point at which the cultured cells divide and double the number of the first culture is faster, suggesting the excellent self-replication and proliferation ability of the amnion-derived stem cells of the present invention.

In addition, as can be seen in FIG. 4 , the number and size of colonies of the amnion-derived stem cells (Equine AM) of the present invention were superior to those of skin-derived fibroblasts having no therapeutic ability. This suggests the excellent self-renewal ability of the amnion-derived stem cells of the present invention.

Example 3. Confirmation of differentiation ability of placental-derived stem cells

To confirm the differentiation ability of amnion-derived mesenchymal stem cells, differentiation into adipocytes, chondrocytes, and osteocytes was induced in each lineage-appropriate medium using the StemPro Differentiation Kit (Gibco, USA).

1) Adipogenic differentiation

Using the StemPro Adipogenesis Differentiation Kit, the cells were aliquoted at a density of 200,000 cells/well in a 6-well culture dish, and incubated in an incubator of 38.5° C., 5% CO ₂ . The medium was changed once every 2 days. The differentiation was confirmed by staining with Oil Red O.

As a result, as can be seen in FIG. 5 , a negative staining reaction of the amnion stem cells was shown before differentiation induction (X100, FIG. 5A), but after about 7 days of culture, all of the amnion-derived mesenchymal stem cells were rounded in the form of fibroblasts. It could be seen that the shape of the cells was changed according to the shape, and staining due to the formation of lipid droplets was observed (X100, B of FIG. 5; X200, C of FIG. 5).

2) Osteogenic differentiation

Using the StemPro Osteogenesis Differentiation Kit, the cells were aliquoted at a density of 200,000 cells/well in a 6-well culture dish, and cultured at 38.5 ° C., 5% CO ₂ in an incubator. The medium was changed once every 2 days. The differentiation was confirmed by staining with alizarin red S.

As a result, as can be seen in FIG. 6 , a negative staining reaction of the amnion stem cells was shown before differentiation induction (X100, FIG. 6A), but after about 7 days of culture, all of the amnion-derived mesenchymal stem cells were fibroblast cells in cubic form. It was confirmed that the cell morphology was changed, and after about 21 days of culture, staining due to calcium precipitation in the extracellular matrix could be observed (X100, B of FIG. 6; X200, FIG. 6, C).

3) Chondrogenic differentiation

Using the StemPro Chondrogenesis Differentiation Kit, hanging drop at a concentration of 1,000 cells/μL, and incubated in an incubator of 38.5 ℃, 5% CO ₂ so that the cells grow in a spherical shape. Medium was added or changed once every 3 days. The differentiation was confirmed by staining with alcian blue.

As a result, as can be seen in FIG. 7 , a negative staining reaction of the amnion stem cells was observed before differentiation induction (X100, FIG. 7A), but after about 14 days of culture, staining due to chondrocyte differentiation was observed ( X100, Fig. 7B; X200, Fig. 7C).

Example 4. Confirmation of pluripotency of placental-derived stem cells

CD44 , CD90 , CD105 showing positive expression in mesenchymal stem cells of Equidae animals presented by the International Society for Cell Therapy (ISCT), CD34 showing negative expression, CD38 , CD45 and immune-related Analysis was performed for the marker MHC class II . In addition, we analyzed the expression patterns at the mRNA level for the embryonic stem cell-related genes Oct4 , c-Myc , Klf4 , and the mesenchymal stem cell-related genes PAX6 , ALCAM , Integrin-β1 , Endoglin , HCAM known to be characteristic of amnion-derived stem cells. did.

1) Reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was prepared using an RNA extraction kit according to the manufacturer's instructions (Qiagen, Cat. No. 74104). For RNA samples (total RNA 1 μl), cDNA was synthesized with oligo dT primers and random primers using iScript reverse transcriptase (BIO-RAD). Specific primer sequences are shown in Table 1 below.

Primers used in PCR gene name primer sequence size Accession No. beta-actin F GGATGCAGAAGGAGATCACAG (SEQ ID NO: 1) 125 NM_001081838.1 R CTGGAAGGTGGACAATGAGG (SEQ ID NO: 2) OCT4 F TCTCCCATGCACTCAAACTG (SEQ ID NO: 3) 197 XM_001490108 R AACTTCACCTTCCCTCCAAC (SEQ ID NO: 4) c-Myc F GCCCATAAAATTGCCAAGAGG (SEQ ID NO: 5) 132 XM_023655154 R AGCCCTGACCTTTGAATGAC (SEQ ID NO: 6) Klf4 F ACCTCGCCTTACACATGAAG (SEQ ID NO: 7) 218 XM_023629843.1 R TGGTTTCCTCATTGTCTCCTG (SEQ ID NO: 8) PAX6 F TGTTTGCCCGAGAAAGACTAG (SEQ ID NO: 9) 224 XM_023646553.1 R AGAGGTGAAGGATGAAACAGG (SEQ ID NO: 10) ALCAM F AGAAGGCAGGAAGTTTGTCG (SEQ ID NO: 11) 147 XM_001503380.6 R GGAAAGTTGAGGATTGTGCG (SEQ ID NO: 12) Integrin-β1 F CTTATTGGCCTTGCATTGCT (SEQ ID NO: 13) 169 XM_005606848.3 R TTCCCTCGTACTTCGGATTG (SEQ ID NO: 14) HCAM F ATCCTCCACGTCCAACACCTC (SEQ ID NO: 15) 165 XM_005598012 R CTCGCCTTTCTTGGTGTAGC (SEQ ID NO: 16) Endoglin F AAGAGCTCATCTCGAGTCTG (SEQ ID NO: 17) 162 XM_003364144 R TGACGACCACCTCATTACTG (SEQ ID NO: 18)

RT-PCR was denatured at 95 °C for 4 minutes, followed by 34 reactions at 95 °C for 30 seconds, 56 °C for 30 seconds, and 72 °C for 30 seconds. A final extension was carried out at 73° C. for 5 minutes. Beta actin (β-Actin) RT-PCR reaction was carried out by modifying the primer annealing (annealing) at 34 times and 60 ℃. RT-PCR specific amplification of the target gene was confirmed by DNA sequencing.

1, Endoglin, 및 HCAM) 모두 발현되는 것을 알 수 있었다.As a result, as can be seen in FIG. 8 , embryonic stem cell-related genes ( Oct4 , c-Myc , and Klf4 ) and mesenchymal stem cell-related genes ( PAX6 , ALCAM , Integrin-

1 , Endoglin , and HCAM ) were found to be all expressed.

2) quantitative real time PCR (qRT-PCR)

cDNA was synthesized in the same manner as the cDNA synthesis method used for the RT-PCR. qRT-PCR was denatured at 95 °C for 10 minutes, followed by 39 reactions at 94 °C for 15 seconds, 58 °C for 30 seconds, and 72 °C for 30 seconds. After reacting at 95° C. for 10 seconds and at 65° C. for 5 seconds, the expression levels of markers were compared with those of the control horse skin-derived fibroblasts.

As a result, as can be seen in FIG. 9 , genes ( Oct4 , c-Myc , and Klf4 showing pluripotency in the amnion-derived stem cells (AM-MSC) of the present invention compared to skin-derived fibroblasts (Skin) having no therapeutic ability. ) and stem cells-specific genes ( PAX6 , ALCAM , Integrin-β1 , Endoglin , and HCAM ) were found to be significantly highly expressed.

3) Flow cytometry analysis

Cell markers are analyzed by flow cytometry using various combinations of antibodies or pure primary antibodies conjugated with FITC (fluorescein isothiocyanate) or PE (phycoerythrin) to amnion-derived stem cells, and then using a fluorescent secondary IgG antibody. did. Antibodies used for comparison of expression patterns relative to the secondary IgG antibody were as follows: CD29-PE, CD34-FITC, CD38-FITC, CD44-FITC, CD45, CD90-PE, CD105-FITC, MHC class II -FITC and IgG-FITC. Approximately 5-8x10 ⁵ cells per sample were used to analyze one antibody, and flow cytometry (FACScan, BD Biosciences, USA) was performed using Cellquest software.

As a result, as can be seen in FIG. 10 , a positive immunological phenotype was shown for CD29 , CD44 , CD90 , CD105 which are positive expression markers of mesenchymal stem cells, and CD34 , CD38 , CD45 which are immune cell-specific markers, immune-related. The marker MHC class II showed a negative immunological phenotype. This suggests that the amnion-derived stem cells of the present invention have the characteristics of mesenchymal stem cells.

Example 5. Preparation of biopatch

1) Primer treatment

A biodegradable PLLA (poly(L-lactic acid)) film was prepared in 15 x 15 (cm). First, one side was sealed using clean paper in order to protect the cell culture surface in the pressure-sensitive adhesive coating process to be described later. Then, for affinity between the adhesive and the PLLA film, a primer was treated on the opposite side of the cell culture surface of the PLLA film. Specifically, DY 39-067 Rubber Additive (SILASTIC??) was wetted with cotton and treated evenly on the PLLA film once, and then placed in an oven at 40 ° C. and dried for 5 minutes to sufficiently blow off the solvent.

2) Adhesive coating

A two-component silicone adhesive, 7-9700 Soft Skin Adhesive (DOW CORNING ^® ) A and B were mixed in a 45:55 ratio, and stirred at 1000 rpm for 2 minutes using an overhead stirrer. Then, after confirming that the bubbles are sufficiently subsided, it was coated using an automatic applicator (Ocean science) and a baker applicator. Coating was performed at a speed of 50 mm/sec with a baker applicator set to 50 μm after placing 3 g of a 15 x 15 (cm) film-based adhesive on the film. The adhesive-coated film was placed in an oven at 40° C. and cured for 6 hours.

3) Attach the release film

A fluorine-treated PET (polyethylene terephthalate) release film (FL-25BMM, Ki-Seung Industries) was attached using a semi-automatic mangle (Ocean science). In addition, in order to prevent air bubbles from being generated, an adhesive-coated PLLA film and a fluorine-treated PET release film were placed between the rolls of the fader mangle, and then the handle was adjusted to adjust the height. The roll speed was performed at 10 rpm.

4) Production of porous film

A porous film was manufactured in a way that minimizes the warpage of the PLLA film to which the PET release film is attached by self-manufacturing a precision perforator. The diameter of one hole in the porous film was about 1.5 microns, and the total area of the hole in the porous film occupied 20-50% of the total area of the film (see FIG. 11 ). It was designed to enable cell culture on a transparent polymer biodegradable film through a cell culture surface design that is advantageous even for post-processing (meaning the post-perforation process).

5) Cell culture surface treatment

Sonication and plasma treatment were performed to induce cell adhesion suitable for stem cell culture. After washing the porous film with an ultrasonic cleaner and drying it at room temperature, atmospheric pressure plasma treatment was performed to prepare a porous film for stem cell culture.

Specifically, a cell engraftment rate test of the PLLA/SSA (Soft skin adhesive) film was performed for each plasma treatment condition. Confirmation of cell engraftment and viability according to various plasma conditions of human hepatic adenocarcinoma cell line (sk-hep1 cells) (ATCC) and human skin fibroblast (CCD-986sk) (ATCC) did.

At this time, Plate A was used as negative and positive controls, respectively, by putting cells (-) or cells (+) in a normal cell culture plate without a film. In addition, Plate B was used as another control with a polystyrene film the same as the material of Plate A. Plate C-F is a cell culture complex (PLLA/SSA) treated with plasma in different ways. Specific argon (lpm) / oxygen (sccm) gas conditions are shown in Table 2 below.

PLLA/SSA plasma treatment conditions plate Argon (lpm)/oxygen (sccm) Plate C 10/11 Plate D 10/8 Plate E 11/8 Plate F 12/11

As can be seen in FIGS. 12A and 12B , all experimental groups showed an engraftment rate of 80% or more compared to the control group (+). In particular, by confirming that the cell engraftment rate was the best in Plate D, a porous film for final stem cell culture was prepared under the plasma treatment conditions of Plate D.

6) Hydrogel production

After dissolving gelatin in tertiary distilled water, EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide)/NHS (N-hydroxysucciide) crosslinking agent and tyramine hydrochloride were added at room temperature, and the gelatin was modified by stirring for 12 hours. . To remove impurities and unreacted substances in the solution, dialysis was performed using 0.1 M NaCl solution, 25% ethanol, and tertiary distilled water, and the dialysis solution was freeze-dried to prepare a tyramine-modified gelatin sponge. The tyramine-modified gelatin was dissolved in tertiary distilled water at 6 wt%, 35 °C. Separately, the lyophilized powder of 10 ml of cell culture solution was dissolved in 1 ml of tertiary distilled water at 4°C. After mixing each solution 1:1 at room temperature, add HRP (horseradish peroxidase) and hydrogen peroxide (H ₂ O ₂ ) so that the final concentrations are 0.55 units/ml and 0.025 ul/ml, respectively, mix, and pour into a silicone mold cured (see FIG. 13).

7) Biopatch production

A biopatch was prepared by disposing the porous film for stem cell culture (FIG. 14A), the hydrogel containing the cell culture solution (FIG. 14B), and an adhesive for skin adhesion (FIG. 14C), prepared above in order. .

Example 6. Application of placental-derived stem cells to biopatch

1) Cell Preparation

Amnion-derived cells between passages 3-5 were cultured using DMEM culture medium containing 15% FBS, 1% Glutamax and 1% penicillin/streptomycin. After removing the medium in the culture dish and washing with PBS, cells were separated from the basal surface using 0.05% Typsin-EDTA. The isolated cells were cultured at a number of 1x10 ⁴ cells/cm ² .

2) cell morphology

Cells cultured for 2 days in each of the culture dish without biopatch and the culture dish with the biopatch prepared in Example 5 were washed with PBS and then fixed with methanol. After the fixed cells were stained with cytoplasm and cell nucleus using Xanten and methylene blue, respectively, the shape was observed using an optical microscope.

As a result, as can be seen in FIG. 15 , there was no difference in the morphology of cells according to the presence or absence of the biopatch. This suggests that culturing is possible without change in cell morphology even in a biopatch environment.

3) Cell number and cell viability

Stem cells cultured for 48 hours in each of the culture dish without biopatch and the culture dish with the biopatch prepared in Example 5 were washed with PBS and then separated from the basal surface using 0.05% Typsin-EDTA and centrifuged. Cells were collected using a separator. After the collected cells were stained with trypan blue, the stained cells were coated on a hemocytometer and observed with an optical microscope. The number of unstained cells and stained cells was measured, and the number and viability were measured.

As a result, as can be seen in FIG. 16 , there was no difference in the proliferative ability of cells according to the presence or absence of the biopatch. This suggests that culture is possible without a difference in cell proliferation ability even in a biopatch environment.

4) Cytotoxicity and cell death (MTT assay, Annexin V staining)

MTT assay

The culture dish without biopatch and the culture dish with the biopatch prepared in Example 5 were cultured for 2 days, and the amount of dead cells was compared using the Vybrant MTT Cell Proliferation Assay Kit (Thermo Fisher Scientific).

Annexin V staining

Cells cultured for 2 days in each of the culture dish without biopatch and the culture dish with the biopatch prepared in Example 5 were washed with PBS and then separated from the basal surface using 0.05% Trpsin-EDTA and centrifuged was used to collect cells. Stained using a kit (No. V13241, Invitrogen) and analyzed for living cells, apoptosis and necrosis using a flow cytometer.

As a result, as can be seen in FIG. 17 , there was no difference in cell activity according to the presence or absence of the biopatch. This suggests that culture is possible without differences in cell proliferation and survival even in a biopatch environment.

Example 7. Efficacy evaluation of skin treatment efficacy of biopatch-type stem cell therapeutics

1) Skin damage animal model

For 6-week-old male ICR mice (Dooyeol Biotech, KOREA), efficacy evaluation was conducted in accordance with the establishment and operation regulations of the Animal Experimental Ethics Committee of Chungnam National University (approval number, 202103A-CNU-072). Mice were brought in at 5 weeks of age and stabilized for one week, then anesthesia (80 mg/kg ketamine + 12 mg/kg xylazine) was administered intraperitoneally to anesthetize and induce wounds through a Biopsy punch.

2) Transplantation of biopatch-type stem cell therapy

After attaching the biopatch-type stem cell therapeutic agent culturing the amniotic membrane-derived stem cells of Example 6-1) to the skin damage (wound) site on the biopatch prepared in Example 5, covered with a sterile waterproof film (Tegaderm ^TM ) , a round-shaped silicone with a hole of 6 mm in diameter was attached to the skin to prevent skin contraction, and then sewn with a suture to fix the effect (see FIG. 18 ). A biopatch in which stem cells were not cultured was set as a control.

3) Results

Check the skin damage area change

The wound area was measured at 0, 3, 7, 10, or 14 days after implantation of the biopatch-type stem cell treatment for the skin damaged site implanted with the biopatch-type stem cell treatment (FIG. 19a), and the change in the area of the wound was confirmed using the Image J program. (Fig. 19b).

As a result, as can be seen in FIGS. 19A and 19B , it was found that the area of the skin damaged area was statistically significantly reduced 7, 10, and 14 days after surgery in the biopatch-type stem cell treatment group.

Check skin regeneration effect

For the damaged skin site where the biopatch-type stem cell treatment was transplanted, the skin tissue of the wounded area was collected 3 or 7 days after implantation of the treatment. After fixing the collected tissue with a 10% formalin solution, a paraffin block was prepared. Hematoxylin and eosin (H&E) staining of slides cut to a thickness of 4 μm from the prepared paraffin block was performed to evaluate granulation tissue formation (FIG. 20a) and re-epithelialization (FIG. 20b) of the skin. For skin re-epithelialization, the length from the end of normal skin tissue (Skin margin) to the re-epithelialized portion was quantified using the Image J program.

As a result, as can be seen in FIGS. 20A and 20B , re-epithelialization of 0.27±0.05 mm in the control group and 0.51±0.04 mm in the treatment transplantation group occurred 3 days after skin damage, and 0.55±0.05 in the control group 7 days after skin damage. mm, 1.07±0.12 mm of re-epithelialization occurred in the treatment group. As a result, it was found that the re-epithelialization of the wound tissue was statistically significantly promoted in the biopatch-type stem cell treatment group of the present invention.

[Sequence List]

<110> mkbiotech.co.ltd

The Industry & Academic Cooperation in Chungnam National University (IAC)

<120> Bio-patch type cell therapy product for Regenerating skin comprising Placenta-derived stem cells

<130> WP213199

<160> 18

<170> KoPatentIn 3.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> beta-Actin primer-F

<400> 1

ggatgcagaa ggagatcaca g 21

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> beta-Actin primer-R

<400> 2

ctggaaggtg gacaatgagg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> OCT4 primer-F

<400> 3

tctcccatgc actcaaactg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> OCT4 primer-R

<400> 4

aacttcacct tccctccaac 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> c-Myc primer-F

<400> 5

gcccataaaa ttgccaagag g 21

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> c-Myc primer-R

<400> 6

agccctgacc tttgaatgac 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Klf4 primer-F

<400> 7

acctcgcctt acacatgaag 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Klf4 primer-R

<400> 8

tggtttcctc attgtctcct g 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> PAX6 primer-F

<400> 9

tgtttgcccg agaaagacta g 21

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> PAX6 primer-R

<400> 10

agaggtgaag gatgaaacag g 21

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ALCAM primer-F

<400> 11

agaaggcagg aagtttgtcg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ALCAM primer-R

<400> 12

ggaaagttga ggattgtgcg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Integrin-b1 primer-F

<400> 13

cttattggcc ttgcattgct 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Integrin-b1 primer-R

<400> 14

ttccctcgta cttcggattg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HCAM primer-F

<400> 15

atcctcacgt ccaacacctc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HCAM primer-R

<400> 16

ctcgcctttc ttggtgtagc 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Endoglin primer-F

<400> 17

aagagctcat ctcgagtctg 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Endoglin primer-R

<400> 18

tgacgaccac ctcattactg 20

<110> mkbiotech.co.ltd The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Bio-patch type cell therapy product for Regenerating skin comprising Placenta-derived stem cells <130> WP213199 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> beta-Actin primer-F <400> 1 ggatgcagaa ggagatcaca g 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> beta-Actin primer-R <400> 2 ctggaaggtg gacaatgagg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OCT4 primer-F <400> 3 tctcccatgc actcaaactg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OCT4 primer-R <400> 4 aacttcacct tccctccaac 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> c-Myc primer-F <400> 5 gcccataaaa ttgccaagag g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> c-Myc primer-R <400> 6 agccctgacc tttgaatgac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Klf4 primer-F <400> 7 acctcgcctt acacatgaag 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Klf4 primer-R <400> 8 tggtttcctc attgtctcct g 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PAX6 primer-F <400> 9 tgtttgcccg agaaagacta g 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PAX6 primer-R <400> 10 agaggtgaag gatgaaacag g 21 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ALCAM primer-F <400> 11 agaaggcagg aagtttgtcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ALCAM primer-R <400> 12 ggaaagttga ggattgtgcg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Integrin-b1 primer-F <400> 13 cttattggcc ttgcattgct 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Integrin-b1 primer-R <400> 14 ttccctcgta cttcggattg 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HCAM primer-F <400> 15 atcctcacgt ccaacacctc 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HCAM primer-R <400> 16 ctcgcctttc ttggtgtagc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Endoglin primer-F <400> 17 aagagctcat ctcgagtctg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Endoglin primer-R <400> 18 tgacgaccac ctcattactg 20

Claims (14)

placenta-derived stem cells; Including a porous biodegradable polymer film and a biocompatible polymer support,
Wherein the placenta-derived stem cells will have the following characteristics, biopatch-type cell therapy agent:
a) exhibiting positive immunological characteristics for CD44, CD90, CD105, and negative immunological characteristics for CD34, CD38, CD45, MHC class II;
b) exhibit the morphological characteristics of the cubic shape (spindle-shape);
c) having the ability to differentiate into cells derived from ectoderm, mesoderm or endoderm; and
d) It has the ability to self-proliferate for more than 50 passages while maintaining the characteristics of stem cells. According to claim 1, wherein the placenta-derived stem cells will be obtained by a separation method comprising the following steps, biopatch-type cell therapy agent:
obtaining an equine amniotic membrane tissue from the placenta that is separated after the birth of a horse and animal mother;
crushing the amniotic tissue (chopping);
recovering the pellet by centrifugation;
isolating mononuclear cells by repeating washing and centrifugation; and
Culturing in a medium to which fetal bovine serum and antibiotics are added. According to claim 2, wherein the equine animal is selected from the group consisting of horses, donkeys, mules, zebras, or hybrids born from hybrids thereof. delete According to claim 1, wherein the mesoderm-derived cells are adipocytes, osteoblasts, chondrocytes, or myocytes. According to claim 1, wherein the placenta-derived stem cells will be cultured on the surface of the porous biodegradable polymer film, biopatch-type cell therapy. According to claim 6, wherein the surface of the porous biodegradable polymer film is ultrasonic treatment (sonication) and / or plasma treatment, the biopatch-type cell therapy agent. According to claim 6, wherein the porous biodegradable polymer film is a release film is attached to the back surface, biopatch-type cell therapy agent. According to claim 1, wherein the porous biodegradable polymer film is polylactic acid (Poly (lactic acid)), polyglycolic acid (Poly (glycolic acid)), polylactic glycol acid (Poly (latic-co-glycolic acid)), Polydimethylsiloxane ((Poly)dimethylsiloxane), cellulose (Cellulose), poly(hydroxybutyrate hydroxyvalerate), polyethylene glycol and polycaprolactone (Poly-ε-caprolactone) A film selected from the group consisting of, a biopatch-type cell therapy agent. According to claim 1, wherein the biocompatible polymer scaffold is attached to the back of the porous biodegradable polymer film in which the placenta-derived stem cells are cultured, biopatch-type cell therapy agent. According to claim 1, wherein the biocompatible polymer scaffold contains a nutrient for cell culture, biopatch-type cell therapy agent. [Claim 12] The biopatch type cell therapy product according to claim 11, wherein the nutrient component for cell culture comprises an extracellular matrix. According to claim 1, wherein the biocompatible polymer scaffold is a support selected from the group consisting of gelatin, hyaluronic acid, heparin, cellulose, dextran, alginate, chitosan, chitin, collagen, chondroitin sulfate and pectin, biopatch-type cell remedy. According to claim 1, wherein the biocompatible polymer scaffold has a thickness of 0.05 to 10.0 mm, biopatch-type cell therapy agent.

Images